Commit 8e65da7d authored by svolant's avatar svolant
Browse files

correction bug

parents db6ccd7c be3c3d82
......@@ -3,5 +3,4 @@
*.RData
.Rproj.user
*.Rproj
AideCode.odt
www/google-analytics.js
*.json
options(download.file.method = 'wget')
if (!require("backports")){
install.packages("backports")
library(backports)
}
if (!require("backports")){
install.packages("backports")
......@@ -8,15 +12,18 @@ if (!require("backports")){
if (!require("readr")){
install.packages("readr")
library(readr)
}
if (!require("jsonlite")){
install.packages("jsonlite")
library(jsonlite)
}
if (!require("shinyFiles")){
install.packages("shinyFiles")
library(shinyFiles)
}
......@@ -179,6 +186,7 @@ if(!require(PhyloTreeMetaR)){
library(PhyloTreeMetaR)
}
# if(!require(plotly)){
# install.packages("plotly")
# library(plotly)
......
......@@ -317,8 +317,7 @@ SamplesMasque <- function(input,values)
CreateJSON <- function(input){
curdir = getwd()
curdir <- getwd()
tmpjson = tempfile(pattern = "file", tmpdir = paste(curdir,"www","masque","todo",sep= .Platform$file.sep), fileext = ".json")
if(input$PairedOrNot=='n')
......
####################################################################################################
# #
# LAST UPDATE: 07 June 2013 #
# #
# This file contains a list a putative contaminant oligonucleotides that could occur in both ends #
# of NGS reads. This file is formatted to be used by AlienTrimmer in order to trim off such #
# contaminant oligonucleotides from FASTQ formatted read files. #
# If you wish to add new contaminant sequences, use the FASTA format to name them, and be careful #
# to always write one sequence per line (lower and/or uppercase characters). Comment lines could #
# be written by using '#' as the first character. If you wish to not trim off some of these #
# sequences when using AlienTrimmer, comment these lines with '#'. #
# #
# CONTENTS: #
# 1. Homopolymers #
# 2. Nextera DNA Sample Preparation Kit (Illumina) #
# 3. Nextera Index Kit- PCR Primers #
# 4. Nextera DNA Sample Prep Kit (Epicentre Biotechnologies) #
# 5. TruSeq RNA and DNA Sample Prep Kits (v1 and v2) #
# 6. Oligonucleotide sequences for TruSeq Small RNA Sample Prep Kit #
# 7. Illumina oligonucleotide sequences for Genomic DNA #
# 8. Illumina Paired End DNA oligonucleotide sequences #
# 9. Illumina Oligonucleotide sequences for the Multiplexing Sample Prep Oligo Only Kit #
# 10. Illumina DpnII expression #
# 11. Illumina DpnII Gex #
# 12. Illumina NlaIII expression #
# 13. Illumina Small RNA Kits v1 and v1.5 #
# 14. SOLID 3 System Oligo #
# 15. Roche 454 Adaptors, Linkiers and Adapters #
# 16. Ion Torrent adapter sequences #
# #
####################################################################################################
###################################################################################################
### 1. Homopolymers ###############################################################################
###################################################################################################
>poly-A
AAAAAAAAAAAAAAAAAAAA
>poly-C
CCCCCCCCCCCCCCCCCCCC
>poly-G
GGGGGGGGGGGGGGGGGGGG
>poly-T
TTTTTTTTTTTTTTTTTTTT
###################################################################################################
### 2. Nextera(R) DNA Sample Preparation Kit (Illumina) ###########################################
###################################################################################################
>Nextera Transposase Sequence (FC-121-1031)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
>Nextera Transposase Sequence (FC-121-1030)
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
###################################################################################################
### 3. Nextera Index Kit- PCR Primers #############################################################
###################################################################################################
>Nextera Index Kit- PCR primer (FC-121-1012, Index N501)
AATGATACGGCGACCACCGAGATCTACACtagatcgcTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N502)
AATGATACGGCGACCACCGAGATCTACACctctctatTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N503)
AATGATACGGCGACCACCGAGATCTACACtatcctctTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N504)
AATGATACGGCGACCACCGAGATCTACACagagtagaTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N505)
AATGATACGGCGACCACCGAGATCTACACgtaaggagTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N506)
AATGATACGGCGACCACCGAGATCTACACgctgcataTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N507)
AATGATACGGCGACCACCGAGATCTACACaaggagtaTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1012, Index N508)
AATGATACGGCGACCACCGAGATCTACACctaagcctTCGTCGGCAGCGTC
