alienTrimmerPF8contaminants.fasta 51 KB
Newer Older
Amine  GHOZLANE's avatar
Amine GHOZLANE committed
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
279
280
281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
318
319
320
321
322
323
324
325
326
327
328
329
330
331
332
333
334
335
336
337
338
339
340
341
342
343
344
345
346
347
348
349
350
351
352
353
354
355
356
357
358
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
378
379
380
381
382
383
384
385
386
387
388
389
390
391
392
393
394
395
396
397
398
399
400
401
402
403
404
405
406
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
425
426
427
428
429
430
431
432
433
434
435
436
437
438
439
440
441
442
443
444
445
446
447
448
449
450
451
452
453
454
455
456
457
458
459
460
461
462
463
464
465
466
467
468
469
470
471
472
473
474
475
476
477
478
479
480
481
482
483
484
485
486
487
488
489
490
491
492
493
494
495
496
497
498
499
500
501
502
503
504
505
506
507
508
509
510
511
512
513
514
515
516
517
518
519
520
521
522
523
524
525
526
527
528
529
530
531
532
533
534
535
536
537
538
539
540
541
542
543
544
545
546
547
548
549
550
551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
589
590
591
592
593
594
595
596
597
598
599
600
601
602
603
604
605
606
607
608
609
610
611
612
613
614
615
616
617
618
619
620
621
622
623
624
625
626
627
628
629
630
631
632
633
634
635
636
637
638
639
640
641
642
643
644
645
646
647
648
649
650
651
652
653
654
655
656
657
658
659
660
661
662
663
664
665
666
667
668
669
670
671
672
673
674
675
676
677
678
679
680
681
682
683
684
685
686
687
688
689
690
691
692
693
694
695
696
697
698
699
700
701
702
703
704
705
706
707
708
709
710
711
712
713
714
715
716
717
718
719
720
721
722
723
724
725
726
727
728
729
730
731
732
733
734
735
736
737
738
739
740
741
742
743
744
745
746
747
748
749
750
751
752
753
754
755
756
757
758
759
760
761
762
763
764
765
766
767
768
769
770
771
772
773
774
775
776
777
778
779
780
781
782
783
784
785
786
787
788
789
790
791
792
793
794
795
796
797
798
799
800
801
802
803
804
805
806
807
808
809
810
811
812
813
814
815
816
817
818
819
820
821
822
823
824
825
826
827
828
829
830
831
832
833
834
835
836
837
838
839
840
841
842
843
844
845
846
847
848
849
850
851
852
853
854
855
856
857
858
859
860
861
862
863
864
865
866
867
868
869
870
871
872
873
874
875
876
877
878
879
880
881
882
883
884
885
886
887
888
889
890
891
892
893
894
895
896
897
898
899
900
901
902
903
904
905
906
907
908
909
910
911
912
913
914
915
916
917
918
919
920
921
922
923
924
925
926
927
928
929
930
931
932
933
934
935
936
937
938
939
940
941
942
943
944
945
946
947
948
949
950
951
952
953
954
955
956
957
958
959
960
961
962
963
964
965
####################################################################################################
#                                                                                                  #
# LAST UPDATE: 07 June 2013                                                                        #
#                                                                                                  #
# This file contains a list a putative contaminant oligonucleotides that could occur in both ends  #
# of NGS reads.  This file is  formatted to be  used by  AlienTrimmer  in order to  trim off such  #
# contaminant oligonucleotides from FASTQ formatted read files.                                    #
# If you wish to add new contaminant sequences, use the FASTA format to name them, and be careful  #
# to always write one sequence per line (lower and/or uppercase characters).  Comment lines could  #
# be written by  using '#' as  the first character.  If you wish  to not trim  off some of  these  #
# sequences when using AlienTrimmer, comment these lines with '#'.                                 #
#                                                                                                  #
# CONTENTS:                                                                                        #
# 1.  Homopolymers                                                                                 #
# 2.  Nextera DNA Sample Preparation Kit (Illumina)                                                #
# 3.  Nextera Index Kit- PCR Primers                                                               #
# 4.  Nextera DNA Sample Prep Kit (Epicentre Biotechnologies)                                      #
# 5.  TruSeq RNA and DNA Sample Prep Kits (v1 and v2)                                              #
# 6.  Oligonucleotide sequences for TruSeq Small RNA Sample Prep Kit                               #
# 7.  Illumina oligonucleotide sequences for Genomic DNA                                           #
# 8.  Illumina Paired End DNA oligonucleotide sequences                                            #
# 9.  Illumina Oligonucleotide sequences for the Multiplexing Sample Prep Oligo Only Kit           #
# 10. Illumina DpnII expression                                                                    #
# 11. Illumina DpnII Gex                                                                           #
# 12. Illumina NlaIII expression                                                                   #
# 13. Illumina Small RNA Kits v1 and v1.5                                                          #
# 14. SOLID 3 System Oligo                                                                         #
# 15. Roche 454 Adaptors, Linkiers and Adapters                                                    #
# 16. Ion Torrent adapter sequences                                                                #
#                                                                                                  #
####################################################################################################



###################################################################################################
### 1. Homopolymers ###############################################################################
###################################################################################################

>poly-A
AAAAAAAAAAAAAAAAAAAA
>poly-C
CCCCCCCCCCCCCCCCCCCC
>poly-G
GGGGGGGGGGGGGGGGGGGG
>poly-T
TTTTTTTTTTTTTTTTTTTT 


###################################################################################################
### 2. Nextera(R) DNA Sample Preparation Kit (Illumina) ###########################################
###################################################################################################

>Nextera Transposase Sequence (FC-121-1031)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
>Nextera Transposase Sequence (FC-121-1030)
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG


###################################################################################################
### 3. Nextera Index Kit- PCR Primers #############################################################
###################################################################################################

