test.fastq2_trim_fastqc.html 342 KB
Newer Older
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
<html><head><title>test.fastq2_trim.fq FastQC Report</title><style type="text/css">
 @media screen {
  div.summary {
    width: 18em;
    position:fixed;
    top: 3em;
    margin:1em 0 0 1em;
  }
  
  div.main {
    display:block;
    position:absolute;
    overflow:auto;
    height:auto;
    width:auto;
    top:4.5em;
    bottom:2.3em;
    left:18em;
    right:0;
    border-left: 1px solid #CCC;
    padding:0 0 0 1em;
    background-color: white;
    z-index:1;
  }
  
  div.header {
    background-color: #EEE;
    border:0;
    margin:0;
    padding: 0.5em;
    font-size: 200%;
    font-weight: bold;
    position:fixed;
    width:100%;
    top:0;
    left:0;
    z-index:2;
  }

  div.footer {
    background-color: #EEE;
    border:0;
    margin:0;
	padding:0.5em;
    height: 1.3em;
	overflow:hidden;
    font-size: 100%;
    font-weight: bold;
    position:fixed;
    bottom:0;
    width:100%;
    z-index:2;
  }
  
  img.indented {
    margin-left: 3em;
  }
 }
 
 @media print {
	img {
		max-width:100% !important;
		page-break-inside: avoid;
	}
	h2, h3 {
		page-break-after: avoid;
	}
	div.header {
      background-color: #FFF;
    }
	
 }
 
 body {    
  font-family: sans-serif;   
  color: #000;   
  background-color: #FFF;
  border: 0;
  margin: 0;
  padding: 0;
  }
  
  div.header {
  border:0;
  margin:0;
  padding: 0.5em;
  font-size: 200%;
  font-weight: bold;
  width:100%;
  }    
  
  #header_title {
  display:inline-block;
  float:left;
  clear:left;
  }
  #header_filename {
  display:inline-block;
  float:right;
  clear:right;
  font-size: 50%;
  margin-right:2em;
  text-align: right;
  }

  div.header h3 {
  font-size: 50%;
  margin-bottom: 0;
  }
  
  div.summary ul {
  padding-left:0;
  list-style-type:none;
  }
  
  div.summary ul li img {
  margin-bottom:-0.5em;
  margin-top:0.5em;
  }
	  
  div.main {
  background-color: white;
  }
      
  div.module {
  padding-bottom:1.5em;
  padding-top:1.5em;
  }
	  
  div.footer {
  background-color: #EEE;
  border:0;
  margin:0;
  padding: 0.5em;
  font-size: 100%;
  font-weight: bold;
  width:100%;
  }


  a {
  color: #000080;
  }

  a:hover {
  color: #800000;
  }
      
  h2 {
  color: #800000;
  padding-bottom: 0;
  margin-bottom: 0;
  clear:left;
  }

  table { 
  margin-left: 3em;
  text-align: center;
  }
  
  th { 
  text-align: center;
  background-color: #000080;
  color: #FFF;
  padding: 0.4em;
  }      
  
  td { 
  font-family: monospace; 
  text-align: left;
  background-color: #EEE;
  color: #000;
  padding: 0.4em;
  }

