diff --git a/CHANGELOG b/CHANGELOG
index 9e5c7de098ee5f5ae441850e7492cc81d7836ada..6bc3da3acd9df30c8d0dcc1106afd4640b4043a4 100644
--- a/CHANGELOG
+++ b/CHANGELOG
@@ -1,3 +1,9 @@
+# 0.3.3
+- Compute prediction for seeds 8-12
+- Prefix off-target feature key result with "off_target"
+- Change header of output format
+- Change some of the command lines : -g => -s and -gf => -w
+
# 0.3.2
- Fix bugg when no off-target feature
- Handle genome in fasta file
diff --git a/README.md b/README.md
index 0a6acf83b6dd28f0c3c3c6ed108095aa2c6d07e0..c5c5bdee463f6f1e62143582527f878a90dce1cf 100644
--- a/README.md
+++ b/README.md
@@ -46,10 +46,10 @@ for guide_rna in guide_rnas:
_output :_
```
-{'target': 'TCATCACGGGCCTTCGCCACGCGCG', 'guide': 'TCATCACGGGCCTTCGCCAC', 'start': 82, 'stop': 102, 'pam': 80, 'ori': '-', 'pred': -0.4719254873780802}
-{'target': 'CATCACGGGCCTTCGCCACGCGCGC', 'guide': 'CATCACGGGCCTTCGCCACG', 'start': 81, 'stop': 101, 'pam': 79, 'ori': '-', 'pred': 1.0491308060379676}
-{'target': 'CGCGCGCGGCAAACAATCACAAACA', 'guide': 'CGCGCGCGGCAAACAATCAC', 'start': 63, 'stop': 83, 'pam': 61, 'ori': '-', 'pred': -0.9021152826078697}
-{'target': 'CCTGATCGGTATTGAACAGCATCTG', 'guide': 'CCTGATCGGTATTGAACAGC', 'start': 29, 'stop': 49, 'pam': 27, 'ori': '-', 'pred': 0.23853258873311955}
+{'target': 'TCATCACGGGCCTTCGCCACGCGCG', 'guide': 'TCATCACGGGCCTTCGCCAC', 'start': 82, 'stop': 102, 'pam': 80, 'ori': '-', 'target_id': 1, 'pred': -0.4719254873780802, 'off_targets_per_seed': []}
+{'target': 'CATCACGGGCCTTCGCCACGCGCGC', 'guide': 'CATCACGGGCCTTCGCCACG', 'start': 81, 'stop': 101, 'pam': 79, 'ori': '-', 'target_id': 2, 'pred': 1.0491308060379676, 'off_targets_per_seed': []}
+{'target': 'CGCGCGCGGCAAACAATCACAAACA', 'guide': 'CGCGCGCGGCAAACAATCAC', 'start': 63, 'stop': 83, 'pam': 61, 'ori': '-', 'target_id': 3, 'pred': -0.9021152826078697, 'off_targets_per_seed': []}
+{'target': 'CCTGATCGGTATTGAACAGCATCTG', 'guide': 'CCTGATCGGTATTGAACAGC', 'start': 29, 'stop': 49, 'pam': 27, 'ori': '-', 'target_id': 4, 'pred': 0.23853258873311955, 'off_targets_per_seed': []}
```
### Command line interface
@@ -82,7 +82,7 @@ $ crisprbact predict from-str --help
```
```
-Usage: crisprbact predict from-str [OPTIONS] [OUTPUT_FILE]
+Usage: cli.py predict from-str [OPTIONS] [OUTPUT_FILE]
Outputs candidate guide RNAs for the S. pyogenes dCas9 with predicted on-
target activity from a target gene.
@@ -91,8 +91,15 @@ Usage: crisprbact predict from-str [OPTIONS] [OUTPUT_FILE]
"stdout"
Options:
- -t, --target TEXT [required]
- --help Show this message and exit.
+ -t, --target TEXT Sequence file to target [required]
+ -s, --off-target-sequence FILENAME
+ Sequence in which you want to find off-
+ targets
+ -w, --off-target-sequence-format [fasta|gb|genbank]
+ Sequence in which you want to find off-
+ targets format [default: genbank]
+ --help Show this message and exit.
+
```
```console
@@ -124,7 +131,7 @@ $ crisprbact predict from-seq --help
```
```
-Usage: crisprbact predict from-seq [OPTIONS] [OUTPUT_FILE]
+Usage: cli.py predict from-seq [OPTIONS] [OUTPUT_FILE]
Outputs candidate guide RNAs for the S. pyogenes dCas9 with predicted on-
target activity from a target gene.
@@ -133,9 +140,16 @@ Usage: crisprbact predict from-seq [OPTIONS] [OUTPUT_FILE]
"stdout"
Options:
- -t, --target FILENAME Sequence file [required]
- -f, --seq-format [fasta|fa|gb|genbank]
- Sequence file format [default: fasta]
+ -t, --target FILENAME Sequence file to target [required]
+ -f, --seq-format [fasta|gb|genbank]
+ Sequence file to target format [default:
+ fasta]
+ -s, --off-target-sequence FILENAME
+ Sequence in which you want to find off-
+ targets
+ -w, --off-target-sequence-format [fasta|gb|genbank]
+ Sequence in which you want to find off-
+ targets format [default: genbank]
--help Show this message and exit.
```
@@ -151,17 +165,22 @@ $ crisprbact predict from-seq -t /tmp/seq.fasta guide-rnas.tsv
$ crisprbact predict from-seq -t /tmp/seq.gb -f gb guide-rnas.tsv
```
+- Off-targets
+
+```console
+predict from-seq -t data-test/sequence.fasta -s data-test/sequence.gb guide-rnas.tsv
+```
+
##### Output file
```
-target PAM position prediction input_id
-ATTTGTTGGCAACCCAGCCAGCCTT 855 -0.7310112260341689 CP027060.1
-CACGTCCGGCAATATTTCCGCGAAC 830 0.14773859036983505 CP027060.1
-TCCGAGCGGCAACGTCTCTGATAAC 799 -0.4922487382950619 CP027060.1
-GCTTAAAGGGCAAAATGTCACGCCT 769 -1.814666749464254 CP027060.1
-CTTAAAGGGCAAAATGTCACGCCTT 768 -0.4285147731290152 CP027060.1
-CGTTTGAGGAGATCCACAAAATTAT 732 -1.2437430146548256 CP027060.1
-CATGAATGGTATAAACCGGCGTGCC 680 -0.8043242669169294 CP027060.1
+target_id target PAM position prediction target_seq_id seed_size off_target_recid off_target_start off_target_end off_target_pampos off_target_strand off_target_feat_type off_target_feat_start off_target_feat_end off_target_feat_strand off_target_locus_tag off_target_gene off_target_note off_target_product off_target_protein_id
+1 TGATCCAGGCATTTTTTAGCTTCAT 835 0.47949500169043713 NC_017634.1:2547433-2548329 8 NC_017634.1 1388198 1388209 1388209 +
+1 TGATCCAGGCATTTTTTAGCTTCAT 835 0.47949500169043713 NC_017634.1:2547433-2548329 8 NC_017634.1 2244514 2244525 2244525 + CDS 2243562 2244720 -1 NRG857_10810 COG1174 ABC-type proline/glycine betaine transport systems, permease component putative transport system permease YP_006120510.1
+1 TGATCCAGGCATTTTTTAGCTTCAT 835 0.47949500169043713 NC_017634.1:2547433-2548329 8 NC_017634.1 4160984 4160995 4160995 + CDS 4160074 4161406 -1 NRG857_19625 hslU COG1220 ATP-dependent protease HslVU (ClpYQ), ATPase subunit ATP-dependent protease ATP-binding subunit HslU YP_006122267.1
+1 TGATCCAGGCATTTTTTAGCTTCAT 835 0.47949500169043713 NC_017634.1:2547433-2548329 8 NC_017634.1 4534189 4534200 4534200 +
+1 TGATCCAGGCATTTTTTAGCTTCAT 835 0.47949500169043713 NC_017634.1:2547433-2548329 8 NC_017634.1 548804 548815 548804 -
+1 TGATCCAGGCATTTTTTAGCTTCAT 835 0.47949500169043713 NC_017634.1:2547433-2548329 8 NC_017634.1 786462 786473 786462 - CDS 785384 786470 1 NRG857_03580 COG2055 Malate/L-lactate dehydrogenases hypothetical protein YP_006119079.1
```
diff --git a/crisprbact/cli.py b/crisprbact/cli.py
index 4eeaebd2e2700a0dd9450dcef52143d77f21264b..8f7552fd8f56106baefabc0faaf0ba7831e70bdf 100644
--- a/crisprbact/cli.py
+++ b/crisprbact/cli.py
@@ -10,7 +10,32 @@ class Config(object):
pass_config = click.make_pass_decorator(Config, ensure=True)
-HEADER = ["target", "PAM position", "prediction", "seq_id"]
+OFF_TARGET_DETAILS = [
+ "off_target_recid",
+ "off_target_start",
+ "off_target_end",
+ "off_target_pampos",
+ "off_target_strand",
+ "off_target_feat_type",
+ "off_target_feat_start",
+ "off_target_feat_end",
+ "off_target_feat_strand",
+ "off_target_locus_tag",
+ "off_target_gene",
+ "off_target_note",
+ "off_target_product",
+ "off_target_protein_id",
+]
+HEADER = [
+ "target_id",
+ "target",
+ "PAM position",
+ "prediction",
+ "target_seq_id",
+ "seed_size",
+] + OFF_TARGET_DETAILS
+SEED_SIZE = 8
+GENOME_FORMAT = "genbank"
@click.group()
@@ -27,10 +52,28 @@ def predict(config):
@predict.command()
-@click.option("-t", "--target", type=str, required=True)
+@click.option(
+ "-t", "--target", type=str, required=True, help="Sequence file to target",
+)
+@click.option(
+ "-s",
+ "--off-target-sequence",
+ type=click.File("rU"),
+ help="Sequence in which you want to find off-targets",
+)
+@click.option(
+ "-w",
+ "--off-target-sequence-format",
+ type=click.Choice(["fasta", "gb", "genbank"]),
+ default=GENOME_FORMAT,
+ show_default=True,
+ help="Sequence in which you want to find off-targets format",
+)
@click.argument("output-file", type=click.File("w"), default="-")
@pass_config
-def from_str(config, target, output_file):
+def from_str(
+ config, target, off_target_sequence, off_target_sequence_format, output_file
+):
"""
Outputs candidate guide RNAs for the S. pyogenes dCas9 with predicted on-target
activity from a target gene.
@@ -40,28 +83,59 @@ def from_str(config, target, output_file):
"""
if config.verbose:
print_parameters(target)
+ if off_target_sequence:
+ genome_fh = SeqIO.parse(off_target_sequence, off_target_sequence_format)
+ else:
+ genome_fh = None
+ guide_rnas = on_target_predict(target, genome_fh)
- guide_rnas = on_target_predict(target)
click.echo("\t".join(HEADER), file=output_file)
write_guide_rnas(guide_rnas, output_file)
@predict.command()
@click.option(
- "-t", "--target", type=click.File("rU"), required=True, help="Sequence file",
+ "-t",
+ "--target",
+ type=click.File("rU"),
+ required=True,
+ help="Sequence file to target",
)
@click.option(
"-f",
"--seq-format",
- type=click.Choice(["fasta", "fa", "gb", "genbank"]),
- help="Sequence file format",
+ type=click.Choice(["fasta", "gb", "genbank"]),
+ help="Sequence file to target format",
default="fasta",
show_default=True,
)
-# @click.option("-g", "--genome", type=click.File("rU"), required=True, help="Genome")
+# @click.option(
+# "-s", "--seed-size", type=click.IntRange(8, 15, clamp=True),
+# )
+@click.option(
+ "-s",
+ "--off-target-sequence",
+ type=click.File("rU"),
+ help="Sequence in which you want to find off-targets",
+)
+@click.option(
+ "-w",
+ "--off-target-sequence-format",
+ type=click.Choice(["fasta", "gb", "genbank"]),
+ default=GENOME_FORMAT,
+ show_default=True,
+ help="Sequence in which you want to find off-targets format",
+)
@click.argument("output-file", type=click.File("w"), default="-")
@pass_config
-def from_seq(config, target, seq_format, output_file): # genome,
+def from_seq(
+ config,
+ target,
+ seq_format,
+ off_target_sequence,
+ off_target_sequence_format,
+ output_file,
+):
"""
Outputs candidate guide RNAs for the S. pyogenes dCas9 with predicted on-target
activity from a target gene.
@@ -76,9 +150,12 @@ def from_seq(config, target, seq_format, output_file): # genome,
for record in SeqIO.parse(target, seq_format):
if config.verbose:
click.secho(" - search guide RNAs for %s " % record.id, fg=fg)
- # g = SeqIO.parse(genome, "genbank")
- guide_rnas = on_target_predict(str(record.seq))
-
+ if off_target_sequence:
+ genome_fh = SeqIO.parse(off_target_sequence, off_target_sequence_format)
+ else:
+ genome_fh = None
+ guide_rnas = on_target_predict(str(record.seq), genome_fh)
+ # print(guide_rnas)
write_guide_rnas(guide_rnas, output_file, record.id)
@@ -89,17 +166,34 @@ def print_parameters(target, fg="blue"):
def write_guide_rnas(guide_rnas, output_file, seq_id="N/A"):
for guide_rna in guide_rnas:
- click.echo(
- "\t".join(
- [
- guide_rna["target"],
- str(guide_rna["pam"]),
- str(guide_rna["pred"]),
- seq_id,
- ]
- ),
- file=output_file,
- )
+ row = [
+ str(guide_rna["target_id"]),
+ guide_rna["target"],
+ str(guide_rna["pam"]),
+ str(guide_rna["pred"]),
+ seq_id,
+ ]
+ if len(guide_rna["off_targets_per_seed"]) > 0:
+ for off_target_per_seed in guide_rna["off_targets_per_seed"]:
+ for off_target in off_target_per_seed["off_targets"]:
+ seed_size = off_target_per_seed["seed_size"]
+
+ def extract_off_target_detail(key):
+ if key in off_target:
+ return str(off_target[key])
+ else:
+ return ""
+
+ details = map(extract_off_target_detail, OFF_TARGET_DETAILS)
+ click.echo(
+ "\t".join(row + [str(seed_size)] + list(details)),
+ file=output_file,
+ )
+ else:
+ click.echo(
+ "\t".join(row + list(map(lambda x: "", OFF_TARGET_DETAILS))),
+ file=output_file,
+ )
if __name__ == "__main__":
diff --git a/crisprbact/predict.py b/crisprbact/predict.py
index 20e97ddbe977b7aff70b432d9dd3247319b95e5a..1dd657cb1bafbf30fc2981cdfff1d76c17c793bd 100644
--- a/crisprbact/predict.py
+++ b/crisprbact/predict.py
@@ -43,7 +43,12 @@ def find_targets(seq):
)
-def on_target_predict(seq, genome=None, seed_size=7):
+def get_strand_value(value):
+ strand_dict = {"+": 1, "1": 1, "-": -1, "-1": -1}
+ return strand_dict[str(value)]
+
+
+def on_target_predict(seq, genome=None, seed_sizes=[8, 9, 10, 11, 12]):
seq = seq.upper() # make uppercase
seq = re.sub(r"\s", "", seq) # removes white space
@@ -65,47 +70,85 @@ def on_target_predict(seq, genome=None, seed_size=7):
preds = predict(X)
for i, target in enumerate(alltargets):
+ target_id = i + 1
+ target.update({"target_id": target_id})
target.update({"pred": preds[i]})
- target.update({"seed_size": seed_size})
if genome:
- off_target_df = compute_off_target_df(
- target["guide"], seed_size, records, genome_features
- )
- off_targets_list = []
- if not off_target_df.empty:
- off_targets = off_target_df.loc[
- 0:, ["start", "end", "pampos", "strand", "recid", "features"]
- ]
- for index, off_t in enumerate(off_targets.values.tolist()):
- off_target_dict = {
- "off_target_start": off_t[0],
- "off_target_end": off_t[1],
- "pampos": off_t[2],
- "strand": off_t[3],
- "recid": off_t[4],
- }
- if len(off_t[5]) > 0:
- # Loop for each feature
- for feat in off_t[5]:
- feature_dict = {
- "feat_strand": feat.location.strand,
- "feat_start": feat.location.start,
- "feat_end": feat.location.end,
- "feat_type": feat.type,
- }
- for k, feat in feat.qualifiers.items():
- if k != "translation":
- feature_dict[k] = "::".join(feat)
- off_targets_list.append(
- {**feature_dict, **off_target_dict}
+ off_targets_per_seed = []
+ for seed_size in seed_sizes:
+ # off-target found for a guide
+ off_target_df = compute_off_target_df(
+ target["guide"], seed_size, records, genome_features
+ )
+ off_targets_list = []
+ if not off_target_df.empty:
+ off_targets = off_target_df.loc[
+ 0:,
+ ["start", "end", "pampos", "strand", "recid", "features"],
+ ]
+ for j, off_t in enumerate(off_targets.values.tolist()):
+ off_target_dict = {
+ "off_target_id": str(target_id)
+ + "-"
+ + str(seed_size)
+ + "-"
+ + str(j),
+ "off_target_start": off_t[0],
+ "off_target_end": off_t[1],
+ "off_target_pampos": off_t[2],
+ "off_target_strand": off_t[3],
+ "off_target_recid": off_t[4],
+ }
+ # Filter the off targets if the strand
+ # is not the opposite of the feature
+ off_t[5] = list(
+ filter(
+ lambda feat: get_strand_value(
+ off_target_dict["off_target_strand"]
+ )
+ != get_strand_value(feat.location.strand),
+ off_t[5],
)
- else:
- off_targets_list.append(off_target_dict)
- target.update({"off_targets": off_targets_list})
- else:
- target.update({"off_targets": off_targets_list})
+ )
+ # Loop through features associated to an off-target position
+ if len(off_t[5]) > 0:
+ # Loop for each feature
+ for feat in off_t[5]:
+ feature_dict = {
+ "off_target_feat_strand": feat.location.strand,
+ "off_target_feat_start": feat.location.start,
+ "off_target_feat_end": feat.location.end,
+ "off_target_feat_type": feat.type,
+ }
+ for k, feat in feat.qualifiers.items():
+ if k != "translation":
+ feature_dict["off_target_" + k] = "::".join(
+ feat
+ )
+ off_targets_list.append(
+ {**feature_dict, **off_target_dict}
+ )
+ else:
+ off_targets_list.append(off_target_dict)
+ off_targets_per_seed.append(
+ {
+ "id": str(i) + "-" + str(seed_size),
+ "seed_size": seed_size,
+ "off_targets": off_targets_list,
+ }
+ )
+ else:
+ off_targets_per_seed.append(
+ {
+ "id": str(i) + "-" + str(seed_size),
+ "seed_size": seed_size,
+ "off_targets": [],
+ }
+ )
+ # target.update({"off_targets": off_targets_list})
+ target.update({"off_targets_per_seed": off_targets_per_seed})
else:
- target.update({"off_targets": []})
+ target.update({"off_targets_per_seed": []})
return alltargets
else:
return []
diff --git a/pyproject.toml b/pyproject.toml
index 6bab28dbacede95d8211712738043a5ae34e9a20..ad1f1868cb6f10c2b23ee673b6256c005b7ce18d 100644
--- a/pyproject.toml
+++ b/pyproject.toml
@@ -1,6 +1,6 @@
[tool.poetry]
name = "crisprbact"
-version = "0.3.2"
+version = "0.3.3"
license = "GPL-3.0"
description = "Tools to design and analyse CRISPRi experiments"
authors = ["David Bikard <david.bikard@pasteur.fr>", "Remi Planel <rplanel@pasteur.fr>"]