>Nextera Index Kit- PCR primer (FC-121-1012, Index N501)
AATGATACGGCGACCACCGAGATCTACACtagatcgcTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N502)
AATGATACGGCGACCACCGAGATCTACACctctctatTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N503)
AATGATACGGCGACCACCGAGATCTACACtatcctctTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N504)
AATGATACGGCGACCACCGAGATCTACACagagtagaTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N505)
AATGATACGGCGACCACCGAGATCTACACgtaaggagTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N506)
AATGATACGGCGACCACCGAGATCTACACgctgcataTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N507)
AATGATACGGCGACCACCGAGATCTACACaaggagtaTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N508)
AATGATACGGCGACCACCGAGATCTACACctaagcctTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1011, Index N701)
CAAGCAGAAGACGGCATACGAGATtaaggcgaGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N702)
CAAGCAGAAGACGGCATACGAGATcgtactagGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N703)
CAAGCAGAAGACGGCATACGAGATaggcagaaGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N704)
CAAGCAGAAGACGGCATACGAGATtcctgagcGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N705)
CAAGCAGAAGACGGCATACGAGATggactcctGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N706)
CAAGCAGAAGACGGCATACGAGATtaggcatgGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N707)
CAAGCAGAAGACGGCATACGAGATctctctacGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N708)
CAAGCAGAAGACGGCATACGAGATcagagaggGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N709)
CAAGCAGAAGACGGCATACGAGATgctacgctGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N710)
CAAGCAGAAGACGGCATACGAGATcgaggctgGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N711)
CAAGCAGAAGACGGCATACGAGATaagaggcaGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N712)
CAAGCAGAAGACGGCATACGAGATgtagaggaGTCTCGTGGGCTCGG


#########################################################################################################
### 4. Nextera DNA Sample Prep Kit (Epicentre Biotechnologies) ##########################################
#########################################################################################################

>Transposon Sequence 1
GCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG
>Transposon Sequence 2
GCCTTGCCAGCCCGCTCAGAGATGTGTATAAGAGACAG
>Adapter 1
AATGATACGGCGACCACCGAGATCTACACGCCTCCCTCGCGCCATCAG
>Adapter 2, Bar Code IDX1
CAAGCAGAAGACGGCATACGAGATcgtgatCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX2
CAAGCAGAAGACGGCATACGAGATacatcgCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX3
CAAGCAGAAGACGGCATACGAGATgcctaaCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX4
CAAGCAGAAGACGGCATACGAGATtggtcaCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX5
CAAGCAGAAGACGGCATACGAGATcactgtCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX6
CAAGCAGAAGACGGCATACGAGATattggcCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX7
CAAGCAGAAGACGGCATACGAGATgatctgCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX8
CAAGCAGAAGACGGCATACGAGATtcaagtCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX9
CAAGCAGAAGACGGCATACGAGATctgatcCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX10
CAAGCAGAAGACGGCATACGAGATaagctaCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX11
CAAGCAGAAGACGGCATACGAGATgtagccCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX12
CAAGCAGAAGACGGCATACGAGATtacaagCGGTCTGCCTTGCCAGCCCGCTCAG
>PCR Primer 1
AATGATACGGCGACCACCGA
>PCR Primer 2
CAAGCAGAAGACGGCATACGA


#########################################################################################################
### 5. TruSeq RNA and DNA Sample Prep Kits (v1 and v2) ##################################################
#########################################################################################################

>TruSeq Universal Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>TruSeq Adapter, Index 1
GATCGGAAGAGCACACGTCTGAACTCCAGTCACatcacgATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 2
GATCGGAAGAGCACACGTCTGAACTCCAGTCACcgatgtATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 3
GATCGGAAGAGCACACGTCTGAACTCCAGTCACttaggcATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 4
GATCGGAAGAGCACACGTCTGAACTCCAGTCACtgaccaATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 5
GATCGGAAGAGCACACGTCTGAACTCCAGTCACacagtgATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 6
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgccaatATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 7
GATCGGAAGAGCACACGTCTGAACTCCAGTCACcagatcATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 8
GATCGGAAGAGCACACGTCTGAACTCCAGTCACacttgaATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 9
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgatcagATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 10
GATCGGAAGAGCACACGTCTGAACTCCAGTCACtagcttATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 11
GATCGGAAGAGCACACGTCTGAACTCCAGTCACggctacATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 12
GATCGGAAGAGCACACGTCTGAACTCCAGTCACcttgtaATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 13
GATCGGAAGAGCACACGTCTGAACTCCAGTCACagtcaaCAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 14
GATCGGAAGAGCACACGTCTGAACTCCAGTCACagttccGTATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 15
GATCGGAAGAGCACACGTCTGAACTCCAGTCACatgtcaGAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 16
GATCGGAAGAGCACACGTCTGAACTCCAGTCACccgtccCGATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 18
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgtccgcACATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 19
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgtgaaaCGATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 20
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgtggccTTATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 21
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgtttcgGAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 22
GATCGGAAGAGCACACGTCTGAACTCCAGTCACcgtacgTAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 23
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgagtggATATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 25
GATCGGAAGAGCACACGTCTGAACTCCAGTCACactgatATATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 27
GATCGGAAGAGCACACGTCTGAACTCCAGTCACattcctTTATCTCGTATGCCGTCTTCTGCTTG


#########################################################################################################
### 6. Oligonucleotide sequences for TruSeq Small RNA Sample Prep Kit ###################################
#########################################################################################################

>RNA 3’ Adapter (RA3), part # 15013207
TGGAATTCTCGGGTGCCAAGG
>RNA RT Primer (RTP), part # 15013981
GCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer,  (RP1), part # 15005505
AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA
>RNA PCR Primer, Index 1  (RPI1)
CAAGCAGAAGACGGCATACGAGATcgtgatGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 2  (RPI2)
CAAGCAGAAGACGGCATACGAGATacatcgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 3  (RPI3)
CAAGCAGAAGACGGCATACGAGATgcctaaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 4  (RPI4)
CAAGCAGAAGACGGCATACGAGATtggtcaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 5  (RPI5)
CAAGCAGAAGACGGCATACGAGATcactgtGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 6  (RPI6)
CAAGCAGAAGACGGCATACGAGATattggcGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 7  (RPI7)
CAAGCAGAAGACGGCATACGAGATgatctgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 8  (RPI8)
CAAGCAGAAGACGGCATACGAGATtcaagtGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 9  (RPI9)
CAAGCAGAAGACGGCATACGAGATctgatcGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 10 (RPI10)
CAAGCAGAAGACGGCATACGAGATaagctaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 11 (RPI11)
CAAGCAGAAGACGGCATACGAGATgtagccGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 12 (RPI12)
CAAGCAGAAGACGGCATACGAGATtacaagGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 13 (RPI13)
CAAGCAGAAGACGGCATACGAGATttgactGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 14 (RPI14)
CAAGCAGAAGACGGCATACGAGATggaactGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 15 (RPI15)
CAAGCAGAAGACGGCATACGAGATtgacatGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 16 (RPI16)
CAAGCAGAAGACGGCATACGAGATggacggGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 17 (RPI17)
CAAGCAGAAGACGGCATACGAGATctctacGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 18 (RPI18)
CAAGCAGAAGACGGCATACGAGATgcggacGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 19 (RPI19)
CAAGCAGAAGACGGCATACGAGATtttcacGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 20 (RPI20)
CAAGCAGAAGACGGCATACGAGATggccacGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 21 (RPI21)
CAAGCAGAAGACGGCATACGAGATcgaaacGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 22 (RPI22)
CAAGCAGAAGACGGCATACGAGATcgtacgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 23 (RPI23)
CAAGCAGAAGACGGCATACGAGATccactcGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 24 (RPI24)
CAAGCAGAAGACGGCATACGAGATgctaccGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 25 (RPI25)
CAAGCAGAAGACGGCATACGAGATatcagtGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 26 (RPI26)
CAAGCAGAAGACGGCATACGAGATgctcatGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 27 (RPI27)
CAAGCAGAAGACGGCATACGAGATaggaatGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 28 (RPI28)
CAAGCAGAAGACGGCATACGAGATcttttgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 29 (RPI29)
CAAGCAGAAGACGGCATACGAGATtagttgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 30 (RPI30)
CAAGCAGAAGACGGCATACGAGATccggtgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 31 (RPI31)
CAAGCAGAAGACGGCATACGAGATatcgtgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 32 (RPI32)
CAAGCAGAAGACGGCATACGAGATtgagtgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 33 (RPI33)
CAAGCAGAAGACGGCATACGAGATcgcctgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 34 (RPI34)
CAAGCAGAAGACGGCATACGAGATgccatgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 35 (RPI35)
CAAGCAGAAGACGGCATACGAGATaaaatgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 36 (RPI36)
CAAGCAGAAGACGGCATACGAGATtgttggGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 37 (RPI37)
CAAGCAGAAGACGGCATACGAGATattccgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 38 (RPI38)
CAAGCAGAAGACGGCATACGAGATagctagGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 39 (RPI39)
CAAGCAGAAGACGGCATACGAGATgtatagGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 40 (RPI40)
CAAGCAGAAGACGGCATACGAGATtctgagGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 41 (RPI41)
CAAGCAGAAGACGGCATACGAGATgtcgtcGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 42 (RPI42)
CAAGCAGAAGACGGCATACGAGATcgattaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 43 (RPI43)
CAAGCAGAAGACGGCATACGAGATgctgtaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 44 (RPI44)
CAAGCAGAAGACGGCATACGAGATattataGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 45 (RPI45)
CAAGCAGAAGACGGCATACGAGATgaatgaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 46 (RPI46)
CAAGCAGAAGACGGCATACGAGATtcgggaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 47 (RPI47)
CAAGCAGAAGACGGCATACGAGATcttcgaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 48 (RPI48)
CAAGCAGAAGACGGCATACGAGATtgccgaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA


#########################################################################################################
### 7. Illumina oligonucleotide sequences for Genomic DNA ###############################################
#########################################################################################################

>Adapter 1
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
>Adapter 2
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PCR Primer 1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PCR Primer 2
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
>Genomic DNA Sequencing Primer
ACACTCTTTCCCTACACGACGCTCTTCCGATCT


##########################################################################################################
### 8. Illumina Paired End DNA oligonucleotide sequences #################################################
##########################################################################################################

>PE Adapter 1
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
>PE Adapter 2
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PE PCR Primer 1.0
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PE PCR Primer 2.0
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
>PE Read 1 Sequencing Primer
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PE Read 2 Sequencing Primer
CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT


#########################################################################################################
### 9. Illumina Oligonucleotide sequences for the Multiplexing Sample Prep Oligo Only Kit ###############
#########################################################################################################

>Multiplexing Adapter 1
GATCGGAAGAGCACACGTCT
>Multiplexing Adapter 2
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Multiplexing PCR Primer 1.0
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Multiplexing PCR Primer 2.0
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>Multiplexing Read 1 Sequencing Primer
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Multiplexing Index Read Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>Multiplexing Read 2 Sequencing Primer
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>PCR Primer, Index 1
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTC
>PCR Primer, Index 2
CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTC
>PCR Primer, Index 3
CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTC
>PCR Primer, Index 4
CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTC
>PCR Primer, Index 5
CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTC
>PCR Primer, Index 6
CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTC
>PCR Primer, Index 7
CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTC
>PCR Primer, Index 8
CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTC
>PCR Primer, Index 9
CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTC
>PCR Primer, Index 10
CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTC
>PCR Primer, Index 11
CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTC
>PCR Primer, Index 12
CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTC


##########################################################################################################
### 10. Illumina DpnII expression                                          ###############################
### from  http://www.omicsoft.com/downloads/ngs/contamination_list/v1.txt  ###############################
##########################################################################################################

>Illumina DpnII expression Adapter 1
ACAGGTTCAGAGTTCTACAGTCCGAC
>Illumina DpnII expression Adapter 2
CAAGCAGAAGACGGCATACGA
>Illumina DpnII expression PCR Primer 1
CAAGCAGAAGACGGCATACGA
>Illumina DpnII expression PCR Primer 2
AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
>Illumina DpnII expression Sequencing Primer
CGACAGGTTCAGAGTTCTACAGTCCGACGATC


#########################################################################################################
### 11. Illumina DpnII Gex                                                 ##############################
### from  http://www.omicsoft.com/downloads/ngs/contamination_list/v1.txt  ##############################
#########################################################################################################