  img {
  padding-top: 0;
  margin-top: 0;
  border-top: 0;
  }

  
  p {
  padding-top: 0;
  margin-top: 0;
  }
187
</style></head><body><div class="header"><div id="header_title"><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAADfUlEQVR42rWXT0hUURTGj5ZpaZqDmYNaCZkuMjXFiiTThZEyoiRlZGmCBYlWMBU5kW+cmRwhKEQXEkRFEBkGQUbpQmnjwk0S4TKiFuWmFqlhf17fbe7Qm8e9z/dmpoEfDr57z/nueeeec4ZUVaVw6CNKdRM1KEQ3wWMwCSbAQ9AHakDSSnYsO4bRDDAAloC6Al9Bbz/R+qgIgLFy8MmEYz1zHqI8qQB8NoCtoAgcAPWgFZzXOC8D38NwHuQzyApLgJ8oBZs/Sgw/ZbngJcpmp8T34/jfa8naaXiLsfwKYNQlMejXG+TRSgJjoj2wVWtJADbF8vDpjb0ROdfsSweLgn3PLQnoJSqWnL7ZhPhBwb6FYaI4fQ4kgy2gEFRocwAh65AIyDAhoE6yt9S0ACx2CwwsG4VfI6BIkgcOKzkwIDDyXninaWQV6s5uIuUSuJdEzpeSCLRaEXBDYGA+1PFwHALVAafvgBokhS4Ia0IJOWaxvtaUANkVHCCKDzj3ZsPZtNZxkM3UJhSQSe3s+ZTZJDwmMoKik0vks8PQB5FzRhHVCwXg1ZgX4COyi4z0UCweKTMS5wvAc5ES3+r3dZFtia+ZMl0JWQnVG7pKq7/F0xWRc4jy5GLNfpHwaxTbiTWNYMhKKXaIjJ0h+99E0zhfBFl4Vg2+SNpzcljtGBtHRSIu01q1ifLVCqpkf1mkXoGfgrW/tfdfVIgyQT4oA1U8D06As2wNGypgZCaCdtxtNA+kghxQrGnHLeAc6NFEIQHcZqex4JgNMEeiNpIxtlHzgwYqVJ0Y+VZwPg/SojoTBiKm9AcTz0Zdag61qAXUyFqvXyBi6H8IcErufzqfiPXNx2UoAJ9EkAZQVmk7L0h7QCWoAYdBM2jnAuokAqpYl4TT+4JItBkJsPGZcCco506bwGmA07K5hG6BO1wAZkjll0DABHvOBg44HNcJ+KEfx8J+BVzEmDgKbge/MWv4bwgttn/7vdkRCugtkbyGZYhwsdlAInwXeAYmIxLAjXllnZDPBiOgGyD6yiMwq3ke0g3X8WKUwbsiS8QCUAr28cp4iBeoo+BkYJ8aA0N3DUQYMSVKwh1gL6jmmc9aMroX4RTs9ygNAjikJ6GRcHfyRmRFwHjEryBUxPWNMIrboswZOGU35wXADVMSoiogVIxvE6JSGej77lPgIGaEvKBTLX8AEZuD+ek/sxoAAAAASUVORK5C" alt="FastQC"/>FastQC Report</div><div id="header_filename">Mon 21 Feb 2022<br/>test.fastq2_trim.fq</div></div><div class="summary"><h2>Summary</h2><ul><li><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[PASS]"/><a href="#M0">Basic Statistics</a></li><li><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[PASS]"/><a href="#M1">Per base sequence quality</a></li><li><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[PASS]"/><a href="#M2">Per tile sequence quality</a></li><li><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[PASS]"/><a href="#M3">Per sequence quality scores</a></li><li><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAEkklEQVR42s2XV2hUaxSF/4nRiaIoiKA+CDYMdsQnS8CAFREVsV4VUR9sWMECVuzYsETsGnvvivVaImhyU+Hq9VUfzKtKkptk5nz3rPkz42RyJskE5Xpgw8yZ8++1Zu+1yzGA+T8t8UPGJP1lTGquMenZxvwh02fd02+/jECOMSNdoEwX6KtrgQJjSv425rtMn3VPv+kZPfvTCLj/MM11WphnTNnnlJRA6fDhsGkTHDsG16/D2bOwfj3OtGmUDhjAZ78/oGd1RmcbTOBPY5JdRxmuo/IvyclBZ/lyeP8ePn6EoiLIyYE3b+D5c3j4EG7fhitXICMDZ8QIiv3+oM7Kh3wlRCDfmFbuwawiY0orOnWCmzfhwwcoLITsbMjKgmfP4MEDuHULLl+2kTh+PESAvXth7Voq+/RBPuRLPutFoOqfZ/1jzL8KK3l5UFAA797B69fw9Cncv29JXboEmZk2HYcOwZ49sG0bbNwIa9aAGzWnd2/kSz69IlGDgEIm1s6UKZCfD2/fwqtX8OQJ3LsHN27AxYtw5gwcPQoHDsDu3bB1K2zYAKtXw7JlsHAhzJ0LM2fipKaGI5FRK4EqwZVXtGtnc/viBTx+DHfvWsFduACnT8ORI7B/P+zaBVu2hETIqlUWeMECmDMHZsyASZNg3DgYNYrK1q2R71hhViMg5X4xJsjOnfDoEdy5A9euwfnzcOqUTUNurgXevBnWrYOVK2HJEli0yGpDaZk4EcaOhZFuNaanw6BB0KsXxT6fhFnoSUC1q/Jxhg61ir56Fc6dg5Mn4fBhq/jKSggE7GcBL14M8+bZUEsfwSCUl8OJEzBkCAwcCP37h8Dp1g2nZUuEEd0nov995iefLxASVKyiX76Eigoil4jouY4doUcPmyIRC18isW8fdO8OXbpA27bgguP388ltWMKqTsC2168lXbtWV/T27bBihRWdQKMvERI5kY0G16XvSllSkoWIsm+uCSvctkME1MfVShkzxipapSRFz54NzZtbR1J7LIlwSmLBVZrJyTXAZY4lEAjNjjABDRP1c6ZO/aHoCROgSZMfh+OR8AJv3NgTPGzCEmaEgCaahgrTp8PSpaAe0KhRzcMicfCgNwmBKx11gMuEJcyaBAQ8axa0aeN9WGFVbmPDHk6HNOHzJU4gkgKVYN++iYNHC1PirYNEjRREROi2TM/QxwPXd6/qkJDjkPAUYbgMv3kdUt7VjOKVmpcmRELd0sOfZxlGGpGi4BU2db2ysprgioxXdZSW2qEU6yclJU4jimrFwXi5C5OIBvcqUYGrjGNTOHgwTufO8VtxtWFUGwmlw6vJiIQmZCx4ixa2p7glXrUlFdY5jstrKyOP9hqx2Jx36ADz54fGdEV9xnH0QhKso5api2Ramu2q7qISdENfr4UkdiVrEIlWrex4Vim6Y9xxR3JCK1nsUlpeX2BX4dp8Qo1IE9XVQ2W/fokvpZ5ruSvMYLxQaycYPRp27Ij0BWfyZIqbNm34Wh7vxUQ1/L1ZM5z27aFnT0LTUwNs/HicYcMoce9pqfkpLya/zavZb/Ny+qvsPyB3ge/Rlc06AAAAAElFTkSuQmCC" alt="[FAIL]"/><a href="#M4">Per base sequence content</a></li><li><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[PASS]"/><a href="#M5">Per sequence GC content</a></li><li><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[PASS]"/><a href="#M6">Per base N content</a></li><li><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAEpklEQVR42s1XfUyUdRz/URrktNpaW/aHW1LLNdN0+U9WSzdfcq31/uLrWvZP+Y/2T+mc54GplSCOt4CBgqicpICGwokvSYkc3B3nQJxmBSo0K6fsiJe759Pn+zzccRx3xyGwvO07fvye5/f9fH7f90cBUP+nDP+QSd1XZ1LT6hPU/FqzWi4ia9mTZ2NGwLZZvUag/Dqzul2XoDzOROVu3KI6RGQte/JM3pF3R41AbaJ6pT5RNdgT1L+tyXGezpJFgM0MNGYDV34ALhUAtZugWZeh0/IiWpNiPfKunJGzd03glEmNo6L0erPqbkse59WqvwD+bgJuXQL+cgF/2oAbPwPXTgJ/HAOulgKXLYArHdqRxWjfGeuVs6JDdA2LgMOkHrGbVbVri+rsyZ9K5YeBfy4CNxsIXEvgaqC1Cvi9nM9KCFwENNMSjTk6ATiSgfMb0XtgJkSH6BKdURHQb84DzVtVl5gVN+0UJ9B+Hrh+lsAnjBsL+K8Ev3KQbtgLXMgkcBJQt5Xgm4Fz6wFaTds/A6JLdIayxCACYjJhrVV+RGAHgWsI/BPQYgV+O0rQQ1xXAJ4uwNvNv5TeTuBiHoFNwC9fAWfXAWfWACc/BayroBVOMyxB3REJ6AFHv/XkTuZN6dvrpwlWSeAjfQG3j0C7DRKaB/6frF2pBF4LnP4cqFpN4JXA8Q+AH98CypagN+dRiO7gwBxAQCK3bYfywv4NzcxbXi0jcDGBC4GmPMPMDSmGv4MJ1G8n8CdA5XLg2PsEfpPAzMbD84Hil4B9z6E9KcYrGCEJSO5K+mhlC/oimr5tpm+bcgmcATh3EoTEbAnG/4EEvL1AzUYCvwccfQMoXUzgeQSeCxS9oIOj4BloWQ9DMALrRP/tWUBavovx6PkdGNHOZON25zZQ+RLAMpumfYegPQEEuLby5haCWeYYoPtnAoXPAvlPAbmPAwRHZixavlUewRpIQMorq5h7z9NGgXGl9UX0Nj2SYZnFw+OBdGVI8Rwj+Hw/Wcue73kEuZOiIFi+sq0TkDoupRTlNJ9jR18qmQyfZk8crGgEBDSKXrald/gISDOReo7KpQTexFT6kv58l7d+ILSiERAQESzB9BOQjiZNBdYVRipVsAZk3B9eyQgJCJZgDiYgwFUfM2gei6xktAn4XVDCFCx6fmglo+0CfxCyZEY0/VgFoS8N7+yKie4WAtZ1iz3AbYisR5KG/kLEIhEVgawJLDLxA0X2hjqXGRemEAWUYm9adH7Ui9PlA4bIOtK7GezCRS9D2xMfvhQPaEbRWKCjpT8GZB3OAlmT2JRYU8pXGFNSuGYU2I67U4cgUPrq4G4oe8Hv7Z4CnPiMLXoderKjaMeBA0lEV+Q8BLjb+gnIWvb8Jmd8FROnmlW15mt4C+KjG0iCR7KIJKRty8AiIms/OY5+Vk5CNvYURwY0tuRhjWTBQ+mQ7vDJ93H65AMbu2gDO6p9F4fS2cMfSkOO5QzMkNYQU+c/SeDX+W3AmeECpyZnKrTjH6I95cG7H8vDfZhIDnekTYCW9wSnnOnsmOyeFWxg5W9DK10I997pzPOY0fkwuWc+ze6Zj9Oxkv8AsrpUzUM9ceYAAAAASUVORK5C" alt="[WARNING]"/><a href="#M7">Sequence Length Distribution</a></li><li><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAEkklEQVR42s2XV2hUaxSF/4nRiaIoiKA+CDYMdsQnS8CAFREVsV4VUR9sWMECVuzYsETsGnvvivVaImhyU+Hq9VUfzKtKkptk5nz3rPkz42RyJskE5Xpgw8yZ8++1Zu+1yzGA+T8t8UPGJP1lTGquMenZxvwh02fd02+/jECOMSNdoEwX6KtrgQJjSv425rtMn3VPv+kZPfvTCLj/MM11WphnTNnnlJRA6fDhsGkTHDsG16/D2bOwfj3OtGmUDhjAZ78/oGd1RmcbTOBPY5JdRxmuo/IvyclBZ/lyeP8ePn6EoiLIyYE3b+D5c3j4EG7fhitXICMDZ8QIiv3+oM7Kh3wlRCDfmFbuwawiY0orOnWCmzfhwwcoLITsbMjKgmfP4MEDuHULLl+2kTh+PESAvXth7Voq+/RBPuRLPutFoOqfZ/1jzL8KK3l5UFAA797B69fw9Cncv29JXboEmZk2HYcOwZ49sG0bbNwIa9aAGzWnd2/kSz69IlGDgEIm1s6UKZCfD2/fwqtX8OQJ3LsHN27AxYtw5gwcPQoHDsDu3bB1K2zYAKtXw7JlsHAhzJ0LM2fipKaGI5FRK4EqwZVXtGtnc/viBTx+DHfvWsFduACnT8ORI7B/P+zaBVu2hETIqlUWeMECmDMHZsyASZNg3DgYNYrK1q2R71hhViMg5X4xJsjOnfDoEdy5A9euwfnzcOqUTUNurgXevBnWrYOVK2HJEli0yGpDaZk4EcaOhZFuNaanw6BB0KsXxT6fhFnoSUC1q/Jxhg61ir56Fc6dg5Mn4fBhq/jKSggE7GcBL14M8+bZUEsfwSCUl8OJEzBkCAwcCP37h8Dp1g2nZUuEEd0nov995iefLxASVKyiX76Eigoil4jouY4doUcPmyIRC18isW8fdO8OXbpA27bgguP388ltWMKqTsC2168lXbtWV/T27bBihRWdQKMvERI5kY0G16XvSllSkoWIsm+uCSvctkME1MfVShkzxipapSRFz54NzZtbR1J7LIlwSmLBVZrJyTXAZY4lEAjNjjABDRP1c6ZO/aHoCROgSZMfh+OR8AJv3NgTPGzCEmaEgCaahgrTp8PSpaAe0KhRzcMicfCgNwmBKx11gMuEJcyaBAQ8axa0aeN9WGFVbmPDHk6HNOHzJU4gkgKVYN++iYNHC1PirYNEjRREROi2TM/QxwPXd6/qkJDjkPAUYbgMv3kdUt7VjOKVmpcmRELd0sOfZxlGGpGi4BU2db2ysprgioxXdZSW2qEU6yclJU4jimrFwXi5C5OIBvcqUYGrjGNTOHgwTufO8VtxtWFUGwmlw6vJiIQmZCx4ixa2p7glXrUlFdY5jstrKyOP9hqx2Jx36ADz54fGdEV9xnH0QhKso5api2Ramu2q7qISdENfr4UkdiVrEIlWrex4Vim6Y9xxR3JCK1nsUlpeX2BX4dp8Qo1IE9XVQ2W/fokvpZ5ruSvMYLxQaycYPRp27Ij0BWfyZIqbNm34Wh7vxUQ1/L1ZM5z27aFnT0LTUwNs/HicYcMoce9pqfkpLya/zavZb/Ny+qvsPyB3ge/Rlc06AAAAAElFTkSuQmCC" alt="[FAIL]"/><a href="#M8">Sequence Duplication Levels</a></li><li><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAEkklEQVR42s2XV2hUaxSF/4nRiaIoiKA+CDYMdsQnS8CAFREVsV4VUR9sWMECVuzYsETsGnvvivVaImhyU+Hq9VUfzKtKkptk5nz3rPkz42RyJskE5Xpgw8yZ8++1Zu+1yzGA+T8t8UPGJP1lTGquMenZxvwh02fd02+/jECOMSNdoEwX6KtrgQJjSv425rtMn3VPv+kZPfvTCLj/MM11WphnTNnnlJRA6fDhsGkTHDsG16/D2bOwfj3OtGmUDhjAZ78/oGd1RmcbTOBPY5JdRxmuo/IvyclBZ/lyeP8ePn6EoiLIyYE3b+D5c3j4EG7fhitXICMDZ8QIiv3+oM7Kh3wlRCDfmFbuwawiY0orOnWCmzfhwwcoLITsbMjKgmfP4MEDuHULLl+2kTh+PESAvXth7Voq+/RBPuRLPutFoOqfZ/1jzL8KK3l5UFAA797B69fw9Cncv29JXboEmZk2HYcOwZ49sG0bbNwIa9aAGzWnd2/kSz69IlGDgEIm1s6UKZCfD2/fwqtX8OQJ3LsHN27AxYtw5gwcPQoHDsDu3bB1K2zYAKtXw7JlsHAhzJ0LM2fipKaGI5FRK4EqwZVXtGtnc/viBTx+DHfvWsFduACnT8ORI7B/P+zaBVu2hETIqlUWeMECmDMHZsyASZNg3DgYNYrK1q2R71hhViMg5X4xJsjOnfDoEdy5A9euwfnzcOqUTUNurgXevBnWrYOVK2HJEli0yGpDaZk4EcaOhZFuNaanw6BB0KsXxT6fhFnoSUC1q/Jxhg61ir56Fc6dg5Mn4fBhq/jKSggE7GcBL14M8+bZUEsfwSCUl8OJEzBkCAwcCP37h8Dp1g2nZUuEEd0nov995iefLxASVKyiX76Eigoil4jouY4doUcPmyIRC18isW8fdO8OXbpA27bgguP388ltWMKqTsC2168lXbtWV/T27bBihRWdQKMvERI5kY0G16XvSllSkoWIsm+uCSvctkME1MfVShkzxipapSRFz54NzZtbR1J7LIlwSmLBVZrJyTXAZY4lEAjNjjABDRP1c6ZO/aHoCROgSZMfh+OR8AJv3NgTPGzCEmaEgCaahgrTp8PSpaAe0KhRzcMicfCgNwmBKx11gMuEJcyaBAQ8axa0aeN9WGFVbmPDHk6HNOHzJU4gkgKVYN++iYNHC1PirYNEjRREROi2TM/QxwPXd6/qkJDjkPAUYbgMv3kdUt7VjOKVmpcmRELd0sOfZxlGGpGi4BU2db2ysprgioxXdZSW2qEU6yclJU4jimrFwXi5C5OIBvcqUYGrjGNTOHgwTufO8VtxtWFUGwmlw6vJiIQmZCx4ixa2p7glXrUlFdY5jstrKyOP9hqx2Jx36ADz54fGdEV9xnH0QhKso5api2Ramu2q7qISdENfr4UkdiVrEIlWrex4Vim6Y9xxR3JCK1nsUlpeX2BX4dp8Qo1IE9XVQ2W/fokvpZ5ruSvMYLxQaycYPRp27Ij0BWfyZIqbNm34Wh7vxUQ1/L1ZM5z27aFnT0LTUwNs/HicYcMoce9pqfkpLya/zavZb/Ny+qvsPyB3ge/Rlc06AAAAAElFTkSuQmCC" alt="[FAIL]"/><a href="#M9">Overrepresented sequences</a></li><li><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[PASS]"/><a href="#M10">Adapter Content</a></li></ul></div><div class="main"><div class="module"><h2 id="M0"><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[OK]"/>Basic Statistics</h2><table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>test.fastq2_trim.fq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>8709</td></tr><tr><td>Sequences flagged as poor quality</td><td>0</td></tr><tr><td>Sequence length</td><td>30-175</td></tr><tr><td>%GC</td><td>54</td></tr></tbody></table></div><div class="module"><h2 id="M1"><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[OK]"/>Per base sequence quality</h2><p><img class="indented" src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAyAAAAJYCAIAAAAVFBUnAAAqXUlEQVR42u3dS3rbxraAUc5/Mh6EO5zB7dx22p4BTxIe0zh4FHa9wAKw9qdGIltaEgkWfgMk+HgZY4wxxpim83ATGGOMMcYILGOMMcYYgWWMMcYYI7CMMcYYY4zAMsYYY4wRWMYYY4wxAssYY4wxxggsY4wxxhiBZYwxxhgjsIwxxhhjjMAyxhhjjBFYxhhjjDECyxhjjDFGYBljjDHGGIFljDHGGCOwjDHGGGMEljHGGGOMEVjGGGOMMQLLGGOMMUZgGTPGhvuw6R59U6/e5l+/Ix7/zlVvXnPManD2rcgILGP+rGWVy9lyt2R9vG1grW5dQ20Pyx+mxwbc5FcO3npD3c5NbkMLiBFY5jr/1my7GlofBdYytm4VWF1/4GVdjfNjtypLD3YjsMwV6iq9d5ntNZf/Vp594ezvRHa0q//+Tn9y+QPM9jTx7xk5GNAcLftJdgNr92covpF3f+Z4Ue3eiYmfJ7g1bv2c6U/ultbWfR1/UERu59zAivzl4ts8a8NYrb2Ce1ZjGYFl7hVYu59f/Zu76+bWbmn12+7+d/qvBXe0uT9MLlrzk+wG1u6Bjd2fre2tV3Aj597piY2hX2DtbsC7v1e8RysDK/7AqXz0BR8pkXtNYBmBZe51BKvhbilrb11WfhE9chMV9ETbc3nxwCq745rceqtbVORAXWXWZ/2cXwmsgu7MCqzduGxyG9b/u6vsYWuMwDK3CKzIuYCCnV/iDEvZEr97Uim9u9r6BQsC69XiFGF9YMVvkOJbL142kRs56yRd8HlInf6pUBxYiRNkWamROCOfdVsJLCOwjPlOYJWdIpx+Jn4UpOERrIIjGQ2PYHU6Vtf89sk6zldwWO6wI1VnCaxWpwhr7hqBZQSWMd0bK/HfWzuV3MCKrPLFzwJJWGXPIoo8s2QLbfscrKwjWJGfIf4crKyf+RV77l3kh3kVPfGud2BFnpFWnGhZP3bkkZv7iHj1fA5W1j2rrozAMhdprNXFfeukw+rnt9bigpeVxT+ZXo7rX0X42jvNV4mW/ST1ryJ85Zy+LPiZc79Pzam04MYQD69E/SR+2vpThLl3aO79Eryt6jeMrMCK/4LGCCxzhUNZZ1fM13t9zK3I5neWVciV3I3AMhrL7s3Y9Rr3rBFYxnxpDbV0miZbkQ3JPWuMwDLGGGOMEVjGGGOMMQLLGGOMMcYILGOMMcaYrwZW5IojbjJjjDHGmGhgNXxLEGOMMcYYgbX2BwLLGGOMMeYrgfX3//7460fWx8+/fuZ+5BIHK8/HI/jxUeJfcrDyCM9HiX9JjXKl34VCoVAozZXRAyv3OVgC62LK33for1/7H9MHwPIjsVUUK/EvGV8puMWWH+9vmHXvU+6jXOnxQrFaBh8vjmBJH4FlyZALFIFFoQgsgSWw9h5mBQeKLRlygSKwKJRbBFbZqwgF1sbyt/kcoQIl/Oyj0IdjSwKLIrA8KikC69AjWAXXwRJYW4FV0F5bH21/l63M8mAWWBSB5bFPEVjdTxFGv15g5dTVOL/LsrGKX6toyRBYFIFFoQgsgSWw1hvLg1lgUQSWxz5FYAksgdXgd5meLvRgFlgUgeWxTxFYAmtQZfcpUwP+Lu/GOvJh5kRk7usuRcmdlbLLM9qRUwSWwBJY3/9dPs+mt2SMqYiSmweWxwtFYAksgfU87+/yb2Yd9CY2jpMJLIrAolAElsAKKZFLKgx/odH5hSE820NgUQQWhSKwBJbAaqBMfxGBJbAoAotCEVgCS2A1/l3GCawD3pCn4HTnYSciL/Be9xRvLUWh9Fv5BdZlAyt4yfVzPZ/s/aysEQLLv/spFAqFklAElsA65fsqCizLH4VCoQgsgSWwGgbWY/oWiq0CK/fEisCiUCiUUyu9n1AhsK4ZWPG3ZD5pYC3frHr8p2xb/igUCsURLIElsM4RWLPSqg+s1WNjAotCoVAoAktg3TGw3sonj4IPgOXB4MlJw/XMElgUCoVCEVh3DKx4XV0vsD4PgNXS2sqphLL8OwKLQqFQKAJLYN0xsP53pkVV8tbFq0+lF1gUCoUyjjLgm6QJLIF1tcDqcf3r6eEugUWhUCgUgXW7wMqqK4GVpUxfqyiwKBQKhXLWwJqezVmG1NbnBZbA6vcObp/XKgosCoVCOekVqu4eWLN4mv7v1n8LLIF1zFvkrjaWwKJQKBTK+U4RfkJqedRKYE328c+fl7vkxICB9bm+g8CiUCgUyqUCyylCgfXdwPrc4AKLQqGc9LRawSvvjlEE1hGBtQyp6f8uG0tgCawjA2vaWAKLQqFQKNc5RSiwaupKYDVRPhfZElgUCoVCEVgCS2C1VZ4nDazbHsCnUCgUryJcf+WgU4QCS2BZ/igUCkVgtbkOVvr6WPcMrPfeXWB9NbAeW41lYaJQKI4rCyxXchdYAktgUSgUCkVgCSyBNUZgbZ0otDBRKBSKwBJY54uSz05dYAksCoVCoQgsgSWwBJaFiUKhUASWwBJYAmtPWTaWhYlCoVAElsA6WZRMd+cCqyywHuERWBTKzd9exv1CEVgCS2CVH8Eq+F2myqyxLEwUCoUisASWwBJYAotCoVAoAuvGgbW6I79SYLU9eSewKBQX53werjgRKbAElsC65i12fGCtHlm0MFEoFIrAElgCS2AJLArF08/dLxSBdb/A2nq1msAaIbCWl8+wMFEoFIrAElgCS2AJLAqFQqEILIElsP686XJoBBaFQqFQBJbA2qkrgTXgcbLpm3BbmCgUCkVgCSyBJbAEFoVCoVAElsCSPkM+0+vve8rCRKFQKAJLYJ0gF1brSvoILAqFQqEIrP3Amj4febWllp8XWNJHYFEoFApFYG0G1iyeVltKYEmfU1wM4t1YFiYKhUIRWMOdIlztrXsG1lZdSR+BRaFQKBSBVR5Yn//eCqxj3ozzSGX252lF+ggsCmUo5Zi3YXa/UIbakkcPrNXnYO0G1nl35Ft3lvQ5+/Xi351s+aNQKBRHsAY9grV6KGv8wApWr/QRWBYmCoVCEVjfCazZHB9Y4WOE6+UkSu75jod/bwYWJgqFQhFYo7+KsN8RrN1aEiUUgUWhUCiUa14Hq21gZR1tEiUUgUWhUCgUV3Lff16UXKD0D6xHpLFOsTAVvB7WUk6hUAZXVpdogRUNrOWZPrlAEVgUCoVyc+W9Pi9XaYG1E1iJp0/JBcphgbX1LyTLH4VCoYwQWMtVWmDd661yKALLIkuhUCitlEVUPQWWwKIILIsshUKhlCsbT716/j5pKLAEFuUMgbXbWJY/ipc4uF8oXw+sSWYJLIFFEVgWWQqFQslRAmcVngJLYFHOEVh7/2Cy/FEoFMoRSvCV3Z9XyAksuUARWBZZCoVCaRNY7ytFCyyBRRFYFlkKhULZVfLeXeP9fCyBJRcoQwdWorEsfxQKhdJbyaqlifIUWHKBIrAsshQKhdI2sP5cvkFgyQXKoIHV/H2vLLIUCoUSUd4vDKxRdl8MLrDkAkVgUSgUisDKVtJPpRVYcoHyzcD61fSNRS2yFAqFErnmQisl8UwPgSUXKF8OrF/t3ljUIkuhUCi7Vw1tq2ydiBBYcoHy/cD61eiNRS2yFAqFcnBgOYIlFygCyyJLoVBurbxfOSiwBBblRoE1bSyLLIVCoTRX3muswPpTS5+JfF5gUc4bWNPHv0WWcpjyfF/VJ/DhFqMIrIsE1jKqlp9fbS+5QDlpYH2OYFtkKRQKpaEyPUUgsFbO/UU+L7Aopw6s90JgkaVQKJRWyuxJrgJLYFFuG1j/fZ2LRZZCoVAEVq/A2nqu1VZ1CSzKBQLr/T5ZFlkKhUKpVJYXGhRYoZbyKkKKwLLIUigUSvytMqZKcO4VWIljWnKBcoHAer9blkWWQqFQOgXW8uP9DRMr/8VfRZioK4FFuVJgvRvLIkuhUCht38Tm7oG1db2r5bE7gUW5bmA9Io1lkaVQKJT/vd7Nc1e5dWC5kjtFYP36td9YFlkKhUJJp5XAElgUgbWyMMWXDIsshUK5pfLMPd4vsAQWRWAJLAqFQtl8zXXZS4IElsCiCKydxrLIUiiUWyrPmssyCyyBRRFYO41lKadQKLdSPketahSBJbAoIyrxK9Q1f+Hx9MNSTqFQbqXMlj6BJbAolC4L06y3ZuFlKadQKJdRloubwBJYFMrRC9NuclnKx1eeW/m8+Pgo8S9xv1DOoiT+3SiwBBaF8v3lbxZblnIKhTKwEjoeL7AEFoUy1vL3Wbks5RQKZRhleoz1iN9FYAksisDqff2YQd/x8JgTXk6rUSjfUmZRdfDvIrAEFkVgdV/+Igfk7TAoFEqTy82srjYCS2DJBcoFAyv9Uh07DAqF0uRdAof6J5zAEliU6wRWcL6+yJ43sApeeXel05125JTRlKxrxwgsgSUXKG2Utg/mtgvT6pUd7DAoFErwSz6vpBn2dxFYAosisK4QWMMeW6JQKB3exOY5/u8isAQWRWB9Z2H6+lNQKRTKWZTl+3cJLIElFygCS2BRKPdSwgeUox9nvMVuHVjTp/1GPi+wKAKr+VVq7Jac7qQMrhT0kPvl1oG1jKrlfwssisASWBTKra4dtfxwiwmsqlOEW1G1/F87corAargwTZ9UYedHobj8r8ASWHbkFIElsCiUsz47yi0msPoG1vK5VgKLIrAOXpjea72lnHKl02qjPW/Js6MEliNYcoEisCzllDueVitosuClDT4PMfe+wBJYcoFyo8D6vSewlFOcVmv5+j73vsDyKkK5QBFYAosynOK0GkVguQ4WhXLuwHrvzCzllHGuGO60GkVguZI7hSKw7DAoVYrTahSBJbAolKsG1sMlDSnHK7vPWHeLUQSWwKJQBJYdBiWqRJ637hajCCyBRaGcPrDer4qylFN6K1kvCXSLUQSWwKJQBJYdBmXnKKltjCKwBBaFcrvA+n10wVJO6XEpEC+koAgsgUWhCCxLOaXR+116twCKwBJYcoFy98B6N5alnFKvzJ5r5RajCCyBJRcoAstSTilXti5q5RajCCyBRaHcObAekcaylFOWSuIVgm4xisASWHKBIrAEFiVbSW82bjGKwBJYcoFy98Da3VlayikzJbLBuMUoAktgUSgCS2BRgsozeMjTLUYRWAKLQrl7YEXO+FjKKVnX9XCLUQSWwKJQBJbAouxflt0tRhFYAksuUARWtpJoLEv5vZWnW4wisASWXKAILIFFaaO8D1y5xSgCS2DJBYrAqlISlzWylN9N+WwMbjGKwBo3sB6TiXxeYFEElsCifFGZve+NW4wisEYMrGk8TVtqGVsCiyKwvr78rTaWpfw+yvJCDG4xisA6xylCgUURWALLDsO9T6EIrK8F1l//9yPv4/9/Zn/kEhTK2sc/m2tSiT+YP0rGl7RWVt+796S/CyWopN9Y0C1GGVnpvSafI7CynoNlR04RWN9a/pYniSzlV1V2L87uFqMIrNEDa/eQlcCiCCyBRTlQib7vjVuMIrDGDazVY1QCiyKwhl3+Zq8js5RfSflc4MotRhFY5w6sZV0JLIrAGn/5m14JyVJ+FeWftHKLUQTWFQLrsRjPwaIIrLMsf+/GspRfQPkctXKLUQTWBZ/knnUldztyisAaYfn7717ZUn5aZfpcK7cYRWAJLIFFEVgCi1KlrF411C1GEVgCy46cIrAGWf6elvJzKVuvEHSLUQSWwBJYFIE10PL3T2NZys+gpC++4BajCCyBJbAoAmus5e/dWHYYoyrPyHWt3GIUgSWwBBZFYA23/OVdPMkO46jwdb9QBJbAElgUgXX6IyV2GOM8N86pWwpFYAksisASWHYYbS4A++eiVm4xisASWAKLIrCusfxF38DODqPDe0R6CyPK5ZXgVK7JcUVgyQWKwDpO8WTqMmVy8Knkw46ccnll+ZHqgdI1OUsRWHKBIrCOvhyAHUbs6efPyEv83GIUisASWBTKoIGVe2i9/niMHUbi6JRdLIUisAQWhXL6wCpYmK4aWInjRqdT7MgpAktgCSyKwLpXYCUa601nPbWoeCkPPFfp2e6Vd+HzfXaxFIrAElgUisAqXmQT5RRUgs/p3jwTl3/tqMyLcxZ8iV0shSKwBBaFIrBGfa1iurpavb3M/kEvOz8KRWAJLLlAEVjXCKwvXkDBzo9CEVgCSy5QBJbAolAoAktgCSyKwBJYFAqFIrAqA2t6AZ5lSG193o6cIrAEFoVCObUSvTifwCoIrGk8zVpq678FFkVgCSwKhXLDt2EWWOWnCD8htTxqJbAoAktgUSgUgSWwGgSWU4SUmwTWAW9iI7AoFIrAumlgbZ0uXDaWwKJcKbCOSR+BRaFQBNYdA2uZUOn/tSOn3DywDnhyqB0GhULp93byAuuIwFo9CSiwKALrdMfJ7JYoFBdQGGodu/tlGnafjyWwKAJLYFEoFIElsDIu0zCb4PWx7MgpAktgUSgUgSWwXMmdIrAElt0ShSKwBJbAkgsUgWW3RKFQBJbAkgsUgSWwKBSKwBJYAosisAQWhUIRWAJLYFEoAstuiUKhCCyBJRcoAktgUSgUgSWwBBZFYAksCoUisASWwKJQBJbdEoXS/+1lCt4m6xhFYAksuUARWAKLQnHUhyKwBBZFYAksCkVgSR+BJbAoFIFlF0uhCCyBJbDkAkVgCSwKRWBRBJbAoggsgUWhCCzpI7AEFkVgCSy7WApFYAksgSUXKALLLpZCEVgUgSUXKAJLYFEoAkv6CCyBRRFYAotCEVjSR2AJLApFYNnFUigCi3KGwJpedH+1pZafF1gUgSWwKN5eZrS3lxFYAmugwJrG01ZLCSyKwBJYFMr1Hi/SR2Add4pw1lLv/xVYFIElsCgUgSV9BFabwPr8t8CiCCyBRaEILOlTdr/kniC+YGCtHr4SWBSBJbAoFIElsFopBSv/uQNrq64EFkVgCSwKRWAJLIFVElhbz23feoGhwKIILIFFEVgCS2AJrJ3LNOxe9coRLIrAElgUisASWAIr4zINiSNVAosisAQWhSKwBJbAciV3CkVgyQXKTQOr66vVBJbAElgUisCSCxRvL0MRWAJLLlAElsCiCCxRIrAElsCiCCyBRRFYcoEisAQWRWAJLLlAEVgUgSWw5AJFYMkFSn/FE8MpAktgUSgCSy5QWipygSKwBBaFIrDkAkVgUQSWwJILFIElsCgCi0LJXPkzzlwLLLlAEVgCiyKwKJTmK7/AkgsUgSWwKAKLQhFYAosisAQWRWDJBYrAElgUisASJRSBRRFYAksuUASWwKIILIrAElgCiyKwBBZFYMkFisASWBSKwBIlFIFFEVgCSy5QBJZcoAgsisASWHbkFIElsCgCS5RQBNYssKYXRY18XmBRBJbAoggsuUARWKnAmsbTtKW2Pi+wKAJLYFEEllygCKy8U4TLg1WrnxdYFIElsCgCSy5QBJbAoggsgSVKrq/E3yJXLlAE1nGBFawrgUURWAKLMqBiR04RWCMGVryuBBZFYAksisCiUATWfmBl1ZXAoggsgUURWBSKwNq/TENWXQksisASWBSBRaEIrJ3LNMwm/XmBRRFYAosisCgUgeVK7hSBJbBEicCSCxSBJbDkAkVgyQWKwKIILIFlR04RWAKLIrAoFIElsCgCS2BRBJZcoAgsgUWhCCxRQhFYFIElsOQCRWAJLIrAolAElsCiCCyBRRFYcoEisAQWhSKwRAnFjpwisASWXKAILIFFEVgUgSWwBBZFYAksisCSCxSBJbAoFIElSgSWHTlFYAksuUARWFuBFRxRQrEjpwgsgSUXKAKrlyJKBJYdOUVgCSy5QBFYAosisCgCS2AJLIrAElgUgUWhCCyBRaEILFEisDxeKAJLYMkFisASWBSBRRFYAsuOnCKwBBZFYFEoAktgUQSWwBIlAsvjhSKw+gbW9Go6kc8LLIrAElgUgUWhCKxUYE3jadZSn/8WWBSBJbCkj8CiUARW+SnCraha/q8dOUVgCSyKwKJQBFbrwPrxI+/j58/sj1yCQln7+GdzzVRSW/jYSsZe+beS8SWUsZUrbcmUCyttV/5zBNbq+UGBRRFYAkv6CCwKRWAVBtZuUQksisASWBSBRaEIrIzAWn0au8CiCCyBJX0EllygCKzyyzRkPR9LYFEElsCiCCwKRWDtXKZhNtHrYNmRUwSWwKIILApFYDW+krsdOUVgCSyKwKJQBJbAoggsgSVKBJbHC0VgCSy5QBFYAosisCgCS2DJBYrAElgUgUWhCCyBRRFYAkv6CCy5QBFYAotCsfwJrFsowbEjpwgsgSUXKAJLYFFCih05RWAJLDtyisASWBSBRaEILIFFEVgCS/oILApFYAksCkVgCSyBZUdOEVgCSy5QBJbAoggsCkVgCSyKwBJY0kdgUSgCS2BRKJY/gSWw7MgpAktgyQWKwBJYFIFFEVgCS2BRBJbAkj4Ci0IRWAKLQhFY0kdg2ZFTBJbAkgsUgSWwKAKLIrAElsCiCCyBRRFYFIrASgTW5+1CVytq608FFkVgCSyKwKJQBNbOEazVhEr/rx05RWAJLIrAolAElsCiCCyBJX0ElscLRWAJLLlAEVgC6ypKcGzJFIF18cDyHCyKwBJYAquVYhdLoQgsR7AoAktgCSyBRaEILIFFoVj+pI/AolAElsCSCxSBJbAEli2ZIrBucR2s5XOtPAeLIrAElsASWBSKwHIldwpFYEkfgUWhdFxh6l8PK7AEFkVgCSyBJbAolKFXfoElFygCS2AJLDtyisASWAKLIrAElsASWBSKwBJYFIrlT/oILApFYAksuUARWAJLYNmSKQJLYAksisASWBSBRaEILIFFoQgs6SOwKBSBJbDkAqVKybhMi8CSPgKLQhFYAotCOUwRWAJLYFEoAktgUSgCS/oILApFYAksO3KKwBJYAsuOnCKwBJbAoggsgUURWBSKwBJYFIrAkj4Ci0IRWAJLLlAElsASWHbkFIElsOzIKQJLYFEEFkVgCSyBRaEILOkjsCgUgSWwKBSBJbAElh05RWAJLDtyisASWBSBRRFYdw+sz9uGbIXU6p8KLIrAElgUgUWhCKydI1irgTX95OwvCCyKwBJYFIFFoQis7MDaOqYlsCgCS2BRBBaFIrCqAsspQorAElgCS2BRKAKrZWB9PrlsLIFFEVgCiyKwKBSBVXuKUGBRBJbAoggsCkVgCSwKRWBJH4FFoQisgV9F6BQhRWAJLIElsCgUgVVyHazVivIkd4rAElgCS2BRKALLldwpFIElfQQWhSKwBJZcoAgsgSWw7MgpAktgCSyKwBJYFIFFoQgsgUWhCCzpI7AoFIElsOQCRWAJLIFlR04RWALLjpwisAQWRWBRBJbAElgUisCSPgKLQhFYAotCEVgCS2DJBYrAElh25BSBJbAoduQUgSWwBBaFIrAElsCiUASWwKJQBJbAOlwJjh05RWAJLIFFoQgsgRVS7GIpFIElsCgUgSWwBBaFIrAEllygCCyBdawSPd9nF0uhCCyBRaEILIHl6ecUisASWHKBIrAElsCiUASWwLIjpwgsgSWw7GIpAktgCSwKRWAJLIFFoQisIwLr8/zNREst/1RgUQSWwBJYdrEUisDaOYIlsCgUgSWw7GIpFIF1UGC9Py+wKAJLYAksu1gKRWC1CazPJwUWRWAJLIFlF0uhCCyBRaEILIElsCgUgTVeYE0/I7AoAktgCSy7WApFYLUJrNkILIrAElgCyy6WQhFYbV5F6AgWRWAJLIFlF0uhCKzC62AlroYlsCgCS2AJLLtYCkVguZI7hSKwBJbAolAElsCSCxSBJbAEFoUisASWHTlFYAksgWUXSxFYAktgUSgCS2AJLApFYAksuUARWAJLYFEoAktg2ZFTBJbAElh25BSBJbAEFoUisASWXSyFIrAEFoUisASWwKJQBJbAsiOnCCyBJbAoFIElsAQWRWAJLIFlF0uhCCyBRaFUKI/wCCyBZRdLoQgsgUWhHKcILIFlR04RWAJLYFEoAktg2cVSKAJLYFEoJw+sY05ECiyBRaEILIFlR0659RGsThknsAQWhSKwBJYdOUVgCSyBRaEILIElsCgUgVWkRM+QHqvYxVIoAktgUSgC66yBdczvYudHoQisUQLr8++51Yra+lOBRaEILIFFoVAE1s4RrNWEmpWWwKJQBJbAolAoAqsqsNJ/QWBRKAJLYFEoFIElsCgUgSWw7GIpFIE1UmB5DhaFIrAEFoVCEVgtA2vr+e92sRSKwBJYFIrAElglgZX4vF0shSKwBBaFcl6lyXXjBFZJYKUPa9nFUigCS2BRKFdSzrgmn+A6WLNrMSwDVmBRKAJLYFEoAktguZI7hSKwBJZdLIUisASWHTlFYAksgUWhCCyBZRdLoQgsgUWhCCyBJbAoFIElsOxiKRSBJbAoFIElsAQWhSKwBJYdOUVgCSyBRaEILIElsCgUgSWw7GIpAktgCSwKRWAJLIFFoQgsgWVHTrmScsxbTBQoGV9yrFIWWAcox+z8hr1fKHdWBJbAolAooyuOLtjGKBSBJbAoFIrAElgUisASWBQKRWAJLFsyhSKwbDQUisASWLYxCkVgCSwKhSKwBBaFIrAEFoVCEVgCi0IRWALLRkOhCCyBZRujUASWwKJQKALrO1dBs41RKALLRkOhCCzXv7aNUSgCS2BRKBSBJbAoFIHVL7A+h7JXK2rrTwUWhXJn5eZvYmMbo1AEVvQI1lZgbf2pwKJQKJWKp59TKJQ7BtbsM8v/tdFQKBSB5d6nUASWwKJQKF9TCl55V3Dyzuv7KBSBJbBsNBQKhUKhUASWwKJQKBQKhSKwBBaFQqFQKBSB5VWENhoKhUKhUCgXug7W8npXroNFoVAoFApFYLmSO4VCoVAoFIElsGw0FAqFQqFQBJbAolAoFAqFIrAEFoVCoVAoFIElsGw0FAqFQqFQBJaNhkKhUCgUisASWBQKhUKhUASWwKJQKBQKhUIRWDYaCoVCoVAoAktgUSgUCoVCEVgCi0KhUCgUisASWDYaCoVCoVAoAktgUSgUCoVCEVgCi0KhUCgUisASWDYaCoVCoVAoAktgUSgUCoVCEVgCi0KhUCgUisASWDYaCoVCoVAoJw6sx2QEFoVCoVAoFIFVG1izqAo2lsCiUCgUCoUisAQWhUKhUCgUgSWwbJoUCoVCoVA8B8tGQ6FQKBQKRWA5gkWhUCgUCkVgCSwKhUKhUCgUgWWjoVAoFAqF4jlYnoNFoVAoFApFYLmSO4VCoVAoFIElsGw0FAqFQqFQBJbAolAoFAqFIrAEFoVCoVAoFIElsGw0FAqFQqFQBJaNhkKhUCgUisASWBQKhUKhUASWwKJQKBQKhUIRWDYaCoVCoVAoAktgUSgUCoVCEVgCi0KhUCgUCkVg2WgoFAqFQqEILIFFoVAoFApFYAksCoVCoVAoAktg2WgoFAqFQqEILIFFoVAoFApFYAksCoVCoVAoAktg2WgoFAqFQqFcJbAev0dgUSgUCoVCEVgNAmvaVcHGElgUCoVCoVAE1mZgxY9aCSwKhUKhUCgCKyOwnCKkUCgUCoUisFoG1qer4o0lsCgUCoVCoQis6ClCgUWhUCgUCkVgCSwKhUKhUCgCa+BXETpFSKFQKBQKRWA1CyxPcqdQKBQKhSKwXMmdQqFQKBSKwBJYNhoKhUKhUCgCS2BRKBQKhUIRWAKLQqFQKBSKwBJYNhoKhUKhUCgCS2BRKBQKhUIRWAKLQqFQKBSKwBJYNhoKhUKhUCgCy0ZDoVAoFApFYAksCoVCoVAoAktgUSgUCoVCoQgsGw2FQqFQKBSBJbAoFAqFQqEILIFFoVAoFApFYAksGw2FQqFQKBSBJbAoFAqFQqEILIFFoVAoFApFYAksGw2FQqFQKBSBJbAoFAqFQqEIrEBgPf4dgUWhUCgUCkVgCSwKhUKhUCgCa8jAeqeVwKJQKBQKhSKw2gTWp6sEFoVCoVAoFIElsCgUCoVCoQis8QJrGlUCi0KhUCgUisBqE1izEVgUCoVCoVAEVrPrYDmCRaFQKBQKRWAJLAqFQqFQKALLldxtNBQKhUKhUASWwKJQKBQKhSKwBBaFQqFQKBSBJbBsNBQKhUKhUASWwKJQKBQKhSKwBBaFQqFQKBSBJbBsmhQKhUKhUASWjYZCoVAoFIrAElgUCoVCoVAElsCiUCgUCoVCEVg2GgqFQqFQKAJLYFEoFAqFQhFYAotCoVAoFIrAElg2GgqFQqFQKAJLYFEoFAqFQhFYAotCoVAoFIrAElg2GgqFQqFQKALLRkOhUCgUCkVgbQTWYzICi0KhUCgUisCqDaxpVMUbS2BRKBQKhUIRWNFThAKLQqFQKBSKwBJYFAqFQqFQBNbAgeU5WBQKhUKhUARWy8CK15XAolAoFAqFIrD2AyurrgQWhUKhUCgUgbV/mQbXwaJQKBQKhSKwWl6mYTYCi0KhUCgUisByJXcKhUKhUCgCS2DZaCgUCoVCoQgsgUWhUCgUCkVgCSwKhUKhUCgCS2DZaCgUCoVCoQgsGw2FQqFQKBSBJbAoFAqFQqEILIFFoVAoFAqFIrBsNBQKhUKhUASWwKJQKBQKhSKwBBaFQqFQKBSKwLLRUCgUCoVCEVgCi0KhUCgUisASWBQKhUKhUASWwLLRUCgUCoVCEVgCi0KhUCgUisASWBQKhUKhUASWwLLRUCgUCoVCuUJgPSYjsCgUCoVCoQisNoE1+w+BRaFQKBQKRWCVB9YsqoKNJbAoFAqFQqEIrPaBZYwxxhhzw+kYWMYYY4wxRmAZY4wxxggsY4wxxpiTBtar6FWExhhjjDFmJ7Byr4NljDHGGGNSgdXg2xX1WdkFTmusXCJLyfqSrJckfPEWW35V5MdO/GmTmt/6JpFvnv47Tf6ZMfsmWXd02S9VfIdGXxTT5xbbehRkbWPLv3aBbSz3EdTpUdn2lrz271L82M/9nsf8Ls3vl8ol6NaB9bmlyv5y8MatebpYVsRU/u4F36HTrz/baTW5T7ParvnPk74ddr/57m3YKbAq46zyFktsn5Fvnv5dGq6MNb/pLM7qt7GtbxLZxtJ/p3ItWv3mNY/KxPds+OyR9EpSZmV9z66/S/1jPzfauv4uuUtEzfe85DOUvh9Y9V+be3/3C6z6QwuVYdEjSTsFVsPbLf34L759mtybNYts4mtbVXL8m+8e2Wp+PxZ8w963WNY2lv47lWtRbu01/J69V7lWO/Iv/i71j/3D1oSCFb7hNtZ1jyCwDs2a3Mdt2Zm7V+l50jMGVvy80okCq+2BooJThJEjEzW5sHrMP5gLW8f2e9yPBY/BswRWwVoU/8GaPyq/GFjFv8sXA6vmsf+qOFrZKbDKThEWfE+B1T2w+j3V6VV93qHgTFzxqdKs+Mv9+XvEX7AYGv48ic0g/ljtlwtZ54/iC3TlLRY8V7J7PmvrBj/ynEskaC5zi5X9E6XgUZkInSaP1lfsUGj975JO9q6/S81j/1Vx6rZHYO1+/1Yrf9vfRWAdnWWVT4064EBR8XHX3ANynQ4TLv/dGVn9e5xa2v3Hfdk/EIuPwWTdYulSrLzFcg9RJMS2t1junjJdxm23sdVvEtzGdr+2a2DlPirTh9xaPVrrOym4wnTdKiK3Ye5jv+B7Hva7nGsbE1jN6uqV8yzvmtcpdA2smhQ75taOB1bbr20YWFlrd83rWYLfZPelT7lf2zyw4oc3Wr2ayTbWaed3zPesuZd73Pu9t4rdJ060ul/6rQmX3MYEVsu/34kreHnja+O4+tcDq8cBvPjtU/zvvOLbof5VhK/OT9kOvkS/7S2W2D6zXkW4eyCw0/GA725jBa8ibLUjKTvs2vBUVMMHRXzLafW7NN8qcg+51f8uXdeE4Pawe5qy4fd8XWV6XQdrwAtBlR1YOuByU8XPCSv7wRrep7nXKGry80R+gPprFPUIrNw77la3WGQTKv7aJrdY2Q9Wszcte/Q1eVT23vYST5rOupJZzffsvadreL8ctiacfRu7xREsY4wxxpg7j8AyxhhjjBFYxhhjjDECyxhjjDFGYBljjDHGGIFljDHGGCOwjDHGGGMEljHGGGOMEVjGGGOMMQLLGGOMMUZgGWPMhRbE5Ft/pP9O4nte7A1AjDECyxizvr+vfOevrdro8QaOgwRWzY8nsIwRWMaY6wdWw33/1d6cVWAZYwSWMaZtYMXf6P7938u/v/vdZl+Y/gnjf3n2M6R/i8TnV5Xg309/H41ljMAyxtwxsJaNstpMW/8R/267R4Ny//KyctK/ReTn3A2srF9TYBkjsIwx1w+sxLGlREtF/rT48/V/Of4lnYiyn8QYI7CMMRcJrMjnV09+nSKwsk7hCSxjjMAyxnwnsBIxMfgRrMoqEljGGIFljKkNrGOeg9U7sHaPtMWfOLWqFDwHS10ZI7CMMTcNrFf+qwiXfxR8FWG/wAr+FvFX/6V/r+D3EVjGCCxjjDHr6VlWrq7kbozAMsYYUx5hbgRjjMAyxhiBZYwRWMYYY4wxAssYY4wx5p7zH5y/5IZ1CKiKAAAAAElFTkSuQmCC" alt="Per base quality graph" width="800" height="600"/></p></div><div class="module"><h2 id="M2"><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[OK]"/>Per tile sequence quality</h2><p><img