diff --git a/.gitlab-ci.yml b/.gitlab-ci.yml
index c86ee27e169770f8f3df8e9ab9d765fd3c472faf..8a1bc6ade6e8b2be06a94a336503a51051b9bbe1 100755
--- a/.gitlab-ci.yml
+++ b/.gitlab-ci.yml
@@ -83,6 +83,7 @@ unit-test-ubuntu18.04:
# - py.test test/test_unit/test_pangenome -vx
# - py.test test/test_unit/test_pangenome/test_protseqfunc.py -vx
# - py.test test/test_unit/test_pangenome/test_mmseq_func.py -vx
+ - py.test test/test_unit/test_utils.py -vx
- py.test test/test_unit/test_utils-pan.py -vx
- py.test test/test_unit/test_corepers -vx
- py.test test/test_unit/test_align/test_getseqs.py -vx
diff --git a/PanACoTA/utils.py b/PanACoTA/utils.py
index d40eb9c7bbf043665fcf898f42b7d0443d0a1cb5..e49c0b7c5f5111555de436c819db3dbacf2a023f 100755
--- a/PanACoTA/utils.py
+++ b/PanACoTA/utils.py
@@ -309,7 +309,7 @@ def run_cmd(cmd, error, eof=False, **kwargs):
call.wait()
retcode = call.returncode
except OSError:
- logger.error("error : {cmd} does not exist")
+ logger.error(f"error: {cmd} does not exist")
if eof:
sys.exit(1)
else:
@@ -399,14 +399,14 @@ def write_warning_skipped(skipped, do_format=False, prodigal_only=False, logfile
"current error log "
"(<output_directory>/PanACoTA-annotate_list_genomes[-date].log.err) to get more "
"information on the problems. Here are those "
- "genomes:\n{list_to_write}")
+ f"genomes:\n{list_to_write}")
else:
logger.info(f"WARNING: Some genomes could not be formatted. See {logfile}")
- logger.warning(("Some genomes were annotated by {0}, but could not be formatted, "
+ logger.warning((f"Some genomes were annotated by {soft}, but could not be formatted, "
"and are hence absent from your output database. Please look at "
"'<output_directory>/PanACoTA-annotate_list_genomes[-date].log.err' and "
".details files to get more information about why they could not be "
- "formatted.\n{1}").format(soft, list_to_write))
+ f"formatted.\n{list_to_write}"))
def write_genomes_info(genomes, kept_genomes, list_file, res_path, qc=False):
@@ -442,9 +442,9 @@ def write_genomes_info(genomes, kept_genomes, list_file, res_path, qc=False):
nb_disc = len(genomes) - len(kept_genomes)
# Log number of genomes discarded.
if not qc and nb_disc < 2:
- logger.info("{} genome was discarded.".format(nb_disc))
+ logger.info(f"{nb_disc} genome was discarded.")
elif not qc:
- logger.info("{} genomes were discarded.".format(nb_disc))
+ logger.info(f"{nb_disc} genomes were discarded.")
# Get input list file name (without path)
_, name_lst = os.path.split(list_file)
# if not QC, write discarded genomes to a file "discarded-[list_file].lst"
@@ -665,6 +665,7 @@ def read_genomes(list_file, name, date, dbpath, tmp_path):
"ignored when concatenating {}").format(file, genomes_inf))
# If there are files to concatenate, concatenate them
if to_concat:
+ print(to_concat)
genome_name = to_concat[0] + "-all.fna"
concat_file = os.path.join(tmp_path, genome_name)
to_concat = [os.path.join(dbpath, gname) for gname in to_concat]
@@ -723,11 +724,11 @@ def read_genomes_info(list_file, name, date=None, logger=None):
logger.info(f"Reading given information on your genomes in {list_file}")
genomes = {}
if name and date:
- spegenus = "{}.{}".format(name, date)
+ spegenus = f"{name}.{date}"
column_order = {} # Put the number of column corresponding to each field
if not os.path.isfile(list_file):
logger.error(f"ERROR: The info file {list_file} that you gave does not exist. "
- "Please provide the right path/name for this file.\nEnding program.")
+ "Please provide the right path/name for this file.\nEnding program.")
sys.exit(1)
message_no_header = (f"ERROR: It seems that your info file {list_file} does not have a "
"header, or this header does not have, at least, the required "
@@ -736,6 +737,9 @@ def read_genomes_info(list_file, name, date=None, logger=None):
with open(list_file, "r") as lff:
for line in lff:
line = line.strip()
+ # Ignore empty lines
+ if line == "":
+ continue
# Header line: Just get column number corresponding to each field
if "to_annotate" in line:
column_headers = line.split("\t")
@@ -745,7 +749,6 @@ def read_genomes_info(list_file, name, date=None, logger=None):
if len(found) != 4:
logger.error(message_no_header)
sys.exit(1)
- continue
# If no header found, error message and exit
if not column_order:
logger.error(message_no_header)
@@ -758,6 +761,8 @@ def read_genomes_info(list_file, name, date=None, logger=None):
infos = line.strip().split()
# Get genome name with its path to db_dir
gpath = infos[column_order["to_annotate"]]
+ gfile = os.path.basename(gpath)
+ gname = os.path.splitext(gfile)[0]
gsize = int(infos[column_order["gsize"]])
gl90 = int(infos[column_order["L90"]])
gcont = int(infos[column_order["nb_conts"]])
@@ -769,7 +774,7 @@ def read_genomes_info(list_file, name, date=None, logger=None):
continue
# If no value for at least 1 field, warning message and ignore genome
except IndexError:
- logger.error("ERROR: Check that all fields of {list_file} are filled in each "
+ logger.error(f"ERROR: Check that all fields of {list_file} are filled in each "
"line (can be 'NA')")
sys.exit(1)
# Could we find genome file?
@@ -1128,14 +1133,14 @@ def get_genome_contigs_and_rename(gembase_name, gpath, outfile):
# - write header ("<contig name> <size>") to replicon file
if prev_cont:
cont = "\t".join([prev_cont, str(cont_size)]) + "\n"
- sizes.append(cont)
+ sizes.append(cont.strip())
cor = "\t".join([prev_cont, prev_orig_name])
contigs.append(cor)
grf.write(cont)
grf.write(seq)
prev_cont = ">" + gembase_name + "." + str(contig_num).zfill(4)
- prev_orig_name = line
+ prev_orig_name = line.strip()
contig_num += 1
cont_size = 0
seq = ""
@@ -1145,7 +1150,7 @@ def get_genome_contigs_and_rename(gembase_name, gpath, outfile):
cont_size += len(line.strip())
# Write last contig
cont = "\t".join([prev_cont, str(cont_size)]) + "\n"
- sizes.append(cont)
+ sizes.append(cont.strip())
cor = "\t".join([prev_cont, prev_orig_name])
contigs.append(cor)
grf.write(cont)
@@ -1227,7 +1232,7 @@ def write_list(list_names, fileout):
"""
with open(fileout, "w") as fo:
for genome in list_names:
- fo.write(genome + "\n")
+ fo.write(str(genome) + "\n")
def list_to_str(list, sep='\t'):
diff --git a/test/data/annotate/exp_files/baseline/test_plot_dist.png b/test/data/annotate/exp_files/baseline/test_plot_dist.png
index 12028ada154d812cbdaaf18975867c4655446b21..c73ea07a1bef4986377ffbc35a205c06a35b250a 100755
Binary files a/test/data/annotate/exp_files/baseline/test_plot_dist.png and b/test/data/annotate/exp_files/baseline/test_plot_dist.png differ
diff --git a/test/data/annotate/exp_files/res_H299_H561-ESCO00005.fna b/test/data/annotate/exp_files/res_H299_H561-ESCO00005.fna
index e9017c690e4148c69a55ca6cf5a057702bbfd13e..6cacdcc139a085115e60811850e6a4badac7f04f 100755
--- a/test/data/annotate/exp_files/res_H299_H561-ESCO00005.fna
+++ b/test/data/annotate/exp_files/res_H299_H561-ESCO00005.fna
@@ -1,4 +1,4 @@
->ESCO.0216.00005.0001
+>ESCO.0216.00005.0001 3480
AGCAGCACGCTTTTTAATCCGTCCACCGGACCTTCAACCGGCCCTTCGCTGATGGCATCG
ATCACACTCAGCAGCTGCGTGGACTTCAGGTTGTCCTTCGCTTCGCGCGGGGTATGCCCC
TTACTGCTGCCTTTACCCATTCGTCATGCTCCATAAACGATAAAACCGCCCGGAGGCGGT
@@ -57,7 +57,7 @@ ATCATTCAGAGCCTGCATTTTCTCTTGAAAAACATGATCTGACATTCCACGGGATTTATC
TGCATAGTCACGTTCAAGTTGCAGACGCTGATTGTTATATCCATGTTCAATCCGCAGTAA
TTCCTGCTGGCGTTGCTGATTTTTATCGCCAACCCCATAACCAGCAATCTGAATATCATA
CCCCTGCTGACGATTATCAATCGAAGCCTGCAATGAATCACGCCATGCTGTTATTTCGGC
->ESCO.0216.00005.0002
+>ESCO.0216.00005.0002 7080
AGCAGCACGCTTTTTAATCCATCCACCGGACCTTCAACCGGCCCTTCGCTGATGGCATCG
ATCACACTCAGCAGCTGCGTGGACTTCAGGTTGTCCTTCGCTTCGCGCGGGGTATGCCCC
TTACTGCTGCCTTTACCCATTCGTCATGCTCCATAAACGATAAAACCGCCCGGAGGCGGT
@@ -176,7 +176,7 @@ ATCCACGAATCCAGCTCTGAATCCGGCACCTGAGCAGGCAGGAAAACTTCAATATGCAGC
TCTGCCTGCCAGGTATCGCTGTCCAGCTCTTCGCCCGTGTATTCAGCGCCGGTGAGATAA
ACGGCAATTGCCGGAAAATCTTCCTCATCAAAAACAGCGGGGCGACCATCAAAAAGCGTC
GCCCCGGTGTCATGCTTCTCCAGTGCATCCAGTACGGCTGCACGGAGTTCAGTATGTTTC
->ESCO.0216.00005.0003
+>ESCO.0216.00005.0003 2583
ATCATACAGTCATTTGTTAATATCTGTCTGACAAGGTACCAAGCAGAAAATAGGGTTAAG
ATATTTGTAGCCATAAATATCATATATACGTTAGCCTATTTTTTTGGGGTTTTATATTCC
TTATTTATAGATCACTGGGATAATGTTTGGAAAAATATTATTTTGTTTTATGTGCTTACA
diff --git a/test/data/annotate/exp_files/res_test_write_discard.lst b/test/data/annotate/exp_files/res_test_write_discard.lst
index ed71bc47a33350d601033dbd7f213446268db47f..9ae80dbc8e0f68e5276b6de3539c56cfcf2cea8a 100755
--- a/test/data/annotate/exp_files/res_test_write_discard.lst
+++ b/test/data/annotate/exp_files/res_test_write_discard.lst
@@ -1,3 +1,3 @@
-orig_name gsize nb_conts L90
-genome1 4564855 156 40
-genome2 6549 16 8
+orig_name to_annotate gsize nb_conts L90
+genome1 genome1 4564855 156 40
+genome2 genome2 6549 16 8
diff --git a/test/data/annotate/exp_files/res_test_write_discard_1genome.lst b/test/data/annotate/exp_files/res_test_write_discard_1genome.lst
new file mode 100644
index 0000000000000000000000000000000000000000..e645589ef2f802d30de5ec30c9a4d1722f901ad0
--- /dev/null
+++ b/test/data/annotate/exp_files/res_test_write_discard_1genome.lst
@@ -0,0 +1,2 @@
+orig_name to_annotate gsize nb_conts L90
+genome1 genome1 4564855 156 40
diff --git a/test/data/annotate/exp_files/res_test_write_info_qc.lst b/test/data/annotate/exp_files/res_test_write_info_qc.lst
index 69e6000582c9053addae5ed37391e8ce4447b6cb..5d303a892f40fb9147450422e4cdb4074d0dba5a 100755
--- a/test/data/annotate/exp_files/res_test_write_info_qc.lst
+++ b/test/data/annotate/exp_files/res_test_write_info_qc.lst
@@ -1,6 +1,6 @@
-orig_name gsize nb_conts L90
-genome3 9876546 6 2
-genome1 4564855 156 40
-B2_A3_5.fasta-problems 456464645 5 1
-genome2 6549 16 8
-H299_H561.fasta 12656 3 1
+orig_name to_annotate gsize nb_conts L90
+H299_H561.fasta H299_H561.fasta 12656 3 1
+B2_A3_5.fasta-problems B2_A3_5.fasta-problems 456464645 5 1
+genome1 genome1 4564855 156 40
+genome2 genome2 6549 16 8
+genome3 genome3 9876546 6 2
diff --git a/test/data/annotate/exp_files/res_test_write_lstinfo.lst b/test/data/annotate/exp_files/res_test_write_lstinfo.lst
index 4d6d57c63f5b77ae5aeed4fb3a7d7aacd51c9ce2..750d1ce14ed94c5649cfe7d14fae95c86ad710f9 100755
--- a/test/data/annotate/exp_files/res_test_write_lstinfo.lst
+++ b/test/data/annotate/exp_files/res_test_write_lstinfo.lst
@@ -1,6 +1,6 @@
-gembase_name orig_name gsize nb_conts L90
-genome.0417.00001 genome3 9876546 6 2
-genome.0417.00008 genome1 4564855 156 40
-toto.0417.00006 B2_A3_5.fasta-problems 456464645 5 1
-toto.0417.00008 genome2 6549 16 8
-toto.0417.00010 H299_H561.fasta 12656 3 1
+gembase_name orig_name to_annotate gsize nb_conts L90
+toto.0417 H299_H561.fasta test/data/annotate/genomes/H299_H561.fasta 12656 3 1
+toto.0417 B2_A3_5.fasta-problems test/data/annotate/genomes/B2_A3_5.fasta-problems 456464645 5 1
+toto.0417 genome3 test/data/annotate/genomes/genome3 9876546 6 2
+toto.0417 genome2 test/data/annotate/genomes/genome2 6549 16 8
+toto.0417 genome1 test/data/annotate/genomes/genome1 4564855 156 40
diff --git a/test/data/annotate/test_files/list_genomes-multi-files.txt b/test/data/annotate/test_files/list_genomes-multi-files.txt
index 8a409cefb4f72f475197e0e983990932437ca8b8..1381fc6ebcbdfcb900c0fbe180153863408f2db5 100755
--- a/test/data/annotate/test_files/list_genomes-multi-files.txt
+++ b/test/data/annotate/test_files/list_genomes-multi-files.txt
@@ -1,4 +1,4 @@
-A_H738.fasta B2_A3_5.fasta-split5N.fna-gembase.fna
+A_H738.fasta B2_A3_5.fasta-split5N.fna-short-contig.fna
H299_H561.fasta genome6.fasta genome.fna ::ABCD
genome2.fasta::TOTO
@@ -9,4 +9,4 @@ genome4.fasta :: TOTO.
genome5.fasta :: TOTO.0114
-toto.fst toto.fasta genome.fst
\ No newline at end of file
+toto.fst toto.fasta genome.fst
diff --git a/test/data/annotate/test_files/lstinfo-miss-1genome.lst b/test/data/annotate/test_files/lstinfo-miss-1genome.lst
new file mode 100644
index 0000000000000000000000000000000000000000..59693cccdf2ed15c02478883f0d0d58916b921d0
--- /dev/null
+++ b/test/data/annotate/test_files/lstinfo-miss-1genome.lst
@@ -0,0 +1,6 @@
+to_annotate toto L90 gsize nb_conts
+test/data/annotate/genomes/genome1.fasta wrong 5 800 6
+data/annotate/genomes/A_H738-and-B2_A3_5.fna ignored 6 7000 78
+
+test/data/annotate/genomes/genome7.fasta ignored_too 65 79705 80
+
diff --git a/test/data/annotate/test_files/lstinfo-no-genome.lst b/test/data/annotate/test_files/lstinfo-no-genome.lst
new file mode 100644
index 0000000000000000000000000000000000000000..882948f9d3d612347ddeed41cf03b0a52749e9e8
--- /dev/null
+++ b/test/data/annotate/test_files/lstinfo-no-genome.lst
@@ -0,0 +1,6 @@
+to_annotate toto L90 gsize nb_conts
+data/annotate/genomes/genome1.fasta wrong 5 800 6
+test/annotate/genomes/A_H738-and-B2_A3_5.fna ignored 6 7000 78
+
+test/data/genomes/genome7.fasta ignored_too 65 79705 80
+
diff --git a/test/data/annotate/test_files/lstinfo-no-header.lst b/test/data/annotate/test_files/lstinfo-no-header.lst
new file mode 100644
index 0000000000000000000000000000000000000000..c1545b2b40a6a19371c50043b22f680f8e4f1731
--- /dev/null
+++ b/test/data/annotate/test_files/lstinfo-no-header.lst
@@ -0,0 +1 @@
+toto toti 4 5 5
diff --git a/test/data/annotate/test_files/lstinfo-not-all-filled.lst b/test/data/annotate/test_files/lstinfo-not-all-filled.lst
new file mode 100644
index 0000000000000000000000000000000000000000..b8f8bd9d9afde9d3ce0600a4939e4e29b283f305
--- /dev/null
+++ b/test/data/annotate/test_files/lstinfo-not-all-filled.lst
@@ -0,0 +1,6 @@
+to_annotate toto L90 gsize nb_conts
+test/data/annotate/genomes/genome1.fasta wrong 800 6
+test/data/annotate/genomes/A_H738-and-B2_A3_5.fna ignored 6 7000 78
+
+test/data/annotate/genomes/genome7.fasta ignored_too 65 79705 80
+
diff --git a/test/data/annotate/test_files/lstinfo-not-int-nbcont.lst b/test/data/annotate/test_files/lstinfo-not-int-nbcont.lst
new file mode 100644
index 0000000000000000000000000000000000000000..ac9accfb909c03b7678ae4be60c4cd6eaa99cc39
--- /dev/null
+++ b/test/data/annotate/test_files/lstinfo-not-int-nbcont.lst
@@ -0,0 +1,6 @@
+to_annotate toto L90 gsize nb_conts
+test/data/annotate/genomes/genome1.fasta wrong 5 800 6
+test/data/annotate/genomes/A_H738-and-B2_A3_5.fna ignored 6 7000 "78"
+
+test/data/annotate/genomes/genome7.fasta ignored_too 65 79705 80
+
diff --git a/test/data/annotate/test_files/lstinfo-wrong-header.lst b/test/data/annotate/test_files/lstinfo-wrong-header.lst
new file mode 100644
index 0000000000000000000000000000000000000000..6f1387f3ef0c89c38cb5a3ab0619d45a2b1d7ca5
--- /dev/null
+++ b/test/data/annotate/test_files/lstinfo-wrong-header.lst
@@ -0,0 +1,3 @@
+to_annotate nb_conts L90
+toto toti 4 5 5
+
diff --git a/test/data/annotate/test_files/lstinfo.lst b/test/data/annotate/test_files/lstinfo.lst
new file mode 100644
index 0000000000000000000000000000000000000000..3938c15933fff9c0e994ffda133cf45e5520b97b
--- /dev/null
+++ b/test/data/annotate/test_files/lstinfo.lst
@@ -0,0 +1,6 @@
+to_annotate toto L90 gsize nb_conts
+test/data/annotate/genomes/genome1.fasta wrong 5 800 6
+test/data/annotate/genomes/A_H738-and-B2_A3_5.fna ignored 6 7000 78
+
+test/data/annotate/genomes/genome7.fasta ignored_too 65 79705 80
+
diff --git a/test/test_unit/test_utils.py b/test/test_unit/test_utils.py
index 4a0240c5c1152088eeaed2e7aec674ee91874315..c8a7f1645db3e85ce6dfc7b5940398c5089082a0 100755
--- a/test/test_unit/test_utils.py
+++ b/test/test_unit/test_utils.py
@@ -5,17 +5,40 @@
Unit tests for utils.py
"""
-import genomeAPCAT.utils as utils
+import PanACoTA.utils as utils
+import test.test_unit.utilities_for_tests as utilities
import pytest
import os
import logging
import shutil
import matplotlib
+import argparse
matplotlib.use('AGG')
# Define variables used by several tests
-BASELINE_DIR = os.path.join("..", "data", "annotate", "exp_files", "baseline")
+DATA_DIR = os.path.join("test", "data", "annotate")
+BASELINE_DIR = os.path.abspath(os.path.join(DATA_DIR, "exp_files", "baseline"))
+GENEPATH = os.path.join(DATA_DIR, "generated_by_unit-tests")
+LOGFILE_BASE = "test_prokka"
+LOGFILES = [LOGFILE_BASE + ext for ext in [".log", ".log.debug", ".log.details", ".log.err"]]
+
+@pytest.fixture(autouse=True)
+def setup_teardown_module():
+ """
+ Remove log files at the end of this test module
+ """
+ # Init logger to level detail (15)
+ utils.init_logger(LOGFILE_BASE, logging.DEBUG, 'test_utils', verbose=1)
+ os.mkdir(GENEPATH)
+ print("setup")
+
+ yield
+ for f in LOGFILES:
+ if os.path.exists(f):
+ os.remove(f)
+ shutil.rmtree(GENEPATH)
+ print("teardown")
# Start tests
@@ -39,115 +62,130 @@ def test_plot_dist():
"""
Plot a given distribution, and check that output is as expected
"""
+ logger = logging.getLogger("test_utils")
values = [1, 1, 1, 1, 1, 1, 2, 2, 2, 3, 3, 10]
limit = 3
res_dir = os.path.join("test", "data", "annotate")
- os.makedirs(res_dir, exist_ok=True)
# reffile = os.path.join("test", "data", "annotate", "exp_files", "res_plot_distr.png")
title = "Distribution test"
text = "Max L90 ="
- myfig = utils.plot_distr(values, limit, title, text)
+ myfig = utils.plot_distr(values, limit, title, text, logger)
return myfig
-def test_skipped_prokka(capsys):
+def test_skipped_prokka_prodigal(caplog):
"""
Test that when the list of skipped genomes (because of prokka run) is not empty,
it writes the right message.
"""
- logfile_base = "test_prokka"
- utils.init_logger(logfile_base, 0, '', verbose=1)
+ caplog.set_level(logging.DEBUG)
skipped = ["toto", "genome", "genome2"]
utils.write_warning_skipped(skipped)
- out, err = capsys.readouterr()
- assert ("Prokka had problems while annotating some genomes, or did not "
+ assert ("prokka had problems while annotating some genomes, or did not "
"find any gene. Hence, they are not "
- "formatted, and absent from your output database. Please look at their "
- "Prokka logs (<output_directory>/tmp_files/<genome_name>-prokka.log) and "
- "to the current error log (<output_directory>/<input_filename>.log.err)"
- " to get more information, and run again to annotate and format them. "
- "Here are the genomes (problem with prokka or no "
- "gene found):") in err
- assert ("\\n\\t- toto\\n\\t- genome\\n\\t- genome2" in err or
- "\n\t- toto\n\t- genome\n\t- genome2" in err)
- os.remove(logfile_base + ".log")
- os.remove(logfile_base + ".log.details")
- os.remove(logfile_base + ".log.err")
+ "formatted, and absent from your output database. Please look at the "
+ "current error log (<output_directory>/PanACoTA-annotate_list_genomes[-date].log.err) "
+ "to get more information on the problems. "
+ "Here are those genomes:") in caplog.text
+ assert "\n\t- toto\n\t- genome\n\t- genome2" in caplog.text
+ utils.write_warning_skipped(skipped, prodigal_only=True)
+ assert ("prodigal had problems while annotating some genomes, or did not "
+ "find any gene. Hence, they are not "
+ "formatted, and absent from your output database. Please look at the "
+ "current error log (<output_directory>/PanACoTA-annotate_list_genomes[-date].log.err) "
+ "to get more information on the problems. "
+ "Here are those genomes:") in caplog.text
+ assert "\n\t- toto\n\t- genome\n\t- genome2" in caplog.text
-def test_skipped_format(capsys):
+def test_skipped_format(caplog):
"""
Test that when the list of skipped genomes (format step could not run) is not empty,
it writes the right message.
"""
- logfile_base = "test_prokka"
- utils.init_logger(logfile_base, 0, '', verbose=1)
+ caplog.set_level(logging.DEBUG)
skipped_format = ["toto", "genome", "genome2"]
utils.write_warning_skipped(skipped_format, do_format=True)
- out, err = capsys.readouterr()
assert ("Some genomes were annotated by prokka, but could not be formatted, "
- "and are hence absent from your output database. Please look at log "
- "files to get more information about why they could not be ") in err
- assert ("formatted.\n\t- toto\n\t- genome\n\t- genome2\n" in err or
- "formatted.\\n\\t- toto\\n\\t- genome\\n\\t- genome2" in err)
- os.remove(logfile_base + ".log")
- os.remove(logfile_base + ".log.details")
- os.remove(logfile_base + ".log.err")
+ "and are hence absent from your output database. Please look at "
+ "'<output_directory>/PanACoTA-annotate_list_genomes[-date].log.err' and .details "
+ "files to get more information about why they could not be formatted") in caplog.text
+ assert ("\n\t- toto\n\t- genome\n\t- genome2\n") in caplog.text
+
-def test_write_discarded():
+def test_write_discarded(caplog):
"""
Test that the list of discarded genomes is written as expected.
"""
+ caplog.set_level(logging.DEBUG)
gnames = ["H299_H561.fasta", "B2_A3_5.fasta-problems", "genome1", "genome2", "genome3"]
- gpaths = [os.path.join("test", "data", "annotate", "genomes", name) for name in gnames]
- genomes = {gnames[0]: ["toto.0417", gpaths[0], 12656, 3, 1],
- gnames[1]: ["toto.0417", gpaths[1], 456464645, 5, 1],
- gnames[2]: ["toto.0417", gpaths[2], 4564855, 156, 40],
- gnames[3]: ["toto.0417", gpaths[3], 6549, 16, 8],
- gnames[4]: ["toto.0417", gpaths[4], 9876546, 6, 2]
+ gpaths = [os.path.join(DATA_DIR, "genomes", name) for name in gnames]
+ genomes = {gnames[0]: ["toto.0417", gpaths[0], gpaths[0], 12656, 3, 1],
+ gnames[1]: ["toto.0417", gpaths[1], gpaths[1], 456464645, 5, 1],
+ gnames[2]: ["toto.0417", gpaths[2], gpaths[2], 4564855, 156, 40],
+ gnames[3]: ["toto.0417", gpaths[3], gpaths[3], 6549, 16, 8],
+ gnames[4]: ["toto.0417", gpaths[4], gpaths[4], 9876546, 6, 2]
}
kept_genomes = ["H299_H561.fasta", "B2_A3_5.fasta-problems", "genome3"]
- list_file = os.path.join("test", "data", "annotate", "list_genomes.txt")
- res_path = os.path.join("test", "data", "annotate")
- utils.write_discarded(genomes, kept_genomes, list_file, res_path)
- outfile = os.path.join("test", "data", "annotate", "discarded-list_genomes.lst")
- exp_file = os.path.join("test", "data", "annotate", "exp_files", "res_test_write_discard.lst")
+ list_file = os.path.join("titi", "toto", "list_genomes.txt")
+ utils.write_genomes_info(genomes, kept_genomes, list_file, GENEPATH, qc=False)
+ outfile = os.path.join(GENEPATH, "discarded-list_genomes.lst")
+ exp_file = os.path.join(DATA_DIR, "exp_files", "res_test_write_discard.lst")
+ assert "2 genomes were discarded" in caplog.text
+ # There is no order in the discarded file. So, just check that the lines
+ # written are as expected.
+ assert utilities.compare_file_content(outfile, exp_file)
+
+
+def test_write_discarded_1genome(caplog):
+ """
+ Test that the list of discarded genomes is written as expected.
+ """
+ caplog.set_level(logging.DEBUG)
+ gnames = ["H299_H561.fasta", "B2_A3_5.fasta-problems", "genome1", "genome2", "genome3"]
+ gpaths = [os.path.join(DATA_DIR, "genomes", name) for name in gnames]
+ genomes = {gnames[0]: ["toto.0417", gpaths[0], gpaths[0], 12656, 3, 1],
+ gnames[1]: ["toto.0417", gpaths[1], gpaths[1], 456464645, 5, 1],
+ gnames[2]: ["toto.0417", gpaths[2], gpaths[2], 4564855, 156, 40],
+ gnames[3]: ["toto.0417", gpaths[3], gpaths[3], 6549, 16, 8],
+ gnames[4]: ["toto.0417", gpaths[4], gpaths[4], 9876546, 6, 2]
+ }
+ kept_genomes = ["H299_H561.fasta", "B2_A3_5.fasta-problems", "genome3", "genome2"]
+ list_file = os.path.join("titi", "toto", "list_genomes.txt")
+ utils.write_genomes_info(genomes, kept_genomes, list_file, GENEPATH, qc=False)
+ outfile = os.path.join(GENEPATH, "discarded-list_genomes.lst")
+ exp_file = os.path.join(DATA_DIR, "exp_files", "res_test_write_discard_1genome.lst")
+ assert "1 genome was discarded" in caplog.text
# There is no order in the discarded file. So, just check that the lines
# written are as expected.
- with open(outfile, "r") as outf, open(exp_file, "r") as expf:
- exp_lines = expf.readlines()
- out_lines = outf.readlines()
- assert set(out_lines) == set(exp_lines)
- os.remove(outfile)
+ assert utilities.compare_file_content(outfile, exp_file)
-def test_write_discarded_qc():
+def test_write_discarded_qc(caplog):
"""
Test that the list with information on all genomes when we run with QC only is
written as expected
"""
+ caplog.set_level(logging.DEBUG)
gnames = ["H299_H561.fasta", "B2_A3_5.fasta-problems", "genome1", "genome2", "genome3"]
- gpaths = [os.path.join("test", "data", "annotate", "genomes", name) for name in gnames]
- genomes = {gnames[0]: ["toto.0417", gpaths[0], 12656, 3, 1],
- gnames[1]: ["toto.0417", gpaths[1], 456464645, 5, 1],
- gnames[2]: ["toto.0417", gpaths[2], 4564855, 156, 40],
- gnames[3]: ["toto.0417", gpaths[3], 6549, 16, 8],
- gnames[4]: ["toto.0417", gpaths[4], 9876546, 6, 2]
+ gpaths = [os.path.join(DATA_DIR, "genomes", name) for name in gnames]
+ genomes = {gnames[0]: ["toto.0417", gpaths[0], gpaths[0], 12656, 3, 1],
+ gnames[1]: ["toto.0417", gpaths[1], gpaths[1], 456464645, 5, 1],
+ gnames[2]: ["toto.0417", gpaths[2], gpaths[2], 4564855, 156, 40],
+ gnames[3]: ["toto.0417", gpaths[3], gpaths[3], 6549, 16, 8],
+ gnames[4]: ["toto.0417", gpaths[4], gpaths[4], 9876546, 6, 2]
}
kept_genomes = []
- list_file = os.path.join("test", "data", "annotate", "list_genomes.txt")
- res_path = os.path.join("test", "data", "annotate")
- utils.write_discarded(genomes, kept_genomes, list_file, res_path, qc=True)
- outfile = os.path.join("test", "data", "annotate", "info-genomes-list_genomes.lst")
- exp_file = os.path.join("test", "data", "annotate", "exp_files", "res_test_write_info_qc.lst")
+ list_file = os.path.join(DATA_DIR, "list_genomes.txt")
+ utils.write_genomes_info(genomes, kept_genomes, list_file, GENEPATH, qc=True)
+ outfile = os.path.join(GENEPATH, "ALL-GENOMES-info-list_genomes.lst")
+ exp_file = os.path.join(DATA_DIR, "exp_files", "res_test_write_info_qc.lst")
+ assert ("Writing information on genomes in "
+ "test/data/annotate/generated_by_unit-tests/ALL-GENOMES-info-list_genomes.lst") in caplog.text
# There is no order in the discarded file. So, just check that the lines
# written are as expected.
- with open(outfile, "r") as outf, open(exp_file, "r") as expf:
- exp_lines = expf.readlines()
- out_lines = outf.readlines()
- assert set(out_lines) == set(exp_lines)
- os.remove(outfile)
+ assert utilities.compare_file_content(outfile, exp_file)
def test_write_discarded_empty():
@@ -157,40 +195,38 @@ def test_write_discarded_empty():
"""
genomes = {}
kept_genomes = ["H299_H561.fasta", "B2_A3_5.fasta-problems", "genome3"]
- list_file = os.path.join("test", "data", "annotate", "list_genomes.txt")
- res_path = os.path.join("test", "data", "annotate")
- utils.write_discarded(genomes, kept_genomes, list_file, res_path)
- outfile = os.path.join("test", "data", "annotate", "discarded-list_genomes.lst")
+ list_file = os.path.join(DATA_DIR, "list_genomes.txt")
+ utils.write_genomes_info(genomes, kept_genomes, list_file, GENEPATH)
+ outfile = os.path.join(GENEPATH, "discarded-list_genomes.lst")
with open(outfile, "r") as outf:
all_lines = outf.readlines()
assert len(all_lines) == 1
- assert all_lines[0] == "orig_name\tgsize\tnb_conts\tL90\n"
- os.remove(outfile)
+ assert all_lines[0] == "orig_name\tto_annotate\tgsize\tnb_conts\tL90\n"
-def test_write_discarded_all_kept():
+def test_write_discarded_all_kept(caplog):
"""
Test that when all genomes are kept, the discarded lst file only contains the
header line.
"""
+ caplog.set_level(logging.DEBUG)
gnames = ["H299_H561.fasta", "B2_A3_5.fasta-problems", "genome1", "genome2", "genome3"]
- gpaths = [os.path.join("test", "data", "annotate", "genomes", name) for name in gnames]
- genomes = {gnames[0]: ["toto.0417", gpaths[0], 12656, 3, 1],
- gnames[1]: ["toto.0417", gpaths[1], 456464645, 5, 1],
- gnames[2]: ["toto.0417", gpaths[2], 4564855, 156, 40],
- gnames[3]: ["toto.0417", gpaths[3], 6549, 16, 8],
- gnames[4]: ["toto.0417", gpaths[4], 9876546, 6, 2]
+ gpaths = [os.path.join(DATA_DIR, "genomes", name) for name in gnames]
+ genomes = {gnames[0]: ["toto.0417", gpaths[0], gpaths[0], 12656, 3, 1],
+ gnames[1]: ["toto.0417", gpaths[1], gpaths[1], 456464645, 5, 1],
+ gnames[2]: ["toto.0417", gpaths[2], gpaths[2], 4564855, 156, 40],
+ gnames[3]: ["toto.0417", gpaths[3], gpaths[3], 6549, 16, 8],
+ gnames[4]: ["toto.0417", gpaths[4], gpaths[4], 9876546, 6, 2]
}
kept_genomes = ["H299_H561.fasta", "B2_A3_5.fasta-problems", "genome3", "genome2", "genome1"]
- list_file = os.path.join("test", "data", "annotate", "list_genomes.txt")
- res_path = os.path.join("test", "data", "annotate")
- utils.write_discarded(genomes, kept_genomes, list_file, res_path)
- outfile = os.path.join("test", "data", "annotate", "discarded-list_genomes.lst")
+ list_file = os.path.join(DATA_DIR, "list_genomes.txt")
+ utils.write_genomes_info(genomes, kept_genomes, list_file, GENEPATH)
+ outfile = os.path.join(GENEPATH, "discarded-list_genomes.lst")
with open(outfile, "r") as outf:
all_lines = outf.readlines()
assert len(all_lines) == 1
- assert all_lines[0] == "orig_name\tgsize\tnb_conts\tL90\n"
- os.remove(outfile)
+ assert all_lines[0] == "orig_name\tto_annotate\tgsize\tnb_conts\tL90\n"
+ assert "0 genome was discarded" in caplog.text
def test_write_lstinfo():
@@ -198,22 +234,18 @@ def test_write_lstinfo():
Test that lstinfo file is written as expected.
"""
gnames = ["H299_H561.fasta", "B2_A3_5.fasta-problems", "genome1", "genome2", "genome3"]
- gpaths = [os.path.join("test", "data", "annotate", "genomes", name) for name in gnames]
- genomes = {gnames[0]: ["toto.0417.00010", gpaths[0], 12656, 3, 1],
- gnames[1]: ["toto.0417.00006", gpaths[1], 456464645, 5, 1],
- gnames[2]: ["genome.0417.00008", gpaths[2], 4564855, 156, 40],
- gnames[3]: ["toto.0417.00008", gpaths[3], 6549, 16, 8],
- gnames[4]: ["genome.0417.00001", gpaths[4], 9876546, 6, 2]
+ gpaths = [os.path.join(DATA_DIR, "genomes", name) for name in gnames]
+ genomes = {gnames[0]: ["toto.0417", gpaths[0], gpaths[0], 12656, 3, 1],
+ gnames[1]: ["toto.0417", gpaths[1], gpaths[1], 456464645, 5, 1],
+ gnames[2]: ["toto.0417", gpaths[2], gpaths[2], 4564855, 156, 40],
+ gnames[3]: ["toto.0417", gpaths[3], gpaths[3], 6549, 16, 8],
+ gnames[4]: ["toto.0417", gpaths[4], gpaths[4], 9876546, 6, 2]
}
- list_file = os.path.join("test", "data", "annotate", "list_genomes.txt")
- outdir = os.path.join("test", "data", "annotate")
- utils.write_lstinfo(list_file, genomes, outdir)
- outfile = os.path.join(outdir, "LSTINFO-list_genomes.lst")
- exp_file = os.path.join("test", "data", "annotate", "exp_files", "res_test_write_lstinfo.lst")
- with open(outfile, "r") as outf, open(exp_file, "r") as expf:
- for line_out, line_exp in zip(outf, expf):
- assert line_out == line_exp
- os.remove(outfile)
+ list_file = os.path.join("toto", "list_genomes.txt")
+ utils.write_lstinfo(list_file, genomes, GENEPATH)
+ outfile = os.path.join(GENEPATH, "LSTINFO-list_genomes.lst")
+ exp_file = os.path.join(DATA_DIR, "exp_files", "res_test_write_lstinfo.lst")
+ assert utilities.compare_order_content(outfile, exp_file)
def test_write_lstinfo_nogenome():
@@ -222,15 +254,13 @@ def test_write_lstinfo_nogenome():
only header.
"""
genomes = {}
- list_file = os.path.join("test", "data", "annotate", "list_genomes.txt")
- outdir = os.path.join("test", "data", "annotate")
- utils.write_lstinfo(list_file, genomes, outdir)
- outfile = os.path.join(outdir, "LSTINFO-list_genomes.lst")
+ list_file = os.path.join("toto", "list_genomes.txt")
+ utils.write_lstinfo(list_file, genomes, GENEPATH)
+ outfile = os.path.join(GENEPATH, "LSTINFO-list_genomes.lst")
with open(outfile, "r") as outf:
all_lines = outf.readlines()
assert len(all_lines) == 1
- assert all_lines[0] == "gembase_name\torig_name\tgsize\tnb_conts\tL90\n"
- os.remove(outfile)
+ assert all_lines[0] == "gembase_name\torig_name\tto_annotate\tgsize\tnb_conts\tL90\n"
def test_sort_gene():
@@ -241,7 +271,7 @@ def test_sort_gene():
genomes = ["genome.0417.00010", "toto.0417.00010", "genome1.0417.00002",
"genome.0417.00015", "totn.0417.00010", "genome.0417.00009",
"genome.0517.00001", "toto.0417.00011"]
- sorted_genomes = sorted(genomes, key=utils.sort_genomes)
+ sorted_genomes = sorted(genomes, key=utils.sort_genomes_by_name)
exp = ["genome.0517.00001", "genome.0417.00009", "genome.0417.00010",
"genome.0417.00015", "genome1.0417.00002", "totn.0417.00010",
"toto.0417.00010", "toto.0417.00011"]
@@ -261,7 +291,7 @@ def test_sort_gene_tuple():
"name6": ["genome.0417.00009", "path/to/genome", 123456, 50, 3],
"name7": ["genome.0517.00001", "path/to/genome", 123456, 50, 3],
"name8": ["toto.0417.00011", "path/to/genome", 123456, 50, 3], }
- sorted_genomes = sorted(genomes.items(), key=utils.sort_genomes)
+ sorted_genomes = sorted(genomes.items(), key=utils.sort_genomes_by_name)
exp = [("name7", genomes["name7"]), ("name6", genomes["name6"]),
("name1", genomes["name1"]), ("name4", genomes["name4"]),
("name3", genomes["name3"]), ("name5", genomes["name5"]),
@@ -275,18 +305,40 @@ def test_sort_gene_noformat():
genomes in alphabetical order
"""
# genomes = {genome_orig, [gembase, path, gsize, nbcont, L90]}
- genomes = {"name1": ["genome.0417.00010", "path/to/genome", 123456, 50, 3],
- "name2": ["toto.0417.00010", "path/to/genome", 123456, 50, 3],
- "name3": ["genome1.0417.00002", "path/to/genome", 123456, 50, 3],
- "name4": ["genome.0417.00015", "path/to/genome", 123456, 50, 3],
- "name5": ["mygenome.0416", "path/to/genome", 123456, 50, 3],
- "name6": ["genome.0417", "path/to/genome", 123456, 50, 3],
- "name7": ["genome.0517.00001", "path/to/genome", 123456, 50, 3],
+ genomes = {"name1": ["genome", "path/to/genome", 123456, 50, 3],
+ "name2": ["toto", "path/to/genome", 123456, 50, 3],
+ "name3": ["genome1 ", "path/to/genome", 123456, 50, 3],
+ "name4": ["genome1bis", "path/to/genome", 123456, 50, 3],
+ "name5": ["mygenome", "path/to/genome", 123456, 50, 3],
+ "name6": ["agenome_nogembase", "path/to/genome", 123456, 50, 3],
+ "name7": ["agenome_nogembase2", "path/to/genome", 123456, 50, 3],
"name8": ["toto.0417.00011", "path/to/genome", 123456, 50, 3], }
- sorted_genomes = sorted(genomes.items(), key=utils.sort_genomes)
- exp = [("name7", genomes["name7"]), ("name1", genomes["name1"]),
- ("name4", genomes["name4"]), ("name6", genomes["name6"]),
- ("name3", genomes["name3"]), ("name5", genomes["name5"]),
+ sorted_genomes = sorted(genomes.items(), key=utils.sort_genomes_by_name)
+ exp = [("name6", genomes["name6"]), ("name7", genomes["name7"]),
+ ("name1", genomes["name1"]), ("name3", genomes["name3"]),
+ ("name4", genomes["name4"]), ("name5", genomes["name5"]),
+ ("name2", genomes["name2"]), ("name8", genomes["name8"])]
+ assert sorted_genomes == exp
+
+
+def test_sort_genome_l90():
+ """
+ Test that when genomes are not in the gembase format, it returns
+ genomes in alphabetical order
+ """
+ # genomes = {genome_orig, [gembase, path, gsize, nbcont, L90]}
+ genomes = {"name1": ["genome", "path/to/genome", 123456, 1, 2],
+ "name2": ["toto", "path/to/genome", 123456, 100, 4],
+ "name3": ["genome1 ", "path/to/genome", 123456, 10, 2],
+ "name4": ["genome1bis", "path/to/genome", 123456, 11, 2],
+ "name5": ["mygenome", "path/to/genome", 123456, 8, 3],
+ "name6": ["agenome_nogembase", "path/to/genome", 123456, 3, 1],
+ "name7": ["agenome_nogembase2", "path/to/genome", 123456, 4, 1],
+ "name8": ["toto.0417.00011", "path/to/genome", 123456, 50, 5], }
+ sorted_genomes = sorted(genomes.items(), key=utils.sort_genomes_l90_nbcont)
+ exp = [("name6", genomes["name6"]), ("name7", genomes["name7"]),
+ ("name1", genomes["name1"]), ("name3", genomes["name3"]),
+ ("name4", genomes["name4"]), ("name5", genomes["name5"]),
("name2", genomes["name2"]), ("name8", genomes["name8"])]
assert sorted_genomes == exp
@@ -331,34 +383,33 @@ def test_sort_proteins_other_format():
assert sorted_prot == exp
-def test_sort_proteins_error_format1(capsys):
+def test_sort_proteins_error_format1(caplog):
"""
Test that when a protein name does not follow the format <alpha_num>_<num>,
it gives an error.
"""
+ caplog.set_level(logging.DEBUG)
proteins = ["ESCO.0417.00010.i0001_12354", "ESCO.0617.00001.i0001_005",
"ESCO.0517.00001.i0001_12354", "error-protein"]
with pytest.raises(SystemExit):
sorted(proteins, key=utils.sort_proteins)
- out, err = capsys.readouterr()
assert ("ERROR: Protein error-protein does not have the required format. It must contain, "
"at least <alpha-num>_<num_only>, and at best "
"<name>.<date>.<strain_num>.<contig_info>_<prot_num>. "
- "Please change its name.") in err
+ "Please change its name.") in caplog.text
-def test_read_genomes_nofile(capsys):
+def test_read_genomes_nofile(caplog):
"""
Test that when the genome list file provided does not exist, it
ends the program with an error message
"""
with pytest.raises(SystemExit):
utils.read_genomes("toto.txt", "TOTO", "0417", "db/path", "tmppath")
- out, err = capsys.readouterr()
- assert "ERROR: Your list file " in err
- assert "toto.txt" in err
- assert "does not exist. Please provide a list file." in err
- assert "Ending program." in err
+ assert "ERROR: Your list file " in caplog.text
+ assert "toto.txt" in caplog.text
+ assert "does not exist. Please provide a list file." in caplog.text
+ assert "Ending program." in caplog.text
def test_read_genomes_wrongname():
@@ -368,26 +419,23 @@ def test_read_genomes_wrongname():
"""
name = "ESCO"
date = "0417"
- dbpath = os.path.join("test", "data", "annotate", "genomes")
+ dbpath = os.path.join(DATA_DIR, "genomes")
tmppath = "tmppath"
- list_file = os.path.join("test", "data", "annotate", "test_files",
- "list_genomes-wrongNames.txt")
+ list_file = os.path.join(DATA_DIR, "test_files", "list_genomes-wrongNames.txt")
genomes = utils.read_genomes(list_file, name, date, dbpath, tmppath)
assert genomes == {}
-def test_read_genomes_ok(capsys):
+def test_read_genomes_ok(caplog):
"""
Test that when the list file contains genomes existing, it returns the expected list
of genomes
"""
- logfile_base = "test_utils"
- utils.init_logger(logfile_base, 0, '', verbose=1)
name = "ESCO"
date = "0417"
- dbpath = os.path.join("test", "data", "annotate", "genomes")
+ dbpath = os.path.join(DATA_DIR, "genomes")
tmppath = "tmppath"
- list_file = os.path.join("test", "data", "annotate", "test_files", "list_genomes.lst")
+ list_file = os.path.join(DATA_DIR, "test_files", "list_genomes.lst")
genomes = utils.read_genomes(list_file, name, date, dbpath, tmppath)
exp = {"A_H738.fasta": ["ESCO.0417"],
"B2_A3_5.fasta-split5N.fna-short-contig.fna": ["ESCO.0417"],
@@ -395,25 +443,19 @@ def test_read_genomes_ok(capsys):
"genome3.fasta": ["ESCO.0512"], "genome4.fasta": ["TOTO.0417"],
"genome5.fasta": ["TOTO.0114"]}
assert exp == genomes
- _, err = capsys.readouterr()
- assert "genome.fst genome file does not exist. It will be ignored." in err
- os.remove(logfile_base + ".log")
- os.remove(logfile_base + ".log.details")
- os.remove(logfile_base + ".log.err")
+ assert "genome.fst genome file does not exist. It will be ignored." in caplog.text
-def test_read_genomes_errors(capsys):
+def test_read_genomes_errors(caplog):
"""
Test that when the list file contains errors in name and date provided,
it returns the expected errors, and the expected genome list.
"""
- logfile_base = "test_utils"
- utils.init_logger(logfile_base, 0, '', verbose=1)
name = "ESCO"
date = "0417"
- dbpath = os.path.join("test", "data", "annotate", "genomes")
+ dbpath = os.path.join(DATA_DIR, "genomes")
tmppath = "tmppath"
- list_file = os.path.join("test", "data", "annotate", "test_files", "list_genomes-errors.txt")
+ list_file = os.path.join(DATA_DIR, "test_files", "list_genomes-errors.txt")
genomes = utils.read_genomes(list_file, name, date, dbpath, tmppath)
exp = {"A_H738.fasta": ["ESCO.0417"],
"B2_A3_5.fasta-split5N.fna-short-contig.fna": ["ESCO.0417"],
@@ -421,57 +463,50 @@ def test_read_genomes_errors(capsys):
"genome3.fasta": ["ESCO.0512"], "genome4.fasta": ["ESCO.0417"],
"genome5.fasta": ["ESCO.0417"]}
assert genomes == exp
- _, err = capsys.readouterr()
assert ("Invalid name/date given for genome A_H738.fasta. Only put "
"4 alphanumeric characters in your date and name. For "
"this genome, the default name (ESCO) and date (0417) will "
- "be used.") in err
- assert (
- "Invalid name abc given for genome B2_A3_5.fasta-split5N.fna-short-contig.fna. Only put "
+ "be used.") in caplog.text
+ assert ("Invalid name abc given for genome B2_A3_5.fasta-split5N.fna-short-contig.fna. Only put "
"4 alphanumeric characters in your date and name. For "
"this genome, the default name (ESCO) will "
- "be used.") in err
+ "be used.") in caplog.text
assert ("Invalid date 152 given for genome H299_H561.fasta. Only put "
"4 alphanumeric characters in your date and name. For "
"this genome, the default date (0417) will "
- "be used.") in err
+ "be used.") in caplog.text
assert ("Invalid date 1-03 given for genome genome2.fasta. Only put "
"4 alphanumeric characters in your date and name. For "
"this genome, the default date (0417) will "
- "be used.") in err
+ "be used.") in caplog.text
assert ("genome.fst genome file does not exist. "
- "It will be ignored.") in err
+ "It will be ignored.") in caplog.text
assert ("Invalid name a/b2 given for genome genome3.fasta. Only put "
"4 alphanumeric characters in your date and name. For "
"this genome, the default name (ESCO) will "
- "be used.") in err
+ "be used.") in caplog.text
assert ("Invalid name #esc given for genome genome5.fasta. Only put "
"4 alphanumeric characters in your date and name. For "
"this genome, the default name (ESCO) will "
- "be used.") in err
+ "be used.") in caplog.text
assert ("Invalid date 1_14 given for genome genome5.fasta. Only put "
"4 alphanumeric characters in your date and name. For "
"this genome, the default date (0417) will "
- "be used.") in err
- os.remove(logfile_base + ".log")
- os.remove(logfile_base + ".log.details")
- os.remove(logfile_base + ".log.err")
+ "be used.") in caplog.text
-def test_read_genomes_multi_files(capsys):
+def test_read_genomes_multi_files(caplog):
"""
Test that when the list file contains several filenames for 1 same genome,
it returns the expected genome list, the expected errors (when some genome
files do not exist) and the expected concatenated files.
"""
- logfile_base = "test_utils"
- utils.init_logger(logfile_base, 0, '', verbose=1)
name = "ESCO"
date = "0417"
- dbpath = os.path.join("test", "data", "annotate", "genomes")
- tmppath = os.path.join("test", "data", "annotate")
- list_file = os.path.join("test", "data", "annotate", "test_files",
- "list_genomes-multi-files.txt")
+ tmppath = os.path.join(GENEPATH, "tmppath")
+ os.mkdir(tmppath)
+ dbpath = os.path.join(DATA_DIR, "genomes")
+ list_file = os.path.join(DATA_DIR, "test_files", "list_genomes-multi-files.txt")
genomes = utils.read_genomes(list_file, name, date, dbpath, tmppath)
exp = {"A_H738.fasta-all.fna": ["ESCO.0417"],
"H299_H561.fasta-all.fna": ["ABCD.0417"], "genome2.fasta": ["TOTO.0417"],
@@ -479,124 +514,284 @@ def test_read_genomes_multi_files(capsys):
"genome5.fasta": ["TOTO.0114"]}
assert exp == genomes
# Check error messages
- _, err = capsys.readouterr()
assert ("genome.fna genome file does not exist. Its file will be ignored "
- "when concatenating ['H299_H561.fasta', 'genome6.fasta', 'genome.fna']") in err
- assert "genome.fst genome file does not exist. It will be ignored." in err
+ "when concatenating ['H299_H561.fasta', 'genome6.fasta', 'genome.fna']") in caplog.text
+ assert "genome.fst genome file does not exist. It will be ignored." in caplog.text
assert ("toto.fst genome file does not exist. Its file will be ignored "
- "when concatenating ['toto.fst', 'toto.fasta', 'genome.fst']") in err
+ "when concatenating ['toto.fst', 'toto.fasta', 'genome.fst']") in caplog.text
assert ("toto.fasta genome file does not exist. Its file will be ignored "
- "when concatenating ['toto.fst', 'toto.fasta', 'genome.fst']") in err
+ "when concatenating ['toto.fst', 'toto.fasta', 'genome.fst']") in caplog.text
assert ("genome.fst genome file does not exist. Its file will be ignored "
- "when concatenating ['toto.fst', 'toto.fasta', 'genome.fst']") in err
+ "when concatenating ['toto.fst', 'toto.fasta', 'genome.fst']") in caplog.text
assert ("None of the genome files in ['toto.fst', 'toto.fasta', 'genome.fst'] exist. "
- "This genome will be ignored.") in err
+ "This genome will be ignored.") in caplog.text
# Check that files were concatenated as expected
concat1 = os.path.join(tmppath, "A_H738.fasta-all.fna")
exp_concat1 = os.path.join(dbpath, "A_H738-and-B2_A3_5.fna")
concat2 = os.path.join(tmppath, "H299_H561.fasta-all.fna")
exp_concat2 = os.path.join(dbpath, "H299_H561-and-genome6.fna")
- with open(concat1, "r") as outf, open(exp_concat1, "r") as expf:
- for line_out, line_exp in zip(outf, expf):
- assert line_out == line_exp
- with open(concat2, "r") as outf, open(exp_concat2, "r") as expf:
- for line_out, line_exp in zip(outf, expf):
- assert line_out == line_exp
- os.remove(concat1)
- os.remove(concat2)
- os.remove(logfile_base + ".log")
- os.remove(logfile_base + ".log.details")
- os.remove(logfile_base + ".log.err")
+ assert utilities.compare_order_content(concat1, exp_concat1)
+ assert utilities.compare_order_content(concat2, exp_concat2)
+
+
+def test_read_genomes_info_nofile(caplog):
+ """
+ Read lstinfo file and get all genomes information
+ Check that when the file does not exist, it exits with appropriate error message
+ """
+ caplog.set_level(logging.DEBUG)
+ name = "ESCO"
+ with pytest.raises(SystemExit):
+ utils.read_genomes_info("toto.txt", name)
+ assert 'Reading given information on your genomes in toto.txt' in caplog.text
+ assert ("ERROR: The info file toto.txt that you gave does not exist. "
+ "Please provide the right path/name for this file.") in caplog.text
+ assert "Ending program" in caplog.text
+
+
+def test_read_genomes_info_wrongheader(caplog):
+ """
+ Read lstinfo file and get all genomes information
+ When wrong header (not all required columns), exits and appropriate error message
+ """
+ caplog.set_level(logging.DEBUG)
+ name = "ESCO"
+ lstinfo_file = os.path.join(DATA_DIR, "test_files", "lstinfo-wrong-header.lst")
+ with pytest.raises(SystemExit):
+ utils.read_genomes_info(lstinfo_file, name)
+ assert ("Reading given information on your genomes in "
+ "test/data/annotate/test_files/lstinfo-wrong-header.lst") in caplog.text
+ assert ("ERROR: It seems that your info file test/data/annotate/test_files/lstinfo-wrong-header.lst "
+ "does not have a header, "
+ "or this header does not have, at least, the required columns tab separated: ") in caplog.text
+ assert("to_annotate, gsize nb_conts and L90 (in any order).\nEnding program.") in caplog.text
-def test_check_resdirlst(capsys):
+def test_read_genomes_info_noheader(caplog):
+ """
+ Read lstinfo file and get all genomes information
+ When no header, exits and appropriate error message
+ """
+ caplog.set_level(logging.DEBUG)
+ name = "ESCO"
+ lstinfo_file = os.path.join(DATA_DIR, "test_files", "lstinfo-no-header.lst")
+ with pytest.raises(SystemExit):
+ utils.read_genomes_info(lstinfo_file, name)
+ assert ("Reading given information on your genomes in "
+ "test/data/annotate/test_files/lstinfo-no-header.lst") in caplog.text
+ assert ("ERROR: It seems that your info file test/data/annotate/test_files/lstinfo-no-header.lst "
+ "does not have a header, "
+ "or this header does not have, at least, the required columns tab separated: ") in caplog.text
+ assert("to_annotate, gsize nb_conts and L90 (in any order).\nEnding program.") in caplog.text
+
+
+def test_read_genomes_info_not_int(caplog):
+ """
+ Read lstinfo file and get all genomes information
+ When a nbcont column is not an int for 1 genome, writes error message and ignores the genome
+ """
+ caplog.set_level(logging.DEBUG)
+ name = "ESCO"
+ lstinfo_file = os.path.join(DATA_DIR, "test_files", "lstinfo-not-int-nbcont.lst")
+ genomes = utils.read_genomes_info(lstinfo_file, name)
+ assert ("Reading given information on your genomes in "
+ "test/data/annotate/test_files/lstinfo-not-int-nbcont.lst") in caplog.text
+ assert 'Found 2 genomes in total' in caplog.text
+ assert ("For genome A_H738-and-B2_A3_5, at least one of your columns 'gsize', "
+ "'nb_conts' or 'L90' contains a non numeric value. This genome will be ignored") in caplog.text
+ exp = {"genome1.fasta":
+ ["genome1", "test/data/annotate/genomes/genome1.fasta",
+ "test/data/annotate/genomes/genome1.fasta", 800, 6, 5],
+ "genome7.fasta":
+ ["genome7", "test/data/annotate/genomes/genome7.fasta",
+ "test/data/annotate/genomes/genome7.fasta", 79705, 80, 65]}
+ assert genomes == exp
+
+
+def test_read_genomes_info_not_all_filled(caplog):
+ """
+ Read lstinfo file and get all genomes information
+ 1 column not filled for at least 1 genome: exits and write appropriate error message
+ """
+ caplog.set_level(logging.DEBUG)
+ name = "ESCO"
+ lstinfo_file = os.path.join(DATA_DIR, "test_files", "lstinfo-not-all-filled.lst")
+ with pytest.raises(SystemExit):
+ utils.read_genomes_info(lstinfo_file, name)
+ assert ("Reading given information on your genomes in "
+ "test/data/annotate/test_files/lstinfo-not-all-filled.lst") in caplog.text
+ assert ("ERROR: Check that all fields of test/data/annotate/test_files/lstinfo-not-all-filled.lst "
+ "are filled in each line (can be 'NA')") in caplog.text
+
+
+def test_read_genomes_info_no_path(caplog):
+ """
+ Read lstinfo file and get all genomes information
+ When a genome in lstinfo does not have its corresponding file, write appropriate error message
+ and ignores genome
+ """
+ caplog.set_level(logging.DEBUG)
+ name = "ESCO"
+ lstinfo_file = os.path.join(DATA_DIR, "test_files", "lstinfo-miss-1genome.lst")
+ genomes = utils.read_genomes_info(lstinfo_file, name)
+ assert ("data/annotate/genomes/A_H738-and-B2_A3_5.fna genome file does not exist. "
+ "This genome will be ignored") in caplog.text
+ assert 'Found 2 genomes in total' in caplog.text
+ exp = {"genome1.fasta":
+ ["genome1", "test/data/annotate/genomes/genome1.fasta",
+ "test/data/annotate/genomes/genome1.fasta", 800, 6, 5],
+ "genome7.fasta":
+ ["genome7", "test/data/annotate/genomes/genome7.fasta",
+ "test/data/annotate/genomes/genome7.fasta", 79705, 80, 65]}
+ assert genomes == exp
+
+
+def test_read_genomes_info_no_genomes(caplog):
+ """
+ Read lstinfo file and get all genomes information
+ When no genome in lstinfo correspond to existing paths, exits and appropriate error message
+ """
+ caplog.set_level(logging.DEBUG)
+ name = "ESCO"
+ lstinfo_file = os.path.join(DATA_DIR, "test_files", "lstinfo-no-genome.lst")
+ with pytest.raises(SystemExit):
+ utils.read_genomes_info(lstinfo_file, name)
+ assert ("Reading given information on your genomes in "
+ "test/data/annotate/test_files/lstinfo-no-genome.lst") in caplog.text
+ assert ("no genome listed in test/data/annotate/test_files/lstinfo-no-genome.lst "
+ "were found.") in caplog.text
+
+
+def test_read_genomes_info_ok(caplog):
+ """
+ Read lstinfo file and get all genomes information and returns it as expected
+ """
+ caplog.set_level(logging.DEBUG)
+ list_file = os.path.join(DATA_DIR, "test_files", "lstinfo.lst")
+ name = "ESCO"
+ genomes = utils.read_genomes_info(list_file, name)
+ assert ("Reading given information on your genomes in "
+ "test/data/annotate/test_files/lstinfo.lst") in caplog.text
+ assert 'Found 3 genomes in total' in caplog.text
+ exp = {"genome1.fasta":
+ ["genome1", "test/data/annotate/genomes/genome1.fasta",
+ "test/data/annotate/genomes/genome1.fasta", 800, 6, 5],
+ "A_H738-and-B2_A3_5.fna":
+ ["A_H738-and-B2_A3_5", "test/data/annotate/genomes/A_H738-and-B2_A3_5.fna",
+ "test/data/annotate/genomes/A_H738-and-B2_A3_5.fna", 7000, 78, 6],
+ "genome7.fasta":
+ ["genome7", "test/data/annotate/genomes/genome7.fasta",
+ "test/data/annotate/genomes/genome7.fasta", 79705, 80, 65]}
+ assert genomes == exp
+
+
+def test_read_genomes_info_date_ok(caplog):
+ """
+ Read lstinfo file and get all genomes information
+ """
+ caplog.set_level(logging.DEBUG)
+ list_file = os.path.join(DATA_DIR, "test_files", "lstinfo.lst")
+ name = "ESCO"
+ date = "0720"
+ genomes = utils.read_genomes_info(list_file, name, date=date)
+ assert ("Reading given information on your genomes in "
+ "test/data/annotate/test_files/lstinfo.lst") in caplog.text
+ assert 'Found 3 genomes in total' in caplog.text
+ exp = {"test/data/annotate/genomes/genome1.fasta":
+ ["ESCO.0720", "test/data/annotate/genomes/genome1.fasta",
+ "test/data/annotate/genomes/genome1.fasta", 800, 6, 5],
+ "test/data/annotate/genomes/A_H738-and-B2_A3_5.fna":
+ ["ESCO.0720", "test/data/annotate/genomes/A_H738-and-B2_A3_5.fna",
+ "test/data/annotate/genomes/A_H738-and-B2_A3_5.fna", 7000, 78, 6],
+ "test/data/annotate/genomes/genome7.fasta":
+ ["ESCO.0720", "test/data/annotate/genomes/genome7.fasta",
+ "test/data/annotate/genomes/genome7.fasta", 79705, 80, 65]}
+ assert genomes == exp
+
+
+def test_check_format():
+ """
+ test that format is ok or not
+ """
+ assert utils.check_format("ESC1")
+ assert utils.check_format("1234")
+ assert not utils.check_format("12")
+ assert not utils.check_format("ESC*")
+
+
+def test_check_resdirlst(caplog):
"""
Test that when the result directory already contains .lst files in LSTINFO,
program ends with an error message.
"""
- resdir = os.path.join("test", "data", "annotate", "test_check_resdir")
# Create output directory with a lst file in LSTINFO
- os.makedirs(os.path.join(resdir, "LSTINFO"))
- open(os.path.join(resdir, "LSTINFO", "toto.lst"), "w").close()
+ os.makedirs(os.path.join(GENEPATH, "LSTINFO"))
+ open(os.path.join(GENEPATH, "LSTINFO", "toto.lst"), "w").close()
with pytest.raises(SystemExit):
- utils.check_out_dirs(resdir)
- out, err = capsys.readouterr()
+ utils.check_out_dirs(GENEPATH)
assert ("ERROR: Your output directory already has .lst files in the "
"LSTINFO folder. Provide another result directory, or remove the "
- "files in this one.") in err
- shutil.rmtree(resdir)
+ "files in this one.") in caplog.text
-def test_check_resdirprt(capsys):
+def test_check_resdirprt(caplog):
"""
Test that when the result directory already contains .prt files in Proteins,
program ends with an error message.
"""
- resdir = os.path.join("test", "data", "annotate", "test_check_resdir")
# Create output directory with a lst file in LSTINFO
- os.makedirs(os.path.join(resdir, "Proteins"))
- open(os.path.join(resdir, "Proteins", "toto.prt"), "w").close()
+ os.makedirs(os.path.join(GENEPATH, "Proteins"))
+ open(os.path.join(GENEPATH, "Proteins", "toto.prt"), "w").close()
with pytest.raises(SystemExit):
- utils.check_out_dirs(resdir)
- out, err = capsys.readouterr()
+ utils.check_out_dirs(GENEPATH)
assert ("ERROR: Your output directory already has .prt files in the "
"Proteins folder. Provide another result directory, or remove the "
- "files in this one.") in err
- shutil.rmtree(resdir)
+ "files in this one.") in caplog.text
-def test_check_resdirgen(capsys):
+def test_check_resdirgen(caplog):
"""
Test that when the result directory already contains .gen files in Genes,
program ends with an error message.
"""
- resdir = os.path.join("test", "data", "annotate", "test_check_resdir")
# Create output directory with a lst file in LSTINFO
- os.makedirs(os.path.join(resdir, "Genes"))
- open(os.path.join(resdir, "Genes", "toto.gen"), "w").close()
+ os.makedirs(os.path.join(GENEPATH, "Genes"))
+ open(os.path.join(GENEPATH, "Genes", "toto.gen"), "w").close()
with pytest.raises(SystemExit):
- utils.check_out_dirs(resdir)
- out, err = capsys.readouterr()
+ utils.check_out_dirs(GENEPATH)
assert ("ERROR: Your output directory already has .gen files in the "
"Genes folder. Provide another result directory, or remove the "
- "files in this one.") in err
- shutil.rmtree(resdir)
+ "files in this one.") in caplog.text
-def test_check_resdirrep(capsys):
+def test_check_resdirrep(caplog):
"""
Test that when the result directory already contains .fna files in Replicons,
program ends with an error message.
"""
- resdir = os.path.join("test", "data", "annotate", "test_check_resdir")
# Create output directory with a lst file in LSTINFO
- os.makedirs(os.path.join(resdir, "Replicons"))
- open(os.path.join(resdir, "Replicons", "toto.fna"), "w").close()
+ os.makedirs(os.path.join(GENEPATH, "Replicons"))
+ open(os.path.join(GENEPATH, "Replicons", "toto.fna"), "w").close()
with pytest.raises(SystemExit):
- utils.check_out_dirs(resdir)
- out, err = capsys.readouterr()
+ utils.check_out_dirs(GENEPATH)
assert ("ERROR: Your output directory already has .fna files in the "
"Replicons folder. Provide another result directory, or remove the "
- "files in this one.") in err
- shutil.rmtree(resdir)
+ "files in this one.") in caplog.text
-def test_check_resdirgff(capsys):
+def test_check_resdirgff(caplog):
"""
Test that when the result directory already contains .fna files in Replicons,
program ends with an error message.
"""
- resdir = os.path.join("test", "data", "annotate", "test_check_resdir_gff")
# Create output directory with a lst file in LSTINFO
- os.makedirs(os.path.join(resdir, "gff3"))
- open(os.path.join(resdir, "gff3", "toto.gff"), "w").close()
+ os.makedirs(os.path.join(GENEPATH, "gff3"))
+ open(os.path.join(GENEPATH, "gff3", "toto.gff"), "w").close()
with pytest.raises(SystemExit):
- utils.check_out_dirs(resdir)
- out, err = capsys.readouterr()
+ utils.check_out_dirs(GENEPATH)
assert ("ERROR: Your output directory already has .gff files in the "
"gff3 folder. Provide another result directory, or remove the "
- "files in this one.") in err
- shutil.rmtree(resdir)
+ "files in this one.") in caplog.text
def test_check_resdirotherext():
@@ -604,12 +799,10 @@ def test_check_resdirotherext():
Test that when the result directory contains txt files in Replicons dir,
there is no problem.
"""
- resdir = os.path.join("test", "data", "annotate", "test_check_resdir")
# Create output directory with a lst file in LSTINFO
- os.makedirs(os.path.join(resdir, "Replicons"))
- open(os.path.join(resdir, "Replicons", "toto.txt"), "w").close()
- utils.check_out_dirs(resdir)
- shutil.rmtree(resdir)
+ os.makedirs(os.path.join(GENEPATH, "Replicons"))
+ open(os.path.join(GENEPATH, "Replicons", "toto.txt"), "w").close()
+ utils.check_out_dirs(GENEPATH)
def test_check_resdirnodir():
@@ -619,19 +812,18 @@ def test_check_resdirnodir():
utils.check_out_dirs("totoresdir")
-def test_run_cmd_error_noquit(capsys):
+def test_run_cmd_error_noquit(caplog):
"""
Test that when we try to run a command which does not exist, it returns an error message,
but does not exit the program (eof=False).
"""
cmd = "toto"
error = "error trying to run toto"
- assert utils.run_cmd(cmd, error) == -1
- out, err = capsys.readouterr()
- assert "error trying to run toto: toto does not exist" in err
+ assert utils.run_cmd(cmd, error) == 1
+ assert "toto does not exist" in caplog.text
-def test_run_cmd_error_noquit_logger(capsys):
+def test_run_cmd_error_noquit_logger(caplog):
"""
Test that when we try to run a command which does not exist, it returns an error message,
but does not exit the program (eof=False). With a given logger where error is written.
@@ -639,12 +831,11 @@ def test_run_cmd_error_noquit_logger(capsys):
cmd = "toto"
logger = logging.getLogger("default")
error = "error trying to run toto"
- assert utils.run_cmd(cmd, error, logger=logger) == -1
- out, err = capsys.readouterr()
- assert "error trying to run toto: toto does not exist" in err
+ assert utils.run_cmd(cmd, error, logger=logger) == 1
+ assert "toto does not exist" in caplog.text
-def test_run_cmd_error_quit(capsys):
+def test_run_cmd_error_quit(caplog):
"""
Test that when we try to run a command which does not exist, it returns an error message,
and exits the program (eof=True)
@@ -653,8 +844,7 @@ def test_run_cmd_error_quit(capsys):
error = "error trying to run toto"
with pytest.raises(SystemExit):
utils.run_cmd(cmd, error, eof=True)
- out, err = capsys.readouterr()
- assert "error trying to run toto: toto does not exist" in err
+ assert "toto does not exist" in caplog.text
def test_run_cmd_retcode_non0(caplog):
@@ -680,30 +870,30 @@ def test_run_cmd_retcode_non0_quit(caplog):
assert error in caplog.text
-def test_run_cmd_error_stderrfile():
+def test_run_cmd_error_stderrfile(caplog):
"""
Test that when we try to run a command which does not exist, and direct its output to
a file instead of stderr, we have the expected error written in the given error file.
"""
cmd = "toto"
error = "error trying to run toto"
- outfile = open(os.path.join("test", "data", "annotate", "stderr_run_cmd.txt"), "w")
- assert utils.run_cmd(cmd, error, stderr=outfile) == -1
+ outfile = open(os.path.join(GENEPATH, "stderr_run_cmd.txt"), "w")
+ assert utils.run_cmd(cmd, error, stderr=outfile) == 1
+ assert "error: toto does not exist" in caplog.text
outfile.close()
- os.remove(os.path.join("test", "data", "annotate", "stderr_run_cmd.txt"))
-def test_run_cmd_error_stdoutfile():
+def test_run_cmd_error_stdoutfile(caplog):
"""
Test that when we try to run a command which does not exist, and direct its output to
a file instead of stderr, we have the expected error written in the given error file.
"""
cmd = "toto"
error = "error trying to run toto"
- outfile = open(os.path.join("test", "data", "annotate", "stdout_run_cmd.txt"), "w")
- assert utils.run_cmd(cmd, error, stdout=outfile) == -1
+ outfile = open(os.path.join(GENEPATH, "stdout_run_cmd.txt"), "w")
+ assert utils.run_cmd(cmd, error, stdout=outfile) == 1
+ assert "error: toto does not exist" in caplog.text
outfile.close()
- os.remove(os.path.join("test", "data", "annotate", "stdout_run_cmd.txt"))
def test_rename_contigs():
@@ -712,16 +902,20 @@ def test_rename_contigs():
and save the output sequence to the given res_path.
Check that the output file is as expected.
"""
- gpath = os.path.join("test", "data", "annotate", "genomes", "H299_H561.fasta")
+ gpath = os.path.join(DATA_DIR, "genomes", "H299_H561.fasta")
gembase_name = "ESCO.0216.00005"
- res_path = os.path.join("test", "data", "annotate")
- outfile = os.path.join(res_path, "H299_H561.fasta-short-contig.fna")
- exp_file = os.path.join("test", "data", "annotate", "exp_files", "res_H299_H561-ESCO00005.fna")
- utils.rename_genome_contigs(gembase_name, gpath, outfile)
- with open(exp_file, "r") as expf, open(outfile, "r") as of:
- for line_exp, line_seq in zip(expf, of):
- assert line_exp == line_seq
- os.remove(outfile)
+ outfile = os.path.join(GENEPATH, "H299_H561.fasta-short-contig.fna")
+ exp_file = os.path.join(DATA_DIR, "exp_files", "res_H299_H561-ESCO00005.fna")
+ contigs, sizes = utils.get_genome_contigs_and_rename(gembase_name, gpath, outfile)
+ print(sizes)
+ assert contigs == [">ESCO.0216.00005.0001\t>H561_S27 L001_R1_001_(paired)_contig_1",
+ ">ESCO.0216.00005.0002\t>H561_S28 L001_R1_001_(paired)_contig_2",
+ ">ESCO.0216.00005.0003\t>H561_S29 L001_R1_001_(paired)_contig_115"]
+ assert sizes == [">ESCO.0216.00005.0001\t3480",
+ ">ESCO.0216.00005.0002\t7080",
+ ">ESCO.0216.00005.0003\t2583"]
+ assert utilities.compare_order_content(outfile, exp_file)
+
def test_cat_nobar(capsys):
@@ -730,37 +924,25 @@ def test_cat_nobar(capsys):
contains what is expected (concatenation of content of all input files)
"""
import glob
- list_files = glob.glob(os.path.join("test", "data", "annotate", "genomes", "*.fasta"))
- outfile = "test_catfile.txt"
+ list_files = glob.glob(os.path.join(DATA_DIR, "genomes", "*.fasta"))
+ outfile = os.path.join(GENEPATH, "test_catfile.txt")
utils.cat(list_files, outfile)
- exp_file = os.path.join("test", "data", "annotate", "exp_files",
- "res_test_cat_genomes_fasta.fst")
- with open(exp_file, 'r') as expf, open(outfile, 'r') as outf:
- lines_exp = expf.readlines()
- lines_out = outf.readlines()
- assert set(lines_exp) == set(lines_out)
- _, err = capsys.readouterr()
- assert "/{} (".format(len(list_files)) not in err
- os.remove(outfile)
+ exp_file = os.path.join(DATA_DIR, "exp_files", "res_test_cat_genomes_fasta.fst")
+ assert utilities.compare_file_content(outfile, exp_file)
-def test_cat_bar():
+def test_cat_bar(caplog):
"""
Check that when cat is called on a list of several files, the output file
contains what is expected (concatenation of content of all input files)
"""
import glob
- list_files = glob.glob(os.path.join("test", "data", "annotate", "genomes", "*.fasta"))
- outfile = "test_catfile.txt"
+ list_files = glob.glob(os.path.join(DATA_DIR, "genomes", "*.fasta"))
+ outfile = os.path.join(GENEPATH, "test_catfile.txt")
title = "test cat progressbar"
utils.cat(list_files, outfile, title=title)
- exp_file = os.path.join("test", "data", "annotate", "exp_files",
- "res_test_cat_genomes_fasta.fst")
- with open(exp_file, 'r') as expf, open(outfile, 'r') as outf:
- lines_exp = expf.readlines()
- lines_out = outf.readlines()
- assert set(lines_exp) == set(lines_out)
- os.remove(outfile)
+ exp_file = os.path.join(DATA_DIR, "exp_files", "res_test_cat_genomes_fasta.fst")
+ assert utilities.compare_file_content(outfile, exp_file)
def test_detail():
@@ -779,15 +961,14 @@ def test_grep():
"123toto.txt other letters\n"
"123toto:txt otherletters\n"
"123toto.txt otherletters\n")
- filein = "filein.txt"
+ filein = os.path.join(GENEPATH, "filein.txt")
with open(filein, "w") as ff:
ff.write(lines)
- pattern = "[0-9]+toto\.txt [a-z]{6}"
+ pattern = "[0-9]+toto[.]txt [a-z]{6}"
lines_grep = utils.grep(filein, pattern)
exp = ["1toto.txt otherletters",
"123toto.txt otherletters"]
assert exp == lines_grep
- os.remove(filein)
def test_grep_count():
@@ -799,13 +980,12 @@ def test_grep_count():
"123toto.txt other letters\n"
"123toto:txt otherletters\n"
"123toto.txt otherletters\n")
- filein = "filein.txt"
+ filein = os.path.join(GENEPATH, "filein.txt")
with open(filein, "w") as ff:
ff.write(lines)
- pattern = "[0-9]+toto\.txt [a-z]{6}"
+ pattern = "[0-9]+toto[.]txt [a-z]{6}"
lines_grep = utils.grep(filein, pattern, counts=True)
assert lines_grep == 2
- os.remove(filein)
def test_count_lines():
@@ -817,12 +997,11 @@ def test_count_lines():
"123toto.txt other letters\n"
"123toto:txt otherletters\n"
"123toto.txt otherletters\n")
- filein = "filein.txt"
+ filein = os.path.join(GENEPATH, "filein.txt")
with open(filein, "w") as ff:
ff.write(lines)
nbline = utils.count(filein)
assert nbline == 5
- os.remove(filein)
def test_count_words():
@@ -834,22 +1013,20 @@ def test_count_words():
"123toto.txt other letters\n"
"123toto:txt otherletters\n"
"123toto.txt otherletters\n")
- filein = "filein.txt"
+ filein = os.path.join(GENEPATH, "filein.txt")
with open(filein, "w") as ff:
ff.write(lines)
nbword = utils.count(filein, get="words")
assert nbword == 10
- os.remove(filein)
-def test_count_error(capsys):
+def test_count_error(caplog):
"""
test that when we want to count something else than 'lines' or 'words', it returns an error
"""
with pytest.raises(SystemExit):
utils.count("filein", get="letters")
- _, err = capsys.readouterr()
- assert "Choose what you want to count among ['lines', 'words']" in err
+ assert "Choose what you want to count among ['lines', 'words']" in caplog.text
def test_save_bin():
@@ -860,13 +1037,12 @@ def test_save_bin():
obj2 = [1, 2, 5, "toto", "plop"]
obj3 = "a string"
objects = [obj1, obj2, obj3]
- fileout = "filout.bin"
+ fileout = os.path.join(GENEPATH, "fileout.txt")
utils.save_bin(objects, fileout)
import _pickle as pickle
with open(fileout, "rb") as binf:
obj = pickle.load(binf)
assert objects == obj
- os.remove(fileout)
def test_load_bin():
@@ -882,22 +1058,50 @@ def test_load_bin():
assert found == objects
-def test_write_list():
+def test_list_to_str():
"""
Test that the given list is returned as expected string
"""
inlist = [1, 2, "toto", {1: 2, "1": 5}, 1e-6]
- tostr = utils.write_list(inlist)
+ tostr = utils.list_to_str(inlist, sep=" ")
exp1 = "1 2 toto {1: 2, '1': 5} 1e-06\n"
exp2 = "1 2 toto {'1': 5, 1: 2} 1e-06\n"
assert tostr == exp1 or tostr == exp2
+def test_list_to_str_default():
+ """
+ Test that the given list is returned as expected string
+ """
+ inlist = [1, 2, "toto", {1: 2, "1": 5}, 1e-6]
+ tostr = utils.list_to_str(inlist)
+ exp1 = "1\t2\ttoto\t{1: 2, '1': 5}\t1e-06\n"
+ exp2 = "1\t2\ttoto\t{'1': 5, 1: 2}\t1e-06\n"
+ assert tostr == exp1 or tostr == exp2
+
+
+def test_write_list():
+ """
+ test that given a list, it writes all its elements, 1 by line, in given outfile
+ """
+ outfile = os.path.join(GENEPATH, "toto.txt")
+ inlist = [1, 2, "toto", {1: 2, "1": 5}, 1e-6]
+ utils.write_list(inlist, outfile)
+ with open(outfile, "r") as of:
+ lines = of.readlines()
+ assert len(lines) == 5
+ assert "1\n" in lines
+ assert "2\n" in lines
+ assert "toto\n" in lines
+ assert "{1: 2, '1': 5}\n" in lines
+ assert "1e-06\n" in lines
+
+
def test_remove_exits():
"""
Test that a given file is removed if it exists
"""
- infile = "toto.txt"
+ infile = os.path.join(GENEPATH, "toto.txt")
open(infile, "w").close()
assert os.path.isfile(infile)
utils.remove(infile)
@@ -908,7 +1112,7 @@ def test_remove_not_exist():
"""
Test that removing a file which does not exist brings no error
"""
- infile = "toto.txt"
+ infile = os.path.join(GENEPATH, "toto.txt")
assert not os.path.isfile(infile)
utils.remove(infile)
assert not os.path.isfile(infile)