>Illumina DpnII Gex Adapter 1
GATCGTCGGACTGTAGAACTCTGAAC
>Illumina DpnII Gex Adapter 1.01
ACAGGTTCAGAGTTCTACAGTCCGAC
>Illumina DpnII Gex Adapter 2
CAAGCAGAAGACGGCATACGA
>Illumina DpnII Gex Adapter 2.01
TCGTATGCCGTCTTCTGCTTG
>Illumina DpnII Gex PCR Primer 1
CAAGCAGAAGACGGCATACGA
>Illumina DpnII Gex PCR Primer 2
AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
>Illumina DpnII Gex Sequencing Primer
CGACAGGTTCAGAGTTCTACAGTCCGACGATC


##########################################################################################################
### 12. Illumina NlaIII expression                                         ###############################
### from  http://www.omicsoft.com/downloads/ngs/contamination_list/v1.txt  ###############################
##########################################################################################################
>Illumina NlaIII expression Adapter 1
ACAGGTTCAGAGTTCTACAGTCCGACATG
>Illumina NlaIII expression Adapter 2
CAAGCAGAAGACGGCATACGA
>Illumina NlaIII expression PCR Primer 1
CAAGCAGAAGACGGCATACGA
>Illumina NlaIII expression PCR Primer 2
AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
>Illumina NlaIII expression Sequencing Primer
CCGACAGGTTCAGAGTTCTACAGTCCGACATG


#########################################################################################################
### 13. Illumina Small RNA Kits v1 and v1.5                                ##############################
### from  http://www.omicsoft.com/downloads/ngs/contamination_list/v1.txt  ##############################
#########################################################################################################
>Illumina Small RNA Adapter 1
GTTCAGAGTTCTACAGTCCGACGATC
>Illumina Small RNA Adapter 2
TCGTATGCCGTCTTCTGCTTGT
>Illumina Small RNA RT Primer
CAAGCAGAAGACGGCATACGA
>Illumina Small RNA PCR Primer 1
CAAGCAGAAGACGGCATACGA
>Illumina Small RNA PCR Primer 2
AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
>Illumina Small RNA Sequencing Primer
CGACAGGTTCAGAGTTCTACAGTCCGACGATC


########################################################################################################
### 14. SOLID 3 System Oligo                                                              ##############
### from  http://www.omicsoft.com/downloads/ngs/contamination_list/v1.txt                 ##############
###       SOLiD Fragment Library Barcoding Kit 1–96 protocol (Part Number 4448274 Rev. A) ##############
########################################################################################################

>ABI Dynabead EcoP Oligo
CTGATCTAGAGGTACCGGATCCCAGCAGT
>ABI Solid3 Adapter A
CTGCCCCGGGTTCCTCATTCTCTCAGCAGCATG
>ABI Solid3 Adapter B - Multiplex Library PCR-1
CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT
>ABI Solid3 5' AMP Primer
CCACTACGCCTCCGCTTTCCTCTCTATG
>ABI Solid3 3' AMP Primer - Multiplex Library PCR-2
CTGCCCCGGGTTCCTCATTCT
>ABI Solid3 EF1 alpha Sense Primer 
CATGTGTGTTGAGAGCTTC
>ABI Solid3 EF1 alpha Antisense Primer
GAAAACCAAAGTGGTCCAC
>ABI Solid3 GAPDH Forward Primer
TTAGCACCCCTGGCCAAGG
>ABI Solid3 GAPDH Reverse Primer
CTTACTCCTTGGAGGCCATG
>SOLID Multiplex Library P1 Adaptor
ATCACCGACTGCCCATAGAGAGGTT


########################################################################################################
### 15. Roche 454 Adaptors                                                                        ######
### from  http://nebc.nerc.ac.uk/bioinformatics/documentation/mira/html/mira_faq.html#section_5   ######
###       http://sourceforge.net/apps/mediawiki/wgs-assembler/index.php?title=SffToCA             ######
###       ftp://ftp.ncbi.nih.gov/pub/UniVec/UniVec
########################################################################################################

>5' 454 adaptor
GCCTCCCTCGCGCCATCAGATCGTAGGCACCTGAAA
>3' 454 adaptor
GCCTTGCCAGCCCGCTCAGATTGATGGTGCCTACAG
>454 Adaptor A
CTGAGACAGGGAGGGAACAGATGGGACACGCAGGGATGAGATGG
>454 Adaptor B
CTGAGACACGCAACAGGGGATAGGCAAGGCACACAGGGGATAGG
>gnl|uv|NGB00599.1:1-47 Evrogen Mint 454 PCR Primer
ACGCAGAGTGGCCGAGGCGGCCTTTTGTCTTTTCTTCTGTTTCTTTT
>gnl|uv|NGB00385.1:1-44 454 FLX linker
GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
>gnl|uv|NGB00386.1:1-42 454 Titanium linker
TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
>gnl|uv|NGB00417.1:1-40 454 Life Sciences GS FLX Titanium MID-1 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACGAGTGCGT
>Ti-MID1-Aprime
ACGCACTCGTCTGAGTCGGAGA
>gnl|uv|NGB00418.1:1-40 454 Life Sciences GS FLX Titanium MID-2 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACGCTCGACA
>gnl|uv|NGB00419.1:1-40 454 Life Sciences GS FLX Titanium MID-3 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGACGCACTC
>gnl|uv|NGB00420.1:1-40 454 Life Sciences GS FLX Titanium MID-4 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGCACTGTAG
>gnl|uv|NGB00421.1:1-40 454 Life Sciences GS FLX Titanium MID-5 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATCAGACACG
>gnl|uv|NGB00422.1:1-40 454 Life Sciences GS FLX Titanium MID-6 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATATCGCGAG
>gnl|uv|NGB00423.1:1-40 454 Life Sciences GS FLX Titanium MID-7 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGTGTCTCTA
>gnl|uv|NGB00424.1:1-40 454 Life Sciences GS FLX Titanium MID-8 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCTCGCGTGTC
>gnl|uv|NGB00425.1:1-40 454 Life Sciences GS FLX Titanium MID-10 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCTCTATGCG
>gnl|uv|NGB00426.1:1-40 454 Life Sciences GS FLX Titanium MID-11 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGATACGTCT
>gnl|uv|NGB00427.1:1-40 454 Life Sciences GS FLX Titanium MID-13 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCATAGTAGTG
>gnl|uv|NGB00428.1:1-40 454 Life Sciences GS FLX Titanium MID-14 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGAGAGATAC
>gnl|uv|NGB00429.1:1-40 454 Life Sciences GS FLX Titanium MID-15 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATACGACGTA
>gnl|uv|NGB00430.1:1-40 454 Life Sciences GS FLX Titanium MID-16 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCACGTACTA
>gnl|uv|NGB00431.1:1-40 454 Life Sciences GS FLX Titanium MID-17 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGTCTAGTAC
>gnl|uv|NGB00432.1:1-40 454 Life Sciences GS FLX Titanium MID-18 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCTACGTAGC
>gnl|uv|NGB00433.1:1-40 454 Life Sciences GS FLX Titanium MID-19 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGTACTACTC
>gnl|uv|NGB00434.1:1-40 454 Life Sciences GS FLX Titanium MID-20 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACGACTACAG
>gnl|uv|NGB00435.1:1-40 454 Life Sciences GS FLX Titanium MID-21 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGTAGACTAG
>gnl|uv|NGB00436.1:1-40 454 Life Sciences GS FLX Titanium MID-22 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTACGAGTATG
>gnl|uv|NGB00437.1:1-40 454 Life Sciences GS FLX Titanium MID-23 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTACTCTCGTG
>gnl|uv|NGB00438.1:1-40 454 Life Sciences GS FLX Titanium MID-24 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTAGAGACGAG
>gnl|uv|NGB00439.1:1-40 454 Life Sciences GS FLX Titanium MID-25 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCGTCGCTCG
>gnl|uv|NGB00440.1:1-40 454 Life Sciences GS FLX Titanium MID-26 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACATACGCGT
>gnl|uv|NGB00441.1:1-40 454 Life Sciences GS FLX Titanium MID-27 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACGCGAGTAT
>gnl|uv|NGB00442.1:1-40 454 Life Sciences GS FLX Titanium MID-28 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACTACTATGT
>gnl|uv|NGB00443.1:1-40 454 Life Sciences GS FLX Titanium MID-29 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACTGTACAGT
>gnl|uv|NGB00444.1:1-40 454 Life Sciences GS FLX Titanium MID-30 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGACTATACT
>gnl|uv|NGB00445.1:1-40 454 Life Sciences GS FLX Titanium MID-31 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGCGTCGTCT
>gnl|uv|NGB00446.1:1-40 454 Life Sciences GS FLX Titanium MID-32 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGTACGCTAT
>gnl|uv|NGB00447.1:1-40 454 Life Sciences GS FLX Titanium MID-33 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATAGAGTACT
>gnl|uv|NGB00448.1:1-40 454 Life Sciences GS FLX Titanium MID-34 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCACGCTACGT
>gnl|uv|NGB00449.1:1-40 454 Life Sciences GS FLX Titanium MID-35 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCAGTAGACGT
>gnl|uv|NGB00450.1:1-40 454 Life Sciences GS FLX Titanium MID-36 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGACGTGACT
>gnl|uv|NGB00451.1:1-40 454 Life Sciences GS FLX Titanium MID-37 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTACACACACT
>gnl|uv|NGB00452.1:1-40 454 Life Sciences GS FLX Titanium MID-38 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTACACGTGAT
>gnl|uv|NGB00453.1:1-40 454 Life Sciences GS FLX Titanium MID-39 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTACAGATCGT
>gnl|uv|NGB00454.1:1-40 454 Life Sciences GS FLX Titanium MID-40 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTACGCTGTCT
>gnl|uv|NGB00455.1:1-40 454 Life Sciences GS FLX Titanium MID-41 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTAGTGTAGAT
>gnl|uv|NGB00456.1:1-40 454 Life Sciences GS FLX Titanium MID-42 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCGATCACGT
>gnl|uv|NGB00457.1:1-40 454 Life Sciences GS FLX Titanium MID-43 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCGCACTAGT
>gnl|uv|NGB00458.1:1-40 454 Life Sciences GS FLX Titanium MID-44 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCTAGCGACT
>gnl|uv|NGB00459.1:1-40 454 Life Sciences GS FLX Titanium MID-45 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCTATACTAT
>gnl|uv|NGB00460.1:1-40 454 Life Sciences GS FLX Titanium MID-46 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGACGTATGT
>gnl|uv|NGB00461.1:1-40 454 Life Sciences GS FLX Titanium MID-47 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGTGAGTAGT
>gnl|uv|NGB00462.1:1-40 454 Life Sciences GS FLX Titanium MID-48 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACAGTATATA
>gnl|uv|NGB00463.1:1-40 454 Life Sciences GS FLX Titanium MID-49 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACGCGATCGA
>gnl|uv|NGB00464.1:1-40 454 Life Sciences GS FLX Titanium MID-50 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACTAGCAGTA
>gnl|uv|NGB00465.1:1-40 454 Life Sciences GS FLX Titanium MID-51 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGCTCACGTA
>gnl|uv|NGB00466.1:1-40 454 Life Sciences GS FLX Titanium MID-52 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGTATACATA
>gnl|uv|NGB00467.1:1-40 454 Life Sciences GS FLX Titanium MID-53 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGTCGAGAGA
>gnl|uv|NGB00468.1:1-40 454 Life Sciences GS FLX Titanium MID-54 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGTGCTACGA
>gnl|uv|NGB00469.1:1-40 454 Life Sciences GS FLX Titanium MID-55 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGATCGTATA
>gnl|uv|NGB00470.1:1-40 454 Life Sciences GS FLX Titanium MID-56 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGCAGTACGA
>gnl|uv|NGB00471.1:1-40 454 Life Sciences GS FLX Titanium MID-57 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGCGTATACA
>gnl|uv|NGB00472.1:1-40 454 Life Sciences GS FLX Titanium MID-58 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGTACAGTCA
>gnl|uv|NGB00473.1:1-40 454 Life Sciences GS FLX Titanium MID-59 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGTACTCAGA
>gnl|uv|NGB00474.1:1-40 454 Life Sciences GS FLX Titanium MID-60 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCTACGCTCTA
>gnl|uv|NGB00475.1:1-40 454 Life Sciences GS FLX Titanium MID-61 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCTATAGCGTA
>gnl|uv|NGB00476.1:1-40 454 Life Sciences GS FLX Titanium MID-62 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTACGTCATCA
>gnl|uv|NGB00477.1:1-40 454 Life Sciences GS FLX Titanium MID-63 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTAGTCGCATA
>gnl|uv|NGB00478.1:1-40 454 Life Sciences GS FLX Titanium MID-64 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTATATATACA
>gnl|uv|NGB00479.1:1-40 454 Life Sciences GS FLX Titanium MID-65 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTATGCTAGTA
>gnl|uv|NGB00480.1:1-40 454 Life Sciences GS FLX Titanium MID-66 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCACGCGAGA
>gnl|uv|NGB00481.1:1-40 454 Life Sciences GS FLX Titanium MID-67 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCGATAGTGA
>gnl|uv|NGB00482.1:1-40 454 Life Sciences GS FLX Titanium MID-68 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCGCTGCGTA
>gnl|uv|NGB00483.1:1-40 454 Life Sciences GS FLX Titanium MID-69 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCTGACGTCA
>gnl|uv|NGB00484.1:1-40 454 Life Sciences GS FLX Titanium MID-70 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGAGTCAGTA
>gnl|uv|NGB00485.1:1-40 454 Life Sciences GS FLX Titanium MID-71 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGTAGTGTGA
>gnl|uv|NGB00486.1:1-40 454 Life Sciences GS FLX Titanium MID-72 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGTCACACGA
>gnl|uv|NGB00487.1:1-40 454 Life Sciences GS FLX Titanium MID-73 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGTCGTCGCA
>gnl|uv|NGB00488.1:1-40 454 Life Sciences GS FLX Titanium MID-74 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACACATACGC
>gnl|uv|NGB00489.1:1-40 454 Life Sciences GS FLX Titanium MID-75 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACAGTCGTGC
>gnl|uv|NGB00490.1:1-40 454 Life Sciences GS FLX Titanium MID-76 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACATGACGAC
>gnl|uv|NGB00491.1:1-40 454 Life Sciences GS FLX Titanium MID-77 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACGACAGCTC
>gnl|uv|NGB00492.1:1-40 454 Life Sciences GS FLX Titanium MID-78 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACGTCTCATC
>gnl|uv|NGB00493.1:1-40 454 Life Sciences GS FLX Titanium MID-79 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACTCATCTAC
>gnl|uv|NGB00494.1:1-40 454 Life Sciences GS FLX Titanium MID-80 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACTCGCGCAC
>gnl|uv|NGB00495.1:1-40 454 Life Sciences GS FLX Titanium MID-81 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGAGCGTCAC
>gnl|uv|NGB00496.1:1-40 454 Life Sciences GS FLX Titanium MID-82 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGCGACTAGC
>gnl|uv|NGB00497.1:1-40 454 Life Sciences GS FLX Titanium MID-83 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGTAGTGATC
>gnl|uv|NGB00498.1:1-40 454 Life Sciences GS FLX Titanium MID-84 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGTGACACAC
>gnl|uv|NGB00499.1:1-40 454 Life Sciences GS FLX Titanium MID-85 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGTGTATGTC
>gnl|uv|NGB00500.1:1-40 454 Life Sciences GS FLX Titanium MID-86 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATAGATAGAC
>gnl|uv|NGB00501.1:1-40 454 Life Sciences GS FLX Titanium MID-87 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATATAGTCGC
>gnl|uv|NGB00502.1:1-40 454 Life Sciences GS FLX Titanium MID-88 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATCTACTGAC
>gnl|uv|NGB00503.1:1-40 454 Life Sciences GS FLX Titanium MID-89 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCACGTAGATC
>gnl|uv|NGB00504.1:1-40 454 Life Sciences GS FLX Titanium MID-90 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCACGTGTCGC
>gnl|uv|NGB00505.1:1-40 454 Life Sciences GS FLX Titanium MID-91 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCATACTCTAC
>gnl|uv|NGB00506.1:1-40 454 Life Sciences GS FLX Titanium MID-92 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGACACTATC
>gnl|uv|NGB00507.1:1-40 454 Life Sciences GS FLX Titanium MID-93 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGAGACGCGC
>gnl|uv|NGB00508.1:1-40 454 Life Sciences GS FLX Titanium MID-94 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGTATGCGAC
>gnl|uv|NGB00509.1:1-40 454 Life Sciences GS FLX Titanium MID-95 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGTCGATCTC
>gnl|uv|NGB00510.1:1-40 454 Life Sciences GS FLX Titanium MID-96 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCTACGACTGC
>gnl|uv|NGB00511.1:1-40 454 Life Sciences GS FLX Titanium MID-97 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCTAGTCACTC
>gnl|uv|NGB00512.1:1-40 454 Life Sciences GS FLX Titanium MID-98 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCTCTACGCTC
>gnl|uv|NGB00513.1:1-40 454 Life Sciences GS FLX Titanium MID-99 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCTGTACATAC
>gnl|uv|NGB00514.1:1-40 454 Life Sciences GS FLX Titanium MID-100 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTAGACTGCAC
>gnl|uv|NGB00515.1:1-40 454 Life Sciences GS FLX Titanium MID-101 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTAGCGCGCGC
>gnl|uv|NGB00516.1:1-40 454 Life Sciences GS FLX Titanium MID-102 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTAGCTCTATC
>gnl|uv|NGB00517.1:1-40 454 Life Sciences GS FLX Titanium MID-103 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTATAGACATC
>gnl|uv|NGB00518.1:1-40 454 Life Sciences GS FLX Titanium MID-104 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTATGATACGC
>gnl|uv|NGB00519.1:1-40 454 Life Sciences GS FLX Titanium MID-105 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCACTCATAC
>gnl|uv|NGB00520.1:1-40 454 Life Sciences GS FLX Titanium MID-106 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCATCGAGTC
>gnl|uv|NGB00521.1:1-40 454 Life Sciences GS FLX Titanium MID-107 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCGAGCTCTC
>gnl|uv|NGB00522.1:1-40 454 Life Sciences GS FLX Titanium MID-108 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCGCAGACAC
>gnl|uv|NGB00523.1:1-40 454 Life Sciences GS FLX Titanium MID-109 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCTGTCTCGC
>gnl|uv|NGB00524.1:1-40 454 Life Sciences GS FLX Titanium MID-110 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGAGTGACGC
>gnl|uv|NGB00525.1:1-40 454 Life Sciences GS FLX Titanium MID-111 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGATGTGTAC
>gnl|uv|NGB00526.1:1-40 454 Life Sciences GS FLX Titanium MID-112 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGCTATAGAC
>gnl|uv|NGB00527.1:1-40 454 Life Sciences GS FLX Titanium MID-113 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGCTCGCTAC
>gnl|uv|NGB00528.1:1-40 454 Life Sciences GS FLX Titanium MID-114 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACGTGCAGCG
>gnl|uv|NGB00529.1:1-40 454 Life Sciences GS FLX Titanium MID-115 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACTCACAGAG
>gnl|uv|NGB00530.1:1-40 454 Life Sciences GS FLX Titanium MID-116 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGACTCAGCG
>gnl|uv|NGB00531.1:1-40 454 Life Sciences GS FLX Titanium MID-117 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGAGAGTGTG
>gnl|uv|NGB00532.1:1-40 454 Life Sciences GS FLX Titanium MID-118 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGCTATCGCG
>gnl|uv|NGB00533.1:1-40 454 Life Sciences GS FLX Titanium MID-119 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGTCTGACTG
>gnl|uv|NGB00534.1:1-40 454 Life Sciences GS FLX Titanium MID-120 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGTGAGCTCG
>gnl|uv|NGB00535.1:1-40 454 Life Sciences GS FLX Titanium MID-121 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATAGCTCTCG
>gnl|uv|NGB00536.1:1-40 454 Life Sciences GS FLX Titanium MID-122 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATCACGTGCG
>gnl|uv|NGB00537.1:1-40 454 Life Sciences GS FLX Titanium MID-123 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATCGTAGCAG
>gnl|uv|NGB00538.1:1-40 454 Life Sciences GS FLX Titanium MID-124 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATCGTCTGTG
>gnl|uv|NGB00539.1:1-40 454 Life Sciences GS FLX Titanium MID-125 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATGTACGATG
>gnl|uv|NGB00540.1:1-40 454 Life Sciences GS FLX Titanium MID-126 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATGTGTCTAG
>gnl|uv|NGB00541.1:1-40 454 Life Sciences GS FLX Titanium MID-127 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCACACGATAG
>gnl|uv|NGB00542.1:1-40 454 Life Sciences GS FLX Titanium MID-128 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCACTCGCACG
>gnl|uv|NGB00543.1:1-40 454 Life Sciences GS FLX Titanium MID-129 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCAGACGTCTG
>gnl|uv|NGB00544.1:1-40 454 Life Sciences GS FLX Titanium MID-130 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCAGTACTGCG
>gnl|uv|NGB00545.1:1-40 454 Life Sciences GS FLX Titanium MID-131 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGACAGCGAG
>gnl|uv|NGB00546.1:1-40 454 Life Sciences GS FLX Titanium MID-132 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGATCTGTCG
>gnl|uv|NGB00547.1:1-40 454 Life Sciences GS FLX Titanium MID-133 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGCGTGCTAG
>gnl|uv|NGB00548.1:1-40 454 Life Sciences GS FLX Titanium MID-134 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGCTCGAGTG
>gnl|uv|NGB00549.1:1-40 454 Life Sciences GS FLX Titanium MID-135 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGTGATGACG
>gnl|uv|NGB00550.1:1-40 454 Life Sciences GS FLX Titanium MID-136 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCTATGTACAG
>gnl|uv|NGB00551.1:1-40 454 Life Sciences GS FLX Titanium MID-137 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCTCGATATAG
>gnl|uv|NGB00552.1:1-40 454 Life Sciences GS FLX Titanium MID-138 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCTCGCACGCG
>gnl|uv|NGB00553.1:1-40 454 Life Sciences GS FLX Titanium MID-139 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCTGCGTCACG
>gnl|uv|NGB00554.1:1-40 454 Life Sciences GS FLX Titanium MID-140 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCTGTGCGTCG
>gnl|uv|NGB00555.1:1-40 454 Life Sciences GS FLX Titanium MID-141 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTAGCATACTG
>gnl|uv|NGB00556.1:1-40 454 Life Sciences GS FLX Titanium MID-142 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTATACATGTG
>gnl|uv|NGB00557.1:1-40 454 Life Sciences GS FLX Titanium MID-143 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTATCACTCAG
>gnl|uv|NGB00558.1:1-40 454 Life Sciences GS FLX Titanium MID-144 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTATCTGATAG
>gnl|uv|NGB00559.1:1-40 454 Life Sciences GS FLX Titanium MID-145 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCGTGACATG
>gnl|uv|NGB00560.1:1-40 454 Life Sciences GS FLX Titanium MID-146 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCTGATCGAG
>gnl|uv|NGB00561.1:1-40 454 Life Sciences GS FLX Titanium MID-147 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGACATCTCG
>gnl|uv|NGB00562.1:1-40 454 Life Sciences GS FLX Titanium MID-148 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGAGCTAGAG
>gnl|uv|NGB00563.1:1-40 454 Life Sciences GS FLX Titanium MID-149 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGATAGAGCG
>gnl|uv|NGB00564.1:1-40 454 Life Sciences GS FLX Titanium MID-150 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGCGTGTGCG
>gnl|uv|NGB00565.1:1-40 454 Life Sciences GS FLX Titanium MID-151 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGCTAGTCAG
>gnl|uv|NGB00566.1:1-40 454 Life Sciences GS FLX Titanium MID-152 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGTATCACAG
>gnl|uv|NGB00567.1:1-40 454 Life Sciences GS FLX Titanium MID-153 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGTGCGCGTG
>gnl|uv|NGB00569.1:1-33 454 GS FLX Titanium Rapid Library Adaptor B universal segment
AGTCGACGTCTCTCAAGGCACACAGGGGATAGG
AGTCGCCGTCTCTCAAGGCACACAGGGGATAGG
AGTCGGCGTCTCTCAAGGCACACAGGGGATAGG
AGTCGTCGTCTCTCAAGGCACACAGGGGATAGG
CGTCGACGTCTCTCAAGGCACACAGGGGATAGG
CGTCGCCGTCTCTCAAGGCACACAGGGGATAGG
CGTCGGCGTCTCTCAAGGCACACAGGGGATAGG
CGTCGTCGTCTCTCAAGGCACACAGGGGATAGG
GGTCGACGTCTCTCAAGGCACACAGGGGATAGG
GGTCGCCGTCTCTCAAGGCACACAGGGGATAGG
GGTCGGCGTCTCTCAAGGCACACAGGGGATAGG
GGTCGTCGTCTCTCAAGGCACACAGGGGATAGG
TGTCGACGTCTCTCAAGGCACACAGGGGATAGG
TGTCGCCGTCTCTCAAGGCACACAGGGGATAGG
TGTCGGCGTCTCTCAAGGCACACAGGGGATAGG
TGTCGTCGTCTCTCAAGGCACACAGGGGATAGG
>gnl|uv|NGB00416.1:1-30 454 Life Sciences GS FLX Titanium MID Adaptor B
CCTATCCCCTGTGTGCCTTGGCAGTCTCAG
>Ti-MID-Bprime
CTGAGACTGCCA
>gnl|uv|NGB00568.1:1-30 454 GS FLX Titanium Rapid Library Adaptor A universal segment
CCATCTCATCCCTGCGTGTCTCCGACGACT
>gnl|uv|NGB00414.1:1-25 454 Life Sciences GS FLX Titanium Primer A-key
CGTATCGCCTCCCTCGCGCCATCAG
>gnl|uv|NGB00415.1:1-25 454 Life Sciences GS FLX Titanium Primer B-key
CTATGCGCCTTGCCAGCCCGCTCAG


########################################################################################################
### 16. Ion Torrent adapter sequences                                      #############################
### from  V. Caro                                                          #############################
########################################################################################################

>Ion A Adapter (non barcoded)
CCATCTCATCCCTGCGTGTCTCCGACTCAG
>Ion A Adapter (non barcoded)
GGTAGAGTAGGGACGCACAGAGGCTGAGTC
>Ion P1 Adapter
CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT
>Ion P1 Adapter
GGTGATGCGGAGGCGAAAGGAGAGATACCCGTCAGCCACTA

###################################################################################################
### 17. 16S primer V1V3  MiSeq ####################################################################
###################################################################################################
>PCR1_V1_V3F
CTCTTTCCCTACACGACGCTCTTCCGATCTAGAGTTTGATCCTGGCTCAG
>PCR1_V1_V3R
CTGGAGTTCAGACGTGTGCTCTTCCGATCTGTATTACCGCGGCTGCTGG

###################################################################################################
### 18. 16S primer V4V5 MiSeq #####################################################################
###################################################################################################
>PCR1_515F
CTTTCCCTACACGACGCTCTTCCGATCTGTGYCAGCMGCCGCGGTA
>PCR1_928R
GGAGTTCAGACGTGTGCTCTTCCGATCTCCCCGYCAATTCMTTTRAGT

###################################################################################################
#### 19. 16S Adapter + primer V5V6  MiSeq #########################################################
###################################################################################################
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAACGTGATAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAAACATCGAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGCCTAAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTGGTCAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACCACTGTAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACATTGGCAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCAGATCTGAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCATCAAGTAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCGCTGATCAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACAAGCTAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCTGTAGCCAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTACAAGAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAACAACCAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAACCGAGAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAACGCTTAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGACGGAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGGTACAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACACAGAAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACAGCAGAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACCTCCAAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACGCTCGAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACGTATCAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACTATGCAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGAGTCAAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGATCGCAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGCAGGAAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTCACTAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTATCCTGTAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTATTGAGGAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCAACCACAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGACTAGTAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCAATGGAAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCACTTCGAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCAGCGTTAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCATACCAAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCCAGTTCAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCCGAAGTAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCCGTGAGAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTCCTGAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCGAACTTAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCGACTGGAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCGCATACAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCTCAATGAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCTGAGCCAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCTGGCATAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGAATCTGAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCAAGACTAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGAGCTGAAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGATAGACAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGCCACATAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGCGAGTAAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGCTAACGAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGCTCGGTAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGGAGAACAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGGTGCGAAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTACGCAAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCGTAGAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCTGTCAAGGATTAGATACCCTGGTA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGTTCTAAGGATTAGATACCCTGGTA
CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCRRCACGAGCTGACGAC

###################################################################################################
#### 20. 16S Adapter + primer V3V4 MiSeq ##########################################################
###################################################################################################
# Forward primer
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG
# Reverse primer
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC

# 16S Adapter Milieu interieur
#16Sf (V3F)
TATGGTAATTGGCCTACGGRAGGCAGCAG
#16Sr (V4R)
AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT
#rc16r
ATTAGAWACCCBDGTAGTCCGGCTGACTGACT

###################################################################################################
#### 18S Adapter + Primer MiSeq ###################################################################
###################################################################################################
#Forward primer 574
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCGGTAAYTCCAGCTCYV
# Reverse primer 1132
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCGTCAATTHCTTYAART

###################################################################################################
##### ITS Adapter + Primer MiSeq ##################################################################
###################################################################################################
# Reverse primer ITS1
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTTGGTCATTTAGAGGAAGTAA
# Reverse primer ITS2
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCTGCGTTCTTCATCGATGC