Commit f030c656 authored by Amine  GHOZLANE's avatar Amine GHOZLANE
Browse files

Add more adapter filtering to help users

parent 207eaa82
Pipeline #70041 passed with stages
in 150 minutes and 1 second
......@@ -931,10 +931,34 @@ shinyServer(function(input, output,session) {
fastaName = paste(tmp,paste(basename(file_path_sans_ext(json_name)),"_contaminant.fasta",sep=""),sep = .Platform$file.sep)
if(!file.exists(fastaName)) file.create(fastaName,showWarnings=FALSE)
if(input$PairedOrNot=="y"){seq =paste("#Seq1\n",input$R1primer,"\n \n","#Seq2\n",input$R2primer,sep="")}
if(input$PairedOrNot=="n"){seq =input$primerSingle}
if(!is.null(seq)) write(seq, file=fastaName)
if(input$PairedOrNot=="y"){seq =paste("\n>Seq1\n",input$R1primer,"\n \n",">Seq2\n",input$R2primer,sep="")}
if(input$PairedOrNot=="n"){seq =paste("\n>Seq1\n",input$primerSingle)}
if(!is.null(seq)){
known_adaptators=">poly-A
AAAAAAAAAAAAAAAAAAAA
>poly-C
CCCCCCCCCCCCCCCCCCCC
>poly-G
GGGGGGGGGGGGGGGGGGGG
>poly-T
TTTTTTTTTTTTTTTTTTTT
>Adapter 1
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
>Adapter 2
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PCR Primer 1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PCR Primer 2
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
>Genomic DNA Sequencing Primer
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PCR Primer 1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PCR Primer 2
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT"
seq = paste(known_adaptators, seq, sep="")
write(seq, file=fastaName)
}
})
......
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment