diff --git a/PanACoTA/annotate_module/genome_seq_functions.py b/PanACoTA/annotate_module/genome_seq_functions.py
index 639a4f9f0c31e6ed5c956d0bebaa70212491631b..6ec2bb814e86dd8dcbe171be5f07212d85418e83 100755
--- a/PanACoTA/annotate_module/genome_seq_functions.py
+++ b/PanACoTA/annotate_module/genome_seq_functions.py
@@ -334,7 +334,8 @@ def format_contig(cut, pat, cur_seq, cur_contig_name, contig_sizes, gresf, num,
def split_contig(pat, whole_seq, cur_contig_name, contig_sizes, gresf, num):
"""
Save the contig read just before into dicts and write it to sequence file.
- Contig name must be at most 20 characters (required by prokka)
+ Unique ID of contig must be in the first field of header, before the first space
+ (required by prokka)
Parameters
----------
@@ -368,7 +369,7 @@ def split_contig(pat, whole_seq, cur_contig_name, contig_sizes, gresf, num):
# we get empty contigs, if 2 occurrences of the pattern are side by side).
if len(seq) == 0:
continue
- new_contig_name = "{}_{}\n".format(cur_contig_name, num)
+ new_contig_name = ">{}_{}\n".format(num, cur_contig_name.split(">")[1])
contig_sizes[new_contig_name] = len(seq)
gresf.write(new_contig_name)
gresf.write(seq + "\n")
diff --git a/test/data/annotate/exp_files/exp_split_contig_cut3N.fna b/test/data/annotate/exp_files/exp_split_contig_cut3N.fna
index d221ee3dd69d9f0361438df8b7413de308b1ace6..79c95494f384fabe70f6a98cea45473f7ac4d55e 100644
--- a/test/data/annotate/exp_files/exp_split_contig_cut3N.fna
+++ b/test/data/annotate/exp_files/exp_split_contig_cut3N.fna
@@ -1,4 +1,4 @@
->my_contig_name_for_my_sequence_2
+>2_my_contig_name for_my_sequence
AACTGCTTTTTAAGCGCGCTCCTGCG
->my_contig_name_for_my_sequence_3
+>3_my_contig_name for_my_sequence
GGTTGTGTGGGCCCAGAGCGAGNCG
diff --git a/test/data/annotate/exp_files/exp_split_contig_nocut.fna b/test/data/annotate/exp_files/exp_split_contig_nocut.fna
index 8cdf33404f0ce78a2d56272b1dab695bbcd662a6..f6d01ad9e592c90a7522d79c69346f6ccae6fa6a 100644
--- a/test/data/annotate/exp_files/exp_split_contig_nocut.fna
+++ b/test/data/annotate/exp_files/exp_split_contig_nocut.fna
@@ -1,2 +1,2 @@
->my_contig_name_for_my_sequence_2
+>2_my_contig name for my_sequence
AACTGCTTTTTAAGCGCGCTCCTGCGNNNNNGGTTGTGTGGGCCCAGAGCGAGNCG
diff --git a/test/data/annotate/exp_files/exp_split_empty_contig.fna b/test/data/annotate/exp_files/exp_split_empty_contig.fna
index 0c5be8ca78c215b25d7d56dc1081445b0fb37d72..d123f54018d2913e99fc8b30aeff2cb0561f2bca 100644
--- a/test/data/annotate/exp_files/exp_split_empty_contig.fna
+++ b/test/data/annotate/exp_files/exp_split_empty_contig.fna
@@ -1,2 +1,2 @@
->my_contig_name_for_my_sequence_2
+>2_my_contig_name_for_my_sequence
AACTGCTTTTTAAGCGCGCTCCTGCGNGGTTGTGTGGGCCCAGAGCGAGNCG
diff --git a/test/test_unit/test_annotate/test_genome_func.py b/test/test_unit/test_annotate/test_genome_func.py
index 779c7d011264b482fc7d05abf111765f2e6502cf..2e782af10beca77c54dc041fec045d5813b3400b 100755
--- a/test/test_unit/test_annotate/test_genome_func.py
+++ b/test/test_unit/test_annotate/test_genome_func.py
@@ -125,7 +125,7 @@ def test_split_contig_nocut():
"""
pat = None
whole_seq = "AACTGCTTTTTAAGCGCGCTCCTGCGNNNNNGGTTGTGTGGGCCCAGAGCGAGNCG"
- cur_contig_name = ">my_contig_name_for_my_sequence"
+ cur_contig_name = ">my_contig name for my_sequence"
contig_sizes = {"contig_1": 10}
resfile = os.path.join(GENEPATH, "test_split_contig_nocut.fna")
gresf = open(resfile, "w")
@@ -149,7 +149,7 @@ def test_split_contig_cut():
"""
pat = "NNN+"
whole_seq = "AACTGCTTTTTAAGCGCGCTCCTGCGNNNNNGGTTGTGTGGGCCCAGAGCGAGNCG"
- cur_contig_name = ">my_contig_name_for_my_sequence"
+ cur_contig_name = ">my_contig_name for_my_sequence"
contig_sizes = {">contig_1": 10}
resfile = os.path.join(GENEPATH, "test_split_contig_nocut.fna")
gresf = open(resfile, "w")
@@ -214,7 +214,7 @@ def test_format_contig_cut():
def test_format_contig_nocut():
"""
- For a given contig, if we want to annotate it with prokka, and do not cut at each stretch of
+ For a given contig, if we want to annotate it with prokka, and do not cut at each stretch of
5 'N'check that it writes this contig as given
"""
cut = False
@@ -238,8 +238,8 @@ def test_format_contig_nocut():
def test_format_contig_nocut_prodigal_notSameName():
"""
- For a given contig, if we want to annotate it with prodigal, and do not cut,
- then we keep the same file (no need to split at 20 characters)
+ For a given contig, if we want to annotate it with prodigal, and do not cut,
+ then we keep the same file (no need to split at 20 characters)
However, we must check that contig names are all different.
Add 2 contigs, to be sure the 'num' parameter is not increased.
"""
@@ -400,7 +400,7 @@ def test_analyse1genome_nocut_prodigal():
def test_analyse1genome_cut_prodigal():
'''
Analyse the given genome, cutting at stretches of 5N, in order to annotate it
- Create new genome file in outdir, calculate genome size, nb contigs and L90, and add it
+ Create new genome file in outdir, calculate genome size, nb contigs and L90, and add it
to the genomes dict, as well as the path to the genome file.
'''
gs = ["genome1.fasta", "genome2.fasta", "genome3.fasta"]
@@ -429,8 +429,8 @@ def test_analyse1genome_cut_prodigal():
def test_analyse1genome_cut_prokka():
'''
Analyse the given genome, cutting at stretches of 5N, in order to annotate it with prokka
- Create new genome file in outdir, with shortened contig names, calculate genome size,
- nb contigs and L90, and add it
+ Create new genome file in outdir, with shortened contig names, calculate genome size,
+ nb contigs and L90, and add it
to the genomes dict, as well as the path to the genome file.
'''
gs = ["genome1.fasta", "genome2.fasta", "genome3.fasta"]
@@ -485,7 +485,7 @@ def test_analyse1genome_same_names_nocut(caplog):
genomes = {genome: ["SAEN.1015.0117"]}
cut = False
pat = None
- assert not gfunc.analyse_genome(genome, GEN_PATH, GENEPATH, cut, pat, genomes,
+ assert not gfunc.analyse_genome(genome, GEN_PATH, GENEPATH, cut, pat, genomes,
"prodigal", logger)
assert ("myheader contig name is used for several contigs. Please put different names for "
"each contig. This genome will be ignored") in caplog.text
@@ -501,7 +501,7 @@ def test_analyse1genome_same_last_name_nocut(caplog):
genomes = {genome: ["SAEN.1015.0117"]}
cut = False
pat = None
- assert not gfunc.analyse_genome(genome, GEN_PATH, GENEPATH, cut, pat, genomes,
+ assert not gfunc.analyse_genome(genome, GEN_PATH, GENEPATH, cut, pat, genomes,
"prodigal", logger)
assert ("myheader contig name is used for several contigs. Please put different names for "
"each contig. This genome will be ignored") in caplog.text
@@ -509,7 +509,7 @@ def test_analyse1genome_same_last_name_nocut(caplog):
def test_analyse1genome_nofile(caplog):
'''
- Test that when we ask to analyse a genome whose sequence file does not exist, it returns false
+ Test that when we ask to analyse a genome whose sequence file does not exist, it returns false
with corresponding error message.
'''
caplog.set_level(logging.DEBUG)
@@ -527,7 +527,7 @@ def test_analyse1genome_nofile(caplog):
def test_analyse1genome_empty(caplog):
'''
- Test that when we ask to analyse a genome whose sequence file does not exist, it returns false
+ Test that when we ask to analyse a genome whose sequence file does not exist, it returns false
with corresponding error message.
'''
caplog.set_level(logging.DEBUG)
@@ -592,7 +592,7 @@ def test_analyse_all_genomes_cut(caplog):
gs[1]: ["SAEN.1114", gpaths[1], opaths[1], 51, 6, 5],
gs[2]: ["ESCO.0416", gpaths[2], opaths[2], 70, 4, 1]}
assert exp_genomes == genomes
- assert ("Cutting genomes at each time there are at least 3 'N' in a row, "
+ assert ("Cutting genomes at each time there are at least 3 'N' in a row, "
"and then, calculating genome size, number of contigs and L90.") in caplog.text
@@ -654,7 +654,7 @@ def test_analyse_all_genomes_cut_empty(caplog):
gs[1]: ["SAEN.1114", gpaths[1], opaths[1], 51, 6, 5],
gs[3]: ["ESCO.0123", gpaths[3], opaths[3], 70, 4, 1]}
assert exp_genomes == genomes
- assert ("Cutting genomes at each time there are at least 3 'N' in a row, "
+ assert ("Cutting genomes at each time there are at least 3 'N' in a row, "
"and then, calculating genome size, number of contigs and L90.") in caplog.text
assert ("Your file test/data/annotate/genomes/empty.fasta "
"does not contain any gene. Please check that you really gave a "
@@ -679,7 +679,7 @@ def test_analyse_all_genomes_noseq(caplog):
# Run analysis
with pytest.raises(SystemExit):
gfunc.analyse_all_genomes(genomes, "toto", GENEPATH, nbn, "prokka", logger, quiet=True)
- assert ("No genome was found in the database folder toto. See logfile "
+ assert ("No genome was found in the database folder toto. See logfile "
"for more information.") in caplog.text