>Nextera Index Kit- PCR primer (FC-121-1011, Index N701)
CAAGCAGAAGACGGCATACGAGATtaaggcgaGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N702)
CAAGCAGAAGACGGCATACGAGATcgtactagGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N703)
CAAGCAGAAGACGGCATACGAGATaggcagaaGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N704)
CAAGCAGAAGACGGCATACGAGATtcctgagcGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N705)
CAAGCAGAAGACGGCATACGAGATggactcctGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N706)
CAAGCAGAAGACGGCATACGAGATtaggcatgGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N707)
CAAGCAGAAGACGGCATACGAGATctctctacGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N708)
CAAGCAGAAGACGGCATACGAGATcagagaggGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N709)
CAAGCAGAAGACGGCATACGAGATgctacgctGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N710)
CAAGCAGAAGACGGCATACGAGATcgaggctgGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N711)
CAAGCAGAAGACGGCATACGAGATaagaggcaGTCTCGTGGGCTCGG
>Nextera Index Kit- PCR primer (FC-121-1011, Index N712)
CAAGCAGAAGACGGCATACGAGATgtagaggaGTCTCGTGGGCTCGG
#########################################################################################################
### 4. Nextera DNA Sample Prep Kit (Epicentre Biotechnologies) ##########################################
#########################################################################################################
>Transposon Sequence 1
GCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG
>Transposon Sequence 2
GCCTTGCCAGCCCGCTCAGAGATGTGTATAAGAGACAG
>Adapter 1
AATGATACGGCGACCACCGAGATCTACACGCCTCCCTCGCGCCATCAG
>Adapter 2, Bar Code IDX1
CAAGCAGAAGACGGCATACGAGATcgtgatCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX2
CAAGCAGAAGACGGCATACGAGATacatcgCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX3
CAAGCAGAAGACGGCATACGAGATgcctaaCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX4
CAAGCAGAAGACGGCATACGAGATtggtcaCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX5
CAAGCAGAAGACGGCATACGAGATcactgtCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX6
CAAGCAGAAGACGGCATACGAGATattggcCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX7
CAAGCAGAAGACGGCATACGAGATgatctgCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX8
CAAGCAGAAGACGGCATACGAGATtcaagtCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX9
CAAGCAGAAGACGGCATACGAGATctgatcCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX10
CAAGCAGAAGACGGCATACGAGATaagctaCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX11
CAAGCAGAAGACGGCATACGAGATgtagccCGGTCTGCCTTGCCAGCCCGCTCAG
>Adapter 2, Bar Code IDX12
CAAGCAGAAGACGGCATACGAGATtacaagCGGTCTGCCTTGCCAGCCCGCTCAG
>PCR Primer 1
AATGATACGGCGACCACCGA
>PCR Primer 2
CAAGCAGAAGACGGCATACGA
#########################################################################################################
### 5. TruSeq RNA and DNA Sample Prep Kits (v1 and v2) ##################################################
#########################################################################################################
>TruSeq Universal Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>TruSeq Adapter, Index 1
GATCGGAAGAGCACACGTCTGAACTCCAGTCACatcacgATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 2
GATCGGAAGAGCACACGTCTGAACTCCAGTCACcgatgtATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 3
GATCGGAAGAGCACACGTCTGAACTCCAGTCACttaggcATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 4
GATCGGAAGAGCACACGTCTGAACTCCAGTCACtgaccaATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 5
GATCGGAAGAGCACACGTCTGAACTCCAGTCACacagtgATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 6
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgccaatATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 7
GATCGGAAGAGCACACGTCTGAACTCCAGTCACcagatcATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 8
GATCGGAAGAGCACACGTCTGAACTCCAGTCACacttgaATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 9
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgatcagATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 10
GATCGGAAGAGCACACGTCTGAACTCCAGTCACtagcttATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 11
GATCGGAAGAGCACACGTCTGAACTCCAGTCACggctacATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 12
GATCGGAAGAGCACACGTCTGAACTCCAGTCACcttgtaATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 13
GATCGGAAGAGCACACGTCTGAACTCCAGTCACagtcaaCAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 14
GATCGGAAGAGCACACGTCTGAACTCCAGTCACagttccGTATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 15
GATCGGAAGAGCACACGTCTGAACTCCAGTCACatgtcaGAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 16
GATCGGAAGAGCACACGTCTGAACTCCAGTCACccgtccCGATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 18
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgtccgcACATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 19
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgtgaaaCGATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 20
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgtggccTTATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 21
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgtttcgGAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 22
GATCGGAAGAGCACACGTCTGAACTCCAGTCACcgtacgTAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 23
GATCGGAAGAGCACACGTCTGAACTCCAGTCACgagtggATATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 25
GATCGGAAGAGCACACGTCTGAACTCCAGTCACactgatATATCTCGTATGCCGTCTTCTGCTTG
>TruSeq Adapter, Index 27
GATCGGAAGAGCACACGTCTGAACTCCAGTCACattcctTTATCTCGTATGCCGTCTTCTGCTTG
#########################################################################################################
### 6. Oligonucleotide sequences for TruSeq Small RNA Sample Prep Kit ###################################
#########################################################################################################
>RNA 3’ Adapter (RA3), part # 15013207
TGGAATTCTCGGGTGCCAAGG
>RNA RT Primer (RTP), part # 15013981
GCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, (RP1), part # 15005505
AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA
>RNA PCR Primer, Index 1 (RPI1)
CAAGCAGAAGACGGCATACGAGATcgtgatGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 2 (RPI2)
CAAGCAGAAGACGGCATACGAGATacatcgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 3 (RPI3)
CAAGCAGAAGACGGCATACGAGATgcctaaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 4 (RPI4)
CAAGCAGAAGACGGCATACGAGATtggtcaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 5 (RPI5)
CAAGCAGAAGACGGCATACGAGATcactgtGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 6 (RPI6)
CAAGCAGAAGACGGCATACGAGATattggcGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 7 (RPI7)
CAAGCAGAAGACGGCATACGAGATgatctgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 8 (RPI8)
CAAGCAGAAGACGGCATACGAGATtcaagtGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 9 (RPI9)
CAAGCAGAAGACGGCATACGAGATctgatcGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 10 (RPI10)
CAAGCAGAAGACGGCATACGAGATaagctaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 11 (RPI11)
CAAGCAGAAGACGGCATACGAGATgtagccGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 12 (RPI12)
CAAGCAGAAGACGGCATACGAGATtacaagGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 13 (RPI13)
CAAGCAGAAGACGGCATACGAGATttgactGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 14 (RPI14)
CAAGCAGAAGACGGCATACGAGATggaactGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 15 (RPI15)
CAAGCAGAAGACGGCATACGAGATtgacatGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 16 (RPI16)
CAAGCAGAAGACGGCATACGAGATggacggGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 17 (RPI17)
CAAGCAGAAGACGGCATACGAGATctctacGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 18 (RPI18)
CAAGCAGAAGACGGCATACGAGATgcggacGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 19 (RPI19)
CAAGCAGAAGACGGCATACGAGATtttcacGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 20 (RPI20)
CAAGCAGAAGACGGCATACGAGATggccacGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 21 (RPI21)
CAAGCAGAAGACGGCATACGAGATcgaaacGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 22 (RPI22)
CAAGCAGAAGACGGCATACGAGATcgtacgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 23 (RPI23)
CAAGCAGAAGACGGCATACGAGATccactcGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 24 (RPI24)
CAAGCAGAAGACGGCATACGAGATgctaccGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 25 (RPI25)
CAAGCAGAAGACGGCATACGAGATatcagtGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 26 (RPI26)
CAAGCAGAAGACGGCATACGAGATgctcatGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 27 (RPI27)
CAAGCAGAAGACGGCATACGAGATaggaatGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 28 (RPI28)
CAAGCAGAAGACGGCATACGAGATcttttgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 29 (RPI29)
CAAGCAGAAGACGGCATACGAGATtagttgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 30 (RPI30)
CAAGCAGAAGACGGCATACGAGATccggtgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 31 (RPI31)
CAAGCAGAAGACGGCATACGAGATatcgtgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 32 (RPI32)
CAAGCAGAAGACGGCATACGAGATtgagtgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 33 (RPI33)
CAAGCAGAAGACGGCATACGAGATcgcctgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 34 (RPI34)
CAAGCAGAAGACGGCATACGAGATgccatgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 35 (RPI35)
CAAGCAGAAGACGGCATACGAGATaaaatgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 36 (RPI36)
CAAGCAGAAGACGGCATACGAGATtgttggGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 37 (RPI37)
CAAGCAGAAGACGGCATACGAGATattccgGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 38 (RPI38)
CAAGCAGAAGACGGCATACGAGATagctagGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 39 (RPI39)
CAAGCAGAAGACGGCATACGAGATgtatagGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 40 (RPI40)
CAAGCAGAAGACGGCATACGAGATtctgagGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 41 (RPI41)
CAAGCAGAAGACGGCATACGAGATgtcgtcGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 42 (RPI42)
CAAGCAGAAGACGGCATACGAGATcgattaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 43 (RPI43)
CAAGCAGAAGACGGCATACGAGATgctgtaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 44 (RPI44)
CAAGCAGAAGACGGCATACGAGATattataGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 45 (RPI45)
CAAGCAGAAGACGGCATACGAGATgaatgaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 46 (RPI46)
CAAGCAGAAGACGGCATACGAGATtcgggaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 47 (RPI47)
CAAGCAGAAGACGGCATACGAGATcttcgaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RNA PCR Primer, Index 48 (RPI48)
CAAGCAGAAGACGGCATACGAGATtgccgaGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
#########################################################################################################
### 7. Illumina oligonucleotide sequences for Genomic DNA ###############################################
#########################################################################################################
>Adapter 1
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
>Adapter 2
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PCR Primer 1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PCR Primer 2
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
>Genomic DNA Sequencing Primer
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
##########################################################################################################
### 8. Illumina Paired End DNA oligonucleotide sequences #################################################
##########################################################################################################
>PE Adapter 1
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
>PE Adapter 2
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PE PCR Primer 1.0
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PE PCR Primer 2.0
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
>PE Read 1 Sequencing Primer
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PE Read 2 Sequencing Primer
CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
#########################################################################################################
### 9. Illumina Oligonucleotide sequences for the Multiplexing Sample Prep Oligo Only Kit ###############
#########################################################################################################
>Multiplexing Adapter 1
GATCGGAAGAGCACACGTCT
>Multiplexing Adapter 2
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Multiplexing PCR Primer 1.0
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Multiplexing PCR Primer 2.0
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>Multiplexing Read 1 Sequencing Primer
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Multiplexing Index Read Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>Multiplexing Read 2 Sequencing Primer
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>PCR Primer, Index 1
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTC
>PCR Primer, Index 2
CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTC
>PCR Primer, Index 3
CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTC
>PCR Primer, Index 4
CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTC
>PCR Primer, Index 5
CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTC
>PCR Primer, Index 6
CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTC
>PCR Primer, Index 7
CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTC
>PCR Primer, Index 8
CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTC
>PCR Primer, Index 9
CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTC
>PCR Primer, Index 10
CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTC
>PCR Primer, Index 11
CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTC
>PCR Primer, Index 12
CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTC
##########################################################################################################
### 10. Illumina DpnII expression ###############################
### from http://www.omicsoft.com/downloads/ngs/contamination_list/v1.txt ###############################
##########################################################################################################
>Illumina DpnII expression Adapter 1
ACAGGTTCAGAGTTCTACAGTCCGAC
>Illumina DpnII expression Adapter 2
CAAGCAGAAGACGGCATACGA
>Illumina DpnII expression PCR Primer 1
CAAGCAGAAGACGGCATACGA
>Illumina DpnII expression PCR Primer 2
AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
>Illumina DpnII expression Sequencing Primer
CGACAGGTTCAGAGTTCTACAGTCCGACGATC
#########################################################################################################
### 11. Illumina DpnII Gex ##############################
### from http://www.omicsoft.com/downloads/ngs/contamination_list/v1.txt ##############################
#########################################################################################################
>Illumina DpnII Gex Adapter 1
GATCGTCGGACTGTAGAACTCTGAAC
>Illumina DpnII Gex Adapter 1.01
ACAGGTTCAGAGTTCTACAGTCCGAC
>Illumina DpnII Gex Adapter 2
CAAGCAGAAGACGGCATACGA
>Illumina DpnII Gex Adapter 2.01
TCGTATGCCGTCTTCTGCTTG
>Illumina DpnII Gex PCR Primer 1
CAAGCAGAAGACGGCATACGA
>Illumina DpnII Gex PCR Primer 2
AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
>Illumina DpnII Gex Sequencing Primer
CGACAGGTTCAGAGTTCTACAGTCCGACGATC
##########################################################################################################
### 12. Illumina NlaIII expression ###############################
### from http://www.omicsoft.com/downloads/ngs/contamination_list/v1.txt ###############################
##########################################################################################################
>Illumina NlaIII expression Adapter 1
ACAGGTTCAGAGTTCTACAGTCCGACATG
>Illumina NlaIII expression Adapter 2
CAAGCAGAAGACGGCATACGA
>Illumina NlaIII expression PCR Primer 1
CAAGCAGAAGACGGCATACGA
>Illumina NlaIII expression PCR Primer 2
AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
>Illumina NlaIII expression Sequencing Primer
CCGACAGGTTCAGAGTTCTACAGTCCGACATG
#########################################################################################################
### 13. Illumina Small RNA Kits v1 and v1.5 ##############################
### from http://www.omicsoft.com/downloads/ngs/contamination_list/v1.txt ##############################
#########################################################################################################
>Illumina Small RNA Adapter 1
GTTCAGAGTTCTACAGTCCGACGATC
>Illumina Small RNA Adapter 2
TCGTATGCCGTCTTCTGCTTGT
>Illumina Small RNA RT Primer
CAAGCAGAAGACGGCATACGA
>Illumina Small RNA PCR Primer 1
CAAGCAGAAGACGGCATACGA
>Illumina Small RNA PCR Primer 2
AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
>Illumina Small RNA Sequencing Primer
CGACAGGTTCAGAGTTCTACAGTCCGACGATC
########################################################################################################
### 14. SOLID 3 System Oligo ##############
### from http://www.omicsoft.com/downloads/ngs/contamination_list/v1.txt ##############
### SOLiD Fragment Library Barcoding Kit 1–96 protocol (Part Number 4448274 Rev. A) ##############
########################################################################################################
>ABI Dynabead EcoP Oligo
CTGATCTAGAGGTACCGGATCCCAGCAGT
>ABI Solid3 Adapter A
CTGCCCCGGGTTCCTCATTCTCTCAGCAGCATG
>ABI Solid3 Adapter B - Multiplex Library PCR-1
CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT
>ABI Solid3 5' AMP Primer
CCACTACGCCTCCGCTTTCCTCTCTATG
>ABI Solid3 3' AMP Primer - Multiplex Library PCR-2
CTGCCCCGGGTTCCTCATTCT
>ABI Solid3 EF1 alpha Sense Primer
CATGTGTGTTGAGAGCTTC
>ABI Solid3 EF1 alpha Antisense Primer
GAAAACCAAAGTGGTCCAC
>ABI Solid3 GAPDH Forward Primer
TTAGCACCCCTGGCCAAGG
>ABI Solid3 GAPDH Reverse Primer
CTTACTCCTTGGAGGCCATG
>SOLID Multiplex Library P1 Adaptor
ATCACCGACTGCCCATAGAGAGGTT
########################################################################################################
### 15. Roche 454 Adaptors ######
### from http://nebc.nerc.ac.uk/bioinformatics/documentation/mira/html/mira_faq.html#section_5 ######
### http://sourceforge.net/apps/mediawiki/wgs-assembler/index.php?title=SffToCA ######
### ftp://ftp.ncbi.nih.gov/pub/UniVec/UniVec
########################################################################################################
>5' 454 adaptor
GCCTCCCTCGCGCCATCAGATCGTAGGCACCTGAAA
>3' 454 adaptor
GCCTTGCCAGCCCGCTCAGATTGATGGTGCCTACAG
>454 Adaptor A
CTGAGACAGGGAGGGAACAGATGGGACACGCAGGGATGAGATGG
>454 Adaptor B
CTGAGACACGCAACAGGGGATAGGCAAGGCACACAGGGGATAGG
>gnl|uv|NGB00599.1:1-47 Evrogen Mint 454 PCR Primer
ACGCAGAGTGGCCGAGGCGGCCTTTTGTCTTTTCTTCTGTTTCTTTT
>gnl|uv|NGB00385.1:1-44 454 FLX linker
GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
>gnl|uv|NGB00386.1:1-42 454 Titanium linker
TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
>gnl|uv|NGB00417.1:1-40 454 Life Sciences GS FLX Titanium MID-1 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACGAGTGCGT
>Ti-MID1-Aprime
ACGCACTCGTCTGAGTCGGAGA
>gnl|uv|NGB00418.1:1-40 454 Life Sciences GS FLX Titanium MID-2 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACGCTCGACA
>gnl|uv|NGB00419.1:1-40 454 Life Sciences GS FLX Titanium MID-3 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGACGCACTC
>gnl|uv|NGB00420.1:1-40 454 Life Sciences GS FLX Titanium MID-4 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGCACTGTAG
>gnl|uv|NGB00421.1:1-40 454 Life Sciences GS FLX Titanium MID-5 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATCAGACACG
>gnl|uv|NGB00422.1:1-40 454 Life Sciences GS FLX Titanium MID-6 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATATCGCGAG
>gnl|uv|NGB00423.1:1-40 454 Life Sciences GS FLX Titanium MID-7 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGTGTCTCTA
>gnl|uv|NGB00424.1:1-40 454 Life Sciences GS FLX Titanium MID-8 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCTCGCGTGTC
>gnl|uv|NGB00425.1:1-40 454 Life Sciences GS FLX Titanium MID-10 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCTCTATGCG
>gnl|uv|NGB00426.1:1-40 454 Life Sciences GS FLX Titanium MID-11 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGATACGTCT
>gnl|uv|NGB00427.1:1-40 454 Life Sciences GS FLX Titanium MID-13 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCATAGTAGTG
>gnl|uv|NGB00428.1:1-40 454 Life Sciences GS FLX Titanium MID-14 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGAGAGATAC
>gnl|uv|NGB00429.1:1-40 454 Life Sciences GS FLX Titanium MID-15 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATACGACGTA
>gnl|uv|NGB00430.1:1-40 454 Life Sciences GS FLX Titanium MID-16 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCACGTACTA
>gnl|uv|NGB00431.1:1-40 454 Life Sciences GS FLX Titanium MID-17 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGTCTAGTAC
>gnl|uv|NGB00432.1:1-40 454 Life Sciences GS FLX Titanium MID-18 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCTACGTAGC
>gnl|uv|NGB00433.1:1-40 454 Life Sciences GS FLX Titanium MID-19 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTGTACTACTC
>gnl|uv|NGB00434.1:1-40 454 Life Sciences GS FLX Titanium MID-20 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACGACTACAG
>gnl|uv|NGB00435.1:1-40 454 Life Sciences GS FLX Titanium MID-21 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGTAGACTAG
>gnl|uv|NGB00436.1:1-40 454 Life Sciences GS FLX Titanium MID-22 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTACGAGTATG
>gnl|uv|NGB00437.1:1-40 454 Life Sciences GS FLX Titanium MID-23 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTACTCTCGTG
>gnl|uv|NGB00438.1:1-40 454 Life Sciences GS FLX Titanium MID-24 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTAGAGACGAG
>gnl|uv|NGB00439.1:1-40 454 Life Sciences GS FLX Titanium MID-25 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTCGTCGCTCG
>gnl|uv|NGB00440.1:1-40 454 Life Sciences GS FLX Titanium MID-26 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACATACGCGT
>gnl|uv|NGB00441.1:1-40 454 Life Sciences GS FLX Titanium MID-27 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACGCGAGTAT
>gnl|uv|NGB00442.1:1-40 454 Life Sciences GS FLX Titanium MID-28 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACTACTATGT
>gnl|uv|NGB00443.1:1-40 454 Life Sciences GS FLX Titanium MID-29 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGACTGTACAGT
>gnl|uv|NGB00444.1:1-40 454 Life Sciences GS FLX Titanium MID-30 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGACTATACT
>gnl|uv|NGB00445.1:1-40 454 Life Sciences GS FLX Titanium MID-31 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGCGTCGTCT
>gnl|uv|NGB00446.1:1-40 454 Life Sciences GS FLX Titanium MID-32 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGAGTACGCTAT
>gnl|uv|NGB00447.1:1-40 454 Life Sciences GS FLX Titanium MID-33 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGATAGAGTACT
>gnl|uv|NGB00448.1:1-40 454 Life Sciences GS FLX Titanium MID-34 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCACGCTACGT
>gnl|uv|NGB00449.1:1-40 454 Life Sciences GS FLX Titanium MID-35 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCAGTAGACGT
>gnl|uv|NGB00450.1:1-40 454 Life Sciences GS FLX Titanium MID-36 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGCGACGTGACT
>gnl|uv|NGB00451.1:1-40 454 Life Sciences GS FLX Titanium MID-37 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTACACACACT
>gnl|uv|NGB00452.1:1-40 454 Life Sciences GS FLX Titanium MID-38 Adaptor A
CCATCTCATCCCTGCGTGTCTCCGACTCAGTACACGTGAT
>gnl|uv|NGB00453.1:1-40 454 Life Sciences GS FLX Titanium MID-39 Adaptor A