class="indented" src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAyAAAAJYCAIAAAAVFBUnAAARDklEQVR42u3dSXbjyBJFQe5/ZX9XqEEOvg4JBDzcPQA29o4NslQSxV432Sgfm5mZmZm17uEsMDMzMxNYZmZmZgLLzMzMTGCZmZmZmcAyMzMzE1hmZmZmAsvMzMzMBJaZmZmZwDIzMzMTWGZmZmYmsMzMzMwElpmZmZnAMjMzMxNYZmZmZiawzMzMzASWmZmZmcAyMzMzM4FlZmZmJrDMzMzMBJaZ2VV3T4+HY2hmAsvM7P/l8W8t+fL6h3tD6vbjY2YCy8x+sa6O0qSSNe8TWLcfHzMTWGb2u3X19JGjx4G2P4947cbZvz88fc7g0F4P8/WTj75d5JN3T9HR9zIzgWVmdkNgnX78KGgigZX78/hE7R6xyOGYmcAyM7sosE4/fzbRij2XC6zISTMzgWVmdl1g7T6dty6wxt8uF1iDZyTNTGCZmV0dWLmnCP9+pPII1uCYTwWWi97MBJaZXdRYgz8PXio+FViDYIq8RqrxEaxIq5mZwDIzyzfWbvocvQ1w9+ODZ+IG9fN6mFPvIoycHO8iNDOBZWZ3ZtaN30XomJnAMjON1Xz4AsvMBJaZ2XRajRNKYJmZwDIzMzMTWGZmZmYmsMzMzMwElpmZmZnAMjMzMzOBZWZmZiawzMzMzATW0/d7/A8A4F4CCwBAYAksAEBgCSwAQGAJLAAAgSWwAACBJbAAAIElsAAABBYAgMASWACAwBJYAAACCwBAYAksAEBgCSwAQGAJLAAAgSWwAACBJbAAAIElsAAABJbAAgAElsACAASWwAIAEFgAAAJLYAEAAktgAQAILAAAgSWwAACBJbAAAIElsAAABJbAAgAElsACAASWwAIAEFguVABAYAksAEBgCSwAAIEFACCwBBYAILAEFgCAwAIAEFgCCwAQWAILABBYAgsAQGAJLABAYAksAEBgCSwAAIEFACCwBBYAILAEFgCAwAIAEFgCCwAQWAILAEBgAQAILIEFAAgsgQUACCyBBQAgsAQWACCwBBYAILAEFgCAwAIAEFgCCwAQWAILAEBgAQAILIEFAAgsgQUACCyBBQAgsAQWACCwBBYAILAEFgCAwBJYAIDAElgAgMASWAAAAgsAQGAJLABAYAksAACBBQAgsAQWACCwBBYAILAEFgCAwBJYAIDAElgAgMASWAAAAsuFCgAILIEFAAgsgQUAILAAAASWwAIABJbAAgAQWAAAAktgAQACS2ABAAJLYAEACCyBBQAILIEFAAgsgQUAILAAAASWwAIABJbAAgAQWAAAAktgAQACS2ABAAgsAACBJbAAAIElsAAAgSWwAAAElsACAASWwAIABJbAAgAQWAAAAktgAQACS2ABAAgsAACBJbAAAIElsAAAgSWwAAAElsACAASWwAIABJbAAgAQWAILABBYAgsAEFgCCwBAYAEACCyBBQAILIEFACCwAAAElsACAASWwAIABJbAAgAQWAILABBYAgsAEFgCCwBAYLlEAQCBJbAAAIElsAAABBYAgMASWACAwBJYAAACCwBAYAksAEBgCSwAQGAJLAAAgSWwAACBJbAAAIElsAAABBYAgMASWACAwBJYAAACCwBAYAksAEBgCSwAAIEFACCwBBYAILAEFgAgsAQWAIDAElgAgMASWACAwBJYAAACCwBAYAksAEBgCSwAAIEFACCwBBYAILAEFgAgsAQWAIDAElgAgMASWACAwBJYAAACS2ABAAJLYAEAAktgAQAILAAAgSWwAACBJbAAAAQWAIDAElgAgMASWACAwBJYAAACS2ABAAJLYAEAAktgAQAILIEFAAgsgQUACCyBBQAgsAAABJbAAgAElsACABBYAAACS2ABAAJLYAEAAktgAQAILIEFAAgsgQUACCyBBQAgsAAABJbAAgAElsACABBYAAACS2ABAAJLYAEACCwAAIElsAAAgSWwAACBJbAAAASWwAIABJbAAgAElsACABBYAAACS2ABAAJLYAEACCwAAIElsAAAgSWwAACBJbAAAASWwAIABJbAAgAElsACABBYAgsAEFgCCwAQWAILAEBgAQAILIEFAAgsgQUAILAAAASWwAIABJbAAgAElsACABBYAgsAEFgCCwAQWAILAEBgCSwAQGAJLABAYAksAACBBQAgsAQWACCwBBYAgMACABBYAgsAEFgCCwAQWAILAEBgCSwAQGAJLABAYAksAACBBQAgsAQWACCwBBYAgMACABBYAgsAEFgCCwBAYAEACCyBBQAILIEFAAgsgQUAILAEFgAgsAQWACCwBBYAgMACABBYAgsAEFgCCwBAYAEACCyBBQAILIEFACCwAAAElsACAASWwAIABJbAAgAQWAILABBYAgsAEFgCCwBAYAEACCyBBQAILIEFACCwAAAElsACAASWwAIABJbAAgAQWAILABBYAgsAEFgCCwBAYAksAEBgCSwAQGAJLAAAgQUAILAEFgAgsAQWAIDAAgAQWAILABBYAgsAEFgCCwBAYAksAEBgCSwAQGAJLAAAgeVCBQAElsACAASWwAIAEFgAAAJLYAEAAktgAQAILAAAgSWwAACBJbAAAIElsAAABJbAAgAElsACAASWwAIAEFgAAAJLYAEAAktgAQAILAAAgSWwAACBJbAAAAQWAIDAElgAgMASWACAwBJYAAACS2ABAAJLYAEAAktgAQAILAAAgSWwAACBJbAAAAQWAIDAElgAgMASWACAwBJYAAACS2ABAAJLYAEAAktgAQAILIEFAAgsgQUACCyBBQAgsAAABJbAAgAElsACABBYAAACS2ABAAJLYAEAAktgAQAILIEFAAgsgQUACCyBBQAgsFyoAIDAElgAgMASWAAAAgsAQGAJLABAYAksAACBBQAgsAQWACCwBBYAILAEFgCAwBJYAIDAElgAgMASWAAAAgsAQGAJLABAYAksAACBBQAgsAQWACCwBBYAgMACABBYAgsAEFgCCwAQWAILAEBgCSwAQGAJLABAYAksAACBBQAgsAQWACCwBBYAgMACABBYAgsAEFgCCwAQWAILAEBgCSwAQGAJLABAYAksAACBJbAAAIElsAAAgSWwAAAEFgCAwBJYAIDAElgAAAILAEBgCSwAQGAJLABAYAksAACBJbAAAIElsAAAgSWwAAAElksUABBYAgsAEFgCCwBAYAEACCyBBQAILIEFACCwAAAElsACAASWwAIABJbAAgAQWAILABBYAgsAEFgCCwBAYAEACCyBBQAILIEFACCwAAAElsACAASWwAIAEFgAAAJLYAEAAktgAQACS2ABAAgsgQUACCyBBQAILIEFACCwAAAElsACAASWwAIAEFgAAAJLYAEAAktgAQACS2ABAAgsgQUACCyBBQAILIEFACCwBBYAILAEFgAgsAQWAIDAAgAQWAILABBYAgsAQGABAAgsgQUACCyBBQAILIEFACCwBBYAILAEFgAgsAQWAIDAElgAgMASWACAwBJYAAACCwBAYAksAEBgCSwAAIEFACCwBBYAILAEFgAgsAQWAIDAElgAgMASWACAwBJYAAACCwBAYAksAEBgCSwAAIEFACCwBBYAILAEFgCAwAIAEFgCCwAQWAILABBYAgsAQGAJLABAYAksAEBgCSwAAIEFACCwBBYAILAEFgCAwAIAEFgCCwAQWAILABBYAgsAQGAJLABAYAksAEBgCSwAAIElsAAAgSWwAACBJbAAAAQWAIDAElgAgMASWAAAAgsAQGAJLABAYAksAEBgCSwAAIElsAAAgSWwAACBJbAAAASWwAIABJbAAgAElsACABBYAAACS2ABAAJLYAEACCwAAIElsAAAgSWwAACBJbAAAASWwAIABJbAAgAElsACABBYAAACS2ABAAJLYAEACCwAAIElsAAAgSWwAAAEFgCAwBJYAIDAElgAgMASWAAAAktgAQACS2ABAAJLYAEAvGlgPf7s9YMvqbT/8aPDEVgAwM8F1mtUPTXTwSNS++F1/H9dqADArz5FWAms4X+6UAEAgSWwAACBVQ+s02yKP0UosAAAgbUdvW49GFhPr38XWADArwfWVEgNPu4pQgBAYJ3UUu41WN5FCAD8dGA9Xrb78aPPD/+KLBcqAPCTL3Jf+ZvczczMzL5hbxRYZmZmZl8/gWVmZmYmsMzMzMwElpmZmZnAMjMzM7OPDazI6/AHXxX/wsSX/P3C2W8x9V2mvmTqLQw3nmNH/4bS+DCHv+AjeXwiBxI58PHnFI/Y7oFMXdC5E5W+QKNvollzjs3+TpngLegLrmOzt6BFt8rec/K7T0v6tj97mNeclvbLpXgX5BGsbTZHZu+jg/9wdT2wiqc9cQiLTv7TD62Wy3Sq7dqPz/h8OD3w0/NwUWAV46x4jg2un5EDP/udw233jJVTuvsPpxbLb3ydGf8UGXxO8b5o98Art8rBYbZc9yL3JLnvNXWYS09L/bY/G21LT8vsXUTlMBtPi8Dq/NrZy3tdYNUfWiiGxYokXRRYjefb+PafPn9aLs3Knezga7sqOX7gp49stV+OiQNcfY5NXcfGn1O8L5qtvcbDXH0v1/WD/MbTUr/tX3afkLiHb7yOLf2JILAuzZrZ223umbst+zzpJwZW/HmlDwqs3geKEk8RRh6ZqOTC7mP+wVw4emx/xeWYuA1+SmAl7oviR6z9VnljYKVPy42BVbntb4VHKxcFVu4pwsRhCqzlgbXupU5b+XmHxDNx6adKp+Jv9viviL9gMTQen8HVIH5bXZcLU88fxe+gi+dY8LmS0+ezjs7wK59ziQTN15xjub+iJG6Vg9BpubVusYdC66dlnOxLT0vltr8VnrpdEVinh991z997WgTW1VlWfGnUBQ8UpR93nX1AbtHDhK9/74zc+694aun0L/e5vyCmH4OZOsfGpVg8x2Yfohh8x95zbPYn5biMe69juwcSvI6dfu3SwJq9VY4fcuu6tdY7KXgPs/RaETkPZ2/7icO87LR81nVMYLXV1TbzKu/K+xSWBlYlxa45t+OB1fu1jYE1dd9deT9L8EBO3/o0+7XtgRV/eKPr3UyuY4t++F1zmJVLecWlv/pacfrCia7LZd19wldexwRW5+cv+naJtzduB4+r3x5YKx7Ai58/6b/npc+H+rsIt8Uv2Q6+Rb/3HBtcP6feRXj6QOCixwPuvY4l3kXY9YMk97Br41NRjTeK+DWn67S0XytmH3Krn5al9wnB68Pp05SNh7m9697l92C94S+Cyj2wdMGvm0q/Jix3xBov09nfUdRyfCJHoP47ilYE1uwF91PnWOQqlP7alnMsd8QqP01zt76WW+Xq697gRdNTv8mscpirf9I1Xi6X3Sd8+nXsJx7BMjMzM/umCSwzMzMzgWVmZmYmsMzMzMwElpmZmZkJLDMzMzOBZWZmZiawzMzMzExgmZmZmQksMzMzM4FlZvZFd4jDf8pj/DmDw3zzf9DDzASWmTU0ROWf5nyKjOK/pD5VOfcGVuXoCSwzgWVm3x9YjT/7vywdBJaZCSwzaw6s+D9c/+/Pr59/emhPXzg+hvFPfjoO41Mx+Pjudwl+/vhwNJaZwDKzXwys10bZbaajP8QP7fTRoNlPfq2c8amIHM/TwJo6mQLLTGCZ2fcH1uCxpUFLRf5v+uP1T45/yaJvkTsmZiawzOxLAivy8d0nvz4isKaewhNYZiawzOyewBrExJs/glWsIoFlZgLLzKqBdc1rsFYH1ukjbfEXTu1+l8RrsNSVmcAysx8NrG3+XYSv/yv4LsJ1gRU8FfF3/41PV/BwBJaZwDIzs/30zJWr3+RuJrDMzCwfYc4EMxNYZmYCy8wElpmZmZnAMjMzM/vN/Qc8q3HyiuICzgAAAABJRU5ErkJg" alt="Per base quality graph" width="800" height="600"/></p></div><div class="module"><h2 id="M3"><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[OK]"/>Per sequence quality scores</h2><p><img class="indented" src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAyAAAAJYCAIAAAAVFBUnAABFfUlEQVR42u3dB5RcZd0H4N00EiAxNEMTaQJBJNICAiEKhCZFUBQEqQqCooKCBfgISjtIbyJFDCKCUsQEpJdEKQomGAkBpuy0Te/JJpts+e5lEUOS3Z3ZuTNb5vmdHE9cNtl95v++s7/cuXNvVbOIiIiIRJoqD4GIiIiIgiUiIiKiYImIiIgoWCIiIiKiYImIiIgoWCIiIiIKloiIiIgoWCIiIiIKloiIiIiCJSIiIiIKloiIiIiCJSIiIqJgiYiIiChYIiIiIqJgiYiIiChYIiIiIgqWiIiIiChYIiIiIgqWiIiIiIIlIlFvwqoqhB72gBQJr9hHQETBEpEPfhC2JNofq93u52ue33me/7VQ/iqf333biYIlomCJyEd+ChbzE3H1P9t9C1Y5P60HNCoFS0TBEpF8W1EbB1SqVkprf3CVz8nn8MwaD6S1/cHVv4GVP7jGT2vti67yB1v7Blr75NWla/ybW3so8vweWvPmCWx7snk+qnkOoo2Clf9M8xlQkY9Vx74ZTx2iYIlIxAWr3Y+3VhHy/Lqr/8hv+4Nr/H3b/6ndz2mbsMYfuu1+88U8sHl68wS20fDyf+gKWgmFDrqYx7Cgx6rQBdb2oy2iYIlIUUewOlCwCvq5W9AH8/yGO/ZXFfSnomqoRX68Y8CChlXoSoh8piX6eFQPhYiCJaJgFfsSYYQ/s9t9Na3QH6KtvUhX0F+V52t8PaBg5fNiXGsja/f4X7uDLuilwHxe5ezA39PuyvESoShYIlKqgtXhgyLNK70aVeixkGIKTf78PL9uJRzByudh7Njxv0I7d/FHpJqjOJjagc8RUbBEdKz2f9/G0Z2CClY+PwKLP0WmuYhTlJoLPwerjaMpHXgAO+zNH5jP/y2oYOV/BKvdQRf5GBY0snYXWHN+5xSKKFgi0tzaj+HW+tDqh53W+PE2XnXK/4hI8e8ibPfT2vic/F8iLPRNeW2gWnu48n/bZrsHb9r4HjrwqOYDyfNbyv/7bHsKxTxW3kUoomCJlO9QVnf/KmKJioiCJVIpP8D8gBTrR0TBEpEofzT66SgKloiCJSIiIqJgiYiIiIiCJSIiIqJgiYiIiChYIiIiIqJgiYiIiChYIiIiIpGl/s03Z33ve8H/VmLBKtvlWGrLlbI9dERERERE3Uj0olRAFCxPOkRERERE5S5YDin17ChYnnSIiIiIiBQsUbBsUSIiIiIiBUsULAWLiIiIiIhIwVKwFCxPOkRERERECpYoWJ50iIiIiIgULFGwFCwiIiIiIgVLFCwFy5MOEREREZGCJQqWJx0iIiIiIgVLFCwFi4iIiIhIwerZiVVVVYJLwfKkQ0RERETU+QUr+PHc9ZtHyzdZ5Pf54R9f/TcKloLlSYeIiIiIqLIK1srfXjHf6up/VsFSsDzpEBERERFFX7DaPaiz8sdXP4zU8vuVP7jGT1vl46v8DW0fnWqjFbX2rbb93a7ybX/4OW38bW0T8n9winzc8vxmFCxPOkRERERE3aNgrV4F1nj0q+1ylv/viyxY7X58jZ+ZZ8EqXrTGx621v6Ggx1PB8qRDRERERNRFC1ahh7Xyeemq0CZU/BGsDhSsdl0d7nP5/1WFQrxE6EmHiIiIiKjLFayCjvSs8TWpPF9Hy+dlxwiPYLX7bUResPJ8cNr4q/J5CVXB8qRDRERERNQ9ClbHikihR2I6dgCszC8RrvKSaIePYLV7IKoDh6wcwfKkQ0RERETU7Y9gNbd5klBBx5Dy/32ePaON37f2cmehBSufE6fyURR6BKvtvyH/M70ULE86RERERESdVrDaPkhT0Bvl1vhp+bxm15zHuwhX/2sL+nJ5vvSZ5/GkDryLMP/Dcm3/zXk+ngqWJx0iIiIiok4+gtVZ6fDVp8pz2aoOvOTXpaJgedIhIiIiIqqUgpXPxQu6Qscq6LCTgqVgERERERERdfIRrEhud1Pqb6/Tj58pWJ50iIiIiIi6ZcGSHh8Fy5MOERERERFRTxDN/Na3YlVVs3/84y5+fEvBsqCJiIiIiIi6h6ipri4xaFBQsJa//baCpWARERERERERRSBa9PvfB+0qu+eezV0+CpYFTURERERE1D1EuQMPDArWgttvV7AULCIiIiIiIqIIRCvS6VivXvH+/RvnzVOwFCwiIiIiIiKiCERzL7ssVlU1/bjjmrtDFCwLmoiIiIiIqBuIUttuGxSsJU89pWApWEREREREREQRiJZOmBC0q5rNN29ubFSwFCwiIiIiIiKiCEQzTz89KFhzfvrT5m4SBcuCJiIiIiIi6tKipiVLEgMHhpe/eucdBUvBIiIiIiIiIopAtPDee8PLX+29d3P3iYJlQRMREREREXVpUW7//cPLX91xh4KlYBERERERERFFIFpRUxOrro4PGNC4YIGCpWARERERERERRSCae+ml4eWvTjihuVtFwbKgiYiIiIiIuqqoqSm19dZBwap75hkFS8EiIiIiIiIiikBU9+KL4eWvttiiu1z+SsGyoImIiIiIiLq6aMYpp4SXv7rooubuFgXLgiYiIiIiIuqKosZFixLrrhte/ioWU7AULCIiIiIiIqIIsvCee8LLX40Y0dwNo2BZ0ERERERERF1RlBs5MihYC+++W8FSsIiIiIiIiIgiSPaVV2LV1Yl11mlcuFDBUrCIiIiIiIiIIkjqvPNiVVUzTjqpuXtGwbKgiYiIiIiIupgol4tvvnl4+avnn1ewFCwiIiIiIiKiCJL54x/Dy19tuWVzU5OCpWARERERERERRZCar3wlvPzVJZc0d9soWBY0ERERERFRFxLl3n03NmBArLp6eSKhYClYRERERERERBEkfe21saqq5N57N3fnKFgWNBERERERURcSJYYPDwpW+oYbFCwFi4iIiIiIiCiK1wdffjloV/F11sl1w9vjKFgWNBERERERUVcUpb7//fD1wa99rZwiBcuCJiIiIiIi6rmibDa+6aZBwco88oiCpWDZokRERERERFH0qwcfDNpV4pOfrM3lFCwFyxYlIiIiIiKKIMmjjw4KVur888ssUrAsaCIiIiIiop4pyr3zTqx//1h1de4f/1CwFCxblIiIiIiIKIKkf/nL8PT2ffctv0jBsqCJiIiIiIh6piix227h5a9uvlnBUrBsUSIiIiIioiheH5wwIbz81brr1sbjCpaCZYsSERERERFFkNQ55wQFq+b44ztFpGBZ0ERERERERD1OlM3GN944KFjZxx5TsBQsW5SIiIiIiCiCZO6/P3x9cKutOkukYFnQREREREREPU2UPOqo8PJXP/6xgqVg2aJERERERERRZOrU2FprxXr1yr3+uoKlYNmiREREREREESR91VXh7XH2268TRQqWBU1ERERERNSjRMlddw3v7nzrrQqWgmWLEhERERERRZDsSy+Fp7cPGlSbSChYCpYtSkREREREFEFqzj47vPzViSd2rkjBsqCJiIiIiIh6iiiTiQ8ZEl7+auxYBUvBskWJiIiIiIii6Fe/+134+uA223S6SMGyoImIiIiIiHqIqOaII8K7O//sZwqWgmWLEhERERERRZEpU2L9+sV69879618KloJlixIREREREUWQ1OWXx6qqkl/4QlcQKVgWNBERERERUU8QJYYNCy9/dfvtCpaCZYsSERERERFFIMo+/3zQrmKDBtXW1ChYCpYtSkREREREFIEo9e1vh5e/OvnkLiIqbcGq+m/W2IrW+F8L/biCRUREREREVOGiXDod32ij8PJXjz9eEQWrjQL04QdXL1IFfVzBIiIiIiIiqnBRZsyY8O7O223XdUSdU7CKLFVt/18LmoiIiIiIqKJEycMOCwpW6qKLFKwoC9Y4ERERqdT89Q9/eK9Pn/d69Xry3nt7AMcRLP9iICIiIiIi6nxR+he/CC9/deCBXUrkJUILmoiIiIiIqBuLEjvtFN4e5447FCwFyxYlIiIiIiKKQJR77rnw8leDB9emUgpWUaXKuwiJiIiIiIiIWlLzrW+Fl7869dSuJiptwar6aFZpRa6DZYsSERERERF1WJRLpeIbbBBe/urJJyurYJXp6ylYRERERERElSfK3HNPePmrHXbogiIFy4ImIiIiIiLqlqLkwQeHl7+65BIFS8GyRYmIiIiIiCIQ5SZPjvftG+/TJ/fmmwqWgmWLEhERERERRSBKX3ppePmrUaO6pkjBsqCJiIiIiIi6nyg+dGhQsDJ3361gKVi2KBERERERUQSi9I03Bu0qPmhQLr/LXylYCpYtSkRERERE1E4Sw4aF7x8cNqzLihQsC5qIiIiIiKibiZLvF6z0ZZcpWAqWLUpERERERBSBKJdOxwYMCApW7q23FCwFyxYlIiIiIiKKQJR96qnwBKytt+7KIgXLgiYiIiIiIupOovTll4f3H/zqVxUsBcsWJSIiIiIiikaUPPro8ASsq69WsBQsW5SIiIiIiCgaUfwTnwhv8PzccwqWgmWLEhERERERRSDKTZoUnoA1cGBtNqtgKVi2KBERERERUQSizF13hVfA2m+/Li5SsCxoIiIiIiKibiNKnXVWULBS552nYClYtigREREREVE0osTuu4e3ILz/fgVLwbJFiYiIiIiIohClUrF+/WLV1bVTpypYCpYtSkREREREFIEoM25ceALW9tt3fZGCZUETERERERF1D1Fq9OjwEqNf/7qCpWDZokRERERERNGIao44IjwB6/rrFSwFyxYlIiIiIiKKRhTfeOPwHs/jxytYCpYtSkREREREFIEo9/rrQbuKDR5cm8spWAqWLUpERERERBSBKHP77UHBSh5wQLcQKVgWNBERERERUTcQ1Xzzm+ElRi+4QMFSsGxRIiIiIiKiaESJXXYJz3D/4x8VLAXLFiUiIiIiIopClEzG+/aN9e6de+89BUvBskWJiIiIiIgiEGX//OfwEqOf/nR3ESlYFjQREREREVFXF6Uvuii8xOjJJytYCpYtSkREREREFI0oecghQcFK33STgqVg2aJERERERETRiOIbbRQUrOzLLytYCpYtSkREREREFIEo+8orQbuKb7hhNxIpWBY0ERERERFRlxalb745vMTowQcrWAqWLUpERERERBSNKHXKKeEJWBdeqGApWLYoERERERFRNKLETjuFJ2A9+qiCpWDZokRERERERBGIcrFYrHfveN++tYmEgqVg2aJEREREREQRiDJ/+lN4idHPfrZ7iRQsC5qIiIiIiKjrilI//nF4idHTT1ewFCxblIiIiIiIKBpR8sADw3s8/+pXCpaCZYsSERERERFFIcrlYoMHBwUr989/KlgKli1KREREREQUgSg3YUJ4idEhQ7qdSMGyoImIiIiIiLqoKH399eEJWIcfrmApWLYoERERERFRNKKaE04IClbqkksULAXLFiUiIiIiIopGlNhhh/AM97FjFSwFyxYlIiIiIiKKQJSbOjXWq1esX7/aVErBUrBsUSIiIiIioghEmT/8IbzE6G67dUeRgmVBExERERERdUVR6oc/DE/A+va3FSwFyxYlIiIiIiKKRpQcOTI8AevOOxUsBcsWJSIiIiIiikKUzcYHDQovMTpxooKlYNmiREREREREEYiyzz8fXmJ08827qUjBsqCJiIiIiIi6nCj9y18GBSv5pS8pWAqWLUpERERERBSNqOZrXwsKVvqyyxQsBcsWJSIiIiIiikYU32aboGBln3xSwVKwbFEiIiIiIqIIRLm33graVWzAgFw6rWApWLYoERERERFRBKLMvfeGJ2DttVf3FSlYFjQREREREVHXEqW+972gYNV897sKloJlixIREREREUUjSu6zT3iJ0d/+VsFSsGxRIiIiIiKiKESZTHzttcNLjE6erGApWLYoERERERFRBKLs00+HlxjdcstuLVKwLGgiIiIiIqIuJEpdcUV4AtaxxypYCpYtSkREREREFI0oecwx4SVGr7pKwVKwbFEiIiIiIqJoRIlPfjI8AevZZxUsBcsWJSIiIiIiikCUe/PN8ASsddetzWYVLAXLFiUiIiIiIopAlPnNb4KCldh33+4uUrAsaCIiIiIioq4iqjn77KBgpc49V8FSsGxRIiIiIiKiaESJ4cPDS4zed5+CpWDZokRERERERBGIcqlUbK21YtXVtW+/rWApWLYoERERERFRBKLs44+HJ2B96lM9QKRgWdBERERERERdQpT++c+DgpU87jgFS8GyRYmIiIiIiKIR1Rx5ZHiJ0WuvVbAULFuUiIiIiIgoGlF8002DgpV98UUFS8GyRYmIiIiIiCIQ5d54I2hXsUGDanM5BUvBskWJiIiIiIgiEKV//evwBKwvfKFniBQsW5SIiIiIiKjzRakzzggvMXr++QqWgmWLEhERERERRSNK7rpreALWgw8qWAqWLUpERERERBSFKJmM9e0b69Ur9+67CpaCZYsSERERERFFkOxjj8WqquJDh/YYkYJlixIREREREXWyKHXxxUHBqvnGNxQsBcsWJSIiIiIiiibJQw8NLzF6440KVr4Fq2qlFPNxBYuIiIiIiKiniuIf/3hQsHJ//7uClVfBWr08rf771j5HwSIiIiIiIqoE0YpkMjwBa/31e9KMOqdgFfpxBYuIiIiIiKinihb9/vfhJUZHjVKwulbBGiciIiLdNv88/PCgYL1y8skeiiBFnYPlCJZ/AxEREREREbUk8/4lRjMPP+wIlpcIbVEiIiIiIqII0rRkSbxPn+BXbTyuYClYtigREREREVEEqXvhhVhVVWLnnXvYjDqnYDV7F6EtSkRERERE1Nw894orwkuMnnqqglVAwWp2HSxblIiIiIiIqPVMO+KI8ASs225TsAorWOX4egoWERERERFR9xQlN9wwvMToa68pWAqWLUpERERERBRBlr/7bngFrE026XkzUrBsUSIiIiIios4RLfztb4OCNe2YYxQsBcsWJSIiIiIiiiYzzzwzKFjzrrlGwVKwbFEiIiIiIqJokv7MZ4KCtbT093hWsBQsW5SIiIiIqCJEjQsWxHr1ivfr17RsmYKlYNmiREREREREEaTu6adjVVXZvfbqkTNSsGxRIiIiIiKiThDNvfTSoGDNPvdcBUvBskWJiIiIiIgiUhxySFCwFv3pTwqWgmWLEhERERERRZGmpsTgwUHBWpHNKlgKli1KREREREQUQerfeiu8BeEWW/TUGSlYtigREREREVG5RQvuvDMoWNO/9jUFS8GyRYmIiIiIiKLJjNNOCwrW/BtuULAULFuUiIiIiIgomqR22CEoWMv+8Q8FS8GyRYmIiIiIiCJI49y5serq+IABTcuXK1gKli1KREREREQUQZY88UR4idERI3rwjBQsW5SIiIiIiKisojkXXRReYvSCCxQsBcsWJSIiIiIiiia5Aw4ICtbiP/9ZwVKwbFEiIiIiIqIo0tCQWHfdoGA1zJihYClYtigREREREVEEqZ80KWhXqa237tkzUrBsUSIiIiIiovKJFtx2W1CwZpx4ooKlYNmiRERERERE0WTGN74RXmL01lsVLAXLFiUiIiIiIoomqW22CS8xOnGigqVg2aJEREREREQRpGHmzKBdJdZdt7mhQcFSsGxRIiIiIiKiCLL4sceCgpXbf/8ePyMFyxYlIiIiIiIqk2j2j38cFKw5F16oYClYtigREREREVE0ye23X1Cwljz+uIKlYNmiREREREREEaRpxYr4gAGx6urGOXMULAXLFiUiIiIiIoogy/75z/ASo9tvXwkzUrBsUSIiIiIionKI5t94Y3iJ0VNPVbAULFuUiIiIiIgomkw/7rigYC244w4FS8GyRYmIiIiIiKJJzSc/GRSs+v/8R8FSsGxRIiIiIiKiCLIilwsvMfqxjzU3NSlYCpYtSkREREREFEEWP/RQULBqDz64QmakYNmiREREREREJRfNPu+8oGDNHT1awVKwbFEiIiIiIqJokv3c58JLjD71lIKlYNmiREREREREEaRp2bL4WmvFevVqXLBAwVKwbFEiIiIiIqIIsvTll2NVVemddqqcGSlYtigREREREVFpRfOuvTYoWDPPOEPBUrBsUSIiIiIiomgy7ctfDgrWwnvuUbAULFuUiIiIiIgomtRsumlQsJa/846CpWDZokRERERERBFkRU1N0K6SG2xQUTNSsGxRIiIiIiKiEooW/eEP4SVGDz9cwVKwbFEiIiIiIqJoRLPOOSe8xOjllytYCpYtSkREREREFI0os/vuQcGqe/55BUvBskWJiIiIiIgiEDXV1cX79In17t24eLGCpWDZokRERERERBGI6l56KVZVldlll0qbkYJlixIREREREZVKNO+qq4KCNes731GwFCxblIiIiIiIKBrRtCOPDArWovvuU7AULFuUiIiIiIgoGlFyo43CS4wmEgqWgmWLEhERERERRSBa/t574SVGhwypwBkpWLYoERERERFRSUQL7703KFjTvvQlBUvBskWJiIiIiIiiEc389reDgjXv6qsVLAXLFiUiIiIiIopGlB42LChYSydMULAULFuUiIiIiIgoAlHjwoWx3r3jffs2LV2qYClYtigREREREVEEorpnnw0vMTp8eGXOSMGyRYmIiIiIiKIXzf3FL8JLjP7gBwqWgmWLEhERERERRSOqPfTQ8BKjDz6oYClYtigREREREVEUoqamxHrrBQVrRTqtYClYtigREREREVEEovopU4J2VbP55hU7IwXLFiUiIiIiIopYtPDuu4OCNf3YYxUsBcsWJSIiIiIiikY08/TTg4I1//rrFSwFyxYlIiIiIiKKRpTeccfwEqOvvqpgKVi2KBERERERUQSixnnzYtXV8f79m+rrFSwFyxYlIiIiIiKKQLTkr3+NVVVl99mnkmekYNmiREREREREUYrm/N//BQVr9vnnK1gKli1KREREREQUjSh34IFBwVr8yCMKloJlixIREREREUUhamxMDBwYFKyGadMULAXLFiUiIiIiIopAVP/mm0G7Sm21VYXPSMGyRYmIiIiIiCITLbj99vASo1//uoKlYNmiRERERERE0YhmnHxyeInRW25RsBQsW5SIiIiIiCgaUepTnwoK1rI33lCwFCxblIiIiIiIKAJRw6xZQbtKrLNO04oVCpaCZYsSERERERFFIFrwq1+FlxgdPtyMFCxblIiIiIiIKBpR5rOfDQpWZpddzEjBskWJiIiIiIgiEDXMmBHv1y9WXb3ogQfMSMGyRYmIiIiIiCIQzbn44lhV1bSjjjIjBcsWJSIiIiIiikDUtGRJcoMNgoK19G9/MyMFyxYlIiIiIiKKQDT/llvC09v32suMylewqv6bNX4wz48rWERERERERF1U1NiY2mab8AbPDz1kRmUqWCu3nzX+fvWCVWhtUrCIiIiIiIg6URT0qvD+g9tsEzQtMypHwWqt+uRZqvJsTgoWERERERFRJ4qye+4Z3h7n1lvNqKwFa/WX/KItWONERESkk/L81VcH7eqdQYOeeOQRj0bxybdgrVyeCn1Z0BEsIiIiIiKiLi6adtRRQcGa83//Z0ad9hKhgmWLEhERERH1JNHyqVNj1dXx/v0bZs40IwXL+ImIiIiIiCIQzTzjjFhV1cwzzzSjshasVcqTdxHaokREREREPUYU3hunf/9Yr17L33nHjDqhYLkOli1KRERERNTzRMXcG0fBKrZglePrKVhERERERETlFRV5bxwFS8GyRYmIiIiIiFZNkffGUbAULFuUiIiIiIjooyn63jgKloJlixIREREREX0kxd8bR8FSsGxRIiIiIiKij6T4e+MoWAqWLUpERERERPS/LJ0wIWhXyQ03bKqrMyMFy/iJiIiIiIgiEEVybxwFS8GyRYmIiIiIiD5IVPfGUbAULFuUiIiIiIjog0R1bxwFS8GyRYmIiIiIiMJEeG8cBUvBskWJiIiIiIjCRHhvHAVLwbJFiYiIiIiIIr43joKlYNmiREREREREEd8bR8FSsGxRIiIiIqKKF0V9bxwFS8GyRYmIiIiIKl0U+b1xFCwFyxYlIiIiIqp0UeT3xlGwFCxblIiIiIiookWluDeOgqVg2aJERERERBUtKsW9cRQsBcsWJSIiIiKqXFGJ7o2jYClYtigRERERUeWKSnRvHAVLwbJFiYiIiIgqVFS6e+MoWAqWLUpEREREVKGi0t0bR8FSsGxRIiIiIqKKFMXjpbs3joKlYNmiRESdIMq99172xRcz999fc9ZZic99LnnCCanRo1NXXJG+9trMLbek77gjM2ZM9oEHMo88khk3Lvfss7nx47OvvpqbOLF2ypRcLJZLp82IiKjIpC6/vHT3xlGwFCxblIioZKJUKvvKK5mHHkrfdFPqJz+pOemk5AEHJIYOjQ0aFDytF/urd+/42msn1lsvuckmNVtumdp++/SwYZnhw7MjRuRGjao9/PBpX/7y9BNOmHHaaTPPOmv2uedO/8Y3svvuO+/KKxvnzDEjIqLabDax5ZaluzeOgqVg2aJERMWlsXFFNrv0lVcWPfjgvGuuqfnmN5OHHZYYNiy+0Uax6upW69GAAfGtt06MGJHYf//k5z6XPOaY1BlnpE45JXncccHvaw4/PDlqVGK//ZJ77ZXcddf4jjvGt902scUW8SFDYoMHB70qaFcdb2bV1akddph5+ukL7757+dSpVh1RZYoyd95Z0nvjKFgKli1KRJRXGmbNWvavfy1+7LH5N988+4ILph9/fHbffWuC0tOnT2tVJvhP8c03Twwfnjz66JrvfCd1+eWZ3/42+8wzubfeikDU0NC0ZEnjnDkNtbUrksnlb79dP2nSstdeq3vppbqnn14ydmzw7/JF990XtKgFt90277rrZp11Vm7EiEzQ/AYMWPmbTG6wwbQjjph35ZVLx49vWrrUqiOqEFHwT5eS3htHwVKwbFGi7iTK3HJLYqedak4/PfXDHxb0a84llxT0a/opp2RHjqw95JDcAQektttulVKyygGh5MYbZ/bYY9oxx8z6/vdTl1yS/vWvM2PHhudLZbNdcEZNy5cv+8c/5l9//fRjj63ZdNOPNMK+fbN77jn73HODctbw3y9h1RH1PFH2z38OF/z665fu3jgKloJlixJ1J1F8p50iOHupQ78Sgwend9659otfnPntb8+9/PKFv/td3YsvLo/Hm+rru/WMViSTi37/+1lnn5357GdXeeUxtdVW0084IX3llblnny1pWbSPiMosSh58cLjCzzvPjBQs4yciqs3985+xPn1ivXp14AjW3NGjC/o149RTcyNHzj7//CVPPVU/ZUrjokWVMKPGhQvrnnkm4NcedFDio2fixwcOTI4cGTyS2QcfzL37rn1E1H1FuQkTwvMj11orN3myGSlYxk9EVJs65ZTgJ33Nl79sRuUQNTbWv/nmgttuCx7wxBZbrPIGxsSnPx2MI3PrrbnXXrOPiLqXqObEE8Nnkm98w4wULAWLiKg2N3FirF+/WK9e2ZdeMqPyi3KTJmXuvDN15pnhqcF9+37k4NaQITWHH56+9NLs44/nUin7iKgri3L//ndsrbWCZ5Lc3/5mRgqWgkVEVJt6/4asNUccYUadL0oms48+mr7wwuSoUfH11//Iwa3+/RO77JIYOjR9111mRNQFRalzzw3fPHvwwWakYClYRES1ucmTYwMGxKqrw7OtzaiLiXITJmSuv77m+OMTn/rU/y791atXzTe+kXvjDTMi6kKieDy+3nrh1dsfe8yMFCwFi4iotua73w3/0XnQQWbU1UVTpqSvvTa8Wn2vXmHN6tev5vTTc5MmmRFRVxC13BsnudtuZqRgKVhERLW1b78dX3fd8B+dTzxhRt1FlPvb35JHHfVBzRowIHX22e1eXtWMiEor+u+9cTJ33mlGCpaCRURUm/rhD8N/dH7+82bU7UTZ559PHnroB+fCr7tu6txza6dONSOiThG13Bsn6FgrX9TNjBQs4yeqUFHunXdiH/tYePjqz382o24qyj71VPKAAz44N2vQoNSPf5x77z0zIiqzqOXeOKkrrjAjBUvBIiKqTf30p+Hhq733NqPuLsqOHZvcd98Pjmatv37q4otrEwkzIiqP6MN741h1CpaCRUT0/lt+NtggPHz1xz+aUc8QZR56KLHHHh9eQCt9+eW1NTVmRFRq0Yf3xjEjBUvBIiKqTV1ySXjOxEpv+TGjHnI2zP33Jz772Q9q1qabpn/5y1w6bUZEJRKtfG8cM1KwFCyiihclk/EhQ8K3/Pzud2bUI0WZe+6JDx36wb20t9xy4ZgxzQ0NZkQUuWjle+OYkYKlYBFVuqjlijWJz3zGjHqyKJdL3357fNttW2pWaocdFj34YHNTkxkRRbbEPnpvHDNSsBQsoooW5VKp+GabhYev7r7bjHq+KJtN33RTapttWmpWeuedF//5z2ZEFElWuTeOGSlYChZRRYvS11wTHr7aYYfaXM6MKkTUtGLFgjvuqNlii5aaldl99yV//asZERWV1e6NY0YKloJFVMGiTOaDCy7/6ldmVGmipvr6+TffnNxkk5aald1nn7oXXjAjog4evlrt3jhmpGApWESVK0rfdFP45rKtt175gstmVFGiprq6eddck9xww5aaldt//6Uvv2xGRIW+9Lz6vXHMSMFSsIgqVZTNtpzynL7hBjOqcFHjokVzL7ss8f5LPMGv2sMOW/b662ZElGfWeG8cM1KwFCyiChWlf/3r8Dlxiy1y6bQZEYU1a/78ORdfnBg4sKVmTTv66PrJk82IqN2s8d44ZqRgKVhEFSnK5VoujJS++mozIlo5DbNnz77ggvjaa4c1q7p6+nHHLZ861YyIWn15sJV745iRgqVgEVWiKPPb34bPiZtsUptKmRHRGmrW9Omzvve9+FprhTWrd+/UttsunTDBjIjWcPiqlXvjmJGCpWARVaKo5fYp6V/8woyI2siKTGbmmWfGevVqqVmzzzuvcc4cMyL636Hw1u+NY0YKloJFVHGizP33h4evNtqo7UP6ZkTUkqUTJoTXJg1+jlZVJQYPnnfVVU11dWZEVNvmvXHMSMFSsIgqTpTYY4/wkP5FF5kRUf5ZNnFi7UEHtZz/XrP55gt/85vmxkYzqmRR2/fGMSMFS8EiqixR5qGHwsNX662Xe+89MyIqNHXPPJN5/y1j4UvMO+20ZNw4M6pYUdv3xjEjBUvBIqosUXLffcPDVxdcYEZEHUxT06Lf/z611VYfXJt05Mhlr71mRhUnau/eOGakYClYRBUkyo4dGx6+GjQoN3WqGREV1bLq6+ffcENygw1aatb0Y49d/t57ZlQ5onbvjWNGCpaCRVRBouQBB4SHr37wAzMiiiSNCxbM+dnP4gMGhMW9b99Z3/lOw4wZZtTzRXncG8eMFCwFi6hSRNmnngp/Cq6zTu6tt8yIKMKsyOVmfvObsd69w7cZrrvu3EsvbVy82Ix6sCife+OYkYKlYBFViih56KHh4auzzzYjolKk/q23ph15ZMsrhskhQxb86lfR3oXJjLqOKJ9745iRgqVgEVWEKPv88+F1jPr3z735phkRlS5Lx4/P7rVXS82Kb7115q67zKiHifK8N44ZKVgKFlFFiJJHHRVevuj0082IqAyWxQ8/nNpuuw+OZu22W/bRR82ox4jyvDeOGSlYChZRzxctf+ed8G4nffvm/vUvMyIqD6dpxYr0VVfFP/7xD2rWqFHZF180o+4tmjIlmGk40H792r03jhkpWAoWUc8XzTj55DxvZ2FGRNGKcrFY6kc/iq+zTsvdDGuOPz43caIZdSNRbsKEzHXXBYOLb7tty+2SwtPbd9rJjBQsBYuo0kXLE4l4nz7Br9xrr5kRUaeIcv/+d+rUU+N9+4Y/nvv3T51zTrRXYjOjKEWJRPbRR9M/+1ly1KiWS4n+71f//slddgnaVeb2281IwVKwiCpdNPOMM8LDV1/7mhkRda4o9/LLNUcc8cH57+utl7700tpUyoy6gig3cWLmzjtTZ5yR3HXXD3rwf3/FhwwJphYMK/vEE7ki5mVGCpbxE/Uo0YpMJt6vX553YzUjojKIso8/nvzc5z54pWmLLTK33lqby5lRuUWNjfWTJi247bbkMccEU/jIYarevROf/nTq1FOD0eT+8Q/7SMFSsCxoojVk1jnnhLcxOf54MyLqUqLMvfcmdtjhg5r1mc9kH3zQjEotaly4sO7pp+eOHp0bNSoxaNBHDlMNHJgcOTL1ox8Fg8i9+659pGApWBY0UVtpmD49vIdJdXV9ge/3MSOicoiy2cz118c32eSDtxmOHJl95hkzila0IplcdN99s84+Oz1sWPhW4pVKVWqrrWaceGL6yitzzz2X/wXZ7SMFS8GyoImaZ//oR8HT6LSjjzYjoq4rSibTF14YazmgUl2dGDo0PXp0duzYgq4CYEYfpmn58mWvvTb/+uunf+UrNZtu+pHDVP36Zffcc/Z55y1+6KGGadPsIwVLwbKgiTp0+Gr27MT7741f9sYbZkTU1UVTpqTOPLPlbob/KwSDBiWGDUsedVTq3HPTN97YRuuq5BkFjap+8uS5P/95du+9M8OGtdx4+8NfyQ03nHbEEfOuumrp+PFNS5dadQqWgmVBExWbORdeGDy91h52mBkRdRdR5o47EjvumDz44KBXxT96klDbrauCZtTYuPy99xY/+ujcX/xi+te+lv70p1d501+sujo9dOjM009f+JvfLJ861apTsBQsC5ooyjTOn5/42MeCZ9ulr7xiRkTdVJT7z3+C/pS+6aagSyW/9KU2Wlew2jO77z79uOPmXHzxwjFjlr78csPMmT1jRivS6SVPPDHv6qtnnHRSZtddVzlAFf7q1Su17bbZ/fbL7rNP8GmNc+ZYdQqWgmVBE5VKNPfnPw+eeXMHHGBGRD1M1Lmtq9Sjyf3735k//jH9i1/MPOOM7N57J9ZEq/nEJ2oPPXT2+ecHqGVvvNFUV2fVKVgKlgVNVA5R46JFifXXD56I61580YyIKkHUMGtW0J8W3ntv0KWmH3980KtajuC21rpy+++f3W+/Wd/5zoK77lr0pz8teeqppa++uvztt1fkco2LF5dNlJs6NfuXv6SvvrrmtNOS++wT32CD1b/h5Mc/Hny3s845Z8Gvf730739vnD/fqlOwFCwLmqhzRPOuvjp4Xs7uu68ZEVWyKP/Wteqv3r0T661Xs+WW6Z13zo4YUXv44dO//vWZZ501+yc/Sf30p6krrkjffHNmzJjMI49kn3km++qrtVOm5NLp9r/LeDz75JPpG25InXVW8gtf+PD6FKueYbb77jUnnjj/ppvqnn++RC90WnUKloJlQRMVnKa6uuSQIcEzdfCPcjMiIlpj65r9s59l99tv+le/OuO006Z9+cu5UaMyw4endtghuckm8bXXzquErf5rwID4xz8e32abxC67JEaMSH7xi8njjksecURyzz0Tw4fHt9xylctQtdzaL7HzzjVf/Wrq4oszv/997vXXzYhIwTJ+oi4qmn/jjcETd2aPPcyIiKiD/0pZsaJxzpzliUT9pEl1L720ZOzYRffdN//WW+ddeWXNd79bc/LJyWOOSY4aldhzz/iOO8Y/8YnY4MGrXGBize9/7Ns3EXS4I49MXXBB5je/yb38chuX9zQjIgXL+Im60g+G+vqazTYLnsoXP/aYGRERlVOUi8VyEyfmxo/PjBuXfeCB9B13ZK67rua00xJ77ZU677zsCy8UdKdkMyIqd8Gqej+rfyT/jytYRD1YtOD224N2lR42rLmpyYyIiIiIFKyiCtYa61FrH1ewiHqqqGnFipottwwK1qI//tGMiIiIiBSsfAtWSwFauQYVWrYULKIeLFp4zz3h4auhQ5sbG82IiIiISMHKq2CtsTxFW7DGiXTbPD527JT3b+w6/oc/9GiIiEgXKliOYBF1X9Gi++8P2lVqm22aGxrMiIiIiMgRrLwKVmulSsGyoIneP/2qKf3pTwcFa8Fdd5kRERERkYJVQMFaJQqWBU30YRY//HB4h7IttmhavtyMiIiIiBSsAs7B6vBRK+8iJOrxoswuuwQFa/6tt5oRERERkYIVWcFyHSwLupJFS8aNC+8Iu8kmTcuWmRERERGRgtXBglXCr6dgEXVDUXavvYKCNe+668yIiIiISMFSsCxooghEdc88Ex6+2mijpiVLzIiIiIhIwVKwLGiiCES5kSPDw1dXXmlGRERERAqWgmVBE0UgWjp+fNCuEuut17hwoRkRERERKVgKlgVNFIGo9qCDgoI1d/RoMyIiIiJSsBQsC5ooAtGy114LD18NHNg4d64ZERERESlYCpYFTRSBaNoRRwQFa85Pf2pGRERERAqWgmVBE0Ugqp80KWhX8bXXbpg504yIiIiIFCwFy4ImikA0/StfCQrW7HPPNSMiIiIiBUvBsqCJIhDVT5kS69Ur3r9/QyF/3IyIiIiIFCwFy4Imav3w1QknxKqqZp19thkRERERKVgKlgVNFIEovPZVdXW8T58VqZQZERERESlYCpYFTRSBKLXVVrGqqtS225oRERERkYKlYFnQRBGI6p57LnzzYJ8+S//2NzMiIiIiUrAULAuaqFhR04oV6R13DC/dfsUVZkRERESkYClYFjRRBKJ5110Xvjj4qU811debEREREZGCpWBZ0ETFihqmTUsMGhQUrCVPPGFGRERERAqWgmVBE0UgmnHSSUG7mnbkkWZEREREpGApWBY0UQSipX//e3hphv79l8fjZkRERESkYClYFjRR0aLGxswuu4T3db74YjMiIiIiUrAULAuaKALRgl/9KmhXNZ/8ZFNdnRkRERERKVgKlgVNVKyoYfbsxPrrBwVr8cMPmxERERGRgqVgWdBEEYhmnnlm0K5yo0aZEREREZGCpWBZ0EQRiJa9/nqsV694377L337bjIiIiIgULAXLgiYqWtTUlN1rr1hV1ezzzzcjIiIiIgVLwbKgiSIQLbznnvDc9k03bVy40IyIiIiIFCwFy4ImKlbUOH9+csiQoGAtuu8+MyIiIiJSsBQsC5ooAtGs738/aFfZESPMiIiIiEjBUrAsaKIIRPWTJ8f79In17l3/5ptmRERERKRgKVgWNFEEotznPx+rqpr13e+aERERERGRgmVBE0UgWvTAA0G7Sm60UeO8eWZERERERKRgWdBExYoaFy+u2XzzoGAtuOsuMyIiIiIiUrAsaKIIRLN/8pOgXWX22KO5qcmMiIiIiIgULAuaqFjR8nffjffrF6uuXvaPf5gREREREZGCZfxEEYhqDzkkVlU18/TTzYiIiIiISMEyfqIIRIsfeyxoV4nBgxtmzjQjIiIiIiIFy/iJihU1LV2a2mqroGDNv/lmMyIiIiIiUrCMnygC0dxLLw3aVXrnnZsbGsyIiIiIiEjBMn6iYrOipiY+YEBQsJaOH29GREREREQKlvETRZBpRx8dtKvpJ5xgRkRERERECpbxE0WQzB/+EJ7bPnDgilzOjIiIiIiIFCzjJyo2uVQqvs02QcGad/XVZkREREREpGAZP1EESV10UdCuUjvs0LR8uRkRERERESlYxk9U9OGriRPj66wTFKy6p582IyIiIiIiBcv4iSJI8v1z25OHHWZGREREREQKlvETRZDMI48E7SrWv3+uNLcdNCMiIiIiBUvBsqArTJTJxIcODc++Ov98MyIiIiIiUrCMnyiCpC+7LLw0wyc/WZtMmhERERERkYJl/ETFJjd5cmzQoKBgZX77WzMiIiIiIlKwjJ8ogiSPOy48t33//c2IiIiIiEjBMn6iCJJ9/PFYdXWsb9/c3/9uRkRERERECpbxExVfr7KJz342PLf9nHPMiIiIiIhIwTJ+ogiSvuaaoF3FN9kkF4uZERERERGRgmX8REXn7bfj668fFKz07bebERERERGRgmX8RBEkdeqp4bnt++xjRkRERERECpbxE0WQ3LPPxnr3jvfpk33hBTMiIiIiIlKwjJ8ogiSGD49VVdV861tmRERERESkYBk/UQTJ3HJLeG77Rhvl3nnHjIiIiIiIFCzjJyr6xcF3340PGRKe237DDWZERERERKRgGT9RBEmddVZ428HddqvN5cyIiIiIiEjBMn6iog9fjR8f79s31qtX9qmnzIiIiIiISMEyfqIIRIkRI8Jz2086yYyIiIiIiBQs4yeKQJS5886gXcUGD66dMsWMiIiIiIgULOMnKlqUSMQ32yw8t/2qq8yIiIiIiEjBUrCIIhClfvCD8Nz2z3ymNps1IyIiIiIiBUvBIipWlH3llVi/frHq6uzYsWZERERERKRgKVhEEYiSo0aF57Z/9atmRERERESkYClYRBGIMr/7XXjd9oEDc2++aUZERERERAqWgkVUtKimJr7lluG57ZdeakZERERERAqWgkUUgSj1k5+E57Zvv30unTYjIiIiIiIFS8EiKlaUffLJWO/eQcHK/OlPZkREREREpGApWERFi3K5lps6xzfbzIyIiIiIiBQsBYsoAlFq9OiwXa21Vtu3HTQjIiIiIiIFy/iJ8jt69eyz4YWvqqoyY8aYERERERGRgqVgERUtSiQSn/pU0K5Sp5xiRkRERERECpaCRRSBqObkk8N3Dm63XdC0zIiIiIiISMFSsIiKFWXGjAnaVaxfv9yzz5oREREREZGCpWARFSvKTZoUX3/98MXB0aPNiIiIiIhIwVKwiIoW5XLJkSODdpX8/OeD35sREREREVF3LVhVK6WYjytYRMWLPrguwwYb5CZNMiMiIiIiou5asFauPqt0pg9/v3rBKrQ2KVhE+YiKvC6DGRERERERddGXCAstVXk2JwWLqH1R0ddlMCMiIiIiosoqWONE2ss/DzssaFdTttjiiUce8WiIiEiXTcEFa42vDzqC5V8MZRBFcl0GMyIiIiIi6nJHsNpuTgqWBV06UVTXZTAjIiIiIqKuVbBWL0AKlgVdJlF012UwIyIiIiKiLlSwWms/3kVoQZdBFOF1GcyIiIiIiKirFKyq1bLG/7RKW3IdLAs6ElG012UwIyIiIiKirvUSYcm/noJFtLoo6usymBERERERkYJl/JUuqjn55KBdJbbbLmhaZkREREREpGApWBZ0saJSXJfBjIiIiIiIFCzjr1xRia7LYEZERERERAqW8VeqqGTXZTAjIiIiIiIFy/grVFS66zKYERERERGRgmX8lSiqnzSpdNdlMCMiIiIiIgXL+CtO1FRXlx46tHTXZTAjIiIiIiIFy/grTjTzrLNKel0GMyIiIiIiUrCMv7JEi//yl/DUq7XWKt11GcyIiIiIiEjBMv4KEjVMm5bccMOgYM277jozIiIiIiJSsBQsC7roNDXVHnRQ0K5qDz44/L0ZEREREREpWAqWBV1k5l13XXjVq402apg2zYyIiIiIiBQsBcuCLjb1kybF11orKFiL//IXMyIiIiIiUrAULAu66NcG/3tdhllnn21GREREREQKloJlQUeQlusypHfcMWhaZkREREREpGApWBZ0sfnwugz1kyaZERERERGRgqVgWdDFZuXrMpgREREREZGCpWBZ0EXno9dlMCMiIiIiIgVLwbKgi80q12UwIyIiIiIiBUvBsqCLyurXZTAjIiIiIiIFS8GyoIt4bXBN12UwIyIiIiIiBUvBsqA7njVel8GMiIiIiIgULAXLgu5gWrsugxkRERERESlYCpYF3ZG0cV0GMyIiIiIiUrAULAu68LR5XQYzIiIiIiJSsBQsC7rgtH1dBjMiIiIiIlKwFCwLurC0e10GMyIiIiIiUrAULAu6kNcG87gugxkRERERESlYCpYFXUDyuS6DGRERERERKVgKlgWdb/K8LoMZEREREREpWAqWBZ1X6idPbjn1qt3rMpgREREREZGCpWBZ0O2nccGCxHrrBe2qZuON270ugxkRERERESlYCpYF3U6ali7NjRwZtKvEwIH1//mPGRERERERKVgKlgVdnKihYdpRR4XHrjbbbEVNjRkRERERESlYCpYFXZyoqWnGqaeGx67WX7/+rbfMiIiIiIhIwVKwLOhiRbN/9KOwXa2zztJXXzUjIiIiIiIFS8GyoIsVzbvqqvCiDP36LXnqKTMiIiIiIlKwFCwLuljRgjvvDNpVrFevRQ88YEZERERERAqWgmVBFyta/PDDsd69g4K14LbbzIiIiIiISMFSsCzoYkV1zz3XckHRuT//uRkRERERESlYCpYFXaxo2euvJwYODO/l/L3vmRERERERkYKlYFnQxYqWT52a3HDDoF1NP+GEQi/XbkZERERERAqWgmVBrypakcnUbLFF0K5qDzusacUKMyIiIiIiUrAULAu6KFHD7NnpoUODdpXdZ5+mujozIiIiIiJSsBQsC7ooUeOiRZnhw4N2ld5558Z588yIiIiIiEjBUrAs6KJETfX1uQMPDNpVauutG6ZNMyMiIiIiIgVLwbKgixM1Nk4/9tigXSU33nh5LGZGREREREQKloJlQRcrmnnmmeGtBgcPrn/zTTMiIiIiIlKwFCwLutjMufDC8FaDAwYsnTDBjIiIiIiIFCwFy4IuNulLLw3bVZ8+S8aNMyMiIiIiIgVLwbKgi25XN90Uq64Ofi28914zIiIiIiJSsBQsC7rYZMaMiffpE6uqmn/DDWZERERERKRgKVgWdLHJPvporH//8KIMP/iBLUpEREREpGApWBZ0sck9+2x80KCgXdWcdJItSkRERESkYClYFnTRx65efjm+0UZhuzryyNps1hYlIiIiIlKwFCwLurhjVxMnJt6/kXNiv/1qUylblIiIiIhIwVKwLOjiMnVq4v0bOSd33TUXi9miREREREQKloJlQReXeDyxxx7hsavttsu99ZYtSkRERESkYClYFnRxrwymUskDDggvKLrZZrk33rBFiYiIiIgULAXLgi6yXuWSxxwTtqsNNsj97W+2KBERERGRgqVgWdDFpua008J2te662SeftEWJiIiIiIgULAu62KR+9KOgXcX69cv86U+2KBERERERkYJlQRfdrq64ImxXvXtn7r7bFiUiIiIiIlKwjL9YUeb222O9egUFK33ttbYoERERERGRgmX8xYoy998f79s3bFcXXWSLEhERERERKVjGX6woM3ZsfO21wxs5n322LUpERERERKRgGX+xouwLL8QGDw4v137ccbYoERERERGRgmX8xYpyr70W33jjsF0dckhtJmOLEhERERERKVjG30FRbvLk7Nix6csui7ccu9p779qaGluUiIiIiIhIwTL+vEQfdKkbb0yde27yqKMSO+8cHzQovBbDf3/FP/7x3Dvv2KJEREREREQKlvGvIe12qf/9GjQoMWxY8tBDE9ttlxkzxhYlIiIiIiJSsIy/uWHmzKUvv7xwzJg5F188/bjjMrvtlvjYx9rqUl/6UtC60jfdFDSw3H/+Y4sSEREREREpWBU9/s7tUrYoERERERGRgtW9x9/Speb87GfZESNyBxzQRpdKDB6c2X336ccfH7SuhffeG/yphlmzbFEiIiIiIiIFq6ILVv7HpdbYpWxRIiIiIiIiBauiC1ahXar2wAOzI0bMufDCNrqULUpERERERKRgVUrByv99fPkfl7JFiYiIiIiIenjBqlopFV6wOrdL2aJEREREREQ9qmCVugaVrWDl0ulcLFY7ZUpu4sTsq6/mxo/PPftsZty4zCOPZB94IDNmTPqOOzK33JK+9trUFVekRo+uOfHExF57Jfbdt/3rS330fXwWNBERERERkYLVasFapfqUqAkV+tfWvfDCnEsumf2Tn8w+99yZZ50147TTpp9wwrQvf7n28MNzo0ZlR4zIDB+eHjYstf32NVtumdxkk8R668XXXjvWu/eaG1L+v/K+JoIFTUREREREpGB1csEaV2Be/frXO9aQ3uvV673+/d8ZOHDq+uu/PWTIW5tv/p+ttvrP9ttP3mmnN3fZZdLw4RP32eeNz3/+9VGjXv/iF//5pS/96wtf+PdOO7321a8+d801f73//nEiIiIibaYLFaxCU/fii3NHj5535ZXzrrtuwW23Lbz77kX33bf4oYeWjB1b9/TTdS+9tOy11+onTVr+9tsrksmG2trGOXOalixpbmhoFhEREamQI1giIiIiCpaIiIiIdLRgNZflXYQiIiIiFVewSn0dLBEREZHKKlid/920Uu+qVkuJvlDkLbNsX6iNv7A8X6gU1bxzReX8Qiv/1zLMqDyicq66UuzZHr/qPDN4ZvDMUEEF68OHpshP6PAXKtGJaK2tsAi/yupra/X/VOov1Bzpi8utfaG2v4ESfaFIaO1+5xFWhNKttEJXXXkeulJ/obIthpI+M7Q2l1J/odI9M7SmiPyZoY2Hq3RfqKTPDM2lPCkon1VXnoeuRMAeW7BKt1HLXLBKOv7SPReUGVL+ndNZX6jl/5biASzbuZXl/0KlXnvl30eeGTwzeGbo+s8MCpaC5Wm023yhkj4BrXJ0pHTHzFdRlOELKVieGTwzeGZQsKIpWJG/kL/GD0Y+/nZfIiydq6RPc+0Wxx7wHFqi54LOOla/xhVYilVXnuVdnnZVumeGsj10azxJpUT/mGzt5e/IH7SSvlicjyjyHxNtnHRRBlF5Vl15lndXaFcKVqcdwVplTZThBIVS7NJO+TlX/n+hlvqhi/akhK4mKsOqK/8BmDL866tELwxVwhGsHvPPvNI9M3QFUdn+haxgdaHDFWUrWOX5QmUW9ZjzHso8oxK9i8eq88xQaQWrJ70WWeq3wvX4gtXpF5xSsDrnabQU/zRp93Erw0+F8hyAKc8TTSkWQyeWnuYSvM0qz1VX6oeu/C9Blk4U+TND5byLsNQroRPfRVjqGZXtDZiRPzOUbdX1hILVRlsv3WVUSnqmRT5fqBSi1q4IUrovVNLLEbXxhSK8KFpnPXSleBrtdFE5v1Dpnhk696ErBap0z3XNnX2NpR55UbRS/NOrci7z1vmVpllEREREFCwRERERBUtEREREwRIRERERBUtEREREwRIRERFRsEREREREwRIRERFRsEREREQULBERERFRsESkJz+pRXT3pFJ/ldL9bSUii4iCJdKFfrSX+udW5Pf26vQf80VCVr+FbaF/YT630ivbfc3LNlwFS0TBEunS/aCcBwa64P1NI7EUA1n9zxZZsNpub2Wr5mVo6rawiIIl0i0LVkF3mG/5fdsHMNr4oZjP12qtLrT7PbfxveUPzLMVdex7W/2b/PD/FtTG2i5YbT8yHRhEocMtaBW1OwsdS0TBEum6x2BW/xm8etnKp9zk85pU2y8tFfT7dr+H1n7fxue3+weLKVjtfnyNnxlhwWr3EejAIDow3EIn1cbXVbBEFCyRblmw8vzxWejnt3uGUPFlpWMfzx/SsSNYHShYHfhuI3mESzfcSL4fBUtEwRLp6gWr7WMMrf3ILOhluzy/gfz/zraP03T472kXXmTBavt7K10dLOiRLMVwI/9+FCwRBUukGxesIn9UF/kzuDmiI1JFVpZ8/sLmkr1EuPJHylOwCvrjZShYBU1BRBQskS5UsNptXc2tnyFU0I/GYs4Qau1r5XmuVUHNMp93CLb2Ofk8PgUdwWpu792dhX63ze0dMcp/EIUOtwNn1+XzOIuIgiXSbQpWcx5vKGuO6DSd5sLfvNbaW+0KOgOpuaPvImzjz+bzvTW3dwSroJfDIixYzUW8izDPBVPQpNr+O21hEQVLRErVCCvku2r3IgiVthIULBEFS0R6csFqdlFNEVGwRETB6l5k7UpEFCwRERERBUtERESk4vP/23BObWpPtZgAAAAASUVORK5C" alt="Per Sequence quality graph" width="800" height="600"/></p></div><div class="module"><h2 id="M4"><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAEkklEQVR42s2XV2hUaxSF/4nRiaIoiKA+CDYMdsQnS8CAFREVsV4VUR9sWMECVuzYsETsGnvvivVaImhyU+Hq9VUfzKtKkptk5nz3rPkz42RyJskE5Xpgw8yZ8++1Zu+1yzGA+T8t8UPGJP1lTGquMenZxvwh02fd02+/jECOMSNdoEwX6KtrgQJjSv425rtMn3VPv+kZPfvTCLj/MM11WphnTNnnlJRA6fDhsGkTHDsG16/D2bOwfj3OtGmUDhjAZ78/oGd1RmcbTOBPY5JdRxmuo/IvyclBZ/lyeP8ePn6EoiLIyYE3b+D5c3j4EG7fhitXICMDZ8QIiv3+oM7Kh3wlRCDfmFbuwawiY0orOnWCmzfhwwcoLITsbMjKgmfP4MEDuHULLl+2kTh+PESAvXth7Voq+/RBPuRLPutFoOqfZ/1jzL8KK3l5UFAA797B69fw9Cncv29JXboEmZk2HYcOwZ49sG0bbNwIa9aAGzWnd2/kSz69IlGDgEIm1s6UKZCfD2/fwqtX8OQJ3LsHN27AxYtw5gwcPQoHDsDu3bB1K2zYAKtXw7JlsHAhzJ0LM2fipKaGI5FRK4EqwZVXtGtnc/viBTx+DHfvWsFduACnT8ORI7B/P+zaBVu2hETIqlUWeMECmDMHZsyASZNg3DgYNYrK1q2R71hhViMg5X4xJsjOnfDoEdy5A9euwfnzcOqUTUNurgXevBnWrYOVK2HJEli0yGpDaZk4EcaOhZFuNaanw6BB0KsXxT6fhFnoSUC1q/Jxhg61ir56Fc6dg5Mn4fBhq/jKSggE7GcBL14M8+bZUEsfwSCUl8OJEzBkCAwcCP37h8Dp1g2nZUuEEd0nov995iefLxASVKyiX76Eigoil4jouY4doUcPmyIRC18isW8fdO8OXbpA27bgguP388ltWMKqTsC2168lXbtWV/T27bBihRWdQKMvERI5kY0G16XvSllSkoWIsm+uCSvctkME1MfVShkzxipapSRFz54NzZtbR1J7LIlwSmLBVZrJyTXAZY4lEAjNjjABDRP1c6ZO/aHoCROgSZMfh+OR8AJv3NgTPGzCEmaEgCaahgrTp8PSpaAe0KhRzcMicfCgNwmBKx11gMuEJcyaBAQ8axa0aeN9WGFVbmPDHk6HNOHzJU4gkgKVYN++iYNHC1PirYNEjRREROi2TM/QxwPXd6/qkJDjkPAUYbgMv3kdUt7VjOKVmpcmRELd0sOfZxlGGpGi4BU2db2ysprgioxXdZSW2qEU6yclJU4jimrFwXi5C5OIBvcqUYGrjGNTOHgwTufO8VtxtWFUGwmlw6vJiIQmZCx4ixa2p7glXrUlFdY5jstrKyOP9hqx2Jx36ADz54fGdEV9xnH0QhKso5api2Ramu2q7qISdENfr4UkdiVrEIlWrex4Vim6Y9xxR3JCK1nsUlpeX2BX4dp8Qo1IE9XVQ2W/fokvpZ5ruSvMYLxQaycYPRp27Ij0BWfyZIqbNm34Wh7vxUQ1/L1ZM5z27aFnT0LTUwNs/HicYcMoce9pqfkpLya/zavZb/Ny+qvsPyB3ge/Rlc06AAAAAElFTkSuQmCC" alt="[FAIL]"/>Per base sequence content</h2><p><img class="indented" src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAyAAAAJYCAIAAAAVFBUnAACAAElEQVR42uydB3gUVdfHBQ3d0CKhF0WQXqV3KRKkCEKQjkrvIEWKgBARpPcmXbrUiBRDkC5FipSA21t675XvnN18KVtndwdfVv7n+Z59htmd87v3ZK7v77szc+eNFwgEAoFAIBAIUeMNlACBQCAQCAQCgoVAIBAIBAIBwUIgEAgEAoGAYCEQCAQCgUAgIFgIBAKBQCAQECwEAoFAIBAICBYCgUAgEAgEAoKFQCAQCAQCAcFCIBAIBAKBgGAhEAgEAoFAICBYCAQCgUAgEBAsBAKBQCAQCAgWAoFAIBAIBAQLgUAgEAgEAgHBQiAQCAQCgYBgIRAIBAKBQECwEAgEAoFAIBAQLAQCgUAgEAgIFgKBQCAQCAQEC4FAIBAv4b/Fb7xhtGH2WwQCAcFCIBBC/5c1K1CK/+HhECwEAgHBQiD+m0rxmv/vKAQLgoVAQLAQCMTLVQpLM1tv5A6bomY2j2Hben4hjXHsQLN0S7905nC76mk2v73HWtopsCZWBEvI+eDw3xFzqAgEBAuBeC0Ey/R/3W1uW5oOsblt5fc2D7TUYIfp9hbBpprYVR9L+W3W3PpOgS2xKVh2/d3tOhmEGD8CgYBgIRAu5lhW5jNsKshL3W/9x/budLhVzjTeum850F9xr+UJFyyBXu78nwOBQECwEIj/oGyZWpe9MxYi5rGe5F8QLOcbbymb84L1QoxLhM4LlqU/jfXrrTZ/jEAgIFgIxH9TsKz/wDFleXmzMv/CDJYzMzEiztg57JcCWyJKJR0QUOG/QSAQECwEwmWMyvR/C525jcaBu52s5LR++VLggY7Nw9nbeCF1ttkq4beCWW+DTVWyawbL3r+7XScVBAuBgGAhEP9Bx3LsgS8rV3kEPohn5X/1/4WnCC0ZgMONF/gUoc3+mmZ4SU8RvrDzJnebOIf/jrhEiEBAsBAIxAvMNyAQCAQEC4FAQLAQCAQCgoVAICBYCAQCgYBgIRAIBAKBQECwEAgEAoFAICBYCAQCgUAgEAgIFgKBQCAQCMT/WLCsvwTD4aVxEAgEAoFAIF5fwcpyJrOCZfZbvCsUgUAgEAgEwhHBcvKtYQgEAoFAIBAQLHEEyxeBQCAQCATiVYpLYsf/QLAcmNDS2R8OGCUooIACCiiggPL6UHKGdSUSNxsECxRQQAEFFFBAgWBBsHDSgAIKKKCAAgoori5YLxx6ihCCBQoooIACCiigQLByLWolcL0rK+tgQbBAAQUUUEABBRQIlsgBwQIFFFBAAQUUUCBYECxQQAEFFFBAAQWCBcHCqQkKKKCAAgoooECwcNKAAgoooIACCigQLAgWKKCAAgoooIACwYJggQIKKKCAAgoooNhSIskbb0hyu0rOfxq+Nfo/CBYooIACCiiggAKKRcHKsiXTDaOQWPYZCBYooIACCiiggALBgmD9639O1U8/yapXV+3YgVMTFFBAAQUUUF43wbJiUf9ZwfpJ9VN1WfUdqperPmRXVEFp0aLaa9dwaoICCiiggALK63MPlunGayFYZFfU3aLSote0L1F9FMOHG8oqLVFCc/q0S5+aPBtXrRpm40ABBRRQQAFFiBIZTWJZufP9PyVYwxXDDfful5CWOK15Weqj+OILtiv9PJakQAF1bjtxrVOT7Ip7UaKE9u5dDDNQQAEFFFAgWFaUyObNWP9ZwfpC8QXZVXUpz2MVkBTYoX4p6qMYMIAqqFq6VDF4MNtJ3rwqHx8XPTWzZ+PKl9dev45hBgoooIACCgQLgmUcAxQDSBaWqZYNVgymjbySvD4q8dVH3rs3C9a6dbStnDnTICjKsWN1Wq3rCZZhNq5iRf4sVUrj54dhBgoooIACCgTLVIlMXeo1ugert7w3dXe9ej1tz1TONFwuHKscq9WJqT5yLy9KrN62LfM2prVrpW5utEfeq5dOqXQxwdLPxim//17Wpg1Xq2hRta8vhhkooIACCigQLKzknh1eci8yqu3q7YZ/rlWtdZO60Z5e8l5KnWjqI+/QgQVr796sPZpDh6Rvv82O1aJFemSkC52ahtk49fr1pIbyrl15HqtwYfXhwxhmoIACCiigQLAgWJnRQd6BdGqfel/WnkOaQ29L36adLeQtItPFUR+yKJaSI0dy7tT6+Uk9PfnSYa1aqSqVywiWYTZuu15J1WpF3748j5U/v3r3bgwzUEABBRRQIFgQLA6yKHKpo+qjOXf6af08pZ60v5aqlipVBPWRN2zIUmKyQIP2zh3DElmKsmWTHzxwDcEyzMbt+38l1WoNt71L33pLvWEDBjMooIACCigQLAiWrqG8IYmUr9rXaP8d7R3DElllFWUfJDurPtIaNUhBtL//bua7gABtu3b0rczdPeHCBRcQLMNs3NFcSqqcONHwdGT05s0YzKCAAgoooECwXnfBqiGtQRblp/UzYz66gHbadvStu8z9QoJT6iN9910WrKtXzX6bkZwc9PnnPAnk5hazZ8+rLliG2ThfYyVVzZ1reD4iculSDGZQQAEFFFAgWK+1YFWRViEpMLuMO0VyRvLnQZ/TD9ykbntiHFcfadmyLFh37lj8c2ZkhE2fbhCUiMWLX+VTM3M2zs+MkqqWLpXkzUvfhs+ejcEMCiiggAIKBOv1Fawy0jIkNXe1dy0VOuNFxvSw6YblGxZHOKg+0hIlWEoePbL+54xat84gKCGjRr1IS3tFBatKFe7LNfNKGvvzz9K33qIfhI4fT9aIwQwKKKCAAgoE63UUrOLS4mROj7WPrRd6XdS6vJK89MtRIaPSXtitPtJChVhKJBKbf86448elBQvSj3WffJIRH/8qClaZMtyXuxaVNO7UKWmBAvSb4CFDrGsiBjMooIACCigQrP+mYBWUFCRtkuqkNgt9PO54QSn/+BPdJ/EZ9qmPYV5Kp9EI+XMmXr8u9/DgJbLKliXfeuUEq3hxFqzH1pQ0wc9PVqQI/Szw008zkpMxmEEBBRRQQIFgvV6ClUeSh5zJsG67zUJfT7zuIffgRwvlZcm3hFKUSr7A6OYm/M+Z8vy5TO8xqlq1XupJsypyVVtN2zWRa+yQRcMEm9SGkibevGnogrZTp/S4OAxmUEABBRRQIFiuKlj+/gnz54dfupQgsNAKnYJsKZ8kn/BCP095XlxW3LBElkCKNiCAnxB0d7frzxmufygvdMIE4SfNwoXK5s1l332nFE4hu6K+tNO2s0Ow8uRhwdLaVtLkhw/lpUvTjzVWV6vHYAYFFFBAAeW/J1j659YkudVFYs5nJKa/fOUEi+yKmrhgQYTAQgfoAngVBol96jM3fC4dNSFUqPpo7983vBfZLkrUmjUsWBMnCj9pyK6o+y1ayO0QLK2dgqVQ8FmQT6iSpvzzj6JSJb7cWbr0K3i5ExRQQAEFFFBehmBlCZPphiXlMv3BKyRYP/wQSe2bOTNMYKHvae+RXnhKPe0q9JqoNXTUxFCh6qO5eZPXEa1Y0S5K9Nat/DjhiBH2C5ZMOKW1tjX1hTRLKEU/GyexZzYuVa2WlSz5L1zuxH8yQAEFFFBAcSHBMqtcr6hgrVkTRc2dODFUYKFvaG6QXlSSVbKr0Fujt9JRI0KEqo/m0iUWrGrV7KLE7N3LD+INGiT8pGnWjAWLNEs4pZWmFfWljaaN0Nm4e/d4Ns7TPiV14HInBjMooIACCij/GcGyOX31qgvW1q3R1NwRI0IEFtpf4096UV1W3a5C743ZS0cNChaqPpqzZ1mw6ta1ixJ39Cg/hdenj/CTpkkTFqymTe24RNhCza9ibKVtJbQvN25wXyrZp6QOXO7EYAYFFFBAAeW/cQ+W6YbrCdbevTHU3EGDggUW+ozmDHW2nqyeXYU+GneUjuoTKFR9NCdOsJQ0aWIXJf7XX/leci8v4SdN48YsWE2a2CFYTTRNqC/N1c2F9sXfn/tS3T4ldeByJwYzKKCAAgooLi1YRiIl8K6sV1Swjh6No+b26RMosNDH1MdIL5rKmtpV6F/jf6WjvHRC1Udz8CBLSZs2dlESLl7kNQ7atxd+0jRowILVqJEdlwgbqvld1x+qPxTalzNnuC/17FNSw+XOoIEDMZhBAQUUUEB5rQTLile5kmD9+ms8NdfLSyew0PvV+/kWb3lbuwp9MeEiHdVeK1R91Lt28WN0nTvbRUnUX4zTNGsm/KSpW5cFq359OwSrrrou9aWBuoHQvhw7xoLV1D4lzbzc2bs3BjMooIACCigQLLNXCV/ppwgvXkyg9rVvrxVY6B3qHaQXXeRd7Cr0jUS+Nb6ZRqj6qDdvZsHq0cMuSrJ+cQdVvXrCT5qaNVmwate2Q7BqKGtQX2qragvty/793Je29ilp5uXOrl0xmEEBBRRQQHl9BMt0HSyzzxK6wDpYN24kUhObNdMILPRG9UbqVE95T7sKfT/5Pt+5pRKqPqpVq6hyin797KKkPHtGRymrVRN+0rz/vpS6/8EHdgjWe8r3qC/VlEIp6h07WLC62KekmZc727XDYAYFFFBAAeUFVnIXI9u/Klj37yeTYdSrpxJY6JXqlaQX3nJvuwr9LOWZXVKiWrKEBWvIELsoqSoVH1WhgvCTpkoVnsF6912pcEoFRQXqS2VFZaGCtXEjC1ZP+5Q083Jn06YYzKCAAgoooECwXE+wnj1LIcOoVk0psNA+Sh/Si2HKYXYVWpWqoqNITQRSlPPn81zUyJF2UdJCQ1llPDyEnzRly7JgVahgh2CVkpeivpRRlBEqWCtXcqu87VPSzMuddetiMIMCCiiggALBcj3BUqlS9YahEFjoecp5pBejlaPtKnRoWigd5SEXqj7KmTNZsCZOtIuSHhfHt5MXLiz8pPHw4EuEnp52CJa7zJ36UkJeQmhffHy4L8PsU9LMy53vv4/BDAoooIACCgTL9QQrNDSNDMPDQy6w0NOV00kvJisn21XouPQ4OqqwTKj6KCdNYr2YMcO+P2d6Ot/zljev8JPm7bf5iGLF7BCsfJJ81JdC0kJC+zJvHvdltH1Kmnm5s3x5DGZQQAEFFFAgWK4nWHFx6WQYhQvLBBZ6gnIC6cUs5Sz75pZepNNReSVC1Uc5ahRLybff2vvnlObLRwdmJCcLPGn0P5cULCgRSEl7kWZ4dsGOvkyfzn2ZbJ+SZl7uLFkSgxkUUEABBRQIlusJVnr6C/2kj0RgoUcoRpBeLFAusLfQ+aQ88ZOcIUh9FEOHspR8/729FFnRonRgelSUEIpGozM850ndF0iJTY/9/4dD30jKSBIkWBMmcF9m2amk+sud0kKFMJhBAQUUUECBYLmeYLH65OP7kJKTM4QUerBiMLnFUtVSewtdVFaUDoxKF6Q+cm9v0gv1qlX2UuSlS9OBaYGBQigSiTZrLQ2FQhAlJC2Efp5Hkoc+I9MjBcniiBEsWAvsVFL7L3diMIMCCiiggALBeoUEq2hRfpIuKipdSKH7KvqSW6xRrbG30KXlpenAwDRB6iPv2ZMFa9MmeynKKlXowBSZTAjl0SMWrDx52GQCAgRRlKlK6sWbkjfpU5emEyRYgwfz84BL7VZSaf78fLkzKQmDGRRQQAEFFAiWyIL1Ro4Qst8BwSpdWk6GERiYJqTQ3RXdyS22qLbYW+gqyip0oCxFkPrIu3Rhwdq5016KqmZNOjD58WMhlDt3tIbrg/R5755WCOVpylPqhZvUjT6lKVJBgtW3LwvWGruVVFasGF/ujIzEYAYFFFBAAQWCJaZg5fQnU8Gyrk3CBatKFSUZhkyWIqTQneSdyC12q3fbW+iaqpp04ONkQeojb9uWBevAAXsp6kaN6MCkO3eEUK5cYcF66y2+QnrjhkYI5a+kv6gXBaQF6PNR8iNBgtW9OwvWFruVVF6mDF/u1OkwmEEBBRRQQIFgiSxYQqRKoGNZ+lnNmioyjMePBd1+3krWitzisOawvYVupG5EB95JEqQ+sqZNeR3z48ftpWhataIDE69cEUK5cEFDHc+fnwXL31+QYF1LvEa9KCIrQp+3k24LksVOnVgWd9utpMp33+XLnVIpBjMooIACCiivg2AZ7ovOpS4SM+pi+rP/sWD5WoiqVR9RS1ev/t1XQNT4m191/KPfj752Rs2HPIO17OIyIT9+9P77VL3fV62yl/KgQQM60H/RIiE/Xr7cjzpeoMBz+ly1SlD3F/sv5gW9nhXmO/0vLhXUpHr1uEk+Pvb25XHFinTghY0bfREIBAKB+I9GlhJlOZPpxksRrJxS9ZJmsFq14omcK1cShZhsbVlt6tV5zXl7TbaTlq8tnk84L2gGq3p1nsHy97eXEqi/Hhd38qQQyuHDauq4uzv/oY4fFzSDdSruFPXiHfk79Hku/pygvjRuzH05dcruy536A5Nu38b/twQKKKCAAsp/fgZLoGBZ/9aRm9xf3iXCTp34VqTz5xOEFLqqtCp16bL2sr2F7hHYgw48GSdIfWSVKrGU3LhhLyWoXz86MPbgQSGU3btZsEqUYME6cEAthHIo9hD1oqyiLH2eiDshqC+1a3NfztutpJrWrfly5+XLGMyggAIKKKC8boJlZfpKHMH6F+7B6tEjkAzj5Mk4IYUuLy1PXbqlvWVvob2DvOnAg7GC1Efq6Uluob13z15KsH6F0pidO4VQtmzhm89Kl+ZVKnbuFCRYO2N2Ui8qKyrT54HYA4L6UrUq9+Wy3Uqq69yZDow/dw6DGRRQQAEFlNfqHizTDZEFK6cSvbynCL29g6j5Bw/GCim0h9SDuvRQ+9DeQg8LHkYHkqAIoRiu2+nMLk5llRIyejQdGL1xoxDKmjUq/Yuu+Sb3TZsECdbG6I3Uiw+UH9DnjpgdggSrfHkWrFt2K2mgfjGwuBMnMJhBAQUUUEB5HQTLyKJsXjQ0dSwHLxGa3e+8YA0bFqyfwokRUugiUn6A7rn2ub2FHhMyhg4kQREkWPp3BOrMLq9ulRI2ZQodGLlihRDK0qUsWO+9J9Xf5C5IsFZErqBe1FPVo88NURsECZaHBwvWQ7uVNKh/f77ceeAABjMooIACCiivj2BZ8aqst9Vl/Z84lwidDEuCNWZMCLVx48ZoIYV+S/oW9UelVdlb6KlhU+lAEhTbFK1Wol9h3YE/Z/js2XRsxOLFQvqyYAEvAFazJgvW998rhVAWRSyiXjTVNKXP5ZHLBQlWkSIsWM/tVtLg4cP5cueOHRjMoIACCiigQLBEnsH6FwRr6tQwMowVK2yvGE5eRZ0hx3Kg0HPC59CxiyMEqI9UyoJVsKADlIhFi+jY8DlzhJw0s2axYDVowAvZf/utIMGaHT6betFO244+SbYECdZbb7FgqexW0tCxY+nAqA0bMJhBAQUUUEB5TQTLVKEEPlT4KgrWnDnh1PzFiyNsFvq59jkvsykt4kChSa3oWNIsmxTt48dUT2nx4g5QIpcvp2PDpk4VctJMnsyC1bw5C9aMGYIEa0rYFOqFl86LPkm2bPdFpeK+vOWIkoZNm8aXO5cvx2AGBRRQQAHltboH6yVl+7cFi9SKDIM0y2ahH2ofklh4SD0cKLTh7qWpYbbVR3v3LktJmTIOUKI2bKBjQ8aMEXLSjB7NgtW+PT9FOHGiIMEaFTKKetEnsA99kmzZ7svz59yXIo4oafjcuXy5c9EiDGZQQAEFFFAgWK4nWCtWRJJhTJ0aZrPQt7S3SCzKS8s7UGjD83djQmyrj/baNZaSypUdoMTs2EHHBg8bJuSkGTpUQR338mLBGjlSkGANCR5CvTB8jg4ZbbsvDx9yXzwcUdIIHx++3Dl7NgYzKKCAAgooECzXE6yNG6PJMMaMCbFZ6MvayyQWVaVVHSi0YQWpYcG21Ufr50diIatRwwFK7IEDdGyQt7eQk8bbmwXrs8/4c8gQhRBK36C+1IuxoWPpc2jwUNt9uXWLBau8I0oauXIlX+6cMgWDGRRQQAEFFAiW6wnWzp0xZBjDhgXbLPR5zXkSi9qy2g4U+mDsQTrWO8i2+qh9fVmwGjRwgBJ34gQdG9izp5CTpkcPvvtq6FC+UNivnyDB+kT3CfViRtgM+uwX1M+2YF2+zIJV1REljd60iS93jh6NwQwKKKCAAgoEy/UE6+DBWDIMb+8gm4U+peE38TWWNXag0CfjTtKxPQJ72Baso0dJLOTNmztAiT93jhfQ6txZyEnTubNcP3XHgtWjhyDB6qDtQL34LuI7+uwe2N0mRXP+PMtibUeUNGbXLr7cOXQoBjMooIACCigQLNcTrJMn4/SGEWiz0Ic1h0ksWslaOVDo8wk8+9VJ28m2YO3bx4LVvr0DlET9jJGmdWshJ03r1nz31fTpLFidOsmFUJprmlMvVketps+O2o62BevUKRasxo4oaeyhQ3y5s18/DGZQQAEFFFAgWK4nWOfPJ+gNQ2uz0LvVu1mS5J0cKPSVxCssZ5pWtgVr+3YWrK5dHaAk3b5Nx6obNxZy0nz4IQvWwoW8njvJlhBKfXV9w0ty6LOlpqVtwTp8mAWrlSNKGqeXs8Du3TGYQQEFFFBAgWC5nmBduZJIhtGqlcZmobeotvClMUV3Bwp9J+kOHdtI3ci2YK1fz4L16acOUJIfPaJjVbVqCTlp6tSR6VdYZcEi2RJCqaasRr34Je4X+myobmi7L7t3c186OaKkCRcu8AqlHTtiMIMCCiiggALBcj3BunMniQyjUSO1zUKvUa0hseir6OtAoR8nP6Zja6pq2qSoVqwgsVB8/rkDlBT9KvDKd98VctJUrcovydm6lQWLZEsIpYKiAvXCL8GPPmuoatjuy5Yt3Jfujihp4tWrfLmzZUsMZlBAAQUUUCBYridYjx8n61/Jp7JZ6KWqpSQWgxWDHSi0LEVGx1ZRVrEtJfr1nxTDhztASdPpeMaoTBkhJ0358ixYBw+q6fP99wUJlofcg3pxN/EufVZWVLbdlzVruC99HVHSJP2Cq+qGDTGYQQEFFFBAgWC5nmDJZClkGFWqKG0WeoFyAYnFCMUIBwodmBZIx5aWl7ZJUepXMFeOHesAJT0yku95KlZMyEnj4cGC9dtvLFgVKkiFUApJC1EvDLLoKfe0LVhLl7JgDXZESZOfPOE6fPABBjMooIACCiivg2C100fOb43+mfNnpj9+5QQrMDCNDKN0abnNQs9SziKxmKCc4ECho9Kj6NiisqK2Bevrr1kspk51gJKRlMTrTuXPL+SkKVKEBev6dQ19vvOOIMHKK8lLvYhMj6RPd5m77b4sWMCCNcIRJU2Vy/nYSpUwmEEBBRRQQPnPC1aWLZluWFEuo3++WoIVFZVOhlG0qMxmoScrJ5NYTFdOd2Q+JiOZjs0nzWeTohg/nm9Unz3bsT+nJE8eOvxFerrNk+bNN/kl3U+esGC9/bZtwUrKSKIu5JfmT8lIoQ03qZttwZo1i2VxgiNKmhYUxJc7S5XCYAYFFFBAAQWCZUm5Xl3BSk7OIMPIl09qs9CjlaNJLOYp5zlWaMP0T/oLG+qj+OorFqzvvnOMIi1UiA7PiI+3oT5KLfXazU2atWGTEpEeQe0vJuPrj29K3qTttBdpNiiTJ7NgTXdESdOjo/ly59tvYzCDAgoooIDyugmWkOmrV12wWH3y8lyOyaSPcaGHKYeRVfgofRwrdGFZYTo8Lj3OhmANGsSCtWyZYxR5yZJ0eFpYmHXKs2farIkrw1SWWm2Dok3VUvvLKsrSdhFZEdqOTY+1IVijR7NgzXNESTNSUvhy51tvYTCDAgoooIDyWt2DZbphKlhmb8N65QSrcGFeESouzsbckrfcm6xipXqlY4U2PIIXmhZqQ7A++4wFa+1axyiK8uXp8FS12jrlwQNt1q1XhQvzzVj//KO1TpGQ8EjeeE/5Hm2/I3+HtkPSQmwI1rBhLFg+DiqpRK9+GampGMyggAIKKKD85wXLSKQcuGj4ygmWhwe/lS801MYFr57ynmQVG9UbHSu0YREpVarKhmB98gkL1tatjlGU779Ph6c8f26dcvOmJuvhwZIlWbD+/tuGYD1MfsjvulbVpu2Kioq0rUxVWqfIvb15qYWVDiqprEgROjw9JgaDGRRQQAEFlNdEsKx4lesJVoUKCjIMlcrGTEkXeRd+UYx6h2OFNiyD/izlmQ0p6diRpWTPHscoqrp16fDkBw+sUy5dYsGqVo2XvypXjgXr9m0bgvVn0p/U/ibqJrRdXVmdtgNSAmz0pWdP7stGB5VU/s47fLkzOBiDGRRQQAEFFAjWC9d6ipDVpxq/8PjZsxTrhW4rb0tWsV+937FC11PVo8PvJ9+3ISWtWrGUHD7sGEXTtCkdnnjzpnXK2bMsWHXrsmC99x4L1pUrNgTrUsIlan9bbdsX//9SwntJ92z0pUsX7ssOB5VUUbEiX+5UKDCYQQEFFFBAeR0Ey9SfzM5aucY6WKw+9fh1MffvJ1svdFNZU7KKY+pjjhW6maYZHX4j8YZ1iqxRI35FzOnTjlG07drR4Qn+/tYpJ06wYDVpwoJVqxbfgnbhgsY65Uz8GWr/x7qPabu5pjltX0+8bkOw2rZlwdrvoJIqq1fny51Pn2IwgwIKKKCA8vrcg/WSsv0PBKtZM7aNGzcSrRe6noynoM5ozjhW6Pba9nT4xYSLNgSrVi0WrAsXHKPounalw+PPnLFOOXCAF3Bv04YFq1EjFqzTp20IluEdz70De9N2B20Hw0sJbfRFP52mPuagkqrr16fDk/76C4MZFFBAAQUUCJbrCVb79vxI3cWLCdYLXV3GNx75a/wdK7SXzosO/zX+V+sU6XvvkVVor1xxjBLYuzcdHvfLL9YpO3eyYHXpIqftVq34Hv/Dh9XWKfti91H7BwYNpO1uum607Rvva0Ow6tVjWTzjoJJqWrTgy53XrmEwgwIKKKCAAsFyPcHy8tKRYfz6q43FOSvJKvE1Ps0NxwrdJ7APHX407qgNwSpXjgXr9m3HKEEDB9Lhsfv2Wads2sSC1bMnC1bHjixYe/bYEKyt0Vup/V+FfEXbnwV9RttHYo/YECz9NT6Nv4NKqv3oI77c+fvvGMyggAIKKKD8VwVL3Hi1BKtPn0AyjKNHbSwB6in15Du7tfccK/Sg4EF0+N6YvTYES79SqPbhQ8coIfqF4KO3bbNOWbWKBcvbmwXrk0/4IcqtW1XWKWui1lD7J4ZOpO3BwYNpe0/MHhuCVakSC9YNB5VUp1+xIv70aQxmUEABBRRQ/pOC9W/G/0CwBg0KJsPYu9fGekvuEndem0AX4FihR4SMoMO3Rm+1IViFC7NgPX/uGCV0wgQ6PGrtWusUHx9+cHLYMCVtf/YZC9batTYE64fIH6j9M8Nm0vbIkJG0vSV6i42+eHpyX+45qKRBffvybNzhwxjMoIACCiigQLBcT7BGjAjRT+FEWy90Pkk+sgqFTuFYoSeGTqTD10StsU4xLF+uVakco4TNmEGHRy5dap0ybx4L1pgxLFiDBrFgLVtmQ7Dmh8+n9i+IWEDbk0In0fbqqNU2+uLuTo3RBTiopMFDhtDhMbt3YzCDAgoooIACwXI9wZo4MZQMY82aKCuF1ur4TXx5JHkcLvTMsJmU4YfIH6xRlErDC/gcpoTPn08ZIhYssH7STJ/OgjVlCgvWV1+xYH33nQ3Bmh42ndq/NJLVbVbYLNpeErnEhmDly8eCpXBQSUNGjeLLnZs3YzCDAgoooIACwXI9wZo5M4wM44cfIq0UWqqTklIUlBR0uNALIhZQhvnh860J1rNnLFhFijhMifzhB8oQNnOm9ZNmwgQWrG++YcEaP54Fa/ZsG4I1PnQ8tX9d1DraXhixkLa/Df/WGkWr5ZdI53FcSUMnT+bLnatWYTCDAgoooIACwXI9wVqwIIJMYP78cCuFfqx9TEpRXFrc4UIvjVxKGWaEzbAmWA8esGB5eDhMiVqzhjKETpxo/aQxzFotXMhS9fXXLFtTpyqtU74M+ZLavz16O20vi1xG29PDplujSKUsWAUdV9Lwb77h2bjvv8dgBgUUUEABBYLleoK1dGkkmcCMGWFWCn1Xe5eUooy0jMOFXhu1ljJMCJ1gTbD+/JMFq3x5hynRW7ZQhpARI6yfNDnvu5o7lwVr7FgbgvV50OfU/p9jf6btdVHraHt86HhrfXn8mPtS3HEljfjuO8oQPm8eBjMooIACCigQLNcTrLVro8gwJkwItVLoa9prpBRVpFUcLvS26G1Z60hZlJLLl1lKqlZ1mBKzZw9lCB40yPpJk/PJQR8fflPQ8OEK65Regb2o/cfjjtP29ujttP1lyJfW+nL3LveljONKGvnjj3y58+uvMZhBAQUUUECBYLmeYG3bFk2G8dVXIVYK7af1I6WoIa3hcKFzroRuiaI5f56UQla7tsOU2CNHKENgnz7WT5pu3eRZa1+tWMGC9fnnNgSri64Ltf9s/Fna/jn2Z9oeEDTAmmBdu8aCVcVxJY1av54vd44bh8EMCiiggAIKBMv1BGvfvlgyjIEDg6wU2lftS0rRUN7Q4ULnfJefRcE6dYoFq3Fjhynxvr784J6Xl/WT5qOPsldv37CBFx399FO5dUprTWtq/x8Jf9D2sbhjtP1p4KfWBMvPjwWrhuNKGvPTTzwb98UXGMyggAIKKKBAsFxPsH75JY4Mo3fvQCuFPqo+SkrRQt7C4UKfiT9DGbrquloTrMOHWbBatXKYkqDXGm379tZPmpYtWbCOHGHB+uknFqyuXW0IVmN1Y2r/7aTbtP1b/G+0/bHuYysUtV715A0dV9LY/fspQ9Dnn2MwgwIKKKCAAsFyPcE6cyZebxg6K4Xep+YLfB3kHRwutH+CP2Vop21nTUp272Yp6dTJYUri9ev8dppmzayfNI0asWCdPs2C9fPPLFjt29sQrFqqWtT+R8mPaPtSwiXabqtta60vR49yX1o4rqRxx4/z5c5evTCYQQEFFFBAgWC5nmD5+yeQYbRrp7VS6O1qvq3bS+7lcKFvJt6kDE01Ta1QVPpnABXduztMSbp3jzKo6tWzftLUqCGlLv/+u5a2f/mFBat5cxuCVUVZhdovTZHS9p9Jf9J2E3UTa4K1bx8LVgfHlTT+7Fm+3NmlCwYzKKCAAgooECzXE6ybNxPJMJo21Vgp9Hr1er6DSt7b4UI/SH5AGeqq6loTLP0qVoq+fR2mpAQEUAZltWrWT5oqVViwrl5lwfr1Vw1tN2ggs04pLS9N7Q9M4wupD5Mf0nYdVR1rgrV9OwuWl+NKmvDHH3y5s00bDGZQQAEFFFAgWK4nWA8eJJNh1K2rslLo5arl/NycYoDDhX6e8pwyvK9835pgLV3KgjV4sMOUVP3LdhQVKlg/acqUYcG6e5cFy8+PBatGDRuCVVRWlNoflc4vFPon5R/arqqsak2w9M8Ayns7rqRJt25RBvWHH2IwgwIKKKCAAsFyPcF6/jyFDOP995VWCr1YtZiU4gvFFw4XWp2qpgzlFeWtCdbChaxHI0Y4TEkLCWGt8fCwftIUL86C9fgxC9b161rarlxZap3iJnWj9idnJNO2JlVD2+UU5az1Zfly7ssAx5U0+e+/+XJn7doYzKCAAgoooECwXE+w1OpUMozy5RVWCj1XNZeUYqxirMOFDksLowwl5SWtUJT6l8MoJ0xwmJIeG8vPIRYubP2kKVCAX2Mj1TvVX3+xYJUubU2w0l6kUePflLxp+Gd4ejj9s4SshDXBWryYBesLx5U0RSLharz3HgYzKKCAAgooECwxBeuNHCFkv2OCFRaWRoZRsqTcSqGnKaeRUtCnw4WOz4inDIWkhawJ1pQprBTTpzv+50xLY3V6803rJ02ePPwrLU9g6Z480dF2sWISK5TY9FhqfBFZEcM/EzIS+NXX0oLWBGvuXBassY4raar+ddGKsmUxmEEBBRRQQIFgiSZYplJlui2KYMXHZ5BhFCoktVLocYpxpBRzVHMcn1t6kU4Z8kryWhOsMWNYsObNc+bPKXVzoyQZKSmWKHI5G1X+/JlGJZPxPwsUsCZYwWnB1Ph35O8Y/pnxIoP+mUeSx1pfpk3jvkxzXEnTIyJ4Nq54cQxmUEABBRRQIFgvXbCsiJdjgpWeTt9K8uaVWCn0l4ovSSkWqRY5U+j80vyUJCkjyaKUDB/OUuLj4wxF5u5OSdKjoy1Rnj5loypaNNOotFr+Z5481gRLkaqglldSVMraU0BagPYkZiRaoijGjeM7qOY4rqQZiYm8FnyBAhjMoIACCiigQLBeUcHytRpubv+QZBw//qulH3S5w2/im3B1gq8TUfh5YUpy6LdDln5wp1MnUoqrkyY5QwkoVoySnN23z9IPdu8+S50tUSIga0++fNz9Y8csdn/zhc18h/7j8ll7ijwrQnsO/nbQ0iG3e/SgZlwbOdKZvkj01zJ9T5/2RSAQCAQCYSucugdL9BksiqJFZWQYkZHplky2t7w3+cQ61TpnTNawlJQuTWfx4l2vXrwwwcaNzlAUlStTklS53BLF9LHBokX5lqynTy1S7ibdpZY3UDfI2lNWUZb2aFO1FmewBg7kGawff3TqcmfBgny5Mz4e/98SKKCAAgoomMFysUuErD6l+dUxOl2apUJ7yb3IJ7aptzlT6JyLoZsXrI8/ZsH66SdnKKoaNShJ8pMnliimC195evKqDffuaS1RriZepZa31LTM2vOe8j3aI0mRWOxL794sWOucUlJZiRKUJC0sDIMZFFBAAQUUCJbrCVaVKkr9sgUWbwzvIO9APrFXvdeZQtdU1cx6nZ95KWnXjgXr55+doagbNqQkSXfvWqKYLt1euTJP4F2/rrFEuZBwgVreUdsxa09tVW3a83fy3xb74uXFfdnmlJIqypXj2Ti1GoMZFFBAAQUUCNbLFawXYj9FyOpTU0WG8ehRsqVCt5C3IJ84oj7iTKEbqRtRkttJty1KSbNmLCW//OIMRdOyJSVJvHrVEuXoUeOXD37wAQvWxYsWBetk3ElqeffA7ll7PlR/SHtuJd2y2JcOHbgve51SUmXVqpQk5flzDGZQQAEFFFAgWOII1ot/ax0sVp9G7By3b1t8vq+hvCH5xGn1aWcK3UrTipJcTrxsiSKrX598QvPrr85QtB07UpKECxcsUfbt48526JAtWPXrs2CdOWNRsA7GHqSW9wvql7WnjbYN7fkj4Q+LgtWiBQvWEaeUVFWnDl/ufPAAgxkUUEABBRQIlmiCJWZeq4LVqhVfNbt82eKiAzWkNcgnftf+7kyhO2k7UZJz8ecsCtYHH7Bg+fk5Qwns3p2SxJ06ZYmyfTsLlpdXtmA1aybXP0WotkTZGbOTWj4seFjWni46fqzybPxZi4Klv1KpPu2UkqqbNOHZuJs3MZhBAQUUUECBYLmeYHXqxA/WnTtn8Wm1KlK+P/2q9qozhe4R2IOSnIg7YVGw9A8Aaq9fd4YS1K8fJYk9dMgSZf16FqzevbMFq107Fqz9+y0K1sbojdTyMSFjsvb0CuxFe47HHbdEkervtdf+7pSSatu25dk4f38MZlBAAQUUUCBYridYPXoEkmGcOBFnqdBlpGXIJ+5o7zhTaO8gb0pyIPaARSnx9GQp+esvZyjBQ4dSkphduyxRfvyRbzgbMECRtefjj1mwduywKFjLI5dTy6eGTc3a83nQ57Rnf+x+i32pUoX7ctUpJdXpH6uMP3MGgxkUUEABBRQIlusJlrd3EBnGgQOxlgpdXFqcHwDUPnKm0MOCh1GSHTE7LFEk+jVC+e2ATlBCRo+mJNGbNlmiLFrEgvXll9mC1asXC9bGjRYFa1HEImr53PC5WXu+CP6C9vwU85NFwSpThgXrjlNKGvjpp3y585dfMJhBAQUUUECBYLmeYA0bFqyfwomxVOiCkoK87JNW4kyhx4SMoSQbojZYFKwCBViwZDJnKGH6N0ZHrlxpiTJnDgvWuHHZgtW/PwvWypUWBWt2+GxquU+ET9aecaH8csb1UestClbx4ixYj5xS0qABA/hy5759GMyggAIKKKBAsFxPsMaMCSHD2LAhylKh80rykk9odBpnCj01bColWR653DxFqzW8GYbfDugEJXz2bEoS4eNjqS/TpvGiX/SZtWf4cN7j46O0RJkcOplavjIyW9q+Dvua9vwY+aNFWdQvwq6VOKWkIV9+ybNx27ZhMIMCCiiggALBcj3Bmjo1jAxj+fJIs4VW6PhVx/kk+Zws9JzwOfzG6IhF5v+ccjm/sCZ/ficpEYsWUZ7wuXMtnTRjx7JOzZ2rytozZgzvmTfPomCNChlFLd8cvTlrz7zwebTnu4jvLApW3rwsixqnlDR0wgRKErV2LQYzKKCAAgooECzXE6w5c8LJMBYtijBb6ABdAMmEu8TdyUIvjlhMeWaHzzb/53z6lAWraFEnKZHLl1OesGnTLJ00w4cr9PNV2YI1ZQoL1vTpFgVrSPAQavnumN1Ze76P+J72fBP+jXmKQsF9yeeskobNmMGXO5cuxWAGBRRQQAEFguV6grV4cQT5wOzZ4WYLfU97j2TCU+rpZKFXRK6gPFPCppilaO/dI5mQejpLidqwgfKEjh1r6aT5/HMWrBUrsgXrm29YsCZMsChYnwV9Ri0/HHs4a8+qqFW0Z3LoZPOUgAAWLHdnlTR8/ny+3LlgAQYzKKCAAgooECzXE6wVKyLJB6ZMMf9S4RuaGyQTlWSVnCy0YTWp0SGjzVI016+TTMgqV3aSErNjB+UJHj7c0kljeGZww4bsW9oXLuTb3keMUFiidNN1o5b7xvtm7dkcvZn2jAoZ9VJlMfKHH3g2buZMDGZQQAEFFFAgWK4nWBs3RpNhjB4dYrbQ/hp/konqsupOFtqwHvrQ4KHmBeviRRasDz5wkhJ74ADlCerf39JJY1j16qefsgVr6VIWrMGDLQpWBy2/69ovwS9rz+6Y3bRnSPAQ8325cYP7UslZJY1as4Zn4yZOxGAGBRRQQAEFguV6grVzZwwZxtChwWYL/ZvmN5KJerJ6Thba9I1+uaTkzBmWkvr1naTEnThBeQJ79rR00piu275mDQtW374WBauZphm1/Hri9aw9h2MP056+QX3N98Xfn/tS3Vkljd66lfKEjBiBwQwKKKCAAgoEy/UE6+DBWDKMfv2CzBb6uOY4yURTWVMnC30y7iTl6R7Y3SxFfewYyYS8WTMnKfHnzvHje507WzppTN88uGULC1b37hYFq56qHrX8fvL9rD2n40/Tnk90n5gXrN9+Y8Gq56ySxuzdy5c7Bw3CYAYFFFBAAQWC5XqCdfJknN4wAs0W+oD6AMlEW3lbJwt9PuE85emo7WhesPbvZ8Fq185JSuLly/zG6NatLZ009erJqLNnzmQvoLB7N7+dsFMnuSVKNWU1avmzlGdZe35P+J32fKT9yLxgHT/OgtXUWSWNO3qUZ+P69MFgBgUUUEABBYLleoJ1/nwCGUbHjlqzhd6p5nunusi7OFnoK4lXKE9LTUvzgqW/OV3+8cdOUpJu36Y86saNLZ001auzYF28mC1Yhw9raE+rVjJLlPKK8tRyVaoqa8+1xGu0p4Wmhfm+6O8Dk7d1Vknjf/2VZ+O8vDCYQQEFFFBAgWC5nmBduZJIhtGypcZsoTepN5FM9JT3dLLQd5LuUJ6G6obmpWTjRpaSXr2cpCQ/ekR5VLVqWTppKlViwbpxI1uwTp1iwWrc2KJglZSXpJaHpWU/ZflX0l+0p4G6gfm+7NzJfenirJIm6G/817Zvj8EMCiiggAIKBMv1BOvOnSQyjIYN1WYLvUrNaz55y72dLPTj5MeUp4aqhnkpWbmSpaR/fycpKVIp5VG++66lk8bTU0qdvXcv+4U858+zYNWubVGwCkkLUcvjM+Kz9jxNeUp7PlB+YL4vmzZxX3o6q6SJ+qcRNc2aYTCDAgoooIACwXI9wXr8OJkMo0YNldlCf6/kVcuHKYc5WWhZiozyVFZUNktR+viwGA0f7iQlVatluSlTxtJJ4+7OghUQkL3n8mUt7alaVWqJkkeSh1qe8SIja48ilV8fVElRybxgrVrFbfB2VkmT79/n2bh69TCYQQEFFFBAgWC5nmDJZClkGJUrK8wW+lvlt7xAqHK0k4UOTAvkFeHlnuYFa948FqzRzlLSIyL4BvNixSydNG5uvMq6Msey7bdusWCVL29esBIzEqnZBaQFciYMTgumnaXkpcz35fvvuS/DnFXSlGfPOE+1ahjMoIACCiigQLBcT7ACA9PIMDw95WYLPUM5g18Lo5zsZKGj0qP4nYYyd/NSMn06y8RkZykZiYm8inr+/GYpGo2Oepo3ryRnwocPWbA8PMwLVkR6BDW7uKx4zoQx6TG0823Z2+b78u23oshiqkpFeRQVKmAwgwIKKKCAAsFyPcGKikrXvzpPZrbQE5UTSSZmKWc5e8ErI5nyuEndzEvJhAksJbNmOf/nlOTJQ6leZGSYUiQSdqlChXK51PPnvLNIEfOCpUnVULPLKsrmUp+MVNr5lvQt833Rv6TZeVlMCw3lS40eHhjMoIACCiigQLBcT7CSkzPIMNzcpGYLPVI5kmRigXKB84XOK8lLqdJepJlSFCNGsJQsEIEiLViQUmXEx5tS/v6bXapEiVwupVLxzrfeMi9Y/6T8Q22uqqxqRCG7ov1kWmYEa+JEUWQxPS6OL3cWLozBDAoooIACCgTL9QSL1Scv35mUlmam0EMUQ8gkflD94HyhC8sKU6rY9FgzgjV4MN/Q/YMIFFmJEpQqLSzMlHL7NrtUuXJSo5xkV7SfTMuU8jD5IbW5jqqOEeVt2du0PyY9xoxgjRwpjiymp0v0VzQxmEEBBRRQQIFguaRgFS7Mq0PFxqabFrqfoh+ZxGrVaucL7SH3oFQhaSFmBKtvXxas1SJQFOXKUapUtdqUcuUKC9Z77xkLVpEiLFjPn5sRrD+T/qQ2N1E3MaKUkpei/cFpwWb6MmSIWLIozZePZ+OSkzGYQQEFFFBAgWC5nmB5ePAb+kJCzFy866HoQSaxWbXZ+UJXUFSgVMpUpRkp6d6dpWSzCBRl1aqUKuX5c1PKhQu85FWtWjKjnB4eLFgPH5oRLP8Ef35TkLatEaWSohLtV6QqzPSlXz+xZFFWtCilSo+KwmAGBRRQQAEFguV6glWhgkK/eIGZO4o6yTuRSexW73a+0IaX+gWkBJhS5J068StudotAUdWpQ6mSHzwwpRgWbW/UyFiwypdnwbp1y4xgnYk/Q23uqutqRPlA+QHtf5ry1Ixg9eghlizKS5fmy52BgRjMoIACCiigQLBcT7CqVVPql99MMS10a1lrMolDmkPOF7qeqh6lupd0z5Qia92aVy0/JAJF3aQJpUq8edOUYva1gxRVq7JgXb5sRrB+ifuF2tw7sLcRpYG6Ae3/K+mvlyqLyipVeDZOJsNgBgUUUEABBYLleoJVr55K/wKZJNNCfyj7kEzipOak84VupmlGqa4nXjcjWB9+yIJ1UgSKtm1bSpXg729K2b1bTd3s1ElulLN2bb4F7fx5jSllb8xeavPAoIFGlBaaFrT/auLVlyqLqpo1eTbu8WMMZlBAAQUUUCBYridYzZrx1M7164mmha4jq0MmcU5zzvlCt9e2p1R+CX5mpER/XU9zTgSK7uOPKVX8mTOmlC1b2CO7d1cY5WzcmAXr5EkzgrU1eiu1eUTICCPKR9qPaP+FhAsvVRbVjRpRqqQ7dzCYQQEFFFBAgWC5nmC1b8+P1/n5JZgW+n3Z+2QSf2j+cL7QXjovSuUb72tGSt5/n6XkDxEogZ9+Sqnijh0zpaxezYLVt6+xYLVqxYJ16JAZwVoTtYbaPDF0ohHlE90ntP9U3KmXKouaVq34cueVKxjMoIACCiigQLBcT7C8vPgdMr6+ZhbnLC8tTybxp/ZP5wvdJ7APpToSe8SUIq1QgUxC+6cIlKABAyhV7M8/m1J++IEFa8gQY8Hq1Ikfoty9W21KWRK5hNo8M2ymEaVvUF++NS320EuVRa3+dq74c+cwmEEBBRRQQIFguZ5g9ekTSIZx5IiZJUA9pLx41QPtA+cLPSh4EKXaE7PHjGC98w4L1gMRKCFffkmpordvN6UsWMD38o8cqTTK2b07P0S5ebPKlPJtOL/remHEQiPKkGBef3VXzC4zfSlfXixZDNQ/kBh34gQGMyiggAIKKBAs1xOsQYOCyTD27DGzLnkRaREyiWfaZ84XekTICEq1NXqrGSl5+22WkmciUELHj6dUUevWmVJmzWLBmjjRWLD69mXBWr3ajGBND5tObV4WucyIMipkFO3fFL3JTF88PMSSxSBvb56NO3AAgxkUUEABBRQIlusJ1ogRIWQYW7dGmxba8NI9pVbpfKEnhvJ7o9dErTEjJW5uLCVKEShh06dTqshly0wpkyaxYM2YYUwZPJgF64cfzAjWuNBx1OZ1UeuMKJNDJ9P+lZErzfSlSBGxZDF42DBKFbNjBwYzKKCAAgooECzXE6yJE0PJMNasMV4xXKVVkUa8KXlTlELPDJvJrzWM/MH4z6lW80v33hSHEv7tt5QtYuFC05Nm1CgWrPnzjQVrxAgWrAULlKaUL4K/oDb/FPOTEeWb8G9ov0+EjxnBeustsWQxZMwYno3bsAGDGRRQQAEFFAiW6wnWzJlh+imcSKNCP9c+J40oLC0sSqEXRCygbPPD5xtRtP/8QxohLSwOJXLJEsoWNmuW6UkzdCiL1JIlKqOcEyaweM2aZUawPg/6nNq8P3a/EeW7iO9o/9zwucZ9UalElMWwqVN5Nm75cgxmUEABBRRQIFiuJ1gLFkTop3bCjQr9UPuQNKKktKQohV4auZSyzQibYSwlf//NglVSHErU6tWULXTSJNOTpl8/FqxVq4wFa/p0FqzJk80IVs/AntTm43HHjSg/Rv5I+6eFTTPuy/PnIspi+Jw5PBu3aBEGMyiggAIKKBAs1xOspUsj9TcnhRkV+pb2FmlEOWk5UQq9NmotZZsQOsFYSm7fZikpJw4lessWyhYycqTpSdOjh+FpQbVRznnzWLBGjzYjWJ11nXmd1fhzRpT1Uetp/9jQscZ9efhQRFmMWLyYsoXPno3BDAoooIACCgTL9QRr7dooMowJE0KNCn1Ze5k04j3pe6IUelv0Nsr2VchXxlJy5QpLyXviUGL27KFswYMHm540putdGcLHhwVr2DAzgtVaw69ivJx42YjyU8xPtH948HDjvty6JaIsRq5YwZc7p0zBYAYFFFBAAQWC5XqCtW1bNBnGV1+FGBX6vOY8aUQtWS1RCr0vdp/Re/0MB2ouXCCNkNUShxJ75AhlC/rsM9OTpnVr4xXbDbFyJb+j0NtbbkpppG5Ebb6ddNuIsj92P+3vH9TfWLAuXxZRFqM3buTZuNGjMZhBAQUUUECBYLmeYO3bF0uGMXBgkFGhT2lOkUY0kjUSpdC/xP1C2XoH9jYWrNOnSSPkjcShxPv6UjZdt26mJ43pOwcNsXEjC1bPnmYEq6aqJrX5cfJjI8rxuOO0v2dgT+O+nD8voizG7NzJs3FDh2IwgwIKKKCAAsFyPcH65Zc4MozevQONCn1Yc5g0opWslSiFPhN/hrJ11XU1oqgPH2bBatlSFEqCnx+vktChg+lJU7s2C9a5c8aCtWMHC1aXLmYEq4qyCrVZliIzopyNP0v7O+s6GwvWqVMsWCLJYuyhQzwb168fBjMooIACCigQLNcTrDNn4skwunbVGRV6t3o3aUQneSdRCu2f4E/Z2mnbGQuW/q4p+UcfiUJJvH6dXwXYvLnpSVO1qpS6efmy1ijn/v0sWG3bmhEsT7kntTkwLdCI8kfCH7S/taa1sWDpZVHWShwljdPrWmD37hjMoIACCiigQLBEEKw3TMLsV2IJlr9/AhlGu3Zao0JvUW0hjeiu6C5KoW8m3qRsTTVNjSiqrVtZsLp1E4WSdO8eZVPXr2960pQvz4J165axYB07xoLVtKnMlOIuc6c2R6dHG1FuJfHzlY3VjY1lcfdu7ksncZQ0QX93mrZjRwxmUEABBRRQIFjiz2AZCZZAbRIuWDdvJuoNQ2NU6DWqNaQRfRV9RSn0g+QHlK2uqq6xYK1dSxqh6NNHFEpKQABlU1avbnrSlCzJgvXwobFgnTmjof316pkRLDepG7U5JSPFiPJ38t98+7+qlnFf9ItEKLqLo6SJV6/ybFzLlhjMoIACCiigQLBEFiyzdmWXY9n82YMHyWQYdeuqjAq9VMVLgw5WDBal0M9TeF3495XvG0vJsmUsJQMHikJJVSo5W8WKpidN4cIsWP/8YyxYFy+yYFWvbixYqRmphjcFmVIkKRL66l3lu8Z9WbOG6X3FUdKku3d5Nq5hQwxmUEABBRRQIFivnGD52oqtW8+TYZQt+8Ro/4jrI/hZuVs9fcWIXWd3UTaPAA+j/ddHjiSNuN2jhyiU337+mbI9K1rU9Ku8ef+hbp469avR/m3bztH+0qWfGu0/cuYINbjA8wKmqfac3UNflQgoYbT/6rhxRL/TtasofTm/aRNle1Khgi8CgUAgEAirYZ9gWTcqsWaw1OpUMozy5RVGJvuNkl9pPEE5QRSTDUsL4xfvyEsaz/roXwijGDdOFEp6bCzfZl6kiBFFqdRSH93cpKY5793jrzw9pUaU4LRganApeSlTSkR6BH1VTFbMuC8LF3JfRowQZzZOLudslSvj/1sCBRRQQAEFM1hizmD9O4IVFpZGhlGypNyo0FOUU0gjpiuni1Lo+Ix4ylZIWshYfaZN47umpk0T58+ZlmZ43bIRJSCALertt80I1tOnOvrK3V1iRFGkKqjBlRSVzNwdlZFIX+WX5jfuyzffcF8miKOkaUFBfMu8pycGMyiggAIKKBAs0QTLVIxekmDFx2eQYRQqJDUq9BjlGNKIecp5ohQ640UGZcsjyWNEUYwdSxqhmjtXrD+n1M2NEmakpOSk3L/PglWqlBnBkstZsPLlMxasJ8lPqMEfKD8wS6GO0LfUqVyCNWUKC9Z0cZQ0PTqaZ+Pc3TGYQQEFFFBAgWC9RMF68XKeIszIoN9I8uSRGBV6uHI4OYSP0kesQueX5qeESRlJuQTriy9YsBYvFotCRkIJyU5yUm7e5DvZK1aUmU1LfadvtdpclLtJd6m1DdUNzVIKSgvSt/EZ8bkEa8wYFqx5IilpSgq/eMfNDYMZFFBAAQUUCJY4gmXJil7GOlisPvn5CbukpFzzMf3l/ckhVqpXilXoYrJilDAyPTKXYA0YwIK1fLlYFLmnJyVMCwrKSbl0iQWrWjXzglWgAAuWVJqLcjXxKrW2paalWUoJWQn6NiwtLJdgDR/OguUjmpJK3nyTEr5IS8NgBgUUUEABBYIlzgyWaHkFCFaxYvwamcjI9JyF7iXvRQ6xUb1RrEKXkZehhLo0XU6KvHdvXoxg/XqxKIrKlSlhqlyek/Lbbxr9UhTmBatYMRasx4+1OSnnE/hd1x21Hc1SyinK0bfqVHWuvvTvz31ZKZqSyooU4dm42FgMZlBAAQUUUCBYridYZcrIyTB0ulwzJR/LPyaH2KHeIVah31W+SwmlKdJcUuLlxVKyfbtYFFWNGpQw+cmTnJTjxzVGy7XnjNKleQLv7t1cgnUy7iS1tkdgD7OUqsqq9O3zlOe5+tKrF/dlo2hKKn/nHZ6NCwnBYAYFFFBAAQWC5XqC9e67Sv01slw3hreTtyOH2K/eL1aha6lqUcJHyY9ySUmHDiwl+/aJRVE3bEgJk+7ezUk5cMD4hYM5o3JlFqxr13IJ1sHYg9Ra7yBvs5Q6qjr07YPkB7n68vHH3JcdoimpomJFno1TKjGYQQEFFFBAgWC5nmDVqqUiw3j0KDlnoZvJm5FDHFMfE6vQjdWNKeHtpNu5pKRFC5aSo0fFomj0CROvXs1J2bmTBatLF/OCVaMGXyH188slWDtidlBrhwUPM0tpom5C395MvJmrL+3acV/2i6akyurVKWFKQAAGMyiggAIKKBAs1xOsxo3ZP27fzvV8X31ZfXKIM5ozYhW6taY1JbyceDmXlOgnnNS+vmJRtB99RAkTLlzISdm4kTvYs6d5wWrQgAXL11edk7IhagO1dmzoWLOUttq29K1/gn+uvjRrxn05JpqSquvX59m4e/cwmEEBBRRQQIFguZ5gtW7NtyhdvpyYs9AfyD4gh7iouShWoTvrOlPCc/HnclKk+lumtH5+YlF0n3xCCeNOncpJWbmSBat/f/OC1bw534J29GguwVoeuZxaOy1smllKV11Xts/4MzkpMr0Pac6IpqSa5s15Nu76dQxmUEABBRRQIFiuJ1idO/Nim+fO5VrVqbKsMjnEdc11sQrdM7AnJTwRdyKXYFWpwoJ17ZpYlKC+fSlh7KFDOSk+PnyT2fDhSrNpO3Rgwdq3L5dgfRfxHbV2bvhcs5Tegb3p21/ifsklWB98wIJ1UTQl1epvUEvw88NgBgUUUEABBYLleoLVs2cgGcaJE3E5C+0p9SSHuKe9J1ah+wfxwloHYg/kEqwyZViw7t4VixI8ZAgljNm1Kydl3jwWrDFjzAuWlxcL1vbtuQTrm3B+FeP3Ed+bpQwMGkjf7ovdl0uw9CtEaK6LpqS6bt0oYfz/v8MSgxkUUEABBRQIlisJVv/+QWQYBw7kWm+pqKQoOcRT3VOxCj08mJeG3xGzI5dgFS/OgvX4sViUkFGjKGH0pk05KV9/zYI1ZYp5werdmwVr/fpcgjU5dDK1dlXUKrOUr0K+om+3RW/L1Rf9Gqfae6IpadBnn/Fs3JEjGMyggAIKKKBAsFxPsIYPDybD2LEjJmeh80v4zTZynVysQo8NHUsJN0RtyEmRFCxIDqGTSsWihE6eTAkjV67MSRk/XkEdnD1bZTbtgAH87fLlqpyUkSEjqbWbozebpUwInUDfro1am6svRYtyX56KpqTBgwfzbNyePRjMoIACCiigQLBcT7DGjg0lw9iwISqr0Fqd1vBuZhELPS1sGuVcHrk8l5TkzctSotGIRQn/5htKGOHjk5Py1VesUN99Z16wvviCv128OJdgDQ4eTK3dE7PHLGVG2Az6dmnk0lx9yZ+f+yIXTUlDRo7k2bgtWzCYQQEFFFBAgWC5nmBNmxamn8LJfkugTCcjgSggKSBioeeGz6WciyIWZf85FQp+SY2bm4iUiO++o5zhc+fmPGkGDmSFWrbMvGCNHcvfzp2bS7A+C/qMWnsk9ohZyvzw+fTtgogF2RStVqJ/abaIfQmdNIlyRq1ejcEMCiiggAIKBMv1BGvu3HByg0WLIrIK/Vj7mASimKSYiIX2ifChnLPDZ2f/OQMCSCCk7u4iUiJ//JFyhk2blvOk6dOHFWrtWvOCNW0a36FFnzkpXjovaq1vvK9Zyg+RP9C3M8NmZlNkMhasAmIqadisWTwb9/33GMyggAIKKKBAsFxPsHx8IvS3KIVnFfqu9i4JRGlpaRELvTJyJeWcEjYl+0LkvXssWKVKiUiJWr+ecoaOHZvzpOnWjW9j37ZNbTbtnDm8kP24cYqclPba9rwMWMJFs5Q1UWvo24mhE7P78vgxC1YxMZU0YuFCno2bNw+DGRRQQAEFFAiW6wnWypWR+ofswrIKfU17jQSisrSyiIXeFL2Jco4OGZ1F0dy4QQIhq1hRRErMTz9RzuAvvsh50nz0EQvW3r3mBWvRIhasL7/MJVjNNPymoBuJN8xStkZvpW9HhIzIFqy7d1kWS4uppJHLlvFs3NdfYzCDAgoooIACwXI9wdq0KZoMY/TokKxC+2n9SCBqyGqIWOhdMbso59DgodmC5e/PglWtmoiU2P37KWfQ55/nPGlatGDBOnLEvGD9+CML1sCBuQSrrqoutfZ+8n2zlL0xe+nbQcGDsgXr2jUWrMpiKmnUunU8GzduHAYzKKCAAgooECzXE6xdu2LIMIYODc4qtK/alwSigayBiIU+FHuIcvYL6pctWL/9xoJVt66IlLjjxylnYK9eOU+ahg1ZsE6fNi9Y69axYPXpk0uw3le+T619lvLMLOVo3FH6tk9gn2zB8vPjvtQQU0mjt283nY3DYAYFFFBAAQWC5RqCdehQLBlGv35BWYU+qmaBaC5vLmKhT8WdopzdA7tnC9aJEywlTZqISIk/e5bXSujSJedJU6OGlDro56c1m3bbNn5TYbdu8pyU8ory1Fp1qtos5df4X+lbL51XFkXt68t9aSCmksb+/LPpbBwGMyiggAIKKBAs1xCsU6fiyDC6dw/MKvQ+9T4SiPby9iIW+kLCBcrZUdsxW7AOHmQpadNGRErCH3/wcupt2uQ8aapUYcG6ds28YO3dy4L10Ue5BKukvCS1NiwtzCzlYsJFro+2fbZgHT1KXHlzMZU07tgx09k4DGZQQAEFFFAgWK4hWBcuJJBhdOyozSr0dvV2Eoiu8q4iFvpq4lXK2VLTMltKdu1iKencWURK0q1blFP94Yc5T5rSpVmw7t41L1hHjrBgtWyZS7AKSgtSa+Mz4s1SbiTeoG+baZpl92XfPu5LezGVNF5/CdVoNg6DGRRQQAEFFAiWawjW1auJesPQZBV6vXo9CcSn8k9FLPTdJF76oaG6YbaUbN7MUtKjh4iU5L//ppyq2rVznjTFivESCk+emE97+jQLVqNGuQQrjyQPtTbjRYZZyv3k+/RtPVW97L7o75eSdxVTSRMuXTKdjcNgBgUUUEABBYLlGoJ1924SGUbDhuqsQi9XLSeB+FzxuYiFfpL8hJ9MVNXIoqhWrSKBUHh7i0hJkUgop/K993KeNAUKsGDJZObT/v67lr6tWVOaRUnMSOSF7KUFLFGepTyjH1RTVssWLP36W/JPxVTSpD//NJ2Nw2AGBRRQQAEFguUagvXkSTIZRo0aqqxCL1YtJoEYrhguYqHlqXJeW0tROVuwlixhwRo6VERKqv6VNYqyZbMoWq0uTx4WLK35K4S6q1dZsN59N1uwwtPDqanFZcUtUVSpKvpBBUWF7L4sX87cz8VU0uSHD01n4zCYQQEFFFBAgWC5hmDJ5alkGJUrK7IKPVfF7w0cqxgrYqGD0oIop6fcM4uinD+fZ5tGjRKRkh4RwTfOFy+eRZHJdNS7/PklltLeucOCVbZstmBpUjXU1HKKcpYooWmh9AMPuUe2YC1ezII1XEwlNTsbh8EMCiiggAIKBMs1BCsoKI0Mw9NTnlXoacppJBD0KWKho9OjKae7zD1bsGbOZIGYNElESkZiIi/4WaBAFuXJE53+HTYWBevRIxasEiWyBeuflH+oqVWVVS1R4tLj6AeFZYWzBWvuXBassWIqqelsHAYzKKCAAgooECyXEazo6HQyDHd3WVahxynGkUDMUc0Rcz4mI4VyukndsgVr0iQWrJkzxf1zSvRXBF9kZBgof/3F/lS6tNRSWomEf1CoULZgPUh+QE2to6pjcZ7sRTr9IK8kb3Zfpk3jvkwTU0lNZ+MwmEEBBRRQQIFguYxgpaRkkGG4uUmzCv2l4ksSiEWqReIW+k3Jm5Q27UVappSMGsVSMn++uBRpwYKUNiMhwUC5fl2rvwBqUbA0Gp7iyptXkkW5mXiT2tlU09QKJZ80H/0mOSPZQFGMG8f3S80RU0lNZ+MwmEEBBRRQQIFguYxgsfq8ybeBp6VlFnqgYiDZw4+qH8UtdBFZEUobmx6bKSVDh7KULFkiLkVWogSlTQ8PN1D8/LT6W/hlVjK7uXH3lcpMin+CP7WznbadFUpRWVH6TVR6VGZfvvyS+7JIVCXNyDCajcNgBgUUUEABBYLlSoJVpIiMDCM2Nt1Q6D6KPmQP61TrxC30O/J3KG1IWkimlHh7s5SsWiUuRVGuHKVN1WgMFF9ftX4RCrmVzO7uvBJpQIDWQDG8CaerrqsVSml5afpNYFpgZl8GDuS+/CiykhrNxmEwgwIKKKCAAsFyJcF65x1+HXJISObFu27ybmQP29TbxC10RUVFSqtMVRoo8h49eJ2nzZvFpSirVqW0Kf/8Y6AcPcqC1aKFNcEqVYoF6/79TMEyepez2aiirEK/kaXIMgWrTx8WrHUiK6nRbBwGMyiggAIKKBAsVxKsihUV+mtkqYZCfyT/iOxhr3qvuIWurqxOaQNSAjIFq3NnFqxdu8SlqOrUobTJDx8aKPv2sWB16GBNsCpW5Am8mzc1BsremL3UzkHBg6xQaqpq0m8eJz/O7Eu3btyXbSIrqdFsHAYzKKCAAgooECxXEqzq1ZX6a2QphkK3lLckeziiPiJuoeur61Pae0n3DBRZmzZkD5qDB8WlqJs0obRJf/5poGzbxoLl5WVNsKpVY8G6dClTsLZEb6F2jggZYYXSSN2IfnMn6U6mYH30EQvWXpGV1Gg2DoMZFFBAAQUUCJYrCVb9+mwh9+4lGQrdSM72cFp9WtxCN9c0p7TXE69nCpbehDQnTohL0bZtS2kTLl0yUNatU1HX+vRRWMlcty4L1tmzmYK1Omo1tXNS6CQrlFaaVvSbK4lXMgWrZUsWrCMiK6nRbBwGMyiggAIKKBAsVxKs5s01ZBjXrycaCl1Tyte/ftf+Lm6hO2g7UFq/BL9MwapblwXrt9/Epeg+/pjSxv/2m4Hy448sWAMHWhOsJk1YsE6cyBSsJZFLqJ2zwmZZoXTSdqLfnE84nylYjRqxYJ0WWUmNZuMwmEEBBRRQQIFguZJgdejAaxn4+WU+rfau9F2yh6vaq+IWupuO7533jffNFKxq1Viw/P3FpQR++imljTt2zED57jsWrC+/tCZYbdqwYB08mClY88LnUTsXRiy0QukR2IN+czLupIEirVmToNrfRVZSo9k4DGZQQAEFFFAgWK4kWN268WKbvr7xhkKXlZblG4y0d8Qt9GdBn/GtXbFHMgWrYkUWrBs3xKUEDRhAaWN//tlAmT2bBWvcOGuC1bkzP0S5a5faQPk67GteBizyRysU7yBv+s3B2IOZgvXuuyxYV0VWUqPZOAxmUEABBRRQIFiuJFiffRZEhnHkSOYSoCWkJcgeHmkfiVvowcGDKe2emD2ZUlKqFEvJvXviUkL0a35Gb99uoEydyvfvf/210krmHj1YsDZvzhSscaH8pqD1UeutUIYFD6Pf7IzZmdmXsmW5L3dEVlKj2TgMZlBAAQUUUCBYriRYgwcHk2Hs2RNjKHQhaSGyB4lWIm6hR4aMpLRbordkSom7O9mDLiBAXEro+PGUNmrdOgNl7FgWrLlzrQmWtzevUrFqlcpAGR48nNr5U8xPVihjQsbQbzZGb8zsi37BKu0jkZXUaDYOgxkUUEABBRQIlisJ1siRIWQYW7ZEGwqdV5KX7EGj04hb6Emhkyjt6qjVBopE/4YanUIhLiVs+nRKG7lsmYEyfDgLlo+PykrmoUNZsJYsyRSs/kH9qZ0HYg9YoUwNm0q/WRG5IlOwChViwZKIrKRGs3EYzKCAAgoooECwXEmwJk0KJcNYvZrfrKfUKUkd3CRuohd6Vtgsyrwkcgn/OTUaif4dy6JTwr/9ljJHLFxoOGn69+fLfytWWBOsUaNYwubPVxooPQN7UjtPxJ2wQpkTPod+szhicaYs5s3LsqgRWUmNZuMwmEEBBRRQQIFguZJgzZoVpp/CiaTtAG0AqYO71F30Qi+MWEiZvw3/lv+cUikLVsGColMivv+eMofNmmU4aXr1YsHauFFtJfOkSSxYM2dmClZnXWdq57n4c1YopFb0G9IspiiV3Bc38ZXUaDYOgxkUUEABBRQIlisJ1sKFEWQI337L77y7r71P6lBKWkr0Qi+LXEaZp4dNp23t48ekDtLixUWnRK1aRZlDJ00ynDQff8yCtWOHNcEitaLfkGYZKIZFRC8nXrZCWRG5gn4zNWwq9yUggPviLr6SGs3GYTCDAgoooIACwXIlwVq2LJIMY/r0MNq+qblJ6lBRVlH0Qq+LWkeZx4eOZym5e5elpEwZ0SnRmzdT5pCRIw0nTdu2LFj791sTrPnzWbBGjcoUrJyvwbEUG6M30m/GhIzhvty/z30pJb6SRi5ZknM2DoMZFFBAAQUUCJZTgvXG/4fZnQK1SbhgrVsXRYYxfnwobV/SXCJ1qCarJnqht0dvp8xfhnzJUnLtGktJlSqiU2J276bMwYMHG06apk15EdHjx63dHbVkCa+VNXSowkDJ+SJnS7EzZif9ZljwMNrW3LxJRFlF8ZU0avXqnLNxGMyggAIKKKBAsBwXrJxWZHZbdMHavj1av9x5CG2f1Zwldagrqyt6oX+O/ZkyDwgawILl58eCVaOG6JTYw4cpc9BnnxlOmnr1WLB++82aYK1axYLl7Z0pWJUVlamdshSZFcrB2IP0G+8gbxasS5dYsKqJr6TRW7bknI3DYAYFFFBAAQWC5aBgWVIi09ksEQXr559jyTAGDAii7ROaE6QOTWRNRC/0sbhjlPnTwE9pW+3rS+ogb9hQdEr86dP8QF+3boaTpnp1Fix/f2uCtXkzv+u6Rw+5geIp96R2BqUFWaGcjDtJv+kR2IMF6+xZFqy64itpzJ49OWfjMJhBAQUUUECBYDklWKaXAh0TLF9hMWfOH2QYzZvfo+1F/otIHRo8aOArdiz056cIGz1oRNsX9XcXPaxTR3SKv48PZ65Xz/BPT8+n1LXt289ZOWTevEv0m6ZN7xv+Weg5r7N6+MxhK4fkrNLFZcuYWLOm6H3545tvKPO9li19EQgEAoFAWAihgpXzUqCly4LizmD99ls8GcbHH7OT7lTz3UWd5Z1FN9lLCXx3V1ttW57B2rePZ7A6dBCdkqi/u0vTvLnBykuVklLX7t/XWsl88KCGftOmjcxAeUv6FrUzJSPFCuVK4hX6TStNK+7LgQM8g9Wmjfizcfp5Pp2XF/6/JVBAAQUUUDCDJeYlwn9HsC5dSiDDaNtWS9ub1Jv44pe8h+iF/jPpT774qG7CUrJ9OwuWl5folKS//qLM6vr1DSeNuzsLVkCANcE6cYIFq0kTFqzUjFRqJDmWdcqdpDs8G6duxH3ZuZP70ll8JU3Q36mmbd8egxkUUEABBRQIlusJ1p9/JukNQ03bq9Sr+PZthbfohX6Y/JAy11HVYSlZv56lpHdv0SkpT59SZmX16oaTRv8+HonS2qsIdWfPsmDVrcuCFZMeQ418W/a2dcrj5Mf0s5qqmtyXTZu4Lz3EV9LE69d5Nq5Zs9dhMO/atWvUqFG7d+/Gf5hAAQUUUCBY4guWkVT9O08RPnyYTIZRp46Ktr9Xfk/qMFQxVPRC/5PyD2WuqqxK26rly0kdFAMGiE5JVSg4c8WKrD5qnf59PDZeEXjpEgtWtWosWEFpQbzOqryUdYosRUY/q6KswhT90qYKb/GVNOnePcqsqlfvdRjMZFft2rUbPXo0/sMECiiggALBelmC9S+vg/XPPylkGFWrKmn7W+W3pA6jlKNEL7QmVUOZyynKsWAtXsxS8sUXolPSgoN5Pumdd/T90lK/CheWWs988yYLVsWKLFjyVDk1srKisnVKYFog/ay0vDRtK/Uv51EMFV9JU/RrxCurVXsdBvOQIUNIsMaPH4//MIECCiigQLBeimCJmVeYYGk0qWQY5copaHuGcgapwyTlJNELHZ4eTplLyEqwYM2dy1IydqzolPSYGL7l/G2+xvf33yxYJUvaEKz79/lnpUrxz54kP6FG1lDVsE6JSo+inxWVFWXB0r/QRjlKfCVN1b/lUFGhwuswmHv16kWCNdbCKYH//IECCiigQLBcT7DCw9PJMEqU4KU1JyonkjrMVM4UvdAJGQmUuaC0IEvJtGksJdOmiU7JSE3lJUzf4rvUb9/W6sXRhmAFBPDP3N35Z4a71xuqG1qnJGck08/ySfNxX2bM4L5MEl9J00JCeDbOw+M/P5jlcnk7fQwbNgz/YQIFFFBAgWD9RwQrISGDDKNgQSltj1SOJHWYr5wvvvq8yKDMeSR5aFsxbhzfXTRnzsv4c5JdUXIyrcv/x955gEVxdQ14UYnGbqzRaIwtsSdRoyaoQUHsFVsUO8aOBRV7Rey9YQc7KlFRVFTs2EFRRGH77tBEqVIF/3N2yLKh7A6wVz/8zzw+POsyc965d/feeZm599xbaE516xoQLIUCh2qZmuJQLd38C/q3IuIisGfaxzTF1KkoWHOMr6RpcXF4N65UqS++Md++fZsXrL59+1LHRBSiEIUoJFhfiGClp8OeYhMTMbweLh8O3uCkdGJR0SUkJSB4YnqifMwYFKxly1hQpGXKQPC02FgvLxxc1aSJ1GDwIkVwsqFaHeKV4AVnaMlZGqSUkpaCPePT4hXjxqFgLTa+kn788EGsGaX/xTfmY8eO8YLVsWNHjuOoYyIKUYhCFBKsL0GwUH1KYL6oxMT0gfKB4A0blRtZVHQFaQUI/i7tnXzoUBSsNWtYUGRVqkDwD+Hh586hYLVsaViwSpbE4ovF3Jn4M9o1cPRvlWSVYM83H97Ihw/HsjgxUVKJJs9EenLyl92Y16xZA3ZlZWUFP1++fEkdE1GIQhSikGB9IYJVoQKu2ffuXVoveS/whl3KXSwqurq8OgTnUjl5//4oJVu2sKDIv/8egqfK5W5uKFhmZoYF65tvULBevOCOxR2DMxwcNtggpaa8JuypTFXKBw7EsmxkoqTSsmXxblx09JfdmKdMmQJqNWDAAPjp4+NDHRNRiEIUopBgfSGCVb26HAyD41ItZZbgDS4qFxYVXVdRF4KLU8Sy7t1RSnbvZkFR/PQTBE8JDHRxwVWcLS1lBoNXr46C9fgxtz92P5zhqPBRBikNFA1gz9cpr+W9emFZdjFRUlm1ang3LjT0y27M/BTCCRMmwM8LFy5Qx0QUohCFKCRYX4hg1a2r0DwjS2knbQfecEJ9gkVFN1E2geDPk5/LOnXCBW1cXVlQVL/8AsGTfH137VJCoXr1khsMXqcOCtadO9y26G1whhPfTDRIaa5sDns+TX4qs7TEsrgwUVLFDz+gLEqln7GZOTkpf/tNCj8ZUYKCgsCrunbtunjxYnhx5MgR6piIQhSiEIUE6wsRrCZN0EWeP09uJW0F3nBWfZZFRbdSYfCHSQ9lf/yBUuLmxoKi/v13CJ549+6mTViogQMNC1ajRihYV69ya6PWwhnaR9obpLRRt4E97yXek7ZrhwvanGCipMpGjSB4ckDAZ2xmYFfatRpZUK5evQpeZWtru2nTJnixbds26piIQhSiEIUE6wsRrFat8Gnaw4dJTaVNwRsuqy+zqOj2XHsIfjPhpqxFC5QSDw8WFE5zeyzh6lUnJxSs4cMNC1aLFjLY08NDtezdMjjDhW8XGqSYc+awp3eCt7RVKyzLWSZKqtJUVNLjx5+xmTVtioL1yy+sBOvgwYPgVUuXLuVfrFixgjomohCFKEQhwfpCBKt9e0wZdfNmQn1pfXQg9U0WFW0VYgXBL72/JG3cGKXkyhUWlJAePSD4ew+PxYvxuee4cQqDwf/4AwXr5EmVQ6QDnOHKdysNUrqFdIM9L7y/IG3aFMtymYmSqs3M8G7c7dufsZlVqSLRLCUkYURZtmwZeNWBAwfOnj0LL2bmlH6Wuj+iEIUoRCHBKpSCZWWFyTYvXXpfU4KT4x5wD1hUdO/Q3hD8n/h/JHXrgjdwefEG4ZSwAQMgeJyb25w5KFh2doYFq1MnFKxDh1R2b+wwS0X0RoOU/qH9Yc9T8aek9eujYN1koqScZoBXgpfX52pmr17hFwP+FS0qlsuZUGxtbcGrrly5cvPmTXgxZswY6piIQhSiEIUE6wsRrN69Q+Ei+s8/8ZUlleF6+ox7xqKiB4cNhuBH445KatRAwXr0iAUlXJOYKtbFBdQKCgWaZTB49+4oWHv2qMZFYCJ75xhng5Rh4cNgz0OxhyQ1a2JZHjBR0lDNFMX4vDx/NG4z++cfTHVRvDg61rVrahaUrl27gle9evXK398fXvTr1486JqIQhShEIcH6QgRr8OAwuIIePRpXRlIGsw9wr1lU9KjwURB8X+w+ScWKKCXPn7OgRPz9NwSP2bVr3DgUrMWLDQtW//6YpWLrVqVNuA2coWusq0GKbYQt7Lk7ZrekcmUsyzMmSho2aBDejTt+/HM1M0dHrMPvvsOnhDt3qoxOef78OUhVr1694LVKpYLXFhYW2ZO5U/dHFKIQhSgkWIVSsEaNCocr6L59saYSU/AGBadgUdET30yE4Nuit0lKlUIpCQ5mQXkzbRoEj964cfhw1Kbc8gvobkOH4p5r1yr5B38n404apEx9g6tib47eLNGszMO9ZqKk4SNH4t24Awc+VzPja+bPP/EO37RpCqNTPD09QaomTZrE/7dHjx783SzqmIhCFKIQhQTrSxCsiRPfwBV0y/a3IA1FxUUZVfTMyJkQf23UWhzRIxKFqFQsKG/nzoXg71auHDgQ5WDTJsOCNWYM7rl8uVI7dN0gZU7kHNhzVdQqfjUbTsFESSMmTMC7cTt2fK5m9uuvqFbTp+N9rG7dZEanODs7g1GtWrWK/6+NjQ389/79+9QxEYUoRCEKCdaXIFgzZ0bCFXTFBjVIQylJKUYVveDtAoi/9M1ikAbwEkaUd8uWQfy3Cxf26oXatGuXYcGaNAn3nD9fqU2+YJCy5N0S2HNx5CJ+BDijskTOmAHxo9av/yzNTK3OWKXxzBmcZFq3rsTolAULFugmF+XXzLl48SJ1TEQhClGIQoL1JQjWggVvcTz46iCQhoqSiowq2vGdI8R3CEFpkJQpw4gStXYtxI+0t7e0xLsvLi6G75PNnIl3aOBna3VrPn2oQcrqqNWw56wQfBwpKcVKSd/On49343JKDfUJmtndu+hV334rkctDihbNeSJhASkjRowAo7p16xb/30WLFsF/jx07Rh0TUYhCFKKQYH0JguXo+A4upZMcn4E01JDUYFTRG6I2QHw7xTiUksqVGVGit22D+G8mTTIzwwyZbm5qg8EXLMCUpBMnypspm+EkyuRnBilborfAnpOVY7EsFVkpKagV3o2bP/+zNLM9ezD9rIUFPhnkVxPKPpGwIBS1Wm1hYWFubi79dy2gDRs2gGDtyPZIlLo/ohCFKEQhwSqUgrVhQxRcPkcsvQfSUFdSl1FF74zZCfFtJX+hlNSsyYgSu28fxA8fPbplSxSsc+cMC9aKFShYo0fL6yswz2pQSpBByp6YPbgstBRn+UlqsFLSqPXr8W7cjBmfpZnNmIE39qZMweFlXbvKcpxIWBDK48ePQacGDhyofefAgQPwzsqVK6ljIgpRiEIUEqwvQbB27oyBy6f1Qm+QhsbSxowq+mDsQYg/LKg3SIO0fn1GlLijRyF+2JAhTZqgYHl5GRasdetQsIYMkdeQ14AzVKWqDFIOxx2GPQcHYdZ4SV1WShqzYwfEj5gw4bM0MyurTKmaNk2R40TCglDc3d1Bp2bo6OM///wD78yaNYs6JqIQhShEIcH6EgTr4MFYuHx2nXcBpKGFtAWjij4RdwLi9w+0QMFq2pQRJf6ffyB+aJ8+deviU61btziDwbdtw2dhffvKvpF+A2f4Nu2tQcrp+NOwZ+9XHbEsjVkpaeyBA3g3buTIz9LMatWSahZQQkPdsUOV40TCglC2bNkCOrVx40btOzdu3OAXfqaOiShEIQpRSLC+BME6cSIOLp8dHE6BNJjJzBhV9Ln4cxC/24vfUUpatWJEeX/pEuaAsLKqUQMF69Ejw4K1dy/aQ9eusq8lX8MZJqQnGKR4vveEPTu/bINlacFKSeOOH8e7cYMGffpmFhTEmZhgDnc+mca1azlPJCwIZdasWaBTp06d0r7z9OlTeMfa2po6JqIQhShEIcH6EgTr3Ll4uHz+NscVpMFCZsGooq8kXIH45s9/QSlp144RJeHmTUxM1b59xYooWM+fGxasw4dRsMw7Sk3EIBUm6R/TDVKuJ1yHsrQLaA4smRkrJY0/exbvxmkSnX/iZnbuHC6S07RpxvDz3CYSFoQyePDgLFmv5HI5n8ydOiaiEIUoRCHB+hIE68qVBLyaztoN0tBD3oNRRd9JvAPxW/v/hFJiacmIkvTwIcRXtWpVqhQKVnCwYcE6dQoFq3WHQDi9ryVfC6HcT7wPO7d83gDLYsFKSRO8vFAW81hXRmlmTk44Lm3QoEyfynEiYb4p4FLm5ubgUqr/5pvt1q0bOFbwf7P8U/dHFKIQhSgkWIVSsO7cSYRrZ/1Zm0EarOXWjCr6SdITiN/cvzZIg7xnT0aUZH9/iK9s0kSTLl4sJF38+fMoWM3a+8LpfSP9RgjlWTKmtGj8vBaWpQcrJU28fRviq/N4h8wozYxfaGjp0sw0rTlOJMw35e7duyBSw4YNy3LaQ4cOhfcf/HfxbOr+iEIUohCFBKtQCtaTJ0lw7aw5axXO8pMPY1TRL5NfQvwG/t+ilAwYwIiSEhyMYlXnR/hhaioWEpwfYFTPzAfTgMlrCKEEpWBS1jovqmJZrFkpadLjx3g3Lo9jvIzSzPgkF25umTqV40TCfFOOHz8OIuXg4JDltCdNmgTvX758mTomohCFKEQhwSr0gvXyZTJcO6vOWQzSMFY+llFFy1JlEL/m829QSmxsGFFS1WqI/7xafShR2bISIcH5lOU1/rgGp1dfUV8IRZWqgp2rB5THsgxjpaTJAQF4N65Ro0/czDgupHRpfCD44kXmA9YcJxLmm7Ju3bocc4ryi+ecOHGCOiaiEIUoRCHBKvSCJZOlwrWzvAMuYDxZPplRRYd9CIP4lQNKo5Rkm4pvLEra27cQ/0G5elCiKlUECdaTJyhYlcwwS0UzZTMhlMgPkbBzhZclsSxjWSlpilQK8RU//PCJm9m9ezjCvWpVSfb7fFkmEuabMnXqVBApDw+PLKe9fv16eH/Xrl3UMRGFKEQhCglWoRessLAPcO0sNX8KSIO9wp5RRcekxUD80q+KozRMmcKIkp6QAPFvFEfBqlVLKiR4QACqQ2kzzFLRWt1aCOV9+nvYucRrUxSsyayU9ENoKA6ir1r1Ezez/fs10yrN/3OzKseJhPmm9O3bF0Tq6dOnWU5779698L6TkxN1TEQhClGIQoJV6AUrJiYNLqhfLbIFaVigWMDqfkx6CsQvFlwEBStbtm6jfZzp6WITk4smDaBEP/4oSLAkkhAsfntMzm7OmQuCfEyHnU2CRVgWe1ZKmhYdjSktypb9xM2MX/164sSsaztnn0iYP0pwcDBYlJWVFcdlnePJp3fPMjaLuj+iEIUoRCHBKpSClZKSDhfOIstswBcclY7sKrqouCggXhcVKRYuZEeRlCjxj6gplKh5c0GCBVd52NnEfC/mQQ3pJpBSXFIc9g8oLlIsYKWk6cnJuBSPqeknbmbduuGEwe3bs87AzD6RMH8Ub29vsKgxY8ZkP23+V3///Td1TEQhClGIQoJV6AUL1aeoWOQ0AIxhvXI9u4ouLS0NiGelRApHhhonrVDhmKgVprZqLRUY/6uvxKIu23Aln9D+AinlpeVh/yflREqWZREXwRt+IUKyTRivmdWujXeqvL2zLuOYfSJh/iguLi5gUYsXL85+2r6+vllWgKaOiShEIQpRSLAKsWCVLi0VbewJxrBdtZ1dRVeWVQbEg4oi1YYN7Cjy6tUPiNrh4j8dZALjly0rFvVZB+dmE24jkPKt7FvY36eKSLmeoZJKS5XCXKP/TbzJtJmJxbhIjqmpWKHI+vwu+0TC/FEcHR3Bovbu3Zv9tGUyGfyqc+fO1DERhShEIQoJ1pcgWJUry0Q7LcEY9qn2savoWvJagLhZQ6TKNj/fiBRF3bo7RZagAl26CBWsqlUlosEr4NzGRYwTSKmjqAP7e9cSqbYzVFJZpUooWM+ff7Jm5uGBFtWoUQ4TMLNPJMwfZfz48WBRXl5eOZ55165d4bdisZg6JqIQhShEIcEq9IJVq5ZcdKAdGMMR1RF2Ff2j4kdAXK4rUu3fz46ibNJko6gnqECfPkIF6/vvpaKRC+Dc7N7YCaQ0VjaG/T0biFT7GCqpvGZNFKxHjz5ZM1uzBhfJGTBAnj1m9omE+aN0794dFOrly5c5njm/RuEjnSJT90cUohCFKCRYhVWwfvxRITrWCozhtOo0u4r+WfUzIM41EqmOHmVHUbVq5SQaAJYweLBQwfrxR6lovD2cm0Okg0BKS1VL2N+9mUh1hKGSKhrgcofc7dufrJmNGoUDrRYtUuQYNstEwnxQAgICwJ965r5W0sSJE2GHK1euUMdEFKIQhSgkWIVesH7+WYWyIBZdUF9gV9Ft1W0B4farSOXuzo7CtW+/WGQDHgCuIDB+8+ZS0bTJcG7L3i0TSGmnxht+IKWq0wyVVNm8OS5HqGMbrJvZb7/hIjnHj6tzeX73n4mE+aBcvHgR/AksKrcznzdvHuxw8uRJ6piIQhSiEIUEq9ALVtu2anzcJRZdU19jV9EduY6AcP1dpPb0ZEcJsbKaI7LVZHISKlitW0tFDmPh3NZGrRVI6RzSGfY/0E6kvsBQSdVt2qBgZct4zq6ZlS2L96j8/bkcw2aZSJgPyu7du8GfVq5cmduZr1mzBnZwdnamjokoRCEKUUiwCr1gdezI4YBtsciH82FX0d1DugNid0eR2tubHSW0Tx870RTwgBkzhApWhw4y0dKhcG7borcJpPQO7Q3777QUqa8xVFLO3BzXe3Zz+zTN7OFDHMZeuXKuSwxlmUiYD8qiRYvAnw4fPpwbgjcw0CzqmIhCFKIQhQSr0AtW9+4hmHJALPLj/NhVtHWYNSC2dhWpfRhqXNiQIX+LZoEHzJunFBjfykomWoXntj92v0DK4LDBsP/GniKOZVlCundHwXJ1/TTNzMUF/al9+1zzh2WZSJgPysiRI8Gfbt68mRvi1KlTsMPcuXOpYyIKUYhCFBKsQi9Y1tZhmDRTLAoMCWRX0TbhmCx+bV8R58dQ48JHjx4hWggesGyZUMHq3Vsm2tQDx1TFHRNIGRU+SqRJzsq0LGHW1iBYyt27P00zmz0bnwCOH5/rnb8sEwnzikhPT+/cuTP4k0SS602yK1euwA7jx4+njokoRCEKUUiwCr1g2diE47IvYpEsRMauosdFjAPE8iGikECGGvdm0qRBIkcQhbVrhQrWoEEykXMnOLcz8WcEUia+mQj7LxnGtizhNjYoWFu2fJpm1rOnHOptyxZ99aY7kTCvCJVKBfLUv39/PfEfP34M+wwePJg6JqIQhShEIcEyjmCJ/rtlsaUc3zeWYI37OxxXLxabcCEcu4q2e2MHlPmjRCEyhhoXaW/fW7QeJGDrVqGCNXKkQnTQDM7NK8FLIGVm5ExM6zCWbVkixo1DwdIZkMS0mdWti/J09aq+74DuRMK8Im7dugXyNG3aND3xJRIJ7NOlSxfqmIhCFKIQhQTLaIJl0JYYCdakmSrQBdPXJZhWtEOkA1DsJ5jgAsvMKG8XLrQSbQcJ2LNH6BJ+48crRMcxr9XtxNsCKQveYmLSaVPYluWNnR0K1rJln6ABSKUhRYqITU0lCr1zA3QnEuYVwa9CuN7Q4kL8Y0SpVEodE1GIQhSikGAxFKzsd7OMLljTlgSDLnwdUJ5pRS8JRymZbF+MKeXdypUdRPtAAg4fFipYKA1nMTP746THAikrwpfA/uMd2JYl0sEBBWvevE/QADw91VBpDRsaWCFbdyJhXhGLFy8Gc3IzNCly0KBBsJuvry91TEQhClGIQoLF8BFh/gTrfF62vuM9ULB8K59nuY25/hdQxiz6iinFx9a2tegISICTk7fAQ4YPv4cr+IhFO712CjxknDcO2B+xlG1Z7g8dCoJ1f8iQ8+y3qVNvQ6X9+ecT/btt23YVdvvuu5f5QPTr1w/M6cCBA/p3GzZsGOy2a9eu87TRRhtttNGmdxMkWNkHXX2yO1hzdjwBXSj3uDZTk90sXw4UmzUlmVJidu1qLjoNEnD+vNA7WEuWKEQ3vsMx/qkygZTtCifYf8h6tmWJWrMGBEuRe95zI/6FMXo0jnBfsMDAwDXdiYR5ip+SktJRsymVBhAODg4gWKf/TZFPf18ShShEIQrdwSrQHSyB465YCNbcgz6gCxV8fmJa0c7BK4EyYGtpppRYF5cfRRc0M92Ejo5atUopelARzi3sQ5hAyr7g1bB/351syxK9dSsIlnzUqE/QANq2xdHrR48atlLtRMI8xQ8ODgZt+uuvvwR8HKtgz71791LHRBSiEIUoJFiFW7Dmu3mDLlS80ZxpRbu8XAWUXnvLMqXEubl9L7oGBuDjI1SwNm1Sip6VgnOLTYsVSDkSsBb27+bCtiwxe/eiYA0Z8gkaQLlygBL7+RmuNO1EwjzF9/LyAm1ycHAwGN/Z2Rn2XLduHXVMRCEKUYhCgmWcMVg5PiL8yH4W4YJzF0EXKnm1ZlrRJ/zwro/VkXJMKe89PKqK7oIB+PoKFaxdu5Si10Xh3FLTUwVS3P3Ww/4dT7AtS9yRI2A9sr59WTcAlSoVauybbyRC5wRoJhLmCbFr1y7Qpm3bthmMf+LECdhz/vz51DERhShEIQoJlnHuYH2uPFgLr/wDulDZowPTij57fw1QOriznauYcPVqedFjMICXL4XG3+8qwzRgQcWEUy7c3wCH/HGWrWDFu7ujYHXtyroBnD//HmrMzExQTi/tRMI8IebMmQPadPbsWYPx+XtdkyZNoo6JKEQhClFIsIz/iLCgcfMkWLePoWCdtGJa0ZduoGC19mQrWIl37xYXBYABSKVC47ucDoQTK/aijHDKtet4B6vFZcZ34y5eRMEyN2fdAFaufAc1Nm6coOWxtSsS5gkxcOBA3eQLeraHDx/qjtai7o8oRCEKUUiwCqtgLXh4AB8RuvZmWtE3LuEjwuZX2UpJ4hNfuPybiIKFZwB19fTDPKtPKgun3L2IgtX4BtsxWAk3bqBgtW3LugEMHhwGlbZxo6Dc99qJhElJ6UJvxcXHgzNZWVlxAj4Vfjh8t27dqGMiClGIQhQSrMItWPOf7sJB7rsHMq3o+2dQsH68zXhguF8guEIJkwDh8V29cRLlVz7fCac8ccdB7nV9yjAtS9KDByBY0l9+Yd0AGjZUQqVdvqwWGJ+fSOjvnyww/osXL8CZxo0bJzC+hYUF7C/XrClN3R9RiEIUopBgFVbBmvtyE6Zp2DScaUU/PYq5o75/wDa1QfhTzOdUvohvHgTL5zqcWPHr9YVTXhxGWazxuBTTsiT7+6NgNWzI9p5fYnrRouJixSQanxG08RMJjx2LE4g4d+4cCJOTk5PA+AMGDID9/fz8qGMiClGIQhQSrEIsWHPEqD7lVtoyrejAPSuAUs2PbXJOuV8oXPurFrmXB8HyxUmUX3k2FU4JdsacXhWfsV29MSU4GARLUpttAtgnT5Kgxho0kAqPz08kXLDgrUDE5s2bQZhOnDghML6trS3sf/36deqYiEIUohCFBKsQC9ZM+WLQhdLzpzCtaOnmpUAp/7w4U8orvyi49tcu4i08/sEAdxyDdbqlcIpqA2alL/XSlGlZUtVqFKxq1ZhS9u+PhRrr3VsmPD4/kbBfv1CBCDs7OxCmhw8fCow/e/Zs2N/d3Z06JqIQhShEIcEqxII1TT0HdKHENHumFR3iuBApr9gukPzUNwGu/T+ZXBAef3/QUZxFeNhMOCViGSppseAiTMuS9vYtZv8sz3be5bRpbwAyb55SeHx+IuGPPwpNhdWrVy8Qpjdv3giMv3LlSth///791DERhShEIQoJViEWrEmhdngLx3YB04qOnDcX000Fi7gQjh3l/v1EuPY3F53mlEKNYa98P56Ys0UeyuLgUPQ1cERKTsmuLOkJCShYJdg+iOzYEW3p0CGV8Ph5mkgYGRkJttSzZ0/hjXnnzp1wyPr166ljIgpRiEIUEqxCLFjjIsahYQxZwXEMK/rNtGnFMUGVSBYiY0fx9sY7WK1FR7igIKGXc9VOOCvRph6pqULzDryxsyv1DMsSxAUx/Gqmp6NgmZiEcAyVtFIlHLH+5EneEMInEj569AhsaerUqcIb87Fjx+CQhQsXUsdEFKIQhSgkWIVYsGzCbdAw+qyTyRhWdMTff5d7glISGBLIjnLhAiYl/1O0l/P3Fxh/gwrTsotWWcfGpgkty7hxFR9gWfw5f6ZfTUmJEnBqITJWSspx/CI50ry2MeETCd3c3MCWNm7cKLwxX7p0CQ6ZPHkydUxEIQpRiEKCVYgFyzrMGg2jy7bAQIYVHT58eBUflBI/zo8d5dSpeGB0EW3jBA+pdlQ4YvGXDAsP/yC0LDY2NW5iWR5yD5l+NaUVKqBgBbJS0osXNT76J5fXNiZ8IuHq1avBls6cOSO8MT948AAOGTZsGHVMRCEKUYhCglWIBatbSDc0DPM9fn4MH0WFDRhQyxulxEftw47i6qqZEydaz926JTD+QgWOvhc5jJXLhS72HGZtXfcyluUWd4vpV1NevTqcGufHSklXr8ZJl1OnvslrGxM+kXD8+PFgS/7+/sIb8+vXr+GQ7t27U8dEFKIQhSgkWIVYsMw5czSMtod8fNTsKjqkR48Gnigl3mpvdhRn5xhgDBI5qr28BMa3V9hj8adNDgxMEVqWbt0ancOyeKm9mH41FXXromD5sFLSv/7CRXL27o3JaxsTOJEwPT3dysoKbCkuLk54Y+Y4jk/mrlQqqfsjClGIQhQSrMIqWG3UbdAwfjnp7c1QsLhOnZq5o5R4qj3ZUTZtigbGSNEC9blzAuNPlk/G4o+39/VNEloWc/Nf3bAs59TnmH41lU2awKmpr11jRGnSBBfJefQoKa9tTOBEQlAl8CRra+u8Nub+/fvDgc+ePaPujyhEIQpRSLAKq2A1VzZHw2jo4enJULDUv//e6hhKibvKnR3FyQmfeY0X2avd3ATGHysfi8UfueDu3UShZWnT5ndXLIub2o3pV1PVqhUK1oULLCjJyenFikmKFBEnJKTno5k1aKAwOJHwzp074EmzZ8/Oa2MeO3YsHHjz5k3q/ohCFKIQhQSrsApWA0UDNIw6Xu7uKnYVrfrll3YHUEqOqo6yoyxc+BYYdqIpKhcXgfGHyodi8QevuHo1QeiNpebNO+7GsrioXJh+Nbn27eHUVKdPs6D4+SVpH/Plo5n17RtqcCKhq6sreNLOnTvz2pjt7e3hwLNnz1L3RxSiEIUoJFiFVbBqymuiYVS/dfQoQ8FS/PST5U6Ukv2q/ewo9vaRwJgjslU6Owt9GiXvj8Xvvd7D473QsjRo0HUrlsVZ6cz0qxliZYWCdeQIC4qLC04IGDgwLH/NbMGCtwYnEi5duhQ86fLly3ltzI6OjnDgwYMHqfsjClGIQhQSrMIqWJVkldAwvnm4fz9DwZJ//33PjSglO1Q72FEmTcKFX5aIhik3bxYYv7usO5+lws0tTmhZatbsuxbLslm5melXM7RPHxSsfftYUGbORBldseJd/prZ0aNxBicSjhgxAjwpKCgor41527Zt2uxZ1P0RhShEIQoJVqEUrFLSUmgYJf137GAoWLIqVQY4oZRsUG1gRxk9OhwYTqIBytWrBcbvKOuIxf9zr4tLrNCyVKo0ZDmWZbVyNdOvZtiQIShY27ezoFha4kzAc+fi89fMnj1L1j+RMDU1tVOnTubm5klJSXltzEePHgXBWrx4MXV/RCEKUYhCglVYBauIuAgaRtHXGzYwFCxpmTLDlqCUOCoc2VEGD8a8AxtFPZVLlwqM/7vsdyx+6yO7dsUILUupUqPmY1mWKpcy/WqGjx4Np6bUrMpndEqVKpiNnc/+lY9mlpSUrn8ioUQi4fOF5qMxe3p6ahfYoe6PKEQhClFIsAqfYCWnJ4MoFAkyhWuto6OCXUVLihUb64BSslCxkB2ld28ceb1LZKGYO1dg/F9lv6JgNT+9cWO0QIq4SJHx9liWuZ8/3toAAIAASURBVIq5TL+abyZNQsFyNL6ShoV9gAKUKyctSDPTP5Hw6tWr/JKC+WjMPj4+cKyNjQ11f0QhClGIQoJVKAUrOi0aROGrl2XgSrlwISvBSk9NBVGYPN0EWLMUs9h9nJ07h0BBDorMFNOnC4zfUNoQBeun8ytXvhNUluRk2H26XVE4arpiOtOvZqS9PbAUCxYYneLlhatit2unLkgz0z+RcM+ePSBJBw4cyEdjDgwMhGN79epF3R9RiEIUopBgFUrBCv0QCqJQ+nkVuFLOmsVKsNJiY0EUZk39ClhTFFPYfZxgDHjJF7VSTJwoMH5tSW0UrO+vLVz4VlBZoqNh97mTS8BRExQTmH413y5ahIJlb290ytq1mDBs0qQ3BWlm+icSzp07FyTpxo0b+WjMHMd17NjR3Nw8NTWVuj+iEIUoRCHBKnyCJU2RgihUePY9XCmnTGElWB/Cw0EUFk4pDSxbuS27j7NFC1wj7x9RU/moUQLjV5NUQ8GqetfePlJQWUJDYfelE8vCUaMUo5h+NaOcnIAlnzzZ6BQbG5wNsHt3TEGamf6JhIMHDwbBUigU+WvMffr0gcPDw8Op+yMKUYhCFBKswidYAckBIArVnv4EV0pbWzmjik5VKEAUVk76Blg2cht2H2ejRrj2yyVRPfmQIQLjlxOXQ8Eq/1h7O0f/liKVwu5rJ2Bui8GywUy/mtGbNqFgjR1rdErz5lhR9+8nFqSZ6ZlI+P79e3Nzc0tLy7S0tPw15tGjR4NgBQYGUvdHFKIQhSgkWIVPsB4nPQZRqOX7M1wpbWxYCVbKq1cgChsmfgusAfIB7D7OH37AYdc3RN/J+vYVGL+4uDgKVvGA0aMF3SxJDgiA3beOrwFH9ZH1YfrVjHF2RsEaNsy4lJSU9K++wkVy4uPTCtLM9EwkDAgIAD0aO3ZsvhvzjBkzIMKdO3eo+yMKUYhCFBKswidYtxNvgyg08G0LXjJgACvBSvLzA1HYOQFHO/WU92T3cVarhqkH7okqy7p2FTTWJ4SDUzIRm8BRQ4aECSrL48dQlr3j68KBXWRdmH41Y11dUbCsrY1L8ffHO0/16ysK3sxym0h4/vx50KOVK1fmuzEvW7YMIpw5c4a6P6IQhShEIcEqfILlleAFotDMtyNcJnv2ZCVYiT4+IAoHJ/4ELEuZJbuPs2xZKRTET1RGZm4uJLgkRIKTKINKwFF9+oQKKsvt21CWI+Mbw4F/yv5k+tWMO3kSBatHD+NSDh/GsVP9+4cWvJnlNpFwy5YtoEfHjh3Ld2PeunUrRNi/fz91f0QhClGIQoJV+ATrbPxZEIXWT7vDZdLSUsaoohOuXQNRODHpF2CZSc3YfZymphIoyCtRMVnbtkKCB3A4BK30qwpwlJWVIFaClxeU5fSElnBgG1kbpl/N9+fPA0tmYWFcyuzZuEjO0qXvCt7McptIOH36dNCj+/fv57sxHz58GCKsXbuWuj+iEIUoRCHBKnyCdTzuON6JeWYNl0kzMymjiuZF4dxkzJneUtqSEeXDByi4uGiRYGBJf/lFSPAn3BM4pYqB38KB7dtzQijxZ89C/IuT28OBP0t/ZvrV5MVUZmZkJQWVxLmW/8QXvJnlNpEwxzmAeYrPP2ScM2cOdX9EIQpRiEKCVfgE60DsARCFbs9t4DLZsiUrweIfdV2ZagGsJtImrChxaVCK0iXFKFgNGwoJfpe7C6dU/eUPcGCrVipBlOPHIf6NqV3gwJ+kPzH9avKPVqUtWhiX8u23OFJNKk0peDPLcSJhVFQUuFH37t0L0pjv3LkDQWxtban7IwpRiEIUEqzCJ1g7YnbgzL6X4+Ay2aQJK8HiB2vfmd4LWPUk9RhRwsNx+ZfK36BgSWrXFhL8KncVTqnOy4aa4isFleXAAYj/YHp/OLC2tDbTryY/OUDauLERKW/eYC2VKSNNTzdCM8txIqGvry+40eTJkwvSmF++fAlB+vXrR90fUYhCFKKQYBU+wVoftR5EYWTQNLjo1qsnYVTRfLoB31l/Aes7yXeMKHJ5KpTi++8kKFjVqgkJ7qHygFNqHPgrHFi3rkJQWXbsgPj+9sPhwKqSqky/mnx6C0ndukakXL2Ki+T8/rvaWM0s+0TCU6dOgRutX7++II1ZrVabazbdTFrU/RGFKEQhCglW4RCsFe9WgChMls6Fa+R337ESLD5hZqCDLbAqSSoxogQGpkApfqqPiUDF5csLCX5SdRJOqdXr3+GI6tXlQihR69dj/LkT4cBy4nJMv5p8glZJjRpGpGzYgIvkTJgQYaxmln0i4dq1a0Gw3N3dC9iYe/fuDXEiIyOp+yMKUYhCFBKsQiZY89/OB1GYq1oG18hKlVgJVsaSLwtn4JQ9SWlGFF/fJCjFL81RSsQlSggJ7qpyhVNqH9QJjqhQQSqE8m7FCogfsmgOHFhcXJzpV/NDRAQKVsWKRqSMHImL5OzcGWOsZpZ9IuGECRNAjJ4+fVrAxjxy5EiI8/r1a+r+iEIUohCFBKuQCdaMSJSelWHrcHh4aVaCxS9aHLFsMbCKSYoxoty5k8g//ELBMjEREny3cjecUldJD42SSQSVZf58iA+ahelJxSIuhGP31UyLi0PBKlXKiDX266+4XOPdu4nGamZZJhKmp6d37doVxCgmJqaAjXnatGkQx8fHh7o/ohCFKEQhwSpkgjUhYgJYwrao7XCNLFaMlWBFzpoFohC1Zg3YFeCUnJIF5coVHF1kYcGJixfHm0wyw2m9tii3wPlYy61NTNDK0tMFlGXGDCzL+vUlxCXgWGmIlOFX88MHPK2iRY31uaSmphcvLoHCxsamGauZZZlIGBoaClbUv3//gjfmJUuWQCgPDw/q/ohCFKIQhQSrkAnWyPCRYAkHYg+AXcFlUqlkcj/mzeTJIArRW7eWlpQGXBAXxIJy7ly8Jh99qLhcORSswECDwVcrV8P5DJMP+/prLH5CgmHDipgwAYLH7NhRXlwejn0Z8pLpV1Niago4TqEwCiUgAGWoTh2FEZtZlomEd+/eBSuyt7cveGPm08EfPHiQuj+iEIUoRCHBKmSCNShsEFjC8bjjpUujYQQFMRGsiDFjUEr27q0kqQQ4f86fBeX4cXxWNXBgmKRqVZQSPz+DwZcql8L52Mptv/kG19h5+9bwhLXwkSMheOyBA9Uk1eBYX86XrWCVKYNlef3aKJRjx+JyXBSogM1MdyIhn4F9+/btBW/MLi4uOc5GpO6PKEQhClFIsP7XBatXKOamOht/tlIlieYayUSwwv76Cywh7vDh7yTfAe4h95AF5cCBWCjCiBHh0tq1Aaf28TEYfK5iLpzPFMWUGjXkcKxanWq4LIMGYVmOH68twbWrfTgftoJVuTIK1rNnRqE4OOAiOYsWvTVuM9OdSLh8+XKwIk9Pz4I35nPnzkGoefPmUfdHFKIQhSgkWIVMsCw5S7AErwSv775DwXr4kIlghfbtC5YQf/p0PUk9wN3ibrGg7NgRwycgkP70EwqWt7fB4NMU0+B8Zilm1auH92CCg1MMl6VXLyzL2bMNpQ3h2Gvqa2wFq2ZNFKwHD4xC6dYNF8k5fTreuM1MdyLh6NGjwYoCAwML3phv3boFof7++2/q/ohCFKIQhQSrkAmWmdoMLOF24u169VCwbt1iIlghXbqAJbz39GwibYI+p/ZiQVm/HjM8zZgRKf35ZxQsT0+DwccrxsP5LFIsatpUmSVbZm4bZ2kJwRO8vH6R4trVF9QXmH41pfXrY1lu3jQK5bvv5Dl6ZAGbmXYiYWpqqoWFhbm5eVJSUsEb8/Pnz0GwrK2tqfsjClGIQhQSrEImWC1ULcASHic9btIEByF5ealZVDTXoQNKyfXrLaUtAXdOfY4FZfnyd1CE+fPfytq0AZzK3d1g8JEKHOO/UrHyt98wecGDB0kGKWozMwieePt2W1lbOPa06jRbwWraFAXr8uWCU96+xbUaS5WSZp8sWcBmpp1IKJPJQIn++usvozRmpVIJrtapU6d0IdM7jd1lnD59eurUqdnTpVInSxSiEIUohVKwRJot+zvZ3zeKYDVSNgJLCEgOaNkSBevcOSaCpfrtN5SS+/fNpHjDzE3txoIybx4+qHJ0fAcXeRSso0cNBh8kxzH+G1UbO3Tg4NgbNxIMl6VFCwie9Pixucwcjj2iOsJWsFq1QsE6e7bglOvXMY1FmzZqozcz7UTCffsOgmCBlxirMfPJ3N+9e/fpuwwoBaDt7OyokyUKUYhClC9WsPKqTcL3/EHxAyZzSpGamaFgubkxESyl5jZM8rNnljIc8uWicmFBmT4dR3Bv2BAl0zyRVO3fbzB4LxmO8d+l2tWlCw5OunjxveGyNGqEZQkI6CrrCsfuU+1jK1jt2qFgnThRcMrmzdFQxnHjIlg0M34i4ejRk0BKpkyZYqzGzI/oCg4O/vRdBqgVoCdMmECdLFGIQhSiFHrB4sVIV49yky1jCVY1GeYaCP0Qamkpgwuki4uKRUUr6tUDS0gJCuop7wk4Z6UzC8r48RH8IjCyPn1QsHbsMBi8s6wznM9B1UF+Hpy7e7zhsvzwA5ZFKu0r6wvHbldtZ/rVlGmGfKlcjKCkY8Zg/WzbFs2imfEVOGTIZD2Zq/JBmTVrFgS8f//+p+8yJk6cCOjhw4dTJ0sUohCFKIVbsHK8U5U/wToveCsZVBIs4YTnCTMzP7hAOjjcPM9ge1WpEljCpYMHOz7pCLgZt2ewoHTs+ASKMH367ccaKbljZ2fwkJ+f/Qzns/z68j//9IVj7e1vGS5LhQpYlkOHOj9BOZt6e+p5lpuf5g7WrTlzCh6qfv0XUMbVq71ZnOfgwQ80afQHgpTs37/fWGEnT0Zjc3JyOv/JN2tra0B36dLlPG200UYbbf+T22cQLOF3sEwlpmAJyenJAwbg/LLNm5ksYiOrWBEs4UNkpI3cBnCrlatZUAYMCNM85YxTjBoFOIWjo8HgraStMA2Y+ix/d2fv3hjDz+zKloXgadHRo+Sj4FhHpSNT95cPHAg45caNBaR8+PCRz1YfHZ3G4u+Yo0fjTExem5vnOoUwf5Q9e/aA5bi6un76v8n69+//p2ZLTEykv2KJQhSiEKWw3sHKTaqYCtaHjx9AEYqIi8BrGxu55vYGE8GSlCwJlpD+/r2t3BaIS5VLWVB69MBxVB4e7xXjx6NgLVxoMHhTaVM4n8vqy5Mnv4Fjt26NNlwWzdo16cnJExUT4dgFigVsBWv4cBQsJyfdOCuUK1pLW8NP4ZRXr1KggN9/L2fUzJ49Sy5Z8jboyJAhQ4zYmN3d3SHmxo0bP3GXkZaW1rFjR16wJBIJdbJEIQpRiFKIBSvL9gkEKy4tDhShlLQUvLa1RcFaupSJYIk1ayl/TE+fopgCxLmKuSwonTrhTMCrVxMU06ahYM2aZTA4n/j0pvrmrFk4QH7NmihDTqpZfbkIKukMxQw41l5hz/SrqRg3DsuyeLFuHLArQLeRtsmRkpiYHhb24fXrlIcPk65cSTh1Kn7fvth+/Vx/+cXWzOwgo2aWlJRetaob6MicOXON2Jhv3rwJMRcsWPCJu4zIyEjgWlpaws87d+5QJ0sUohCFKCFfQB6sTzaLMOJDBFynK8kqwespU3AW2Ny5CqNXdHpSEiiCpHhxeD1LMQuI0xXTWXycbduqoQh37yYqHBxQSqZMMRhcu3TPokVvNX5pIB1AWlwcRJaWQiWdp5wHx06WT2YrWFOnYlnmzNGNU/cOZrsoe7PhoEGybt1kZmbSZs2ktWtLKlbk76/l8A/sSnM75m92zaxFi60AWL58uxEb84sXL/RM5WNXlqCgIOD26dMHfrq5uVEnSxSiEIUoX6ZgMcqDpUhVwMW3prwmqs8shWaEuPEFKy0qCqWkfHl4vVCxEIgTFBNYfJw//4zJQv38khRLlgBRbmtrMLh28WknpyjNGP9IAzewIiIgsqwSKuky5TI4dqx8LFvBmj0bBcvOTjdOubO/ozX5VMnRpYoXl1SpIqtfX9GypapTJ65fv9BRo8ItLTHfQb9+Y9k1s86d5wNiyZIzRmzMoaGhEHPgwIGfuMu4d+8ecEeMGAE/N23aRJ0sUYhCFKKEUCZ34YL1KuUVXJEbKBqg+ixUaBbyM75gfQgJQSn59lt47ahwBOIoxSgWH+ePP2IRXr1KUa5ahYJlY2MweClJKTifIC5o0ybMEWVn90Y/IlWhwMg1UUnXKNfAscPkw9gK1qJFKFh//60bp/xlzL9vElRkzSbJ3r0qNzf1xYvqu3c5f39OLs+ZAo6ix1SM0sy6dx+lycx534iNOSUlBWJaWFgIT+ZulLJ4eHgAd+bMmZqHnnOokyUKUYhCFBKsPAiWX5IfXKebK5uj+jiinYwaZXzBSpFIUBHq1IHXG1QbgDhYNpjFx1mrFg4jUyhSlZs2oQYNGGAweFFxUTgfJad0do7JLQnnf8ry6hWWpQEq6RblFjjWWm7NVrBWrsSyjBjxHy/0+YG/XXWVuyqEkpSUZG5uDq5grFUCs1NAgCwsrADRt6/UuI25Z8+eEDY6OvpTdhkuLi4A3bBhA/y0sbGhTpYoRCEKUUiw8iBYPok+OFZa3QbVZwM+Xxs8WGb0ik5+8QLnwTVuDK93qHYAsY+sD4uPs1IlzJUaEfFBuWsXSknPnvojKzh8QmoqMYXXrq6xcKyNTbh+RJKfH5alOSrpbuVuOLyHvAfTr6Zq40Ysy6BB//HCZ2V5wcoxzWn2IK9fv9YO2YbXLJoZvAPB27bt8+OPCuM25pEjR+Y2lY9dl8Gr1alTp/h6y37/jDpZohCFKEQhwcp1u5ZwDS7S5pw5qs8OFKw+fYwvWEmPHmEu8pYt4fV+1X4gdpF1YfFxliqFq/3Ex6epXFzwoaSlpf7Ir7nXcDJlJGXg9cmTcXCstXWYfkSijw8uXNMGldRV5QqHW8gs2ArWzp1Yll69snihKMgE05wqpgqhXLp0iX8+CD/hNYtmxg9a+vnniUWLipOS0o3YmPnndI8ePfqUXca8efMAeuvWrX79+sGL8PBw6mSJQhSiEIUES3DC9/fn4SLdLaQbqs9+FKwuXYwvWIm3bqGUtGsHr4+qjgLxT9mfLD7OIkXwrk5a2kf1iRM4rN7MTH/kp9xTOJnKksrw+vz593Bs9+4GcAnXrkFkzhyV1E3lBoebyczYCtaBAyhYnTtrg/hyvihYT8rBz86yzkIoO3fu1I4ogtcsmtmxY8cgeMuWjlCN/v7JRmzMK1euhMgXL178lF3G+PHjARoQEDBpEq6u+PTpU+pkiUIUohCFBEuoYJ2MO4mjiMKsUX2OomD9+afxBev95cvgAyGdO8Nrd5U7PpSUtTH+g8jkdDj/r77CB0nqs2dRsFq21B/5vvo+nEwtaS14fe1aAhzesSNnoCznz2NZuqGSeqg94PAW0hZMv5rq48exLO3ba4O4v/LC9LBX6sDP2tLaQiizZ88GS+CzosNrFs1s9erVELxzZ1eoRmfnGCM2ZmdnZ4h8+PDhT9llDBgwgL9xxeudp6cndbJEIQpRiEKCJVSwXGPxIZdNOI7hdXdHwWrTxviCFX/mDChCaO/e8NpT7QnEn6U/G50SFZUG51+uHI6wVmuUTtqkif7IN9Q3cBKltAG89vFJhMPbtlXrp8SdPAmRw6xRSa+or8DhjaWN2QqWpvakv/2mDbL+4RHgfu32h6nEtIi4iDREKlAXfH194Se8ZtHM+KWRmze/AtVYubIsIuKDsSj8QKgtW7Z8si4jPT29U6dO5ubmqampBw4cAPrevXupkyUKUYhCFBIsoYLlHOMMl+pxEeNQfTwxS+fPP0uNXtFxx46hlAweDK+91d5A/En6k9EpISEf4Py//VaGUnLzJqY2rVdPf+SL6otwMs2kzeC1n1+Spvgq/ZRYV1eIHK6ZVnabuw2H15XUZStYly6hYDVrpg0y1XsTpod16f2j9Ed+nR/9lLi4OFAEKyurtLQ0+Amv4+Pjjd7MunfvDpFPnAgBu4KabNxYmd2x8ke5fv06RF60aNEn6zKioqKA2KtXL3h9+fJlTfbU5dTJEoUoRCEKCZZQwdoUjZdquzd2qD7eKFg//WR8wYrdvx+lZNQoeO2j9sntwVYBKRIJrrVXpw5OYeMePEDBqllTf+R/1P/AybSWtobX/FJ9embA8VuMszNEjhiHSvqIewSH15DUYCtYN26gYDVooA1i7bkIuHX2jekl7wUvtii36Kc8f/4cM7j/jTncx40bB6/hHeM2M35hmd6am5TgVWBXOTpW/ijPnj2D4JMmTfpkXYZYLAbi6NGjtbWXPZU8dbJEIQpRiEKClevmFOUEV2iHSAdUHx8UrNq1jS9Y0du3o5RoLlF+HGbeqiqpanTK8+fJ/EUdBevZMxSsypX1Rz6mOgYn00HWAV4rFKlweK1acgNl0WTYemOHSvqcew6HV5RUZCtY9++jYNWqpQ3S7twEHPu1Z469wh5eTJJP0k85d+4cKMKqVavwE3dygtfwjnGb2ePHjyHs1KlT+f/m5lj5o3Acp38NaaN3GQ8ePACivb291h379OlDnSxRiEIUopBgCRWsRW/xXsjSd0tRffxwpeSqVSXGHx21bh0oQuSMGfA6MCQQiOXE5YxOefgQn/G1bInP+LjXr1GwypTRH5nPGWEls4LX4AH84CEDZXFywrI4oJIGc8G4VLakFNOvJvf0KZalShVtkIZnBwK36/61e1R74IWlzFI/ZfPmzZqHdyfg9fHjx+E1vGPcZnb69GkIu379eu07OTpW/ihJSUma4fOdC9JlrFGuaSlrCT+FfC6enp5ABBn9qBmPxT9Xff/+PXWyRCEKUYhCgiUo8qxIXHp5TdQaVJ/AEM0gcbHRK/rd8uWgCG/nz4fXshAZEIuLixudcvMmTgNs3x6nAXKaBW0kpqb6I+tmPY2LwzHypUtL9VPeahauebcUlVQVooLDi4qLshUsTe54Sdmy2iDVL3QE7pgjB25xt7SzIPVQpk2bBn7w8OFD7b0ZeMe4zUybllP3zeyOlW9Kt27dIH5sbGy+uwywK6gr+Cnkczl06BA/6ZL/L78ioVgspk6WKEQhClFIsARFnvxmMlx1tkZvRfWRhWjWCTa+YL2dNw+lZMUK1IUQzkSMGTLhhXEply5hIisrqxD+SyMuWhTzKahUeiLrrtvz4QNUGh6knxI5axaEjVqzhqeYSkwhgiJEwbABaGRRrCOLZa82A+iSfzyUnNJUbAr1KebEeii9e/cGP4iIiNBITwSLB152dnY55gLN4lj5pgwfPhziy+XyfHcZTaRNtDNGDX4umzZtAtzp06f5/2qTjlInSxSiEIUoJFiCIo+JGANXnb0xOAWd40JMTPBSznFGrujI6dNRSjTPj+CoEuISAM2eXKCAFHf3eE0m+lCeIilVCjOCBgfrieyozFx5Go4yNZVAhORkfYsKv5k8GcJGb93KU8pIykCEV9wrpg1ArMmgGqJW80FMfWoA1OXaPXxcKG0Iry+qL+ZGeffuHchBjx49tO/w0/2ioqKM2MzA2LQOp8exnj/n8keZPn06xH/y5Em+u4xy4nL8rVMFpzD4uSxcuBBwN27c4P+7detW7TNW6mSJQhSiEIUEy/D2V9hfcNU5EnckQ31KoGBJpUau6Ijx4yFuzI4dPKW8uDxAX4a8NC7lyBFc62bIkLAMwapYEQXr+XM9kRcoFsCZTFRM5Clly+JKO9HRafrKMmYMlkWTFQmOqiypDBGeck+ZNgBJyZJYFnHGbSqTADTUO0/QHXvLesPrTcpNuVFASkAOJk+enHnbcvJkPieWsZpZTEwMBOymSb6ac6X961g//ijNq2PxEZYvXw6Iy5cv56/LuKe+B7VUTFIMfl5QXzD4ufA5vbRzLfkRZhs3bqROlihEIQpRSLAERe4b2hcuOe7x7hnqUx4F6+VLI1d0+IgREDf2wAGeUk1SDaC+nK9xKXv3xsDJjxkTkSElNWqglDx6pCcyPwtvhmIGT6laFRM4hYZ+0EMJ++svCBt3JENJa0pqQoT76vtsBeubb7AsL17A69cqHFkvev61QoGmMlsxW+uIOVL4LJ26w8/hte7zr4I3M39/fwg4fvx4fWKaX8fiD+eX+jl27Fj+uoxdql18Qg18tKpYYvBzGTRoEOC07/v4+MB/Z82aRZ0sUYhCFKKQYAmK3CWkCz5gen8xQ32q4TMyX18jj44KGzQIpeT4cZ5SW1IboD6cj3EpW7dGw8lPnvwmQ0rq1kUpuX1bT+RJ8klwJvOU83hK7dpyzQ28FD2U0L59IWy8e4aS1pfWhwg31DfYClb16liWx4/h9cUXmEisyK3v+ID7VPvgvx1lHXOjrF27FuTAXXPC/z5LdYd31q1bZ6xm5uHhoZ1zp9+xwK7y6lj8sW5uboDYtm1b/rqMCYoJ/BLj8LO7rLvBz8XCwgJwyckZKyrK5XL477Bhw6iTJQpRiEIUEixBkTtwHdAPEm5kqE9tFCwfHyMLVmivXiglZ8/yFH7Y0DX1NeNSVq+OgpOfNSuSp0gbN8YVpq9c0RN5jByHoC1XLucpDRviLZaAgGR9X8cuXSDs+4sZStpU2hQiXFJfYitYdeqgYN25A6+33j4HxBIXmvMB73B3sic7zf60y8/PT/sOvM6et7MgzQy8R+DtJfCqvDoWf+DVq1cBsWTJkvx1GW1lbaGW1irXws8qkir6Pxf+iafuqDUwLXNzc7Cu9PR06mSJQhSiEIUEy/D2m+o3uOQ8SHqQoT4N8eJ37ZrauBXNWVqCHyR4efGUX6S/5DYUpiCUJUvewckvXvw2Q7BatEDB8vDQE3mofCh/3eUpv/6KqzE+fpykrywdOmBZbmQoaStpK4hwRn2GrWA1aoSCdfUqvJ51CXN3fXMq45aVKkRVXFzcRGwSxAXlSOETHERHR2vfgdfZh0wVpJnZ29tDwLt37wopS14diz/w6dOnuolM89RlqEPUpSWlodL8Of+Kkorw4p76np7PRSqVAmvEiBG6b/bv3x/eDAsLo06WKEQhClFIsAxvTZV4A8Y/2T9DfX7BK9+FC0YWLLWZGfhB4u3bPIW/nXBaddq4lDlzIuHkV62K4ikyDVTl5qYncj9ZP8xSodzKU/74A3PZ376dqIei+u03CJv0IENJ20nbQYTj6uNMG4BMI4sqjSwO+Wc1EL8/OlAbs7G0MbxzXnU+OwWEALSgb9++WWLCO/B+eHi4UZrZwIEDIRrHcQIbc54cK6PaVSpADB06NB9dxk31Te1NPiuZlfYTz+1zefToEbBmaPLiarcpU6ZkmRlAnSxRiEIUopBg5brVU9SD601wSnCG+rTFUd6nT6uMW9EqjR8kPX7MU8xl5jh1UXXEuJSpU9/AyW/eHJ0hJRYWKCWurnoid5N1wywVqr08xcICc9l7eSXooSibNoWwyf4ZSmops4QIB1UH2QrWH39gWU6exNpzw9ywPx+emEUTN6g2ZKfcu3cvuyvABu/A+/fv3y94M3v//j2fZl338ZnBxizcsXQpVlZW+egytii3QP3AZx3y77zR4fLhej6XS5cuAcvR0VH3TX6JoQsXLlAnSxSiEIUoJFiGtxpynFelTlVnqI85CtaRI0YWLKXmCVdyQABP6SrrCtB9qn3GpYwdGwEnv3t3DE+R9+gBUOXu3Xoid5RhSvTDqsM8pWfPUIhw9my8HoqiXj0ImxKcoaT8csu7VLvYClanTihYhw7hqK8To3F5nKMLtTHnKubCO38r/s5OOXr0KGjBVk3WLt2NT+ykO2oq380sMDBQuy5ynhqzQMfSHtulS5fs69UI6TL4kXb8VIZzahzB1lDaUM/ncuTIEQDt2rVL900XFxfd3O7UyRKFKEQhCgmWvu0b6TdwvXmbljFuqWtXFKx9+4wsWIoffkApkUp5Sl8Z5obYrtpuXMrQoWFw8ocPx2UIlrU1CtaWLXoi8w8rT6lO8ZSBAzHC8eNxeihyTfaHVHWGkg6U47KAG5Ub2QpW9+4oWHv2wOuap1Dphp/erI15UHUQ3vlT9md2iqOjI2jB+fPns8SEd+D9lStXFryZ8fd7li1blo/GrHWsihUlhw6p9NfYsGHDAKRUKvNKaSFtAfVzQn0CvxUh8q/EXxURF8mSG1b38C1btgDo5MmTum96eXnBm0s1SyRRJ0sUohCFKCRYBravJV/DtSchPSFDffqiYG3fbmTBklWrBn7wITQjx/oQ+RCArleuNy6lX79QzfPN+AzBGjYMBWvNGj2RdYfbf8Ql58IhwoED+ha8k2pSUqW9zVDS4fLhEMFJ6cS0Acj798eybMWRQ+XP/Y73YzyPamP6qDFxw7eSb7NTxo4dC1oQoLl3qLvBO/C+ra1twZuZs7MzhHJxcclfYwbHAruCaq9fX6q/xqZOnZo9P6pBipJTlhCXMBGbvArJMKqW0pbZn1DrHr548WIAeXt767754sWLLLm+qJMlClGIQhR+e/o0eerUN/CTBCtjS/+Yzi8LCC8y1GcIJoJav15p3I9TWq4cSkl0xuioUfJRAHVUOhqX0rUrrqXo6fk+Q0rGjkUpWbZMT2TdhBFw1Pjx+JBxx44YPRTJ119D2PSEDCUdpxgHERYrFrMVrKFDsSxrcbZj8as/AnH37cz0E+oQNb/6kPauDH9gWlpa586dzc3Nsz9W0w6cgn0K2Mz4dfq0q8rkozFv2oTZMX7/Xaa/xpYuXQqgq1evwuvoHTvUf/wRtXp12n8X/MlOucpdhZqpLamtfWeiYiK8M00xLbfPhc90/+zZM903+RWHevXqRZ0sUYhCFKJk2fgx0HZ2b0iwMrbE9ETMqCQpoa3oUaNQsBwdjSxYkq++QinRpG3UXuEWKBYYl9KhAw5Rv349Q33kmkUDlfPm6Ymsm/L0Iy54F6nxy6jcnTRdrFmv8WN6hpJOVUyFCHMUc9gKlmZ9HuVyzNdV5GEllMLnfrph+XRcHmoPXQo/827QoEE5huWn/sE+BWxmQ4cOhTgymSzfjfnJE/zgypcX66+x7du3axcEVGtG/eM/ExNl06YREybEHTmS+u/TQ93D1yvXw359ZH207xxQHYB3zGRmuX0uQ4YMAZBa8xRYd+MHgcXHx1MnSxSiEIUo2i0lJb169Uc//TT/6lUFCda/f5SnvYMrTQVpBW1FT5yogGvWggUKY36caWl4ISxSREuZoZgBXHuFvXG/NL/9hlmsHjxI4ikKe3vgKmbM0BO5qqSqdtEezc2YtxBhxYp3ufpVYiLElJTIVFJ+pRo7hR1bwZo0CQVr/ny5UiV6XVQUbCJX/UeCreXWcBrrlOt0Kbdu3QIhcHBwyDHsnDlz4LewT0GaWUpKSseOHTt16pSamlqQxly5Mj4lvHdPrafGjh07Bie8Q7OiZWjPnvjh1qsnKV48w7Q0/+S1aoX99ZfSyUnt7R2iWbTcRm6T5Rbjc+45vFNSUlLJKXP8XKysrACUmJg1W8eoUaPg/aCgIOpkiUIUohBFu509G9+w4VzoHletWkWClbFxqRxcaarLq2eqzwwULHt7YwpWWnw8XPmkpUppKfOU84A7WT7ZuF+apk3xSZO/f8Z9MsWCBXgNnjhRT+Ry4nJwJoEhgTxl+XJMVTp//ttcy/LuHZalQqaSLlIsyjKDj0UDUMyciWWZOdPbD+WgiG/5LGHnK+fD+2PlY3Up/MQ3Z2fnHMPu2rVLd+xU/pqZRCKBIDY2NgVszJaWOPhv1y6lnhrjh5kvX74c43Ttivn0PTzSk5IS79yJWrUqpEcP+Fx0ZUtcrpzMwqLpfVz40l32n3RodSR1suTf11Li4uJyW7h6/vz58KubN29SJ0sUohCFKNqtd++HHTrgahehmpHWJFi4BafgssF1FXUz1WeeUrOcn9yIH+eHN2/gaierVElLWapcqmsDxvrS1KuHdhgcnMJTlI6OeEtj1Cg9kYuLi8OZyEJkPGXdOlxsZ8aMyNwQqRyHMatnKulKxUqIMEI+gmkDUP4ri7u9vQFX/EbdLGFdVC7wfjtpO13KkiVLQAi8NAn0s2+XL1/WXXwmf83M29sbgixcuLCAjXnmTPzsJkxQ6KkxX19fYE2bNg1eK5s1w8xqWQa8p6cnP38es3OnrF8/fqnvl1+JTANFRYJE/uW/kjZqJG3Zkp/0MEg+SLtEUhYKv+xgjsrIP6PU5ragTpYoRCEKUd6+TWvefJpmOdrNH//Hts8pWP7J/nCZaaJskqk+S1Gwxo41pmClKpUoJTVraimrlZiLfJh8mHG/NNWr4wAytTo1Q0rWr0fukCG5heVC8AaeidhES9m+PVpzmY/IDZESHIyiUzdTSTeqNkIQuGCzFawVK3hZnHfWDXDlL/6WJewD7gG8X1VSVZcyYsQI+NIHa1J2Zd+CgoJ0F4TJXzPbv39/luxQ+WvMhw6pchvnnqP6gK/jvFSdTPTZKdzjx+ePzIFqqX+9uLhIEf62lqxVK/jVOuU6+E8vea/slCdPnmg1LsvGL5K9fv166mSJQhSiEIXfli27/yduXaKiokiwMrcHSXhVbqVqlak+q1Gwhg0zpmClvH6NUtKggZayWbkZuNZya+N+aSpUwIxK796l8RTV9u14Qe3bN7ewkhAJnMbX4q91dCEWIowcGZ4bItnfH8dCNclU0p2qnXiplvViK1jr1vGyOPz4DsDVPNstuyyWlJTUfdyZmpraqVOnjh07JifnPG8W3tcdPpW/Zqb/Jpnwxuzvj+PcS5eWcFyuNaZ9eJeelIQj4UxNP+aSO157rJPSCepkoHxgyKtX8ilT8PGuRrD4xXNyTGyh+yAyy3b/PvYj9vb21MkShShEIQq/tW8/HjrGmTN3ffzf2z6nYN1IuAGXmfZc+0z12YyCZW1tTMFKfvoUpaRZMy3FWekM3B7yHsb90pQogQOlExMz5vep9u1DweraNbewAVwAjvGXVNBSjh2LgwiDBoXlhkh68AATfrbKVFJ+SlpnWWemDUC1bRsvi5auywDX1N0me+SfpT9rl53+KGx0FJ+6E/bMdzMbOXKk7rjvgjTm6tXx47t1i9NTY/zw87hXr/jx7AYpg2SDtAlBOB8f1LJvv+V9tLy4PPzqEfcoC0V3KH2WTalUwq/++usv6mSJQhSiEAW2U6fuQK9oZtYjMjKeBOs/28X3F+EaYxVilak+zihYPXoYU7AS792DC5u6dWsthR8wZCGzMCIlPf2jZs6+OFNKjhxBKTE3zy3sY+6x7m0MOOrMmXgI0qtXrsP0Em7cgJhc+0wlPaY6hpIqbc9WsPbu5WXx54OYFcL8n+nZI/PjilYrV/OUq1evwvd+0aJFeiIvXLhQm1kqH83sw4cPFhYW5ubmSUlJBW/M3brhOPctW5R6aoxPoCA5exa/UW3aGKTwec4ylsHmOEmpUvjxBQSE/LuI5A7VjiwU3WQQWe/FpqRAYTt16sQnD6NOlihEIcr/Z0p6enq3bvg3trX1/o//k9vnFCz3eHdMERTaJ1N9XHAojIWFzIgfZ4K3N17V/vxTS3FTu2VPRFRAyvv36XDmX38tyZSSU6dQStq2zS3sHe4OnEYdSR0t5fLl9xDE0pLLlXLxIsQMscpU0n/U/0CQ36S/sRWsw4d5Wax96C/ADTm/MnvkhYqF8KvR8tE8Zc+ePfC9P3DggJ7IuiOo8tHM+DxbgwcPNkpjnjsXx7mPGSPXU2N8CtD7mzdDbYT276+fIgmRFBUXLSYpxk9igE3asiWamRvOKOQXcBylGJWFopvONPs2YMAA+C2/P3WyhYhy/fr1QYMGwU+qMaIQxViUK1fwz/g2bfpdvx5LgpV1OxJ3BK/WYUMy1cdNDRc5MzNjCtb7CxdQSrp21VL4BXdbSFsYkRIZ+UGzpJ0sU0rOn8cxN7/8kltYPsd3I0kjLeXWrURN8dW5UeLd3fHS3idTSS+q8S5gM2kztoL1ryx+c9wKU4hddc4e+bDqsFZbPwpLsA7XG9gH9sxfM7t9+zYcPmfOHKM05hMn8LvXsqVUT43xi9ic12Q4ezNlin7KWfVZqJDG0sbaUIqRI3E44KJF8Npd5a77W+2x/II8fn5+OUa2s7OD3z558oQ62UJEkUqlvXr14pPuUo0RhShGoaSmpvbti48UmjY9lMto2P/fgrU3Zi/e8wgfnak+5/Ai16KF1IgfZ7xGDkL79dNSvNReWa58BaeoVKlw5t99J9dSuGvXULAaNswtrIfaAz1P1kJLefQoSVN8VW6UOM1jx7AhmUp6XX0dgjSQNmArWP/KYomzuG7xtgfu2SM/4h7BrypLKvMU/mmaQqEvry4/L2+Ipjj5aGaHDx/ObbhSPhpzYCCudFSihFip5HKrMX4Z5oM2NlAbUblntOMP5LOBDJUP1YZSrl2Lg7f698eLbojUVGJaVFw0iAsKEbyk9OrVq+G3Hh4e1MkWFopKpeKlGac5dekCskU1RhSiFJxy5swZaFO//TZk8eLIj/+r2+cUrK3RW+EKNOnNpEz18ULBatzYmIIVe+gQSsnQoVrKLe4W5t+S1DUi5fXrFM2CwYpMwbp7Fwc1166dW1g31X+eVH7EBX2TIUijRsrcKDGasVDhozOV9J76HgSpJa3FtAFoZbGIN67tc/H17RyDl5aUht8GcAEJCQnm5uaWlpYfPnzQE1k7iCoxMTEfzczR0REa2IULF4zVmGvXxnHu167lKlhHjhzBRAk9ekBtxLq66qf0k/WD2lijzFztW+3pqevcv8p+hR1OqE/oUvj1cLKv3shvrq6u2tyt1MkWCgo/0LBXr15jxozhM+tSjRGFKAWkJCUl9e3bDxpU5cpuEgnmnkzy83tjZ5f89CkJVsa2JmoNPm+KzJx2fusWzpavW1dixI8zZvduuKpFjB2rpTzkHgK3hqSGESlPn6IbNWuWuRod9+QJCla1armFdVW56o61/4gz79DSfvgh17s+0Vu34sOpSZlK6sf5QZAqkipsBUsjiwHf/yjyK6PNxZB9443BXeUeGBgIX/3R/4qgng32gT1h/3w0s3HjxsGxL168MFZj7t1bln2tcd3DL126BMQFf/4JtZFw7Zp+Chg81IaX2kv3WZG4aFFJsWIhchzp9bfib9hhpmKmlsKvgW317xi77Bs/dYDPzkqd7P8+ZcOGDfyNqzt37vBpzGxsbKjGiEKUAlL4xxe//jqqXbuMETVgV3hxzCmD4P9TwVr6Dp+hLHy7MFN9HqJg1ahhTMGK3rJFd8QMHOXPYYLTipKKRqTcu4fDp9q0UWdKSUCAWLOGcG5hs2SL0ByFA7mqVZPlRolaswZiRupkQnoV8gqClJWUZStYGlm8Wh0TMZi8LpZb8MGywbDDSsVKT0/P3JI5ZdlgH9gT9s9rG+M4jr/ZExcXZ6zGvGgRjnMfPlyeW409evQIiBPbtoXaSAkM1EN5zb02EZt8Jf5Kwf0nO7y0fn0c5375Mrzeq9qrnQH674NmHLY/9N+7rdm3ly9fwg5glrmV5bDqcANJA/hJXflnpxw8eBA+rE6dOoGX4wNipbJPnz7wjre3N9UYUYiSb0psbGz37t2hKZUvf37PnhgIkp6aKqtSBVfXePyYBCtjc4h0gAuMU5RTpvpo8j1WrGhMwYpavRqlZPZsLSWICwJuKUkpI1K8vRPgzM3NucwvjUQi1gzqyS0sn+90gHyAlhIVlaZZwk6aG+Xd0qUQ8+3CTCWVh8ghiKnYlG0DePkSuM51WyHrUdXcgi9WLIYdRipG8rkG4I8Mg8H5P0Rg/7y2MX9/fziwf+5T+fLRmN3dVZrbkNLcakwqleKgsdatoTbSYmP1UE6qTkJV/Cr7NQtC1qcPZjLbsAFeP+Wewj6lJaXVIRle7ufnB/GnTp2a65c5Kgp26NmzZ25lAbvCMXmSBtSVf17KmTNnzM3N+Ywb2mj8GL65c+dSjRGFKPmm8OvYNms28euvJTExmLPmvWb0hbJhw4//Y9vnFCy7N3ZwMdgUvSlTfYJQsEqVMqZgvVuyBKVk8WItRckpgVtUXNSIlPPnMcNCt24hmV8azbqBYhOT3MLyK/bYyG10nitjroevvpLkRol0cMDh1U5Oul/NIuIiEAcu0gwbgFQK3LnN/wBQmRuNcgvOJ+VqK2trb28PDeDu3bsGg8M+fHbyvLYx/ibZ9OnTjdiYg4O5IkXEpqZihSLnGouJicFk7mZm0tKl9VMWKBfoZmHQbvyqjvLRo/n/fi/9Hna7yl3N/gQwt61r166wD/wNl/38FZyigrgCrsYtLnKbu01d+eeieHt7W1hYwMcEVwLdaC9evOjYsSP8KsszcaoxohBF4BYQEGBlZQV/vZQp4z1kSEZS7rAhQ6BffefoSIKVuY2LGAcXA+cY50z1UaJgFS0qNuLHGTlnju6cL/7AYpJigM7y+KYglJMnMQl7//6huhRwJcwQIcs568QSxRI4B1u5rS6FX7NOk0gyh41/zBy9aZMu5Wvx1xBHzIkZNgCNLNp0MMfMqJfb5Rbcl/OFHb6RfNO/f39tuiaDwfkbUXltZnv37oUDN/1bFcZqzA0a4HpHFy+qc6sxi06dgCv+6Sf9lJ7ynvjHg3JTlviqY8dwnHvr1vx/reXW/ENV/kA3NzcIvm3bNj3B+VFrr1+/zn7yB1UHcaVICeaI7y3rTV35Z6E8fPiwW7du8BmtXLkye8BZs2Zlv2VLnwtRiCJwW7ZsGbSg1q1nazpqnAyUFhsrKVlSbGKSKpeTYGVuNuE2cCVwjXX9j/oUw5lcCgVnrI/zzdSpKCWbN+tS+Plur7nXxqK4uuIygjY24f8RrLJlUbByGcHtoMAnpFMVU3UpJUti8ePjczasiHHjIGCMs7MuBYQG4rzgXjBtAOLixS37YvLxhp599cQvKylr+swUGkDXrl3TBSQngX34oVTBwcF5amb8KoRnzpwxbmMeMABX7HZyUuZWYwN798Y8Vebm+ik1JTWhrq6rsyaW5DSrSUrKlg3RrHrI38XsK+vLH7hz504IfuzYMT3B+VlpOaas7CbrBtEmr672VVAxE7HJNfU16so/MSUiIqJfP5zcNHv2bI7LoRPj15qEvyjUajXVGFGIkqf4vr6+miVuO3399d1vv5Xxk9RjDx7EXOIdOnz839tEWaxIuwl5v4CCZR2Gf76fjDv5H/UpjYbx+rXRBCvC1halZPduXUolSSVAP+OeGYvi7BwDpz1uXIQuRVK1Kn7wfn45hp2mmAbnMFsxW5dSqRJOZHvzJufsBuGaDEzaBAH8gdUl1SHOY+4xW8EqV+6XsZhl1MzTVk/8ltKW5S+Wh0vI+PHjBcaHPXMc+at/s7W1haOgvRm3MTs64mJNgwfLcquxvzW51G8NHKiHwq8yWVJSMsfnthLNYEz1/fv4LEntDXt+J/mOP5Af8n/58mU9wXfs2AH7HD16NEvYlyEvTcWmRYNMfKqIRm2pAmG7yLpQV/4pKXFxcfzimPCVViqVOQYE6+JTxJ07d45qjChEyVN8BwcHaDt9+qyAXtrePiP9FdepE17iNSuC/O8KVnapyv7auILVPaQ7rtT2/vx/1KcSCtazZ0YTrPBhw1BKDh3SpcAlDdAPuAfGomzcGA2nbWf3Rpci/f57vJT6+OQYlp+lv0ixSJdSsybeQVEqU3OkhFlbQ8C4k/9R0jqSOhDnDneHaQMAWaw9B+9g9feaqyf+UPnQGntrQBtYvXq1wPh88swc8wPp2fhZJO/evTNuY/bwwHHuDRtKc6sxh0GDMNWnra0eylHVUaio1tLWOSJk5uY4zn3fPngNBlZWUhaH0KXiOPfp06f/H3vXAddE9vzB3rtnV9Szn13PLoK9l7P3evbeFcup2FDsDc9e8azYQMUuNjwsqJTsJpvNhqb0XsJ/3k5cwmYTAgTv/vfzffhwksvO7OvfN2/mOwJRu6GC9Hrbtm0Tid3IbAQ51n8VBeEv65XFi+Pbqts5sfydP8/WrEmdOcP+2DCEkpCQgISiY+AUJDN2X48ZombPnv1jizWvFoVCMXToUIWBe6IfLfb/XcuzZ89sbGy6dev2009/wyr94UMCPJ6kUsly5aIKFEgJD/+3W7AkEZIR4JVNgGXL2cIe4B7rng76VCYA6+VLswGsgN9+gy0n+uJFXS0/Uz+D6keqR+bSsnFjKLz28uVf0wGsOnUIwDKQgGycYhwJolRu0tVSuzbDG/ASpcdi794gMOZGOkhan6qPjtI5OgFoK6tSWzuRO83H241dkCvX1f6jNuwfFy5cMFE+Oh7Z29ubPtOQrQCD6cw7meVyckmdO7eMoqRbbDN/AXTacKAflCXMEmio35nfJVUoZs0iCXMWLMA/beTEs805imR3Hjt2LAhXGPUkePnyJXxnwbfHhYIkZLt+y0+c+CwsZniRrJEg3OzL39GjbIECqERWvTq1cCHz9Cn3P75haDQavLodMmSIt3cGl/UAv2CTgK3i77///rHFmktLbGwsLAjQBX369JGkbpGUc/gwW7cuNXWqAoax/s+aNV/1fxYt+tKggfLKlegf/fKdtcCZBPp3+nQHWHmaNdPmO0HqosDBg1P/lSWnANYNE0rdD3Vhld7mvk33w8qVP0LzHThw54aZyls+w+7DtWt1P6z5kZBA7rq3y1xahg9/Aa89evQL3Q+9edKjezt2SD7S5U0XeId5T+bpfli9ujfI2bPnnuQj7xs3BoH37e3TNaM334z3tt3IyfKxWrUCR1qBotmX1xv52oYHG5r+3hQ9tU2UDN+E748ePdr0l8FrslGjRuVETWvUICNw61Z3yf+7tUMHUL3aqOrWb1tDQy1+vFjy/z7moy7etmqFf45+Phq+3O9VP/g37Lsg/OLFi0aEnzp1Cr7Tv39/3Q8P3jlILiV9CngXsPArVAjku04bXsivEKGSd99qrpa5ePFm9+5vEFr99NPnEiV88N98DgPvyZOfnTzpeuN/sqDpsXv37idOnDDl+2jrWrRo0Y0fxRzFxcUFL2dtbW3h98iRI69cuWL8kevXb8ya9TRvXn9hDGfqp0wZn8uXb/5o+e9WcM2HKfbrrx68N46HdpO1siL7+6pV/+C7ZQJg6fta5ZwFqwlLiCu94r10kewvv5AwLjc3s5EOcPyNTOz9+7paWtAtQPU11TVzaYFjDby2g0NYOqsPT5ikunJFUmw/RT94h4PsQV0trVuTZEHPn8dJalHxFJdxHh66WtrJCXvCX+xfOWvBatIk11ViKrssu2lEvhfn1a53O5gJX76Ymh8Kvgnf7927t+lHGaRwdHBwyInT0siR5JZ23TqlZIudadsWVG9YsMCIlnJUOWioZ9wzaS+cJ0+In3slbSIBZMxqwbaIj48HyYCxjFchKSnJxsYGNhKWTbuhm83MJnnT77bEnNzkd7NmC5gF8CEMD7OcL2/eVGEqofz5ZRs2KDlOrVKRDNnDhsmLFaNw18mVS9a+PX3kSGR4eMr/zokcudyg4969e2eiFg8PDxzzCp7T31x1ua+6X5GuqB9a8Z+3lGzcuJF3zRnw4cOHYfwl/oIFCxITEw1p8fDg2raV46D9+Wd62jRG0oK1dm2o/s/ixV9KlCCb1LBhgfphPD8sWDmkBTNNbdu2P08eCn6Cg4mbcsK7d2StK11ak5j4v2XBMuVrdZg6MMJ9En3SQZ8WZOxeu2Y2gKVq3ZqAkufPdbW0p9sLaeDMomXGjBB47b17w3W1yK2tibfNuXOSYrvKiUvTcfa4rhYbG0JUcf9+rKQWtkkTQlbrlQ6SdpZ3Bjmn2FM5OgE+tLSxeFIBFL3iXmV4eQcYKyA5wHQVaNv/+PGjiZMN11PTbyEzNZm3blXyjBsKyRa7XptcgC6cNcugimQ14daXFePUBq65VSpZwYJCeKmMk/ErRh6ZSiakvjZehg4dSiIZvwVPqNQqDHS4sIScJWBbIDmrLS193j4pLitOPmcvZKf3AcgtXsxgeG/9+tSDB+K5CSDh8GG2Vy85T0si40EYNWhQwMWL0XFxmv/2hoHZkwDyPn78OFNaMEoDgxXMUpc7qjsFKeJ4V0pWSpKA5r+6kTs5OWHYso8P2Uo4jkOamBUrVujmQsUHYTDb2TF4x12mDHXwoDILdfH2TihWjOxTdnZff0Cf76Dl2rVr0KEDBw7kSS1l/fppN5cvixaRNC0zZqT+W8s/CbCqKqoSMqokJh30aU8GLpyMzdWdSv5aTcgBqQtuTrAnzKVlwoQgeO2jRyPTAazu3QnAOnZMUmwHuoMuyMMHe/VSg5ybN6Vz/TK8U1eiTzpI2ltOYgUOs4dzdALc/3WYxcf8oIhWG0vF7ebmBjOhyZQmd2Pvmq4Cb0zc+AQyppSZM2fC91++fJkTk9nNTaWbEDPd8ykpD4sXJ2kWJ0wwpOJa9DUSa0m3N+bp1awZGRgXL+KfjehGBGq/Ima5md8STRopeCElNNcFFckaXo2uJqtZA/PwyLt1I7zGW7cuZ5bD/2pON89y7794ocIzj6WlbPp0hjHKHOfjwzk6sp07c0jnhmkJYGrcvRubkvIf3DBgBHbmedGuXLmSWS3Ozs7w4Pjx481SFyelE4Y15JPl06Uv/s9v5JjhEXrh1atXwoc0Tffr1w+zdQlkMfCUuzvXuDGNI3PIEMWnT1mvi6trTO7cRM7Jk5E/AFaOalGpVKNGjcJAKLzggpMbrsaKihV1rSf/aoD1/aMIy8rLwlAPTk5HbdC1K7HcnjjBmqs7mdq1CSjx9dXVgjyQB5UHzaVl+PBAeO1z56LSAaz+/ck+euCApNiWdEvda0p88LffAtIGkF5RVK0KApOYdJD0N8VvIGePck+OToDj1lMIRbh3IePykf+z1tpaAkG/KWXHjh3wFDxr4jTGnG6BgYE5sWQwDJcvH8ETyBWi+3iyWu2VLx+ohuXbkIpVX1dBQ81UzDSiQsHTbSj/+ENr/VZMIs5tN4gL5+rVqzOsxdatW+Gbp05pbZZDFENI0mjfmWS9L1iQUypZR0diOe/cWcbJkJEEDZyZba7jxyORNqVCBerCBdb0RVatTnZ0DGvRghV8Vn76ia5bl7lzJ+Y/s2H4+Pgghdvh9PHhJkpWKpVouBVMX1mrC6fmFjILLWWW0MzD5cNvqG7kl5GD0Bbllv/8Rv7o0SPMR6TPbPL582eke92+fXsqnyRj7lwmb14ymCtXps6eNcP+sn9/BCbeePw47gfAyjkt586dg34cNmzYnTsMn91XlpBAQHPs3bvEYP/zz6n/4vJP8mAVoQnbZ1RKOlDSty/xgDFuuc1UdyqqVCGgRKnU1YJ7kj7Rdpa19O9PgNHVq9HpANawYQRg7dghKfYX+hd4BzeVm66W0aOJJezUKek8d/KyZUFgcnA6SDpKMQrkOCgdcnQCrOlLvHwKeVQ0Ln/NmjUwGSoerjgleIrpKpB6AJ41pQr+/v7o7WgKkWnWloymTck56a+/WFGLxXt6+ltYdOavhJKSpKk0eqp7ZmhQVG7eTBLmDB2KfwLQh0e6Hu0K9dq9e7eJTj+wc5DW4PwLUYVgf312YTsBVa1bk033wwfiD5UvH+fvjwkDGtINYSc2vaFCQ1OGDAlEbNSvn8IAV27GY8zXN3HNmq+1ajHC1aGTU8R/wHOF4zhE+Zu+5a3KghboQZCw6ltq0SzUBQA0GrBzy3L/odTidThrkZyhVN6rqqv/4Y383bt3XbuSKXPmzBlJsfAFWCX4Ft4L4B59BCdOVPj7c+aqy9y5IXzyXLlMlvgDYOWEFjiH4IXvxYsXp08nnThunDbIOmjcOJIex2hisX/vFWF25ZoAsGBRgIUgOTU5HfThqbR37jQbwJKXKUNASUg6hqoxCkIiv1m52VxaunbleN/8GF0tzPjxBGJLZcxQf6OKeMw91tUyZUowyIFNSFILXaQISTMclQ6Sov1jvXJ9jk6ASSNI4siybvVMcUUsfqt4W1Vb01XAUghPwbOmVAGOrfDlCYYv6bK/ZEyYwPAOFoyoxaKvXYP2H8QfmoOCgiRVlJGXydBTjb1+nfi519dmdcQUQ/W21jMxQ7a7uztyhcOzcEhAzi1m3jwC2mbM0AYl/PorAfeHD8vVcnS6/5P908RWuncvtlIlMg2LFqV37VKaZZG9dSumZk0tzLKxAeCX+P9xw0hOTlYoFDdu3OjTpw92ga6XT2a1vH37FpA6oISIiIgs1OU19xopWorJip1lz+pKnsZMg8/LUGV0+Yf/Sxu5XC7HLtj1LUWHZHnw4LmNDUkKWa3azlq1aBcXlXnrkpKS2qcPceqoU4eBM8kPgGV2LXglMm7cOKWSK1eOGCBv3CAEDZqYGNwNE2WyHwBLoiRqEvGYJWroMWPIyr55s9kAFl24sD4omaIgF15wuDeXlvbtiePOkydx6QDWtGkEYK1eLSkWyU6FnRgfnDOHHIl27ZLmTJPx1/6pyekg6UzFTJCzUrkyRydArylzQEvNy78aEQ7Hejwy5nmXpwRdwnQVkZGR8FSPHj0ks4uIytmzZ7N57s+w7NhB/Nz79hVHeEUcOADtP5m/GPr48aOEuTRJAa1UmiptXD4nkxFyvLx5uW8+TdUU1eotJwDr9u3bGdbi8+fPgvtOezkJ19im3EZ36EAQ1dGj2rG3ahXBW3ySx03KTfCdunTdlNQMgvsSEjQLF36xtCQwqF07FU0nmneRdXaO+uknOX+TSTk4hAng5B9cyh8+VFWsSMNvyf/75cuXly9fnjt3buPGjZMnT0aTCRY4WMfFxWVzW0J3OuPJkSTLNdU1vPytQdXQJxlm1ay13Br+byO6keA0+Z/ZyL29vYfwCRVWr15txIx9+3ZM1aqKsmXPW1vb8je5x3KiLlFRKY0bk+XC1pZLTNT8AFhm1EJRFMLoW7dunTnDCq6xpNnPnCH+pm3apP67yz8GsCJSIsjZiy4maugpUwjAWrvWbGmYZbzDrQiUYFj7MmaZubQ0b06639MzPh3A4o0KzJIlkmJhG4Z3eM+919WydOkXHl+G6avQJCYSs0deMSRdyCwkLjjMwhydAC3mTQctv57uZPxEjsHSaMVBdnITy8CBA+FZkJBhFdAD6cCBAzm3ZNy/T+By1aq0qMW+2tlBFyzmTdaSrjN/RRHOBVu5bYYqqBrEIZ27p6WHHRE4ovGMxiD29evXGdYiIiICvtmrV6/X3GtLmWUBWQFf9jNVlHC4c98akHv2TMY7LHBKJaNmMDfimagzRsR6eyfgVpEnD7V+fSjOGLMvsl+/powdG4SmrBYt2HfvEv7BpdzfnytRghyLCxWinj3jYEF/9OjR6dOnAU5Nnz4dswXoFhsbmxEjRixZsgSO1M8NuNZmqhawc2DoaKbuu49EHskrywtN2EneyUftIyn5s/qzFW0F3xkkH/Rf2sjhbDJ69GhotDlz5iQaCM7/8iV5zJi0MXbokIsNX84ZCOjOZl1YNqlCBXJsmDQp+AfAMqOW3bt3Y+Ip+Hf//qSFly3T3iqoe/Yk6XH27/8BsKRLYHIgjP9y8nKihp49mxHaMfvdqUlIkAQli5nFhOSTmWeuQVO/PtmZPn5MSAewli0jAGvOHEmxhanC8A7+nL+ulrVrCSP8mjVfJczREREgjS4mhqR2SjuQM0MxI0cnQHW7CaClt1N3I8Jv3LiBOUCsOXJ6dotxM10LsvSChAyrMG/ePJKs5vr1nFsyWFaNWbc/fkzntxQ0cSJ0wWY+wF4yz/TSL0uh4guYBRmqUPTrR/zcd2q9APeG7205siWIhT3elIqgA+/CjwRbD5APUN2/T8Z5lSq6Kmie55b9ixCkObKO8M1aTC3hRj7dNNGk7toVXqAAxVOGMi9fxuf0IuvqGlOtGjlK5c1L2dl9VSjMowXwytSpU3fs2HFMquxJX3btguV7R506ds2aTWnadHLbtkPQY1q39OvXD8YbLPQw3j5+/BgbG2vebYnjOCTdePHihSntBt03L2QeRg78zvzOqo05az9QPcBFBvNx/Qc2coZhMHXphAkTJOnaDVlJL126hDSkly9fzom6wNEaVww7O+UPgGUWLUIQCZx5fHy4/PmJqcTTk1xxJAcGynLnhm092WS2xf85gCVPksPMt1JYiaHPYgKw5s0zD8BKCQ+XBCWrGBLqNY2ZZq5BY2VFdguaTufqyPCsHczvv0uKRRc0YYnEB7dsCQM5S5ZIjBsyqiws5OXEkHSDcgPImaiYmKMToPRmEhYwZZcxOtADBw7AfNi6deuMkBnwZccwR9O1CHapDKswePDgLKR5zuyS8euvxM/97Fk23eM878afdnbwAkeOHNGXj9mfTKH/YJYvJ1d4U7SZs73ivdr3bg9iw03LqDV58mT4ct17hMT/DHtG6eBAxkb//ukwHJ+TRzF5Mt4ZVaeqw5ePRh4ViXrxIg49ruBnypTg6OiUnFhkX758OXbsWI9vHLl4tzJ7dggSOmTTPyYpKcnd3R3JPrJTOnbsMmjQ+FWrVjk5Obm6un769Ok7bEtI47Rs2bIMJYelhHVTdyNcDFS+HewOU4QfZY9ayixhqTnHnvv/vpEDGF28eDG01aBBg4K/BfroFnf3WCurND8/wfEcy759++DZLl26AArPibpcvhxtaUmij48cYc0xX+KrV1e8ehX/PwuwNm3aJOQE27aN2C/at5fj/wrfuRP6OKB//9R/ffnHANanhE/EsVdZTwx9VpEZMm2aeQBWckCAJCixZ+xB+3hmvLkGTbly5MwUGJjuIlIbLDZ2rMT+qmbQBU2kZfdukjQaNh59FUlyOZFmJYak25TbQNRIxcgcnQAF9vcALes2GwNYK1asQIeSfeH74MuTgieZrgVjcUFChs6tNjY2nTt3VqlUObpk/P47GYdLlzK6jysbNoQuuMLjSP1s1ppUTXGaEHt6cV4ZG8lOnyYjs21b/DM2IZZs8J07qpNM6qPVq1fD938691M5qhyAJ/nw4cQetn69hCv9N7PWPnYfHmkSNek2HljHoaYFClBCDKx5F9nExMSTJ08iXxTmRDp27BjLapHrs2dx9eopsxzhFRgYePjwYQzoQze+adOm7dy587hU0TVfDR2608rKsXbtHXPmrIFHdu/eM3y4h6WlH7yGvb3ye25Lfn5+Xbt2hVEdEGCMm9cn0ac2Uxt68Cf5T0/jnpouH10IisuKyxJlZqmLyt2dqlQJfn/njRzphXv16qVLeZXKOw6eOxfVoYMKoVW+fAYjVTFss1u3bvfv38+J1RKPxwULylxdVVmeL7CJCAcPOPlIXh3/5wEW5nWGAgcz4bgrBNywzZvr5hf+AbAkypv4NzAdmrHNxNDHnmxs48ebB2Al0rQkKMEbk2HyYeYaNEjsGxGRkg5g8UBbiMZPZ//kfIgLGlVMpOXwYcKtMnmyxPks4dMnsonWE0PSvexeXU+LnJgAHKe2PN2G2GZWGbsiHDNmDKxfT548eRj7EL7cWtXadC3wFDwLEoy/P0w84Ws5umTs20ec6rp3l+s+TpcqBV3wjCfvXrp0qUi4b6Iv1LqSopJJx3EvLyTixD9hcwWZrQe1vhR9yZSKHDx4EL5fdXfV6cx04TZQdfOm6MhP/fQTcczi90KVWtVA2QDecH9EmuOCj09i7twE3Lx8GZcTi+zTp09HjBiB6Ad6DT3tsEydOvXChQtfvnyJj9fMm5c5jiKO4168eLF8+XLhUm/SpEkuLi7Gr/CExwFCoauZSBfgadykZ8xgMNzi+2xLCB0OHTqkK+f163grKwZ+kxvVGFfE7k3YJsjMnIlbSDXXQ05OR9D7AidOdupClStHgHupUiQ1+vfayNE6DkgUsRE+qFAkLV/+FS8E+aBXqnZt5sGDWCNa1q9fj7TvsODkxGo5YgQ5rpQrR715k2kyiPDwFDu7r4ULk62kWLH7bdr8VqTIfcmAp38Q+rx+/XrQoEHw23Qtb9/GV6umgN8mavn777/xcnDw4MHw5/PnKvSSlMlIk6oePSK3UiVKaOLjfwAsgwUOYSRRmqqdGPo4snyaJ7lZBk3Cx4+SoGQ/ux+095f3N9fQxO0hMVGTDmAdPEgAVr9+Ev7g3FtyGKV+Emk5fToK5IwaJUGhGf/mDXGpaSaGpH+yf4KoXvJeOTfNvL05i1vk9Ow6u5thvyW2c+fOsOHJ5fKQ5BD4clG6qOla0DTVpUsX3RR7+gW2ZLxPyenN79kzwrtRvnyaR5QmLo7sK/ny+fn6wjtMnjxZJPxM1BkyqAL6m6iC4glEOH6p8vb2BpnNJjRb8GWBKRW5dJX4lNSxq3NfdV/t40NuJvLn5/R41hWjRpFL6sWL8U9AbwgB4zRaODVsWCBvMA42+ylWqVTihQ4hvp848S2fSkGj0Xh6em7ZskXwH4dOX7Bgwblz527dkpnCsu3r6wtABP2WcMe1t7eH1jO99w8fZtE8IMlAsXu3EufygAFyaM7vA7AwwVT//v0Fr+2UlFT0mwaM5RjmiO4EgwMHx2hisqDFj/OrQ5O8ZAMCBmhSNdmpi3LbNm3WSQsLOaxsemG/knIePXoEY+D27duSjlMZvv/58+dxqFy7RmiZVSr1rVsxffqohYQBjRvDWhsRFZWSYV0AmqOhvU+fPmgdMe9qyTBc+/ZyTCplojkWnoqL0zg4hJUqRX9jnqN69SLRc9bWtjVr7vLyis4hgBXv6amwsoLfJvY+TdM4c7t16/b8+XNTtCQnpyIChmllCgceDBWMHOzbty8cp4kJdiGDa4L28mfOHGij4ClTUv8/lH8MYN2NvQtjqQvXRQx99hOA1b+/eQCWIVBylD0K2rvLu5tFS1KSBt45d26ZSAt74gRZhrp21Zf5XPUcXqAqXVWk5dKlaBA1aJDEZUHc06fEStFODElPs6dNjFzLMighUXUvScyj50iDAAvONDArhvLmOnjqJ/lPunmQTNGCu6ahsxEW5Hzfs2dPTgMs2Dgwh7Farb32TaQoAperVcPs1AMGDBAJn/9lPlR5Q+gGE1XQHTuSwXn8uPobudcv839ppWplSkUcHzuSnI/TSSJn9uxZcqRr0UIC9Z46Rf5Xo0b4J2yuzdhmgnvc+/cJAMwKFKBUqiQzwoWYmJgDBw4AVsZV8vLlyyl6iXIASUCVV61aJRAfwPcXLVo8ffqlQoU+S+aJg++vXLkSxWLkHcAyE13WhLpcvsxiwsQVKww6Izs7q4oWJV3ftq08LCzlOwCsVEKARyIn7ty5g0LWryfBLpb5PltsHgz9ZSmzXBu6VhcbZVaFB+dRki4JotZ8XZPlunCvXlE8+ZBy9WqMWmXmzTO+woSGhu7evdvW1lbA04C0YBbfu3dPYJIz/uYAy/B++fjx43DSW7lSWbUqLfDWjh4d9OxZXKbqAkc4wPSY205I6GnG1fLzZ3XNmmT8dO0qV2V0VahUcgA7BCfITp24R4/CMBUYBrJA6dBhyMOHT80OsBJ9fWm+EwEuh8yenayXGEP/CI1ujjhnAWNduXIlQy1LlnxBDwRTOPAAQINYdL3CPOiwDmN3azNJcBxVuTIIin306AfAMlZcol2gwfsG9BVDn6PaqxmzwAVDoOQsexa0W8utzaIlMjIFWRlFWlTOzmR769BBMsAHXgCOlSItcDIDUT17SijFzABcFzEkvcheBFFt5W1zDmA5/6W08Mtl4W8p697FkGRMCoY+ifCUDWcDb3Ur5pbpWnDV05+0umXRokXwHQwFymnrAp5EXVy0x8e4J0/IWGrbFuACbBiwVYhIJturCCWVa4yrqSFRM2aQLWrRIqH1aq+tnZfKK5iXjJTeb8k5ssdvPYichQuJnGlSERsKBcXzwHFv3mCL3Yy5iX480SnRAwaQ9ANz54aYq8U4jnN2dh40aBBupdu2bcsQAEVHR9+6dQt2FOGyr0ePnh07ripZ0sXS0r9CBerGDdnJkyfx9lmweMEjWeDxf/BAVawYWeUnTMggatHdXctq2KCBUqlM0reLK6pUSZAiQsvy5nfz5k0hE+WTJ3FwWrNsfLnAW0J3kvtTwYvRF7OvxS3GLbcsN2C1K9FXsjJfOE7erh05Y/Ttq4X1PC2fcvduyRUGevbIkSN414O4aurUqbpEYngeW79+/YkTJ16+fCnJgff06VOk1luyxHHQoLRs4jVqMFu2hIWEJGdt7kOnIogZPHiwt7e32a/VPDxUJUtSfNSIwsgRDo4Q1atrkUezZqybWwwcPHAZHD58eHBw8IsXXu3ba0f+4sWLlenzkWQHYMV5eMhLlybn/zJl0B5JFy781c4uRWfCiiTAcQjjaj09PTFjB3QrnHV1O06k5cqVaLyLhyGdIQceAGhcBGBIqL4h0ytXyP1gxYoUKmEvX8ZTbmrmp///FsByjnKGcTU0cKgY+pwlAMva2jwAyxAoucxeRv5rs2gJCkrms63JxQCLJ/6mW7aUOJapbsMLNKYbi7Q8eBCL5xiJrcjFhYRO9BVD0hvsDeLNJm+WcwBrsxO50Mz3ujDd3mAOY+Qs2cHnBYKnZoXMIgl8whxM16JrnTJU0KHnxYsX3wFgzZxJjpWrVmkpM6LOn4f2Dxw8OJWkjCRUWCEhadAkOTW5ME1C4r8kfzFRPrtvH1ngAE2Te6vDxAdrb2tC7h+XQXK6oOSgvH55rW2tYT2CNVfeqROStkuHBfTuTeCXvb3QYm1UxJ1u5od16Nlw/vyN6dOnX7x4MWvXN7rucWiGQaDg5+eXqX75+PHjn3/+CduwsPu2a9e3RYvRHTt2xz/79+8PI+TDhw9ZG8k8WRHZzHr3ztiuAMXTk6tTh+YXdwWSdaWd+3nMCr8TpeqYtc0vPj4eb0Zev/apXJkMvBJeVYnt6kMhi3rX4dxlFi0wH0FmEbqId4L3N5N5VMOGStjw7tyJ9fFJjInRGAQl69eTK/KyZblviES5aZOMv/tR6RyKCABNSDh//jxmWoSycuVKuVwuWC6hB8+ePbt8+XLhC1h69+49f/78gwcPPnz4EEY1iPLy8urbl+RsbtVqBaIQQAJdu8pPn2azsL3qh8vgcAUImCmPIhO1ADLIm5e886ZNErZS2OYaNtTa4WrXZi5ciIIawYENry9heQHUggJfvYqtWtWpffveaOWF9omJickmwIq+fJkqWBB0q/v00cTEJHh7B/Bpc8moLlUqzMFBwzPo6j7u6OiIbQWQV+ua8uefaJhcsmSJ/Js3nq4Wf//E4sVJHR0dtbSOhjjwoLIYf6AfSI4+bXPmaJ0fFCNHwsNfV65M/X9S/jGAdSzyGLTzuKBxYuhzmQCsVq1os8AFQ6DkluqWCN9kR4tcngTvXK2aQgyw3NzIkG3YUMLeo4fw8MEXL+L46kuEyEXx9rDAoWJI6s65k3hMql7OAazpjuQ+t4RrGbp5c0OS0eEG9mnUcjCC5NcbHzTedC3wrJABxoibF8xqXH9zGmA5OSl1rYlh20myv5C5c4ULnc+fPwuSPyR8gPpWZ6qbrkX18CEZHlXJNfHmzZtB4EjnkSBkU9gm47XYGU7S49gMJqe9v9+8kfFmGe7vv6XvIHbvJlo6dhRa7F7sPRLB+q6ERZG3S5d+AXSV5esbwS9q3bp1ePocOHCgm5tbZs1LIhdXANlwghe23iZNpnTocP7JE2WWR3JYWEqDBqQ3W7eWm8655eOjhqMO73FM370bq3vuR7sgnP7jdIgnsmld2Lt3L3//QoBv8wEeeag8ljLLuUfc4U/AQKJb1ixrGRVIUpfWZGqGpoTCn5ikT/enTBl5s2bsgAEBc+aErFnDwCy4eVPl5fLcv0BB4UY7zUI6eTJpjZIlVR4eOEOvX7+ORCpQ5s2b99GAnQ8d8miavnbtGiAwPLEIpXPnLn36TLK2JndkjRrNsrT0K1uWgl329WvOjC7bMpkMr+EA2jIMY3bH8N27leg6ohtLcf26qk0brVc+IH4HB2VSkgZbAx3w+/XrJ+BRLBs3hubN+7ZJkzU4xaCtnJ2d9Q1+d1R3KtOV4XcGrvR79qDJKnjq1FQdG3zc8+ccf1QjJqJKlSKcnDilUrAt8Z3S2dU1nXke/sQGHDduHJ580kwbsZpGjUj1Bw8W3zyKOPAoigW0jfAR6pXe5UuNl/VPnnBaezy/1iXqLLw/AJZ02R9B3MynBU8TQ59bKt5p0TwAyxAoua+6L7qhy46WT58S4J1hqRIDLIx3qFVL4gTD31F2kncSaQFQD6JgaEpcRB47BtKCxokh6TPuGdnaqeo5B7D6bTwPKqqcrUA3aGBIMu6I6DdKrjninsAjLdmWpmuBZ9G3xpCKV69eofE8R+OVdNSRzbVsWe1i94W/iQvj2RmWLVsGb/Ls2TPRgWFI4JBMaGFZWf78MktLzscH4enmB5tBSB91H+O1aMo2ha8Nn0ka/PaRI2SHq1jRiAc1kvKBljQJnzqChPyL58KZErOOALTK7PUN726sOnbsGC6ysD7CMdREolRT+uXy5ctjx45dufJSmTIU78YhW7WKEUIgTBceF6fBGP66dWkfn8yBkoQEzYgRgbgZHJ77QDj3p4SEwG/S8gULRl+5YhboA+gEdtAOHbqVLes9lB5HyO2CJsbHa5Bj7+jRSLNoidXENmebg/Bu6m6XrkagJ9PQoQG2ttzPPzPwbxHeEn7yWXyqVuRVu3ZyGxt5mzb0hAlyR0f2sJPydPM5ly0a3a1qfeLgmWHDtLAYTiBGchIA/A4ISH75Mv6vv6K2bw+bNEnRo4e8cWPPGjXO1qq1tmXL0dbW2vvitm37t2njc+AAyzBcDsXE4RUkzGjONIf9TGmZN4/B8MYHD1T376u6ddNCq5IlKRjMaPfBB9GEA1PJR2eeYgFs3bEjxzu/P8ebTWxhDx7Uag2unGdRqiim/V7KLFWoFRJ10Wi+LF6M3Rlqby/5/jGurmyzZvgdqkYN5cGDV69cQWAnQj9Y3rx5gys/4MKHDx8KctBSVacOExkp4cUocODlyfO+TZtpGNd5544YGqJDdrNmWvOY0smJ7KeNG6f+/yn/GMDaHrYd+nD+l/li6MNnKalTxzwAK/L4cUlQ4qHyAO3V6Gpm0fLmTTxeoou0cC9f6vNr63rZ95D3EGnx80tENm19LRH795NjxzQxJH3DEcKLClSFnANYrdYRJohGeypRNWtKuxMxjK2tLRxxMAaQOLemhMIjhenCJkYt6RqoJE+TIjcv9XcJoS9Viuw3CgXxwgnkuaai+GTMaMnXTdeD3Kpbw7ZmSgvdpAnx67pyBa/GHvs8BiGl6FJGGu19wnv8ztp1a4nnLx9Tg24xhoq8bVtie9B526aTrxKA9bnoO/odOuzDATpT1zdQ7t27BwAIvzB37ty/v5nQzN4vnz5pc8Dj0cvdnTNdC2xOgwYF8AQQCtMj53XnC6CBxYu/oPYFFjPSzv3JyfBvvLgK37Mn+9Dn9ev4pk3J9rlg/Z48VB74oRIJWj17NgopkWJjNdnXAkWZpMQYlKIbp4DkvXvDDUGfyZMVPXvKG5Z/UcrilSHgBT+lSl1r3lw7Elq1Glaz5oWff1a0aAHTmYPGnzAhaMiQgI4dVT16qG1suJo1jcK4fDIrK6p9+4/dup3v0GHEihU3zX55p39sg90d80abXQtgtn79CKgqXJjCmEf4B6AuX990fktIQgFQ7927d5JiGSYJr9ucnMLd3NyQ7gRwz7p163x9feGMjZlti1PFsSFhazvOprM1ahIScAWDs1bkyZPG6qDRRDk7M7Vrw5dvlyjRxdoadMHcN9SAMpkM83DA6n3rFnG6PXQogq8p7e2dYETPrVvK9u1HwYNt2gwYPfqpftBlp05y3TtWebduxOdv3bofACtjgLUhlPCPr/i6Qt89kL9uMw/Awuy8+qDEi/MiiXqocmbR8vRpHCbHFQOsd+/Qa0FfJrI+DpAP0DvFJuFmIHHNwV9RfZkvhqQfuY8gqiRVMucAVs0/1oCKzmsrUpWkSZ7gLAXzZNSoUbpaKsgrwFPyJLnpCxNIADmSAcBQ8A7F0dHxuwEsW1sywy9eJH7uHB/0F3v/fuq3xD5z5swRJP/K/gqVvR97P1Na0KVAuWFD//79QWBoaGglRSWQ8ynBIIf4oi+L4AvTg6cjFdZm3o7CrDWWtlz5xx/I8669IrxH/PzyniLpjMY4jZEmTTV8fdOlSxeAgyNHjhQMXaIER+bqF5WrK12liurbrcTZs2zlyhQak2CLio83CbjPnBnCp2Qka30WQQl/7l9jMSaXhR+Imjo1WDe2IXTDBoQG8B10vM2aloiIFEAeZcr8RW4JR3a18CfmKwH0YKpTe/tQswAsNDDn8iPZDGsu2JOSYqxfVO7uMnQmOnnhyRPu/HnVjBmKNm3ovn3lw4bJu3e/a209Vesz16Z/lYqHLS39jEAx4adsWTlUauDAgLlz0y4i3741Jdu7+ee+q6sruhOJjDRm0SKXq0uXpgQq3ffvxTU8ceIETivj6ZIQZwNqgUM4RVHbt2/HiNqevXvWcapj6WfZgm7hw/lcYi/Vo+thM3eSd3rCPcHbbrz+o4sVi71715SKaJKSnq9Z06tjR1CxrlYtOKSx168b9HZQqWANwWGwatWuAgX8Qf2ZM8ZI1wCW4cLSo8eowoVf63PgeXlxuXOToff5M7+ZfvwI0BDOHdz79z8AVsYAa+XXlTAC1oeuF0MfLw6J2swyzcIcHSVByWf1Z2Q3NouWO3fIjtWlCycGWL6+BGAVLaovc7uSGPBGKEaItHz5QvzlS5eWACW4lH9dIYaklJoCUQVlBXNuYSpjTzzWR80uS5UuLSkWFiaBnkrQ0oXrAk/diLlh+sKEV28XLlyQ1IL/V1gEvwPAmj8f+dxJ5iKmZk1y/e/rC/9GpwSAWSg2UZOYn8pvKbOMSInIlBbG3l7G074hPT3AmqGBQ6HR/oz4U/L9k1OTEba+iHuB9ryFbdoQG5jhtY8sfy9ekHFYrJiGp1lq04acYWYeJLfkLSa2ACFPnz413mIfPny4ePGivb392LFjhXA/eOH9+/cLBi1znvvfvVNMnIieIlTx4tw3x3Y448IWhZaAevWUGcbnb9wYiiHijx/HZQ2U6J77z869UbAg2Sn79FHrOoNHnjxJ8RAkcMQI+H7WoA8SkjVrxgwaQmIwy9wog+YrLPfvx6IrWHBwslkA1suX8ZYj1xMrpqyAZ7ynoQbkGIZu0ICYSMeNE0l7+fIlxruhD9OhP/74zPulBdo7BAUlAwh4/ToeoDwcTo4ciZw5M9jaWrV4cQi60uua4lL/HbzkiHJgSOuSvJtLi6urqkoVSpLe/ejRo5gkUfd+zVAZNYoMkpYtWaWSw+u5CXMmaM89ozvduqdNAcSqWXulPexumCxk+sexH5rUQs+qBAMWMv0SHByM4cCLBg+W8QTL5JDWvbvqwQNDbXju3DnEfI0azZg2TWFEuKenJ/oVzJs3D5CWuzunz4FnZ8dgSIp2qdy4kbyArW3W+uV/DmAt+LIA2nNb2DYx9Pms5gmuZWaZZqH8BqYPSuRqOb+45DeLlmvXSDBq374BYoDFMLg068uECQAvMEExQaQFFm6M7dLX8nXlSnJ3vl4MSVVqFTLl5NzCVGDbcFCxZGQRqnBhSbHbtm2D2bJ3715dLXND5sJTW8K2mL4woY0KDmeSWgSm+O8GsI4fJ5aDzp0JdEb/mxQ+1E6hUKC7mPaOmE9LUIepk1ktGGfq2bgxRozDs7vCd5GBETRB8v1vx9wWFGlJ7Vu0gFOeOiPPbapePWJ+u3Pnxo0YjHiNjk7p96lfJ5tOtt1s4w1zIkveCJw/fx764roBVJedfuF8fJh586hChfDqDX1a6Tp1BIwFxcVFVasWjSaB2bNDDNFLHj8eid+5dCk6ixu53rnfwyOuTBk5fymW7voD/i+NoQadOqkz6+dFwikikOfF3z9x4AFy+9N7SW9RdXr3JgvjrFkh2QclSUmaxo2JA3KT68TTqxBd6O946cyezPz5pPpWVpxMJgSaXLp0afTo0Yize/TosWvXLooi52H2yBEZn40v+vLlHJ2VOTT3MdAEwKJAjpXTKwwgEkwIc/v2bVOEh4enoHv43LnEieICe6EwVbjMpTI2Q7RnniFDhjx69AiFe3PeoxWjc/lbEloWD4udMyslKk1lJYyKiho/fjwInDZtGpygOF9f3VlJw+HG3l716BGX/nDFceru3R+2bduXv80YLZBKiIqbmxvisPXr1yclJX0bVyRLXoECMoEDr25dMsdPnNDatOR8ehx2//4fAMskgDU9eDp0/L7wfWLoI1fzfpfmAVhf7ewkQQkUWAngBTg1l30t589H8WaIQH0tSBWj1mMnt1PagfYZzAyRlpSUVEIwaCmRNezLggXEyXrbNn0t+WT5QJq+Y6NZFiaYX5YHu4L8Pd1zQXUkxcJBBCYM8iwLWpwinOCpsUFjTV+YQALImT9/vqQVGqYlLEY0TX83gIX21BIl6OSvobpZw5OTk/Fl4vh45kMRh6Cmo4NGZ1YL5+cHnX23dGlMHUPOdvGeIKo2U1vy/YcHEqRrH0ocVP39/ckO16GDvFnGDB24UwbPmNmsGSsETh+4TDw/Gs1rxCax//zmJ5czq1ZBW+uelQFXAbrSx1iAJ+3sviLlOmw5rq5iFoPbt2Py5KFEDkaZqgXn6YmqRed+P7/EIkVoNIw9epSWlQW+o6hYUfuqnp6mK7p/X4WGsbNno6hEqpBXIevO1ra2tqJ8xoDn+BsTCnkapfH6vXumZAnElHk1ajARMQnojFVVUVW/U+JfvaLy5IENVXX1qo+Pj7Oz87JlywT2Sxj8mzZt8kmPJpX8egs7sSFy8H8zwOI4Dm1ycHCCyZXTK8zly5fxXhIAq+nynzyJy0WWYdkK96O47A9RDJEr5fv370dp2C+f+Xs1lbOzS8tCzS5oL2bbqNrAUTBDFQkJCUgoCocomSxtI+bevxfsyoLHHN2ggWLwYMbOjj17dtH0TzytyZtx4yYhVBVljYRy6tQpHD8HDx7U6F2pe3io2rWTC+JLlqTQVsd5eJBxVaSImofyPwBWxgBrfNB4aMOjkUcloI8laVxTLuMzfA1t5JcUKCkgKwAvQKvp7Gs5diySz58YpK8FUT/HT1fdghlYFzAL9LWgB6i+i0nw9OkgKnzfPn0txWTFQJqP2icnFiYCMi4Q+m/nVgQsclIe6HibLnJzfhZHwhubs81NX5hAgpCCSg/reGGIco4usvqlYkVyZPx4U5xzadIksoh8+kScpSYHT4aa7gzfmQUtlJXVX2XKYKJrYl3QJCGfVnCyOH1NeEp4AapALlkuZZIStfTiGa4/TJyYsanM1RXe/2DpkeguHRdHRtfSpUvh8fLHy08NnvoPbn6apCSlgwNVvrwWWqX39jCEsVL5kNsWLVhci8eODfr6VWvKev06HhO6LV/+NWt14QCp8Bn3lA0aJOkdxAHrIGUi7HObN4cJlBTwTSV/oQbPcgZQjrj3KXXt2uRVJ00i3T0haALUpvdyQnp09OhRkd7Jk4Phm7/9FiBdl2+pJwH6sTwTr2S/0HRioUJkhXFzI6j07/i/MQ/Pw9h0V1SauDgY7Q+KFNkzePCUKVOEe2EM4zVivwyeNIl0YoUKSSz7/wtgqflUMBi3MXPmTEMGmFh3d6ZWrVg3t0xcEapcq1BV4Lfwya1bt9CKs09nPTexrFz51aKfo4VvbrwDEWwEjx49Gjp0KPZU9+7dd0yb5s0b3emBA3bLd6BrAaweU4KnhCQb5BYG0IOEokOGDJGkYGWdnOj69eUdO9JVq8pwq+Z/jlu0z0XYqP3ONZrBzZy5nL9tAMx34cKFb7aDFLzogDe8ohN4qx8W4OCgREbZn3/Wegohl7KQ1fcHwMoYYA0LHAbdci7qnAT04e2ENG2GaRbCk2VLgpISshLEm1j9Kfta9u0LhxeePj1YAmDxt9e6GwOWmYqZoH2lcqW+lhIlyIKrn6MjaPx4EBV5VAKSlqPKgTQvzisnFqY7d1QW7tVA/r0GPFj09dXbJCjMnyDQ7wqAgFxAUIVSUlNMXP5AAsiBGYiXDrrlxo0b6Ff+nQFW//4kBu3Ysmek7p07C6Ls7e3hfeCt4N9N2CZQUwCUWdAi7937cMWKeDGKjyMJ/tXoq6KXPxxxmORE4mwFLeP4De8hTyKaYfGvUKmWxW2oy/79xFEsNjYWm7qAV4FcVC50z//emx/GK/GZqpExjj13TgI5SGGsb6bEVAeHMLQAAehxdo6SyRIR/YwbF5S1usC5H/PAANRLMcBED3pXrPiK+0vfvgHCbE0JC8OYTZCgkgprF5XhwzFvnTImRkMlUhg8ePvNbejWQYMGJSWlI5HnuCTERh4ecRKhDOvWIe2njId+ypUrRYkCUUj37mpRttP1ocQZq5GyUXIqcfCKi4t79uzZhsGDB7RpoxvZMHfu3OPHj799+zYDr7XERM7WlmDTxo1ToqKyPCvdOfdKVCX4/T0BlprPCooxemvXrpXo96AgmidCI5EltWp9XbMGnTKNaPHn/EtRpRDcTFRMfMe9c3d3x4Qw6AuR2YrsC9tPkIzMoq7TLMmgyIULF2qDf9u1OzBsGMP7D0SmRC7+sjgvRSIbStIl94Tvwe4WlZ07d6LxSS7PmOub8/eHsxCcjp4Pm1cy71tolXkWs7Bx/C0sHK2sEJWv6dzZ55dfFk+YgMjvyZMnGfbLhQuqmjUp+K0FvlZWxNP0m2/uD4CVMcDqF9BPtIukQR/+luDTJzMs5UETJhgCJeWp8vACf3N/Z1/Ltm3E5L5w4RcJgMXfGnB6TMGTFJOIj79yvb4WTPIqpMATSuCwYYQm4JwEJK1GEwD0XPU8JwDW6dOsxdsiBMBVJysL9+6dSCbm0Rs/fry+FoyJkyXKTF/+8O5f8CQQyqFDhzDe7TsDLMwKN7MboTQLGpt23Xnu3DnknY/TxMGmmFuWO2uJeJklS7ZVr46p1vBxu6/k+njJlyWil8dUPCciTwhaFjdtCg/+5eRkiqLdHbdBRaqWeIspyR8+fIh++rWYWujDNyRwiP4NQs4BLDHjzqFDasNWa32MpSsKQJWNDYdnabRd9eihRv7GzNZFuWsXeqzLBwxQMxn4rNy4EYMJeqtXZzw9tX5s8BQ8i86XojQyorJvH4v8XujOheYrDB6cwO9GDx48EGm0s/uKActiUHj/vow/9bNHjpBsuDz0I1lQda7wUr9FosE7C87yBFFp4qoz1Qu8KDDv9LzFixfr0qEN7NNn3bp1cIpQmEzPSlBmaCjDd5a6T5/UlJQszMo7qjsFZQWNBHrn6NwHfIkA6JzOYovoCi2UgLHkvIETf9gWLcIcHZP5txIPJ07ZSd6JsOfLigDAgn+UvVe2cw9ieN6wYUMW6rIlbAtqzTtjGX9YYvVMTKxi9Og7xYpN5RcH5P49ffo05vXySfTpoe6BEhoqGz6IfZB+qT+NSQaRLcLUFYxRN21K876q8kQVB/M6zMEBlkq2SRPnihW7deiAngyEK6tnT33i2YwPPNevk9lUvrw6/QH+B8AyVrpyxK3HLcZNAvqUJ6e0v/82g3eUlrtICpRYUVbwAh6cR/a14B4Ma58EwKpRg4CSb37ZQhmpIJzdDkoHfS01apDoCYpKFGkJ6NcPREVflYCkdeg6IO2B6kFOACyHXSRKMZdvXsyyyemloMdpuWrVKn0t3dTd4Nlr0ddMX/7QQH3mzBmRltWrV8PnoOs7AyxXV+IV3sbqOQlHXbZMEPXixQt0F3se9xxXq6xpYU+csKtTB0Rdv35d6z/Ee7K3U7XTfXMqkUJesegUrcs29/Tplho18JYhYy2sunp5b6jItirzdS1w58+fvx97vzZTG4+2yD+pu+zmBMCK8/DgrK21nNGVK+tyRhs7LqfHWHq2sFQnpwj0yipdmo6OTslC7zNLl2rfasYMRHsZ1kWhSGrZkkW6zoMHv8WQchwmmiR2jqVLDeziXJEi5G23bVNi/+pyX129ehXZxUTqIiNT0D535IjOzqpQ0HwQA+ys2u4+eRK92eiqVQWei9BQ4dk0zlI4yUycOHHAiAECqLKxsZnctu2uatU8FyzIcu8nymRIeR8yb15mZ6WT0gnRVR5ZHvi9Xbn9OwMsdAZF9/PHjx+L0JXyl1+Sg4MBOMbevQsHeLp4cdm3PD5c586soyOnA2qHKIbA/ytDlfFQecD63O1pt3a920EjN17WeJVilVwtz1RdVnxdgZawLcotMGz4wFJKYLcn4w6avUsX7TXx0aOurq54XiVRhqNHA15HtydYkGswNXC+w9y/HkNWHvgy9r5QZRPbavx4smFVqUJ9+qTWt/R+unOnG+/J0L1Dh2cFCwZPnpwSHZ2pflGMG0fm0YwZ2en9/zmAhcfxJ3FPJKCPFZrBzQCwMMWSJChBshB3lXv2taxY8dUQSw1Vvz6xbd69K5I5SD4ItO9l9+prwZwe+hRtXNeuICrGTQKSNqYbg7Tbqts5AbBm2b8gW/vb8jR/laPSsy1h9I2Tjh1FeBZjRTeGbjR9+UNLFcgU2/x4n6cHOkHC3wdgIXFGobw+fhbp+CSDgoKQonNP+B7B8JAFLdybN7MbNgRRHt+SroSnhMMamp/KH69JC+5b83WNKGJAuWvXUf5ucc2aNRlqcXQkIKB6Lndfi9yJNA3HWaQSZb85ynBJ3KIvi4rSRXHZbaVqdTX6qiZVY16AlfDhA54TiH2ldGnJrGcmYqzk4GB9+e/exVetqoDfme59/tyP2ySjc+VqyqBKSNDMmBGCm+yoUYEymXbhUtrbo0ewYswYUZiLQqHGVHT9+2u3WF3zFV7gIvulPoMGOiTUqKH1/yXSpkxBK6Ba52Kde/UKaWxl+fIpebsvunBZW2vZZPz8/NauXZvmXNWrU/3F9UdeHEnx0timTTWJidnp/bjHjyneqBaxf7+Js5JTcwuZhRh+NFw+fDe7m9h+qCKvuFffGWDxoZ1OeKXl6+srRle6yD4+PvrixYBBg6j8+QXXb3mvXuzhw7MoEshVmCqMK7OXlxcsFyCz4/yOln6kjuWp8nDGTtIkZXyXnqqZGUK8SgCCn406i2/Ys6ccsz+hZUf18CHFo2qqVCnBi5HjuMuXLwuJp6ZMmYKO57C2bAjdgBCWnA+vN7TpTEaCEe8oybJ3L4v0sEhCYeAQohg6dKi3vT3Fe/8wtWrFv3xpohaOYaiSJcm+o+PU+ANgZQywMF2DLgVLGvSpR5Yed3dV9uGCmud+jXF11dfSlCb5Rm6qbmZfy7x5IbopLXW1YHCpPk1RL3kvQnfE/qmvBf12X78WbxKq9u1BVNwTCUjaim4F0q6oruQEwBpgd50wxb9uQDdsSOri5ib2J+OzN9y6dUtfy5HII4RAK3CU6cvfzZs30clUpAX3G3+dcIHvA7DgqerVyRHttkWt6PTxPpidd7TfaKjj/oj9WdYytlUr4i+v07MNlQ11nbpgea3OVCfngVj3tGVr7FiXkiXhwenTp2dow0eKzgNtCJdM+M6dGEwwTifDAZbQlND1oevLyMvgsltfWX+XcpeSU2YfYMW/fs1YWSHgoIsU+WpnlxIRkYUWEzAWbHiSGCsLvS8692dtvpw9G4XRhbVr048fa6EPSJPxmwq5rdNBPxMnksgJKysaGb1F5issgu1hzpw57u7ugj9WUpKmdm0yIDduJOEm7LlzMktLKm9eVfo8cdjxDO+4CT/OHRdaWhIzm49PIuz0ixYtEpyr4Ohy794971hveIFc/pbX61kAMErgbYTZhNeRJ0+iQ5juCmyoX2ScrLe8NyZ7+UP5B37YR9GHWHPl7UTh3t9n7m/dupUE1gwc+JZf+vTRlW5JCQ+PPHKEhlWaH+RrxpB2z+1neeb2CrVK5e3tjSkaZ82apVQqz7JnG9INBRuSc5SzkeQNyanJY4LGwDcLUAVcol2Eunz8yJUrR/HBHAzn769FV4ULc8+e6R0fpHNE3o65XY+pV+1BtQ7dyBVeja01WrAtHMMc1clqU1qMD4AldXBwUJrSLwne3srGjclL5skTum4dZkTIwPTOJ4ij6tXLZu//zwEsWLthxHxM+CgBffgL3Zs3zQCwVB06EPqfR4/0tbSRt4EXuMReyr6WqVPJ0RAvCMQAq107chzUY860kRNH5tOsxIUX5k1DakTdwvJYTTf+WXjWWk5Yuc+x53ICYLVeSrLs1X9pTbdsSQDWNy4GHTdwwkL+IX2El/YeLY5Yv5qwTUxf/t6/fw/SQKauChCO6a6+/yILTw0ZQvj9tlj8Fpeeahn53JvcJh7ur+NfZ1lLPz4ZBevsnDaigqcKiXegPI4jKXSqKKrorsJ0gwYvChQQRVZKFtiJMRNfxNnz5JLXxmbPnj3w4OHDh6W9ozQxu8N3V1VUxQ2gElVpg3IDpaayDrCSk+UYJJgrV8js2clBQdnpFyMY613CO3ht+G1677OXL1NlyojO/VkbY58/J9avr8R0KIJzDByuMNIF9j+0/h49yqIzusA8KTJfYXn27NmECRN69OiBm+KAAQOgvwIDiXP65cvRSBfk++ojRjsyy5cb3KL27/cpXKKmhZuFhf+McReE3N69evU6cODAly9pnqPzOJLuqeU5i7DNm811QYxEOXSxYrC5GpmVr7nX9SmyIxSTFQPwkeZyznmXpcrC5zACv//cB1A7jz89jmnRwq9hQ1MAPRmfXl4Hjw7NxRPaOwwkc8jFygop0adMmSI4jwNkPKg8WIPSXtU1Y5u5xkjA0HhN/MAAIqUIXUSIRBHe8Px5FeDmPHlkLs3HI7pSPXxoqF8SEhLOnz8PqygOgJUrV8LLcByHdrU+a/oUp7WZdnLJcnXmOjuyjj6cwch0Pz+uRg0C74YOVZjeL5qEBBLaz/sIqtq2TTQQy3aIPdSAbgC/FZipQsf/5AfAMglg4YmcTqQloA+fbPzSJTb7cIFt0YKAEh02DhHEOcOeyb4WTGx54kSkBMDq3JkArJMnRTL14V2a31I3tRBErVuU/G1jwkcJSNpd3h2kHWOP5QTA+nnJNhDe8dVvNI9WRbFRvr6+mKpTUktkSiQevDIMJNQ3VvnqhCu6ubnBJzN0ruG/J8BC3qDRFmtFEfs7duyAt6pyoEo+Kl+CJiFrWlQqlU2nTjbW1l902NpORp4kmZQCBuCfk4InifJKpURHy3Ln9s+Xr7OtrY2NjdKwDxOs53jM/fNPFg7ZmG5i+NChAseEoZKkSToReaI2XRvX3FJUqSXMks/qz1kYY1+WLNHSIxlIAJzZTgGMpb2y0cFYiZrEsnKyGVeQV8hYC8OwBw7QrVppveyLFtU/92dhjEVHpwwapCXyGT9em1QTJCNdC2h5dccbnXbWrdN22XPVc33zlVBiY2NdXFzwfhxdZJYvX/7ixYtffyV9OrvmHmIea91a8P+VLAvGe5Yvf7Jdy98ErHby5MnIyEiRLv8pw0u/JO9+NuK02TzwNBqMzoG9P8FAkpNrqmtlKGI0BbTxlHsqEgjLGmaqeMY9+85zH04Cn3/5Zfivv5I0FQsXajQaU7RcZi8jQ9X8u5N2jhgxrH17bPa+7dv7v3ql7wXvFOGEwUAkuQ3X6Xnc87ThlBKNzsql6FJwWJWsy5QpxBpa3eKud+nKKg+PDPslJibmyJEjCNxhOOFiu2TJkuTkZABzF6MvDgoYlJ/Kj+8DFekl73WYPYzuYrqld28MgKV0MZKJfRHr7q7gPXrpokWVO3fqin3HvZuomIgBAQ3865Lbx1y5OC+vHwArcwCrvJwE8QUkB0hAHxs5n8nIDAALV+EEHZfYtF1c3hNe4Ah7JPta0MJx4UKUBMDq3ZtsA3pxXvoXlMKzyAtw9Wq0SAtTvTpJ1UJLQNL+8v4gGjRetwAAgABJREFU7QB7ICcAVully0D4sLdT5bwTGHvihK7Ae/fu4cnMkBY0hPgl+pm+/IE0kAmShU9gRYBP7NPzEXw3gHX/HjEYNLa4pEkfNo+eyHXt6rZgW2RZC6AcYrFr2zaQZ3LHgi7tABfIYqSJLUbzPGeJPmkr1IMHmFh+KA+V3rx5Y0j+2rXEfNWwIY114bp2fVCkCLIAmLJhwDkbdrjm8ua44BamCk9jphknBBFjjitX8FIgLn14dnY3v+BgEcb6Pfh3PHwbyjUkOCcxs2ej1QrZC+nq1dkrV8wYrbZli5bIp0kT+tUrcrelevQI0JWvRe5mBa/D5926pW1Xw+TD9M1X+sXb2xvGvxDi17//0KpV9xbN+/x50Zr6Qco6zl4KB4ejbdoMwqcGtW59qFIlbvp0TYLYxTP66lV4482jCDKorKiMsRRm8cDTxMWhwzuVP3+0jouP4EWQV5YXE+cZYvJDV/HmdHNWzX63uc+9f48DzLNx4368M8DevXsz1PJA9aC0Z+nKByp3G99NiBvo36vXsDZtbpQoIeJyE+oSp4lzCHMoLS+Ns6x/QH/vBO+wlLC2qrbEVUte/n3Ce0N18Zs+t47FTeL/1/ONif0SE6N5/Tp48WJHGxtb/pq4782boT4+iUICqPCUcOiX9nR7nE3EskgVg4HqrHJWqQmUX7OGQRd7kau06d2REhoaOGSINqakb1/1588+nM88Zl4hqhAGNcPv7k9+Iatchw7Zn5X/cwALrZHQkRLQp6demExW4QLDB/ElymT6WgbKid11H7sv+1owi8X16zH6WhS//Ub2AL1o7bp0XZGLvfDs8OEErp07J6aQwUuW5AAJSIpr9A52R04ArHyrCYvmQl87Be+erEyfVh2z8q1bt86Qlp5qAmSvRF8xffn7448/kLZA+ATkwyfHjh37RwDWVx+VpYV/PsvPSHAgFLzNbD6h+bTgaVnW8vTpUxAytkUL5uef9U8gAEzPRp1Fr/N0zlJ8Zi7FhAl4TanrAKdbZDKuTBli6jh1isW6hO/du8PKCh7ZpsO+a0qLXWQvYsA5CRGX5a1GVXPhXDIcY4n+/hhmFeboaPZ+0cVY+zgHYuegCtqHkiRURemiiqT02dBSUtjTp8kh4RsVNVW/vnLLFn0SYLOMMVdXVdWqNJ8GQHbyJItWt2mlNsInFfI8//jU2xTzlX4JDw8/d+7ciBEjcOfu2LFLz45z9DlN1CRvoz8AAgxl4DfRkW5ubqEHDqAvNtuyZZIirX2SQ0LkPElp2O5dLdmWgrnUXCEOcMRVfCOSFeLIklOT54XMwxH1O/O7AJ70C2y9FSjCk7lCueL7zH1AV9praN7v6t27d8gLevXqVcPGy+gzN878Ov1Xaxtr4RJ2zZo1d+/e5aAY4MvVrUtESoTdVzvkGQZkU0pO2LOqKar5J/obqouSzwV3O3e9/HnJleSxY2ltyHHqt2+5mzdVTk5KwENz5oQMGBDQrBmLuZ7wp2hR91atfoPfwifwf+E78E34PjzlcMJzisea+r6NhTzdpWSlanz4JddAR0vLdOqy1i+RJ07ACedjfotlC4qV8CmCKrrLu+9WkviGpq5FSBfs2vUDYGUaYOWjyFFJ8mJl4EAyAvbtMwPAkleoAD2UxHH6WkYoRhiKAc6sFltbjvfKj5UAWKNGkSGydatIphXNk0SoPPS1TJhALhyPHhUb8HGj0mU+TAuUZQgt/kZmo9kBVlycBv0Idih3KIYOJXVJb9Fdv369ceiz6Msi4kIRusH05Q8ToIJk4ZOpU6fCJ3fTB2N+N4AV/+pVDYs7PHVIusiDqKgoeKsO3Tr8Gf5nlrUggersxo1llpa6xIy/BfxGrn0jj3VXdxc50ad+4+xg9+3D9tcFo7pl+XJy0GzePC25UJJSObZ5c3jkuWF7kpG63FHd6afoh+fLilRF42NMExurbNSIJADWMc6ZsV8EjHWupUUeX/JKp6PI3dbgwMHwbxvOBl3WAD2Ebd6MBmAM8oJjj8rFJZsRkRnWxcdH3bWrHDNfzZ7NnDnDwj9yW/iet2gh7LImmq/Ep//ExKstWvzesJW1tTYGcMyYMadOncIsUp8+fXJwcBCct5o1m1ijxqVPn7RrYLynJzYFXapUzA1tInboIOKcZ2ubqtG8iHsB/Zufyg+Yz5wxpBpN+O7dQhxZ4Kt7yOECG4EpJ8PzqvOI7PFQmqNzX4Su8HH0UrC1tRWlf0lISACAu2rVqjT+sC6dFi5eeO3aNdHFvZGcBLolKDlodsjsXBQxHRWni0umsdJ61x0+jKcFgCDr1hHnv4IFZX37ytu1k1tZ0WhDlfzJn5/6+WcGtq2ePbmOHVU9e6rh3/AJJhGR/Mlb+26J1XMLPrMSPivhWX0hs1B0pZvZTknSJG19u7z863wos/WDitcVV0nEJedFwNwrUiX9I9APgJUBwEpJTUGQLjkBRowgl8rbtyuzv/zRfGBFSqgEgcIEBXEstVfaZ19LmzYqpFeWAFh84ghlegOPWop7XXgWQ7737RNTSGPMs65tX3h2GjMNpK1mVpt9w1AokiyOdgThp9hTirFjSV3SEyj8/vvvxqEPQAR4fETgCNOXP5AGMkGy8AnG631KTz773QBW9NWr/S22Q6ccOhQhEthhEIm+uSe/l2UtyCK2lg+GiNOJyd8eth3abWTgyNyy3LAJhaaEpjs58PYG1fPnGEy+VQ/B8xs8h+4+Fy6kXawgu0T3Dh3CXVyy3GIunAt6mRjnKAriBwxTp06KnruPuQAWaYpAr9JvSLT51G1lcDsMSQ4pJyfza7vX/MBRo4T4ebpaNaWdHSeVACQnABZaEezslHw+Ui3F+tLZn4Vd1sP7dqbMV0LBvO9UlSpjRryoXn1rp05at+Xu3buPGjWqM087xGfqnVO5Mrk8OnCA1a1LSlhYQN++Mh76fV2+POr0afSGEWxa44JIEuh+Af3MCbAQjvBxZHdqWFS/xychlv/0NO6piZLHKchb/UL/wnBMzs19AV3RdeuKvNrRUaFXr15yuTwlJcXT03PLli1CckZrG+vG0xs3PdnUS+aVYXyGfk4CUfGM97RirAylDsTgDKSWVa5YgSMN6Y10f0qXpho1onv2lE+erNi+Peyvv6JevowPCEg25BoAn8P/he/AN+H78BQ8CxJATprYfo4W1xrk8iwlfNCYbryWWYt7mendAYcf5yhnZDkm3fqi3HHr3GhXJklI1VwBHzKpvYf3Ncus/N8CWNEp0ciaKDkBJkxQ8LRSZgBYeGBCrh2RlhkMCZmxY+yyr6VJExIW5OUVLwGwZs4kc2DlSpFMzB6o6zIsPLtw4ReefjBMdMGBQViSLTaPIZb2JcwSs28YL17EwXRCki3m99/Jfrl2ra5AXF9EOV91JbyKf4WJOExf/j5//owL2Teg4KP75/cHWOH79tlZjIfmnzIl3YILoKfR7EYkWc3jh1nWggF9ewYOFOV0wgBMzMX7W8Bv6e7dKIqsRGXKwONXrlyBxxcuXCjh2ryA4Vm/5bp10X6/QYPg33/PTovtZ/cb5yiKOHSIbCSFCxsJH8s+wIrVxCLhS8eLRXxza/2xUqKizl4kR46CHyzuWZFZA3gi5tYttSn5TXNgjF2+zGL6r7JlZSpV2i47+EBxJHzKnFH58WMZn+9XdfXqhw9c0aJUrly+mzb9NW3aNMHpZ9myZR4eHngVYGMjl6iLRhO2ZQumoidBaBYWEX+mWWEDkgPQ7U83oM9cLXY74kaxT8SHut51i5d9myeakhMN77s5GaasmM/Mz6G5r4uupMhsNei90Lt3b4y8wzJ16tReR3rl88xXWVH5DffGxBhYyZwEJhaAILJixdBJQMdRVVm3LrVmDXP+vOrJE07UrtlsMZAGMkHy2rXKOnXoo8cZZ5XzMPmwYlQxIfCwPd3+SOQRXbcfQ8U1xrUZ2wwfrEHVOKQ8BIhKdfMmhWbm/PmV69fXcidHONfL9j8AVqYBFhwxCb+tvIxkd86YwfDE6Ex2J7NGg6c0SS0LGMKBuYhZlP0lA2lpfHwS9bVglkpGb/9DA4BCLRHgitkw1q9PZ7EgUWP8diVZl2UM8UOfw8wx+4Zx9Wq0xVPiDPSae01ScEBdli1LC6L29tZnTxBpATBtKbPMR+UzzqcnkoC+I5ht1N3dXd+P/rv6YK1c6WzRnPdZTmeuvxt7t8ZmwqV+4sSJLGtB97Jzc+cS95QpU9JQlCaxIFUQ1yAkv0m7muRNDvJu3dQk/7wHceEaO1Yk9uNHLVG4i4tKty5IgHSqXDl5+fKppkVFGSpGOIriX79Gu1HUmTM51y9QRgWOgneoydQMCfJDfyx5qVJ0EeK6MdCBNF1Lj0rxDJ19O1k2x5i7u6pSJer+fZWwyz60rpHbl/AkeXjfzsTlYHi4olo1Mg3nzdPO/WVk8WncmAb0eOvWrdGjR9++TWgtz51j8c7o5UvOUF1iHz2ieCIjecWKov+1LYzEDtekajIcY8YWcwxzxNzSA993/PxzJck4MiPliuoKbOR5qDy6rCjmmvsidCVZl4SEBExsj9zox44dY1kWKUBL0CW8E0wyjhrPSZDxtRrLUrzri7x3b+PRo99htYQt7DB7uJe8F+5o8JOfyj8oYNDF6Itxmjh9mR5xHtacNX4T8KhThJMuzR4nkylGjkTTWOdD5D+HmUM/AFamAZYySYm8PtLQhz95L1qUXYCliY0lB/2CBSW1rFCStAOzFLOyPzSrVCEmN6UySV+LkqeBUaTnF1CpVQj5JbXY25PEOytWfNVVkRwSQmZUGWlIupZZi46iZp9mhw5FWHwmMT5ytZzhg+2FlR0KLOWSpKAiIVYKcnP/OfGz6ZN5xowZIBm3ipMnT0rylX83gBU0fvwHi4K5c/nnyUPFxaWBko2hG8udLofvlmUtCxYsAAn3eXsP27Klrhw85BWni4uwacisWcLVgEwmw7shvQYkY9LWNl1wdXR0dJcuXTp37vyxZk1yI5me1iuzLWaIoyjl61cEASEzZ+ZovziEOSA/EGxs6I8l5xmniDtRx47chSOV5ST6fVPYpn8cYOmXYT4D4N2GbDLISi9ZAnmfTvbXX4XkQjStzS2mm5YOPqxWjRYdU6Xv7N69U1StmvBOzBwG+L4OU8dExwNTWixBk4B0X3DcWhu6VpOq0Y8jM0U+ukPUU9aT3L+z3C/66MpQXf7++2+AVq+/EY7AIoBMNI/jHqeaLyeBQYQdFqY9SLRurTY5QeR3WC19OB9H1rEz11kIPISFC3ocTqHI0fMh4QMmIIaf0vLSMHmxB/VFIT3vhJUWhq6YfgCsDACWb6IvMthKQ58VxF9v1ixFNgcNLPToyympZZ1yHbzDZMXk7A9NjMsICUmWAFgbNpDlY+JEka0bmV0ktTg6Etal+fO/pDu1KJVEThVpSLpZuZnkUVGMNfs0W75RQRxRPxcm1rjVqwnAmjZNkIYOQJs2bTKupY+amDrgTGP6ZN64caOQfgfki1LxfGeAhfkAGlh9hH55/jxtWYeDWpEHRdDFOMtaJk6cCBI+vn6tPQwkp42iFmwLYoNhW4pqgZSz7MWLKKF3794g4bPO/vTuHYcMywKVJRbk1Jg/f34IbzDTTa2YtRaT4CjiOHXPnsQ/rFUrfS4AM/aLW4xbbllu2K11A1Tjnjxhfv5Z4IO4E3sH3agxyv3fA7C0wYOy3A+ta5jOSh915gyasRP9/HSlYR6kqlVphkkHrxs0oIV0Olmoi2uMK4nHpIq+495ls8XeJbzD9ACFqEKidQDjyMjgr1BBn5BZv8BJrxZNHHcWfllorn6RRFemtNjxyON4VL4UfSmzIzkLOQk0cXFInQ3vqfbx+ZccFcSrZbLaMcwR1y78KSsvC4AYgRcch+y+2kWkZJDFQXXhwpr5ZMCMUYz5AbAyDbDeJrwlznHKxtLQhw+ImDw5uwArSaUioKRSJUktW5Vb4R1GK0Znf2gWLkwOi7r5ZdMA1rZt5B1GjhQd/ZG5UVLLgQMRIG3atHRTLtHXl4Cb2tKQdKdyJwgcqhhq9mk2cgXxBCr1thoBWDw1ADN+vCANEzCfOnXKuJalX5aCkD9C/zB9MoNMwWo1a9YsSSaC77Zk4JFx3AAf6Jc9e9I8DKooquTyyWXb2RZKQkIWiUbRmSMoKAhju3SJZE9GngR0Bb9Fdll+a87NyWS6EE03Vh/mDrxqjx5ibkD0ILl48WLs/ftkZa9XL/stJuIoYhYtQlOriJTVvP3iwXmUpEuC3rWha41Lnh5M8sE1ZZsmahL/PQALgweHy4ebvssmKRQYR4zOUul2I5U2vdiaNQx/HcnlyUPlyiW7dUuVzbp0k5NAv2GKYdlpMUDASFwJ6Mor3kvCo+jFC5pnhJZZWpLzG5PB3cVtFQkOgA1bN5VtlvvFELrKsMVux5DXICllw/dmbSRnDmOlpAQMGoT50bk3b/49tlhDWnwTfdd8XSO4seemcs8OmR2UbGoWh9PsaXiqA93hB8DKNMB6HvecxGSqWktDn60EYI0enV2AlejvTwBBenoh4Vlk2hisGJz9oYnEOikpElrYvXvJfjNokK5AT85TP8o97VR0PBKkjRuXbiAmvH1L5mFjaUh6UHmQhHco+pl9mnWc70L8EN80J3XZsYPUZdgwnXCECcTFWy85g0gI8pIPDRxq+mQGmSB5Im/5Qwjy9u3bf2rJoPlso3sd1Lr9AisF8i2NGzcOXs/Pz8+4lgsX2Bo1qLNn2fRRZpwtT8WelJQUwPu5Z+i0RHyc+Vy8aR54y5bBC/z111/455s3XL58hBpAlM2TZVmMSAgICNAkJWGlEv38stliuhxFJC8eTIZcuWLv3Mm5fvHj/JBffkDAACMZ3AQXwBoMyUay6uuqfwnAEriv4B9qA6z0+psrmi5gkEhqOX2aRc6tT5/UzZoRg/qkSYrs18VD5ZFPls9SZnmDvZGFFoPGnxw8GffXCvIKHxI+GGwxlmUWL6Z4d3uMIzOuBXqTrEtMDSREzUK/cEql6tEjpYMDxZOg6qMr4y32Ov41ElYt/7o8OyuMSb2PjgF8vBRdokRCZsJg/0GAJRSXGJf6TP2bMTczpeUp9xSatypd9QfAyjTAuh97H4lqpKHPbgKwBg/OLsBKeP+eDNyGDSW1OCmd4B36KPpkU0t8vAaZRSS1sH/+SUBJ+gi4J9wTjJ6Q1OLsHMUneApMt60+f06uXVpLQ9IT7AkQ2FXe1ezTrO6cPwnLpRdx8WEPHCB1+ZYlEMBBt26ErVj2zZRiSMub+Dck74GygemTGV2LQL7wD04vBOz7LBlaT778+V+9iudTQ2gNMzdibmBqi7Vr18Iburm5GdHi46P+5h0kq16dWriQefqUVAfjJfv16wdPha5dS67tliwxXoWwrVuJO7xOgmfM2LN37178c8wYYr7q319svkIiH8CsWoA4ejQhlnRwyH6LCRxFt34lJhaSxjXH+oVTcz3kPXA4RaVEmSL8cdxj9Iy+rbr9b9iWBPOV8Ik+K72ohPJ8koqKFZO/pQ7UF9u+PTFidehA0FWFCpSfn3nmyxxmDkknSjcRhTJk2GIv41/+zPyM/km7w3cbgcJpprj0cWRGoj4TNYlNWZIMY3rwdBPrwnl5sWfOMHZ2isGDaWhtHZ4owFj66MpIi8kSZRjeOy5oXPZXmAx7P/UbsTBVoACcr1L/Zd6EOaSFUTMwbXPLcusnm/8BsDIAWABmYXT2UveShj5OBGD16ZNdgBX/8iU6hEpqOckSs0oXeZdsagkLS+HPjrQ0wMKAL1tbXYF3VXfJDkE3kNTi4kISs/TtG6ArEO90OBtpSOqscjZkTc3m0Cwzm7hw9vswSv0tsbn8mz+1l5cXZlzJUEusJhamSl4qLyyLpk8zkIzUyfB7vM695HdeMhIB4llYMNWrA5LOl4/cvERFEVvl2lASWLDoyyL0wT9w4IBhsMg1b042v+LFSaC+wCjTuDG9cOFjwYULc5Wou3UzXgU0dEXqZLc8c+YMCFm9ejXAuO3blbwJSYYATrfY29vD144ePap16PnrLwLZ27c3S4uNo8eQjOAuFv7dbE0JTsxyvyxkFhL/WVlx2ORMl7/wC3mqFl1LP6Xad96WROYrQYuRXZaEZObNK7O01LULSjiluan4FLoyEaN3Nusi42TlKRJH7Mg6mthiyanJ60LX4fVZY2VjDEEwscV048goKytm4ULW0ZE9fFjl7Ky6dYuDYf3unVouh6feJ7xHtuo7sRLm0pTISDiURhw6FDJrFmdtTQvnG+HH0pKuWlVuY0PXrq2fK1ayxZI0SZ8SPjlFOJWUk+vpHuoe+pHRWQMlxjFW5PHjyNETfenSvwH6fDctlanKIjruHwDLJIB1MfqiPrtPGvQ5SczdXbrIs9mdsQ8fElBibS2p5QJ7Ad6hvbx9NrVwXBJ/ZJRLA6yLFwkoadtWV+B11XV0W5HUcvduLF99TldgzM2bZPftJQ1Jr6muEW9ouqXZJ0De+fNB8gwZIYAgF0BQF2trFOXi4gIb9ty5c03RUpOpCXL+j73zgG7iaOK4bDAdQid0CAlgeu8dTA29BtN77x1C7xBMqKbE4NB7M5gSY9M7BEyxsU7S3elkG/fezTdzZ4SQpdOpOIF8e4/Hs2Xd/nf3NLs/7c7OvEl6I93MoGTBgx7+X7Ro0b81ZMTfuoUg0rw53F6/Pn4yb93CkP2C5/6JmBNCrpu5c+caVFGpMpYWypalnj3j1GoNzBQDByoLFKD4SIAYlap16yl//BEd6qvC7i1eXLwJQnICrZvz06fcsmW4NNW8+Tjt/OroqDAGrP7+/hkzUEwMRlKwtxffmJDYS+/GDinrjeIz/Sdm3XP5g/3DTm4HX2qPscfMKj8hPcGRcYTqTaAn/LvTUublK82XUen1Ztm02Fi6cmVc2pw506QKfMbgGZQuTdm2LULMs6JUUT/OtGO1IlkhZNCDJwVfP3RzdUjvMTxHJhzTMPKPypFDWazY/MWYvK/kk5z+g7sHjxwZNGCAumVLMFV0Z9Qag/aWQoVgHFaNGsVs2sReuiSeIimD9lI4zzjPjREbhwYPrcPW0aZAFnY8De5OWgwlxhgrztNT2DmN3LHj60Gff0YFZmfoajB2AljmAdah6EPoYB48xDD6nMRprEULawELPpoIJZ07G1QxSDkWqMjlyVDbH36gDQOWhwfOmvXqfeGOozbAdtp7795N4ONDqr/wZuBBLbCvYSS9pr4GBdZU1LStAURHp8mW4crEKgaz1qj5rL2Kxo2Fonbu3CmktJOiIhzQPRlzUrqZQcl8NGoMn7hr165/a8iIOXoUk70MQAey8eM/8DkGMAasECtcSCcCNeyr82g+H3FguI4dccumRAnq/n21Hnjt28d27OiO6aKrLhF2mTs57N0h6xyrNNq0FJUqQGZ3rWCjXbuievdWwlQKN+bK9QgKadq0V44c8jp1KKCr/fv1F9Xv3bsH7+nfv/8XvcEf94v+tKZlcY8JjobHmjnYB9hlUYwiuLzV3nmpvNrAAeZKQK0Ez+jz6vP/1oRhcPlKVyXzLPth7Fj8tVat9MREkyqXL6vLl6fgf5u3pbGisZRAMFuZrfkV+YUQR17xXtb0GPPHH1TVqipnZyV8HenaVQFfU2rXpipWxCzdn3b3/LPJ6p7Cn3pvykRgOXOydesGDxsWsWlT3NWrKRJizL7n3l9iL21kNo5UjWyqbFpQXlCvUEDGinTFzprO1Zhql+Iu2RxKMj/9xCdPFHnzwithCxd+Vejzz6gMVg3GMCvMOgJY5gHW3ij0fxr7Yaxh9Lmk1k2gZvHjjD17VtctVE/F4D6dBSq+vklQ2xo1GIMqnJcXWrujo26BBl2mPnssPUNfn3r1vohpGX3oEJQTPMQwkt5S3xJ2QGxrAO/fJ8u2dYWSd7O7EbB4YIVhTte3+vjx41JUFoYthHKWhS2TbmZQMpTfq1Ur+P/ChQv/1pARwZ8DDZkxA27fvx8PeA4aFMSmsHi4UoERQNLT07t06QKVjP6UECbDoUSdkVWzUCHK29vwnLdjxw4+huqW9u25TzmI5QXyvh85MvjGjXjtsYnExPQ7dxLWrYvoVPfpd7JnuqP+d9/JnZyotm3bt23bNiDA6PGrbdu2gdDWrVt1e0MIth7Ie4BZ3GPqmzeFxQZm06YsilGEK2Sad0L6zr6qvhY//Zk0LseWV5SXc/J/ZcIwuHylp6I7y0b/+afgeZOUKRzlPzz5wWgp7PLDUGPsAXVXdRc+lQOCBuhldrK5VQJupgYHJ79/7/v8TO4AXFg6dn5KyNSp6latwpYtS3r7VjfciTEVP43fEmZJA0UDwMdyinJChk3df0WURdpwbaaGTIUJ60HCAyk+f1Y+F92nn/D4sZARK3j48K8Nff4ZFSFWZeZVZwJYJgDr98jfMfJ4yDTDxnxDLQRxsfJxCmFjggYPNqgieJpXoipZqSL4PjdsyBoGrHv3cIisWFG3wD3MHpCG8cigytu3SfwuzxfEFrV3r16kb12VR9wjDNxKlbWtAcCkLjuC31xPshifBvMz8JHxhKKGDBkCc/a9e/ekqByOwTO3/YL6STczYdGlPQ9Y95o0YXfv1ju//c8MGaEzZ2qdwf/+Gx/Njz/SayPQNa2ROsO9b+LEicI5R10Vwdk8Xz7K09NotGXBL+rgwYP8XamrWh2oKTunk0pMAZ+runUZvSSsZQq+cnYOWr+euXlTLXwzHzhwIJTz5MkTY0LDhg0T3vDFaK7RyO3sqNy50+PjLesx7v176geM5KQagCFCsiJGEa6QadhWCkyIWUtRS+tEZcHTpzm6hqIG+iarhv/zE4ax5avMKtpZluJT2UT+/vvXMPkNUw3DlESKVplLPqk+Kfhp5aPyuUe7/8MT+bZIPA9eQlkiJDXEpMpT7ulOdid8ABwVjnpElUOeAz4e/VX9f6V/PcoefcG9+Feg5PPT5xfqNJ07p6ekfG3o88+oCBNlZ2VnAljmAdb6CAyMOT90vmH0ucPB571SJcrKxxnFn+D7MHq0QZUn3BOoQ2mqtJUqPj7oMtWqFWcYsJ49E2Lo6Rb4O4N8CZZsUEWpRKeuChVUugXCIIvrKNMMI+lL7iXGc6OK2dYATp2KkV3Fc0A31TcRsPiTjIry5fnNL6ZDhw5t27ZVGYomnLmoF4mYHb0qXVW6mUHJbVu3btO6dfvWrd/zHhVU0aL0tGnc48f/5JARNHCgNnpCSkp67twU1KUxjV4mzdXNhWI3bdoE+HLu3DmtysSJNL95Jz97lhUpXEhcc+HChYx1Sv4Ywb2uk5ctC/vpJ1o79tvby2vVYiZNCtnx48w7spLxf/2l15Zp06ZBOZcvXzaoAuQnJHNMyTRSqxs3BoHY8+ct6zFlt27CuXrNp8xnto1RJFzCwhh8vHUTvVn29L3UXg5yzExwXH38H54wjC1fGVSBWVaIeqUyktHon5/83nBvhF0zN9ZN+yKtoeHpCKTSUNHwofrhPz+Rp39Mb8u1Nfb9Df7qm+S7K2pXb2VvGO31iKqaohpUe75q/i31LSGQ29cAJfj0+VSDisKF02Jjv0L0+WdUBNcXQOH/CGDJdC4pr1sMWMvClmUOEvgZfZ5wIq6a0js6cvt2hJIpUwyq+HK+uAhMFbFSxdMzDmrbqZPGMGC9eSP4V+oWKARe14tRq703KCiV99pR6hYYsX49OrrON4yk/py/EHPZtgawfXuk7Amel3nFvcK2vHiBbSlRAtfMHqHfz8CBAyWqJKQnZJNng6nXmNOrwXL6tGwJKgN69WI2bIBZXIsbSicn9vDhj7qRx7JsyFC3aAGi8T4Z6ZybNsXl1WqvcWFvTcQa4cUzZ85APX/77Tfh17lzkY0cHKjDh1nxwseMGSPECM3YCuR7mK5SRfjVzS26YUM1PIWICGxpemIifqm1t0/j9yIzr4QdOHDAsG/4H3/AXxd+6cYhXMLx7+CRIy3oMXrZMvw8FCjA3f/imI/1MYp0r+3MdowBQTno+U5ZPJQL+w4lqZJSXLZtNWFcYC/YUXbZqGyZl6+MqSS9fo1JbIykyv5XJr819BohNJGwjuit9q5GVYNXwK7n0fMEQPlXJnJVikrw/ToacxTtKD0R+H5dxLpumm5CQFrtv+/k3zkpnRYziy+oL+imgv3aoCTp7VtV2bK41/lVos8/owIWKsSn/S8Ali4S6bGU9mdbAda80HnQcRsiNhhGH1+O3x+xFrCEiEGhOse7dFUCuACoQ14qr5UqZ89iVIXevQMNf2goSs7nXNUt0GDqwM8Lb1EY96FAgS/iPoTxk1n4csNISnO0MAnZ1gAW/fpB9t7eLsA+47udnx/vIlQAp73t2wUPdOkqlWkMDikkLZFkZjQ9okEDUBnzKdGQ+uJFVd++WhdXumLFiA0bUkNCsnTIoPktsOSAAKGEadNCsA9e44aINlLA8+fPhZyM8PPWrZHwhmzZ5Hv3MiYLFxLHvvyUCS49KQkP5Nvbp8fFGYBUfrtZG9dNtxwhZ9H69esNqgiJHc98OuP9xTjOfwFQFitmjFaNcuf583i4yc6OzUR1FsQoMqbiqfbMKUcPmw3MBlsN5fBhrq+on3kJOYsmDJjFAT6EDMcVqArf9OQHXedI4WFMaNEqZpXwaCpSFS+rL//rbdkfhRH7cslzNWIb6R73QyJUlXMOcoavtTfVNyVG8/p2oeQ/piIsmuola/ovbBEagyqJjCX+tikhU6DXtkVuM4w+AQhYefNaC1jhK1bg+YulSw2qwGCB8fvl2axUOXIE44IOHhxk+EPDp+uBeUi3wAX0AnRBo6cZVElOThfWP3QLDOUTLQNPGPtoCiN45lVuawzAefobZNA3RbSbdnK+ZvDj+PHjzQWsVlwrkdwmBr2nx9atm1mFe/2aWbJEwacTFo4LBTk7A3xk0ZBB5coFKlri+fPPaFnhxyBcQFFAGzsxIiJC2INzc4u2s8MT4i4upumK47gOHTrAjYxOVhmmdm1Mw/zggYEvDL/9hlve48ZlbsuFCxegnFmzZmVWCQgIaNeuHQjJ5YYDR6lKlxYWsQDiM/+jZ8828G/iRDl/uEmVKc+38PTFYxRJfC5n2DPCsUFb5SPT3nuXuwszMZR8gD2QpRMGlF9eUT5jmqfKXWQvfuuTHzwUYdgUGuWsctY7MfAvtqWSqpJQK3u5fS2m1qSQSUdjjjIpDEGfb1eljqIOPNCL6osEsL64PESvjs8wxdXUO1MN/vXixcv8RlCAh3XXIz5V+4Phw429IbscQ+Gd9zhvjcrUqXegth07PjP2hgAHB6jG5XPntK8MfITeGEMeDDF2C7QdyoR+0L7y5Oef0Ttn/Hhjt+R6jxPG6SunPWx31eh7Cn1fnlb43BbeF+rypUuCh/vixYull1bNF3cTqvtWl/j+2/Pn7ytValSrVqtXr878V6iD9/LlfzdqFPAp4M3rChXuTp585bQte8CTD/3lnzev9hVX1xuyFpjhtfqrLxoiZKHJk+ch1GXcuHtSCj916hTc0rlzZ90Xn7Vvjw968uTM73/RvDn86e6MGZn/dODAASFUROY/bdiwQYjUaqwavlWrigQcEvn3rkSJyxcvGit2+IPhGDzJr+iJKyfM6vPzl8/Puz0PuleQKexX2EoLNXiNvzceCi/oV/Co51GPLLhcr7vWe1lPaEKFNxXW31zv8V+5ir0rhuvlAQ5LfJZ8VRVb6rO03Ntys+/MPuF5woNc/4mr1XP8Wj7r9qyvuZJmA5bB/UEbrmANDsL4FodjDhsjWQcHPDZF05w1vBwyfTqewXFxMaaSn8Jte3/O3xqVbdtwS2jq1BBjKnLeXVE3+fl4Ggf3ZfQyYyr58mFoSiFiuHB9GD0a87zu22dMpQiFMfd8OV8bfsOoPOIYHt169TlKqnAgn5PLBw0aBNP2w4cPpasIoc9bcC0kfo+hZ83CfcBp08TbkqJShS1apCxRQpj1FXnysPXrRx86ZJPvZGo+ygZTrZq2hLS0jzmnYu7qMcwXvn0jRsyADilS5MyqVeESCxf82ABVdXsskk/4+GHCBANLTWXK4Gblu3eZ20JRlJBQKLPKvHnzhIOKxp5L1J496mbNPowbF758eeZ/xlawFFWqsH/8IfJcUj+mNlU3hY4aFjxM4rfYx9zjqfTUolRRgUvyUfkqKiqeY89lxXdlTsM1VzY3mSzLApX33PuJ9EQHykHw+FnDrLHtuvK/vrpwlbtalip7TX2NrMcQlaxWmU5Px1PJ9Oz/zgqWOFHZBLB6B/aGXjsTe8Yo+uRHwPL3twqwYM5AKHF1NaZSjCqWeX/XXJUNGyKgqvPmhRpTofi5n3vxQvvKcNXwzPHTdG8vVgzjJ3348DmUSxCfPiLmsFEkFQ7IPOGe2NAACg/H889Obz/nkKb4DMGqFy/atWvXvn17lmWlq7xOeo1xMehKEs1MxS/asZ9S7Jk4SZSUFHPsGNeqlYBZbIMGNhkyWD7KKOfkpFtI8SO9QGP63c+5cXx84qtWXQsc4+y8V7rK1atX4ZYpU6botkXIiaSXdBI5kmURHwsV0p4p0yute/fuUNqbN290X2QYplOnTvD6az5B7D88yPon++emcuMicex5EYm0j2mH2cNOSid7ub2AVtWoahuYDQFcQJYO5cBzwHAgt4vdZROV9I/p7tHuxaniwi7VENWQ19xrMsUSFaJisYoL64LnQ1X9/iOAlRmMsgKwOmswXeuVuCtG0acYAtbLl1YBVvDQoRio2t3dmAp8D4NqPOIeWaMC3/OhqsuWhRlTEbyF1A8+nx4aoBoAui6MizGVcuVU/ALe50P1Qga62DNGkbQShf4Hd7g7tjIAmMezjcbjYCMUoz4DFp+n5T6fJMfZ2dkslZT0lBxUDph44tLjpJiZgs8Qor5+3SwVYQVI3aqVbQBry5bMgf4KP8FQTxO2ZZwrfPw4MX9+xfffH4Q+WbVqlXSVY8eOwS2//vqrblvSwsPRsSxPHj2vcyF1oG5aAr3SRo8eDaX5+Pjovnj58mV4ceTIkf/WICseowheXB+xviJdUXtsvq+qr56/RZYO5b8xvwme0dvZ7X4aP2tUniY+FVbs4F8DRQNjCzxkiiUqREW6yln2rGBQ/wXAMkZFNj9F2JprDb3mHe9tFH34pFqPHlkFWEH9+uGqz8mTxlSEoIjGYhNLVJk3LxSqun59hFHAqlIFp3xvb+0rPVSYN8aVcTWmUqUKnvP38/ucGhlmVigk7opRJK2uQJ+VG+obtjKAsLA02eyJwomhz4DF57o/ySfJmT9/vrkqNZmaUODjxMcmzYyjaeE8nTbAkkQVITezsmRJmwwZNH+2IGzRIm0JQId2AfYyv+xde2JyJF/fpMKFcT+3f//70CejRo2SrrJ7924huINeW1TlyuFWoJ+f7ouh/Iap7jFSvdIWLVoEpZ04cUL3xZUrV8KLOz6tAv7zg6yxGEX3Eu45BzlrT3uVV5RfwiyRuN5j27ZUoCpoE6E4KhyHq4bvZHc+5Z5KVwFMHPthrLD8VlJZchuzzayjamSKJSpExdj1jHuWOcTjNwlYskyXwT/ZBLAasY2g1x4mPDSKPj8p+Ky6amsep4aPghh36ZIxlZoKnO9NftcUV5k6Fc/tb9sWaRSw+HNhak9P7StOSifQdWfdjanUqYPZGF+8+Jx9jGvdGqMxeRtFUuHk+SX1JVsZwJs3SbK1uNK2kdn4GbAcHaEaLosXw7S9fft2c1UE3zu3aDeTZqbmE3UrKlQwuy3p6UKExtSgIOuHDNWwYXppVh8kPMD52KPq998rAwKS4X94Uj17BsbGJrRt27ZDhw4pKSkSC1+7FncV3dzc9NoS2KMHfjE4flz3RXWzZvhhvnbNWFu2bt2q91A4juvVqxe8+OjRo39xkNWNURSTFrM7anctppb2tFf3wO5X4q6YSyQ2bMuf7J+VFZXrKurmkOfQ9eEvTZXurey9K2qXb5Kv9rio3pX6MXVb5LaCioJCkJS5oXOj06LJFEtUiIqtVGBkEKKB6B5W/Ya3CG1WrihgCSsZL5NeGkWfmghY165ZBVgcfyBLCHttUKWhoiFU44L6gjUqY8ZgAuB9+6KMAhYfLFt97rOvbgsFJgk/oT5hTEWIZnn//ueEbmyjRnh6/6FRJBUSjws5bWxiAF5e8bI97fUCNyvr1YNqzOR3o86ePWuuytpwzDAzM3SmSTNj+NRASicnC9oieGLFeXpaP2RABXBn9lOIdriAD6AJOX/viylryuBObocOXGIiTsDOzs7QLQqFQmLhgvu50I1frB0uXYrx2xYs+AyNSUkYLcLOLi0y0lhbdDcchevWrVtCgud/fZAVYhTlpHLmU+QT8KWEssSisEV0Cv31DOUqjQqGgsXMYvj+8538O13YKqQo1E3TbV3EursJdxPTM772eMd7C+MYZvPQdPZP9idTLFEhKjZXETaavDgvAlhSAetHGhOwvE9+bxR9GiJgXbhgFWAJX/r1IiTp3t5S0TIz6Jir4uwcBFU9fDjGmIqSX3xijx3TvtJA0UA8tke7dhgJDBBH+wpTsyYUkvTSKJJ2UHaAMuHruK0MAON7ndaPQaLku3RAjx7ime+MlXkx9iJ6zXNOJs2MnjPHWJglkyrC6dGIdeusHzIUtWpBUYmPHmlLGP8BT4D+uGa5MPc2a6aOjc1wlgK4gW7566+/JBY+duxYeL83v3esW0khSbmmSxftK1ABvcOMmdvi5eUFpY0bN077ypYtW/Sij/6Lg2x5OiMcVCuu1bGYY8npyV/zhAHfm2+qb65n1jsHOZdTldOFLcDEhmzDqkxV4dcf6B8uxF4gUyxRISpZpCJs+Oh+zyeAZQKwSqvwyBubwhpFn5YIWCdOWAVYbN26ODs+f25MxeBWnbkqvXsHQlXPnIk1ClidOiFg6QS8FjLOXldfN6bSrZsGyvTw+OwMTv/4I/rlvDeKpD+rfoYy9zJ7bWUAW7ZEyLzxEMB97v7ntrRr99bevm2bNh06dGAYxlwVZYpS8FMxaWYqfpuM2bbNgrZEHzyISb4HDLB+yKD4bPYparXe7nb5/if5dEYqIYmNcLm5uQHQ7Nu3T2Lh/fv3h/e/4I+X6lYymY/+r+tGFrl1K/ra8w5extri6+sLpfXu3Vv7irCiduPGja9hkPVO8P6J/gn+/xYnDCaFORpzdFLIpJpMTe1RRwe5w+rw1doFLTLFEhWikhUqY1RjwNyW0ksJYEkFrMKKwtBloalGQxs4OaFri7u7VfFjaD6CojZuUGYVg87m5qp07oww5OkZZxSwevZEwNq9W/uKcOLvNnfbmEq/frgqdurU51UxIdx2CmsUSfup+mFwfGabrQwAnfdf5tWLE6bs2vVm/vza6E3mqqR/TBc2ifQefWYzU/DPTn31qgUqSS9fYgCtn36ycsjgGAbTLNvbf0zNiJeR+jFViDtwwlPj6MhcvvzFQ/fx8RFS/kksXwjjLmTL/rKb0oVUr6nBwcILQYMGiUdBEzyu2rdvry1QyN7TrVs33VAaZCi3XiUiLeJg9MEaTA29hSvSY0SFqGSFyipmFQy5w1XDCWBJBSxhlopPjzeKPj3Qu8XVlbHmcar4+AgpKpUxFSFcwlZmqzUqrVvjdp6Pj9G2qAYORMBy+RyUwWDMKt3bhw4NhjL//DNa+4qicGGccUONIukQ1RCDKdssNgDn0ZjfMPv7nF+0pW/fQyVKwMy9YMECy1SaqJtAsT7xPiJmhmTj4CC3s+PkckswLiWFypkTPZaio60CrGfP9FaS3ia9xcDcqgoGdRmGEUmArXcFBAQI2XUMtkXdsqWuS7vwSU7y9RVvixD99fHjx/Dznj179FyyyFBOVIgKUfnmVP5k/4RRt7WyNQEsqYBlJ7eDLtM7m/MF+gxAwNq61SrAUvL7O9plgMwqw1TDoBrrmfXWqDRqxPIRJRKNAtbw4bigsnat9hWDUdd1bx837gPPl58d5yk+hHp6vFGME9ZRVzArbGUArQY9wfOxfmW+aIuz84YfftA9+W+uypgPWM/tkdvFAOvOHYwFVbasxW1h69dH97s7d6wZMtSXLyMZ16+vvf1IzBGofO/A3gZF09LSOnbs2LZtW4oynUYTMAi6cfDgwQbbEjJ1qjb1ZGpgIB6oLFBALzJW5jJnzMBo8h4eHvDzuHHj4Ofz58+ToZyoEBWi8u2q3OZu49daRQUCWJIAKyE9AYP7UblEOnrYMBUfXMoqwFLkzw8zk94yhu7t4+hxmH6YXm6NSo0aDFT11askYyr0+PEIWEs/byHnofKArl6gat3bp0/H0A8uLp+PjMn5jHvaKN6ZVaaoMH/2QnqhrQzgpz4eUKCjf70vAGv06Gk1a2aeuaWrbI3cCsWO/zBe5Omz+/fj0lGHDha35cOYMRheYds2a4YM9o8/oJDAHj20t88NnYsUG77CmK7gt37r1i2ThV+/fh3eOfmTF79eOdG8dNDgwR8/+bxzHTqYbIs27oOfn58QM0LvSCMZyokKUSEq35aKSqOyk9tlp7JrU04RwBIDrPC0cOHks0hHjxuHkTaXL6eteZxU9uy46pOSYkxlGj0NarKAXmCNSqVKWFW53OipKJo/1EbP+xyuU/CT1ctQpnv7ggUYvHTt2vCMPa+EBFzRySWGpHPoORgBgZ5pKwMo2MsNCmyn7PzFZ33y5H5NmsAs/vTpU8tUvOK9oNjm6uYibRHCe9KTJlnclsidO9ErfORIa4YMes0aTAs4caL2dicOT0UYc76BS0Ccw4cPmyz8xIkTQrZsg21JfPpUe2wwVAh2+uuvJtuyf/9+KHPdunVCyIYZM2aQoZyoEBWi8q2rlKJKYeBM9UMCWKYBi0vhoLNKqUqJdPS0aUgtCxZYDljAVQgl2bOLqMyj50FNZtAzrPnQlCqFi20cZxTj6PnzdZMW0xpaOIIkorJiBabf+fXXjPQ7QvoUzENnvC1L6CVQ7ER6ok0MIDX1o12/DZipN2i47u3vZ87EI4Rt26rVastUglODMQmu4juRtih79UK8cHGxuC0J9+7h7l6dOlYBFr9PF85nvxGuokrMQ8ykMMZ0jx8/DmSzVmc72Ngl+Eht3rzZYFvSExPx60G2bOnx8Rn+WJcvm2zLRT6F0cyZM2fNmmWQ88hQTlSIClH55lSaKpvqBlQigCUGWPJkucGkv1+gzzwErBkzLAestOhohJL8+UVUltJLMakcPcGaD03BghhRIjzcqH8MvWwZAtanAEV+Gj8QLUAVEFHZuBETSM+Zk+HSnsJxGBSqlBiSrmHWQLEj6ZE2MYDAwFTZOKTPOaFzdG/3mT4djxB26mSNSnFl8cyYons7Va0aHiG8fNnypx8bK7e3p3LkSE9KsnjIUA0YgLks3TLizqtT1FDtworCIrqCZ9XEiRNNFr5+/Xp45/79+421halRA93IHjxA9zs7u7SwMJMD08OHDwW/LsEV7O3bt2QoJypEhah86yqDlIN0j3ARwBIDLN8kX+isGkwNMfRZioA1YYLlgJUaHIx+PMWLi6ispTGw+Ah6hDUfmpw5MW1iQoJR7yhm3TrEo2HDhF9fcC8wkjVVQkRl+/ZIKHPy5Iz8uEJ+PbqSGJIKaWvhg2gTA3jxIlG2cDTmyYnYqHv7kUmT8Ajhzz9bo9KOawclX467bLgtLCvnzwByAQHWqNB8CkiRKGgmL4WwdHT1qnCvRxw6pUHlRURDQ0OF4AgmC1+wYAG888yZM8baEjxkCO4MLl6Mj75KFSkDk0KhaMOHKIP/x4wZQ4ZyokJUiMp/QGUBvQDG3kn0JAJYpgHrceJj6KyGbEMx9FmLgDVihOWAlaJSIdaULy+i4sK6QE0GKgdavlKSBi1FB3QRFcbFBWsyYIDw6wP1AyG7rYjK/v1RUOyoURnnH5N8fXHLrIYYku5kd0KxvZS9bGIAnp5xss29oMCD0Qd1b9/IJ8nZ3qOHNSrTQtD1bUPEBoNt4fjdPap0aSuNWYgdpV1/sgSwKlfWDY6wKhzDscwOnS2u2717d+iizKtHetf48ePhbV5eXsbaErF5My7j8Wl/gocPlzgw9eCD7MPl6upKhnKiQlSIyn9AxZV1hbG3q7IrASzTgHUr/paQMUMMfVww9sHAgUqLH2fyu3f41b9qVRGV3Szmleup7GmxSlxcOtQzTx5KRIV1dUXA+gQlN9U3QbSKooqICqapkcl/+SUjXXHi48foUdRQDEn/YP/AnGhf+qRbbAAHD0bLDmAeoStxV3Rvn85HWjpj3QrWvqh9UPLQ4KEG28IeOIBLj23bWmnMERs2QDkhU6daPGRQfLRP7d5c38C+UO1D0YfEdafzu6jXrpnIID5w4EB42/Pnz421Jf6vv3CPu1gxDDHq6ipxYBKOMRpLZESGcqJCVIjKN6fiqfaEsbe6ojoBLNOAdTXuKnRWJ00nMfTZjYDVs6flgJX4/DlCSd26IioH2ANYE6XlHkUhIalQzyJFlGKAxWdu0eYtvqK+AqK1FbVFVM6ejYVie/UKzJhrb93Cg/qtxJD0CIshmtoo29jEANavj5BdrAYFPk384rRg365dYfJ+2NkqjHuQgGt4ddg6BttCL1yIZDx+vJXGHH/9Oq4AtWhh2ZDB8duy8pw5tff+QP+A0cuSfMV1f//9dykJczp27KibGdrAHndICFbA3h5X0f7+W+LANHXqVCi2Z8+eZCgnKkSFqPw3VN5p3sHYm4/KRwDLNGCdiz2Hm1mBvcTQ5wACVqdOlgOWcI5M3ayZiMox9pheiFhzVRgmBepZpoxKREV9/DguRbRsKfx6lj0Lok2UTURUcIcOm5/xYtzVq5j9t5MYkp5hzxgs1jIDmDEjRHavhOCK/nlFh6Jg8nZq1UrRrp01KtFp0XZyu5xUztSPqZnbouzTB8l4yxYrjVkAFDzloBM8zAzA4j8/ik9bzFFpUVDnXFSulPQUcV3hKN9SnbBnBtbG+J7srMOpBotSlSyJdciTR5urR+IKFvxPhnKiQlSIyn9GpYC8gDY6NwEsMcA6GnMUeuqXoF/E0OcYAlbr1pYDlrDDwrVvL6JyTo2o11jR2GIVf/9kqGflyrQYYJ0/j9Nkw4bCr0fZowaXmnRv9/GJh2JbteKEX2PPncOIl73EkPSy+jIuCynq2MQABg0KkvllhwIT0xO1996+fRsm76ENGiibNbNSpYKqAhT+Lvld5rYo+NNz7KVL1huzqkwZvQzZ0kcK9vRpfGqNGws33k7AaMIN2AYmRV+/fg29NGKE2MmJp0+fwnsGDRok3ha2QQODvncibTly5AjQFfxPhnKiQlSIyn9GpZaiFozAl9hLBLBMANYf0egtNCp4lBj6nFMDYTRurLDcO+rSJVz16dZNREXY2c28Wydd5e+/k6CetWszYoDFrz8patUSd5bSvf3Ro0QotmHDjNTOMUePYlzvX8SQ1EuNATyrKqraxABadsMl2TzvC+iqCOErFzg6KuvVs1LlZ83PUP6pmFP6bVGr5blyIRn7+1tvzIHdu0NRMSdOWAJYfKhS5acw7r9H/g4VHvthrEnRuLg4XOdzchIJFXbjxg29aA4Gi1I3a4arsM2bk0GWqBAVovL/rNJD1QNG4B3sDgJYJgBrR+QO6KnJIZPF0MdTzYOL5YAVc/IkQkm/fiIq3mpvg/7m0lXu30+AejZpohYDLB8fBKzKlYVfheN+vZW9RVRevUJuq1Ejg9uExCnBo8SQ9D53Xy9hkzUGUKmDD5RWLqCSrsrGjRsBC7aVK0c5OlqpsjBsIZS/LGyZXlvUDx7gEcLvv7eJMYctXQqlhS5YYMGQQS9ZIriCCTeODB4JFd4ZuVNK7/Xr1w866tmzZ8YKP336NLxh4cKF4m2JcnUFujLo4U6GcqJCVIjK/4/KVHoqxmWk5xDAMgFYmyI2CREsxdDHGwGrShXLASva3R2hZOhQERVjEROkq3h54V5eu3acGGA9fIiAVa6c8KsQsOoX1S8iKgEBuPNYqVLGzmPkjh14IG6yGJI+554bDK9lmQHkb3sSSmukaqqrIjhQnylalKpY0UoVIWtyn8A+em1h+aembN3aJsYsZPHT9V2TPlKoxo4VMkgKN9Zl60KF7yXck9J7QiD1c+fOGSt879698AYAVjLIEhWiQlSIislLmDcHqAYQwDIBWCvDV0JP/RomllvtwQMErPLlLQesKD44wodx40RUjMX8lK7i4YHe6N26aURUuL//xlWZ4sWFX1czqzHkumqkiIpajb7zpUpl+M5HbNqEKzFzxJD0reYtpqCRf2e9ASQlpcs67dQeRNDe27t3bzxCmDs3VbKklSqvkl5B+ZXpynptYfi4miojPtrmqqQolXrBZs0ALH57kd29G+5KTk/OQeWwl9vHpMVI6UAXFxdc6tu2zVjhwlrgnj17yCBLVIgKUSEqJq9T7Cn8zq9oRADLBGAJ20Nrw9eKoc8LDgijRAnK4scZyYf3DJk+XUQlI2uNvIDFKqdOYcCqfv2CxADLzw8Bq0CGyhIGkwZOUk0SUQkLS4NiCxVSCL+Gr1xpMt2vQqOAYnPKc1pvADSdIhuMEDzuwzitilwuBybo6OQUYGdHFSpkpUpSelJ2KjsgS3x6vG5bVP37o1v3pk22MmZFoUJQYOqnN0sfKRQNG6L/07lzcNffSX/r4aD4JewAzp0711jhixYtgjecOnWKDLJEhagQFaJi8nrCPdGuhhDAEgOsGSEzoKdcIl3E0MdPA4RRoIDc4scZvnatnv9NZhWVRgU1ySHPYbGKu3s01HPo0GCxDw1NY0Ajh4zszrPp2RgQnJ4tohIfj/FLc+XKiF8axoeGghaJYZyGs8OQ8nbwg5UG8PhxomzqdKjkkrAlWpVbt24BE4wcPhzbkju39WZWjcE4W88Sn+m2RVG7NmLNhQu2MmaubVvdTMnSRwqqbFmsyf37cNfB6IO4Oh00QOKHX8gJqHtIUO+aOHEivOHGjRtkkCUqRIWoEBWTl1qjdpA7wDhMaSgCWGKANf7DeOgm1yhXMfRRIWDlyGE5YIX9+itCyYoV4o8TiAQqYzGUuLpiTpvx4z+IqwjhIjX8sbJJqkmguJhZLKKSnv7RjsclIYRTyIwZcHuki4u4Sk55TihZoVFYaQAXL8bKlg+BorZFbtOqHD58GJjgV971G2pmvZkNDBoopOL53BaOo/LkwY56985Wxhw6axZ+DFavNnfIwA8f1ESBi4jTQxA310Wsk/jhZximQ4cObdu2VcHn2NA1iA+IrxtsnQyyRIWoEBWiInJVoirBOHxTfZMAlhhgDQseBt3kHu1uAn3scCrnOAsfZ+jcuXB/xMaN4iq55bkFKLZMxcUFszLPmBEiriJwAydHXhylGgWKq5nV4iq5cmEO6fh4JKwP48cbzJeiV8J38u+g5Leat1YawN69UbLtXaCo4zHHtSrr168HJti7d28GeRhBB+kqQmo/7VkH5KtHj3AvtUQJGxpz9KFDGEKsb1+zjJl7/Ro/fN99J6i05lpDVT3jPKUPGUOHDoXuunv3rsHyu3TpAn+Vy+VkkCUqRIWoEBUpV3tle/xOzh4kgCUGWP2D+kM3nYw5aQJ9cuMcR1EWPs6QKVNw1Wf7dnGVQlQhqMwb7o1lKmvXhkMlFy4MMwFYhQsjYL1+DT8PVg0Gxc3MZnGVQoUUUHJYWBr8HDxsGOYtdjeBpCUojL3+nHtupQGsXBkuO9oIvyvE39SqTJkyBZjg8uXLcj5DH27iWqdyPvY8xgPTdNa2heVhSNGihQ2NOYlHJfqHH8wDLC8vrEnVqoLKdwok18DUQOlDhuBldezYscyFK5VK9Gbr2JEMskSFqBAVoiLxEtYmltPLCWCJAZYQZPJS3CUT6FMIl3DevLFw8+7D6NG46rN/v7hKSaokegJxzyxTWbIkDCoJRGICsEqVQsB6inn9eit7awOmiaiUKqWCktVqTMwSxLt+x5w0gaQVFBge/T5330oDmDw5RHYNF2NfJ73WqghHCF++fEmVKIFtefHCShV5shwkSqtKa9tC87u6qlGjbGnMqakUoLqdXVpkpHRjZg8f1kaLUCTj6YHvld+bNWTs3r1bLxCD9nr+/Dn8acCAAWSQJSpEhagQFYnXCmYFHsCnRxLAEgOs9hwu9P0V/5cJ9CmJgPXsmYWAFTR4MELJkSPiKhWpihjfiLtnmcrs2aFQyc2bI0wA1g8/IJTwG0ZdlLj79gf7h7hKpUo0lBwQkIyl/fwzempfMoGkVRVVoWQvtZeVBtC3b6DsaUEo6kPqB0ElICBAyJ3HcZyifHn0/n7wwEqV9I/peag8oBKeFi6oqAYOxCOEGzbY1pjZRo2g2HgfH+nGzPz2GwLWwIHw89nYs7orbRKHDA8PD+ixKVOmZC785s2b8KfxX2azJoMsUSEqRIWoiFzurDsMxW2VbQlgiQFWU3VTgzEb9dGnIgLWvXsWAlZg794wR8aePSuu4kg5IpRwFkLJpEkhUMmdOyNNAFa1aghYf/0FP8PnAxSPsEfEVWrUYKDkV6+S4GeufXtEhL9MIGkdRR0o+bL6spUG0KylShZgZx+QLe1jmqDi7e0NTDB69Ghc0alSBQHL29t6M2vINoQK3064Lago6tYVIiPY1pgFDzbhiIDEkuk5c3Bjcfp0+Hlp2FKo5ILQBWYNGa9evYIe69WrV+bCz549ixmHFiwggyxRISpEhahIvHzUmF+kIlWRAJYYYNVhkQOeJz43gT6OCFheXhYClqZzZ1z18fQUV6mnrAeV8WA9LFMZOTIYKunmFi2uoqxfX5vAuImyCSieYc+IqzRsiOmuHz1KhJ/VTZvC7Qn3TCCpsZLNNYAKDZ9COUXkxbUqf/75JzDBsmXLNNpICleuWG9mQv6ZXVG7BBUqXz7E0DdvbGvMUbt3Y0z/YcOkG7NqyBBcS1u3Dn7uHtgdKnki5oS5Q4bgye6fKani/v374fV1fOFkkCUqRIWoEBUpl0KjsJPbOVAOwjd/AliGryp0FZix3iW/M4E+9ZRAGB4erGWPk2vdWrsxJKLSTNkMKnOaPW2ZysCBQVDJY8diTABW8+YIWHxgSWGd6Yr6irhKq1YYatXHB+NwsnXqwO2Jz00gaRtlG4NrY+YaQO66V6CcaqoaWpW1a9cKRwjxU964Mbbl7FnrzWxLxBaMuRoyCZ/X06d4hLBoUZsbcwKfqoipWVO6MSudnLCNBw7Az2VVZaGS/sn+5g4ZY8eO1Qt2JVy//fYbvO7q6koGWaJCVIgKUZF+fU99D6OxKkVFAMtoyeVU5Qz2kT76NEPAOn3aQsASPG8SHz0SV2mnbAeVOcwetkylR49AqOSFC7EmAIvf42MPHdJ6St1U3xRX6dQJI4F5esbBzzS/K5f8zgSSdlZ2NujdZZYBxMamyZrjVnc7rp1WZfLkycAEV/hVKyVPruzRo9ab2fX46yDUUt0Sn9eRI+j21Ly5zY05PT5eni0blT17emKi1K9KNWrgKp2n5xvuDdQwnyKfWd+ZhEJWrlwJnXaApzTda8mSJfD6iRMnyCBLVIgKUSEq0q/Gisbo0hPvRQDLaMnFlMWgj4JTg02gTzsErMOHLQQspmZNmCOTXr0SV+mq7AqV2c/ut0zFyQnXma5fjzcBWN26IZTs2wc/l1eUx7N+6vviKr16IbqdPYvopipXDm5PUZlA0l7KXlDyTnanNQYglyfLeuDC0qCgQVqVHj16ABP4+vpiWzp1wra4uVlvZoGpgSBUSFEIIXLZMnR7GjkyK4yZ4X3gEvlTnFIuqlgx4aTkSTUmvW6mbmbBkHHw4EHotBUrVugVLtDqtWvXyCBLVIgKUSEq0q+BKgxPvTdqLwEsoyXnU+SDPopOM+G31LUrAtb+/RYCFv3jj7jqExAgrtJH2cdg0ASJKi1aYFLqO3cSxFVUffviLtX27ZpP0apecC/EVX75BTcfjxzBzUclP9+nBptA0kHKQVDyb8xv1hjA3bsJspGLoZxpIdOEV/z9/QEIunTpkgGLPXsiYO3aZRMzK6IsAlrqFLXql18QsNauzQpjDnJ2xpgdPOCavDiaxiD62bJpWHYpvVS7iWnukOHl5QX9NmbMGL3ynZ2d4fVHjx6RQZaoEBWiQlSkX/PoeTAgzw+dTwDLaMnZ5Nmgj1LSU0ygTx8ErB07LAQsVenSuOqjVourGAv7KVGlXj10RX/6NNEEYPETvJDDuIC8ACj6afzEVUaNCub5Mgp+VvDe32nRJpB0JI0+42uYNdYYwOnTsbI5EzDWfHhGehkBFMaOHZsBWHwwBXbLFpuYmRAk/WrcVYVwDuD06aww5ojNmzHz96RJkgBL8Ab7/nstf++L2mfBkKEb2+LLbw5d4XX4KxlkiQpRISpERfq1i90FA3K/oH4EsAyXnJyeDB2UncpusqMHD1bxIaYYyx6ngg+enhZmIsa6scQ1ElUcHTGYwtu3SSYAi496yqxaBT8LGStVGpW4Ckb7lMm3b8cAEPJs2eD29BQTSDqRnogZmukl1hjAzp2RsnX9dZdh3d3dAQiWL18ulECPGIFLTWvW2MTMpoRMQcCN2EzxAeI5fhfS5sYcz0dmVzdtKqVY9tIlDONepw78XEWBBzKeJD6xbMjo1asXdN3ff//9+ZOgUsErHTp0IIMsUSEqRIWomFX+ZfVlGJDrsfUIYBkuOSotCjoovyK/yY4eNQoBa/VqCwGL4lPtpMeb8I4SUi8vYSyEkgoVsJJKpQn0UU2ejIC1eLFaowY5e7m9SZU5czCE6caNEenJybigkt00ks6iZ2F2P3qONQbw669hsr3o+H8+9rzwypo1a4AJ9u/PcFOjJ0xAwPr1V5uYmWuUK2gNU2Koeqpw4SwyZuBsZKa8eYV82yYAa/9+dLfv3FmpUWaTZ4MvAwnpCZYNGdOmTYOu8/D4HAQEYAte6devHxlkiQpRISpExazyhVNH3ym+I4BluOSg1CDooOLK4iY7etIkZJclSywELDmfLPpjerq4ymx6NtQH/rdMpXhx3McMCkoVV6Fnz0Yogf85zA+Th8pjUmXpUkzCs2JFeFpUFMJBftNIuohZBIVPUU2xxgDGjv0gO1Mb3fAT7guvTJw4Udcpm54xA9syd65NzOxewj3QqvvmJ2SaJk2yzphVfAB67vZtk8Uyq1djA0eMuKLGcBU1mBoWDxmbNm2Crtul46/m4+Oju99KBlmiQlSIClGRfuWn8sOwHJoaSgDLwKVMUULvlFeVN9nRs2djrhj434LHmZ6QgCsiuXKZVFnMoEP3ZNVkyz40+fNjSuaoqDRxFWbJEsyyN2nSa+41yBWmCptUWbcuAkpesCA0NSgI4aO4aSRdyayEwseoxlhjAN27B8p8ykA58mT5p1e6AxO8+RT/k16wAPlj6lSbmFlkWiRo5fJ3eG8vUw0blnXGHNirl0nf/IzlRj5NODRzE7MJ6jYkeIjFQ8bx48f1grafO3cOXpmbCU/JIEtUiApRISomrxqKGjAsP0p8RADLwPU26S30jiPjaBp9FqN70+TJKgseZ1p4OK76FCxoUmUVswrqM1o12rIPTfbsGG4+JcXEOpmwKKIaNeoJ9wTkSlGlTKps3RoJJU+fHpKiVOK95U0j6UZmIwKBaog1BoAR5H1za495RkREABB07dr182rc8uVYn0xrMBabmRDJ868KMkbUr8tKlXC+2rQEP3dVv364n+viMoIeIfiHWTxk3L9/H3rP2dlZ+8qBAwfglbWZDkuSQZaoEBWiQlRMXj+rfoZh+WjMUQJYBq5nic+MOanpo88qBKzRoy0BrBSOw1WfkiVNqgirFM4qZ0tUUtKhhsBYJlUY/hSbavDgO9wdkKtEVTKpsmdPFBQ+btyHpLdvcb53NI2k25hteMJC1c8aAyhb+R0UklOesfj3/PlzvS0tZsMGbMvQobYys64aDEW2q6OMPXky64w59sIFZO6WLU0Wq2jRAj3ijx+vr6hvWVC7zzBK0+3atWvfvj3LZhyG3bJli96mIRlkiQpRISpEReI1WTVZ95A7AawvrrsJd6F3mqubm0afTQhYzs6WAFayXI7LFT/8YFJlO7Md6tNX1dcClaioNKhh/vwKkyrsjh0IfH363FDfALnqiuomVf78MxoKHzo0OPHZM9zbqmcaSfcye6FwAHxrDMCh4i0opKyynPDrmTNnAAhWrlz5GbB+/x0Bq39/W5nZvFAMbTJ9qozTOW1nc2NOYRiJfvQUH0GN8bmZh8oDFQtLC7NmyPjll1+gAx8+fCj8unTpUvj12LFjZJAlKkSFqBAVcyWENZGRwSMJYBm4bsQjYXTgOphGn+0IWH37WgJYSb6+OEdWr25SZR+7D+rTTdnNApWgoFSoYfHiStOAtW8fAlbXrhfVF0GuvqK+SZVTp2Kg8H79ghLu3sUFleamkfRP9k/sW2UHiw0gPDxNVvsMFNKAbSC8IiTOc9OJ287s2YOA1b27rczMnd0Bil1cHbLamJVFiqCf+7NnJgCLjzp21/+qsJlr5ZAxf/586MCTnxbnpk6dCr96enqSQZaoEBWiQlTMlRCya7TiWhHAMnBdjEXC6B7Y3TT67MMYnt26KS14nImPH+OqT4MGJlUOsYegPu2V7S1QUSpToIYVKqhMA9ahQwhY7doJH44WihYmVTw84vjma+Jv3EAs6GAaSU+yfOHKFhYbwNu3SbJ2uAzWVdNVeEUAAt2Mxay7O7bFyclWZvbw9h7cNr2VK6uNGfoQPxXu7iJlcgEB8B557tyuLMaP6KjsaOWQsWPHDuhA4FTh16FDh+ouaJFBlqgQFaJCVKRfj7hHMDKXVpX+xgBL9ukySEsifzULsE7EnIDeGRA0wDT6HELAat/eEsCKv3ULV31atjSpcoo9hVuWyuYWqCCOyOSOjoxpwDp1CqGkWTN3FvMoOymdTKp4ecVD4e3acbEXL8K9gd1NI+kl9SVjy2MSDeDmzXhZ/3VQyIjgEcIrwhHCt2/faktQnzyJzkwtWtjKzIJ3bMnmL8v23i5z8FXbGnPo3Lm4cTxHLE4Yd+cO7iRWqDBFhRFQZ9GzrBwyLly4AB04Y8aMDA/Nn3+GX/38/MggS1SIClEhKuZKsBrWgXKwk9uZG57wq1jBMgZY4tgkHbAORh+EeWt48HDT6HMKAat5c0sAK+7qVZgmNR07moYSlocSpSVQ8vRpItSwXj3WNGDxwcGV9eq5Mrgu0l3V3aTK/fsJUHjTpuqYEyfg3qABppFUxMFLogEcOxYjmzAHCpkXOg+JJDQUaKBbty/2T9U88CkaNLCVmX2YMKHSNWirDOqfpcYcc/SoEEFUzHoFFG7SpI2yDVTpD/YPK4cM4ZRA377o5MeyrBDGXS95DhlkiQpRISpEReL1E/0TDM5vkt78FwBL7xWJjGXsbbujdkPXTPgwwTT6XELAql/fEsCKPX8eV3169pQIJdWoahao3LmDDNSihdqkCvfXX7gu4ui4ldmKC3iqASZVXrxAeqtTh40+eBDuDR5uGklFjihKNAAXl0jZ4pHa2ARPnz4FIJgwYcIXgHX9OgJWjRq2MjOuVavOOxCwtjPbs9SYk9+9w6dQpoxImcz27QhYvXoVo4phtBXukZVDBrBUx44doRvlcvmrV6/ghz59+pBBlqgQFaJCVCxT6azpDIPzpbhL/7+A5WHkGnNvDHRNrye9PExd27bdgFm3YsXXHuZft+fNg2nyeatWJt/peh2XlEq/LW2ByqpV3lDDunVfmnzndd4x/G2pUpPv4RHTLk+6mK6Y63UovEyZt/f4NDtPupi+5cC1A1B4sXfFPCy9+vV7JPutJ26N3Z4Fv65cuRKAYPr06brvueHqCvV5U6aMh40u//z5p09FwOr3qJ9HVl6XL116nzMnVN7z+HFj73kwciS+YVgXqE9e/7w20R00aBB04549e/bu3Qs/wK8e5CIXuchFLouubk+7wfg87v64r6Q+X9EK1prwNdA1i8IWmV6PucPBrPvDD5QFvBzt5oarPiNHmlQRifxpUuXChVioYY8egaZXsJ4+xbWTkiWX0cvwk0GPM6lC0+hBX66cKmLLFrg3dOZMkyq+nC8UXoQqYvE3jOHDg2UHW0AhV+Ouwq+bN28GIDh48OAXbeEPEIivA0kH/NTgYChtd+88Jo8a2OTbkqJ+ffRzNx5wS0jL7b7XGerTTNnMJt/Jli1bBt3o7u4u+GPNnj2bfIslKkSFqBAVy1R+i/gNxuepIVPJFqH+tSRsCXTNqvBVptHnCQJWqVKWAFbkzp0wTYZMmiQRSgzmrjGpgh5LMvnAgUGmAev1a4SSQoXm0/Mx5hM93aTKhw8YA6JYMWX4mjVwb9gi00gawAXguguV12ID6NxZI7vkCIU8T3wOv06ePFnvCCG25dUrbEvRojYxs3hvbyjtTu+6uI5Ilc5qY1YNH45+7kuXGgWsn3+GN8y/2gvqM1Y11iZDxv79+6Eb16xZA6gKP6xevZoMskSFqBAVomKZyvnY87pH3Qlgfb5mh842ln5EH318EbAKF7YEsCL4yOmhs2dLhBKD2ZdNqri5YSzQkSODTQMWH/hUnjs3oBXIAWaZVImJwSim+fIpwvg8huGrTCMpq2Gh8GzybBYbQJ06rOx+cShEnYKOZd26dct85I17/x4BK18+m5iZgMJBY0blkucCXX/OP0uNmdm0SYj4aqxMYYmr+7PmUJmtzFabDBnXr1+Hbhw/fvzWrVvhhx07dpBBlqgQFaJCVCxT8U3CZZEqdJX/AmB9tOkpwkkhk6BrdkbuNI0+AQhYefJYAliAI7jqs2SJRCixl9tboLJzJ6YLnDQpxPSHRq1GwLK3H0ePA7ll9DKTKqmp0IfybNnkgIlwLyCjlI+mA+UA5dMcbZkBfF9SIfPLDiUkpSeFhIQADfTs2VMfFoWQ6Nmz28TMQiZNwtZt2VJTURN0L6ovZqkxqz090UO/ShVjZVJlysAbKvpjekQvzssmQ8a7d++EfI7CXuGRI0fIIEtUiApRISqWqcSlx2E+Nypn2se0bwawZF9eerRkqzhYI4PxkJpbtJtp9GE1PJPILXicYYsW4arPmjVmQInGbCjZvDkCajh7dqgUFbmDA1RpGIXOPeuZ9VJUHBwwk7RmwhS4MXLnTikq+an84utAIo8sLe1jtiJP4faCCkyS/fjxY8HD3QCFZM+OsU8Zxnoz49q0gaLirl4doBoA0huZjVlrzCoVVj5bNo1CYaBEjoPH9CqPzE5u5yB3EDjVJkOGEE5s0qRJ8P/ly5fJIEtUiApRISoWq5RUloT5gklhvrEVLJuVawSwBgUNgn45FnNMEvrwhEHTZj/O0JkzhXUR6VDix/mZq7JyZThUb8mSMCkqVIECUKUB73tp955MqhQooIDy5UMmwI3Rbm5SVITgAi+5lxYYAGb+qXQNbq9MV4ZfT548CTTg4uJioC18Mhnu/XvrzUxZvDgUlcIwv9K/YoYp1cisNmaFoyMGoTVEORyfYelUa/w81FDUsOGQIXizDRgwAP6/f/8+GWSJClEhKkTFYpXmavTi8I73JoD1xdUzEKMAnI89Lwl98iNg+flx5j7ODxMQSqJ275YOJX9zf5ursnBhGFRv7dpwSYDFk8TPfk6g5cq4SlEpUUIJ5fv2GgM3xhyThKRlqbJC9CYLDODlyyRZw2OYbEfdAn7dsGED0MD58+cNtKVoUQSsV6+sNLPU0FDcsMufH34+yh7VHtzLUmNW9e+PeSo3bMhcoJrPSrRizvdQk0HKQTYcMtatWwed2alTJ72w+GSQJSpEhagQFXNVhgUPg1F6f9R+AlhfXB01HaFfrsVdk4Q+xRCw/v7bbMAK5g+LRR88KB1KHqofmqsyY0YIVM/FJVKKiqJcOahSh7cYBMGddZeiUqGCCsp/7ISRmWLPS0LSnxQY4vaW+pYFBnDtWpysM+Zd7hPYB36dOHEi0MDLly+NOSpxjx9baWYZGY0aN4afn3PPQboQVSirjZlZsQKTVQ8dmrlA9s8/4U8DD+Di82pmtQ2HjCNHjrThr3bt2mUO404GWaJCVIgKUZGusiJ8BYzSC8MWEsD64mqpbgn9cjvhtiT0KYuA9fCh2tzHGTRgAK76nDghHUp81D7mqowf/wGq5+oaJQmwKleGKrV4XQ+0TqpPSlFxdGSg/FvNh6GX0jVJSCq4il9TX7PAANzdo2XOK7Rx9rt27QpAEBUVZQCwfvwRAev2bSvNLGr3bm24MrjrO/l34kuJNjFm9swZXDarWzdzgcIZw5q3CkM1zqnP2XDIuH37tgBYvXv3JoMsUSEqRIWoWKNyOOawsaTG/9eA1YBtAP3yJPGJJPT5CZ2QfHzMBqzA7t1x1efiRelQclV91VyVoUODoXrAJZIAq1YtqFL9147GzsplLqRePUwW5Fl3CNyYcFsSkjZUNITyL6gvWGAAGzZEyKZNg9uXhi0NDg4WaMBwW2rUwJWn69etNLOQqVPRVW7TJkGlsaIxqJ9Qn8hSY+b8/PBEZ65ceIziy4uePds/myynf3Y7uZ32oIBNhgyFQiEA1ogRI8ggS1SIClEhKtaoPEh4AJMF4AQBrC+u6kx16JfXSa8loU9NBKyrV80GLK5DB5hE42/ckA4l59XnzVXp1y8IqnfqVIykKbZRI6hS9dcVjWU1zlxI8+ZqKP9sVWe4MfGJJCRtqWgpzigij2zWrFDZCjzkuCNyx8OHD4EGZvLh4w20pUEDBKyLF600M659e1ycu3xZUBmuGg7qy+nlWW3Mwnat2ttbr0CVs/OVypi0p4Kigs2HjF69egkHCckgS1SIClEhKtaoBKcGo0uJohABrC+uH+gfoF+oZEoS+jREwDp/3mzAUjdvjqs+d+9Kh5Lj6uPmqnTrhoEkPDziJAFWq1ZQpUqvS4HWHe6OFJUOHTAS2NEKCFhJryUhqZPSyZiPl0kDGDw4SLYDk2iejDl5/PhxoIFt27YZbkuLFggoxhPOSPyQKL//Ho8QqlSCyjpmna53edYZs7JrV/Rz366fW1rZvv3mXghY3ZTdbD5kDBs2DLp0ypQpZJAlKkSFqBAVK1XyK/C4d3haOAGsz5cQvkKTqpGEPi0RsI4fNxuw2Hr1cNXn2TPpUHKQPWiuSrt2CEBeXvFSVJQdO0KVSr1B/54n3BMpKt27B0L5f3w/GG5MpiQhaQ9VD2OnFE0aADbnWEPh7Ov69euBBi7ye6wG2uLkhBn93N2tMbO08HD0hcqb92N6uqByTn0O1Oso6mS1MdN8LnB6/Hh9cKxefdQimV6ofVsNGePHj4cunTBhAhlkiQpRISpExUqV2kxtY+5G/7+AVVBREDolIi1CEvo4YZyCgwdZcx8nw8c6SnrzxgwoYc2GkiZNcAvv/v0ESYDVowdUqfC7fKDly/lKURkwALcgdxTCFaxUjSQkFcJ1GoyzZdIAqlVjZNcqwe1vkt4ABwANvHr1yqCKindxY/bsscbMEu7eRUpr0EDblnead0LaIk7DZakxC6cFlS1a6BVIFSnS9BAC1p/snzYfMtzd3aFX3Y1QKRlkiQpRISpERbpKn8A+uPUUc5wA1ucrJ5UTOiUxPVES+vRQ8cf0zAYsVYUKuOqjUEiHEhfGxVyV2rUZPopEkhQV1cCBUKU8/jlAS87JpagMH45O9JvyoJN7WoQkJB2mGmYsUrxJAyhcWCF7ivj7IeVD586dAbCio6MNt0UIJfX779aYWdTevXiEcPhw3bZ8T2EMqgfqB1lqzNyLF+jn/t13XxRH03I7u4JPEbBecC/I8EdUiApRISpfrcrc0LkwVq8NX0sA69Ou0Mc0IfGfxI4eMEDFB5oyOyWLskQJXPUJDJQOJeuYdeaqVK5MQ/X8/ZMlARYfmss+wA5TKWvUUlQmTMAwEKuyY5iG9ERJSCrkOhTxEzfWluTkdLvs/rIAu2zybJyGA7rq27ev0bYMHYqAtX69NWYWMn06HiHcsEFXpY2yDdT/AHsgq405I1aqTigv+Pl2KaSrIlQRMvwRFaJCVIjK16ziGuUKw/XoD6MJYGVcsWmxwh6QxI4eNgwBa906swFLweelSYuUFAJUJAGzuEqZMlg9hkmRokKPH/82B87fDnIHiSozZ4bCDYtlI+X2UpF0Go1xFhbQC8z2WmNTZMXvw70llCXu378PgDV79myjgDV2LPowLV9ujZlxvCNX3KVLuioT6Yl6LlBZZMxKPgci6+amfUV96dKe9viAWilakeGPqBAVokJUvmaV6/HXYbhuw7UhgPVp0SI1BFcIlEUkdvS4cbhEtGyZ2WmYKT6zcnqSpM07AUpEJnVjKkWKoItYSEiqJMCaPv15AZy/C8gLSFRZtAhT8cyWTaTySEXSefQ8kJhBzzC3LU+eJMocL8G9NZmaR48eBcDasWOH0bbw8avoBQusMTNV6dK6zvvCjVuZrVCHHsoeWW3MqimYQpueNUv7CrN377Rp+IAmqSaR4Y+oEBWiQlS+ZhUqmYLhuqyqLAGsjItJYaBHyqjKSF2PmYaANX++mYCVmooeNpJXfQQomU5PN/dDkycPBpqPi0uXBFjz598vjvN3CaqERJVVqzCZ9GTZTGURqUi6lF6KodjpCea25dKlOFmLg3Bve6792rVrAbA8PDyMtmXuXKSTGTMsNrO0yEgoAcExLU1X5ar6KtShiqJKVhsz4+qKfu5OTp9fWbXKaTc+oF3sLjL8ERWiQlSIyteskpKekp3Kbi+3N+jS/f8IWP7J/jCB/UT/JBV95iFgTZ9uHmClxcRknP83B0rG0+PN/dDY2SHIfSIEU4C1bNnNcjh/l1eUl6iyeXME3DBatlBVRiqSrqXXgsQIeoS5bdm3L0rW8ze495egX8aOHQuA9fpT5C0Dbfn1VwSsCRMsNrOE+/dxh65ePb22KDQKMBgHyoHW0FlqzNy9e0h4JUt+XtOaNKmMjyxzJkcy/BEVokJUiMpXqFKJxmPv75LfEcDC6++kv6E7ajG1pKLPUgSs8ePNA6zUkBBcnCha1CwoGa4abpZKQkI61C1nTkqiCrNunRAlvKqiqkSVnTsj4QZn2Qr6J6lI6sK6gMRA5UBzDWD16nDZyMW4kvdheqdOnQCwYmNjjQLWmjUIWCNGWGxmUfv34xHCIUMyt6UihcHuvdReWWvMHEflzYt+7q9fCy+8GoLROnL759A7gkCGP6JCVIgKUfkKVTpqOsKgfTnuMgEsvIT8QY3VjaWiz1oErOHDVWY9zhSGgYlTVbaseVCiMg9KwsPToG4FCyqkApaLy9laMpFAmpkLcXOLhhv6ydYztaQi6W52N0j0VPY01wCmTAmRzZkA9y55uwToqn///iIq7JYtiLADB1psZqGzZkEJ4WvXZlbpquyaeZ8uK4xZ0bAhxqM/nhHB/9joGqBb9+WPZPgjKkSFqBCVr19lwgecs7ZFbiOAhdfN+Jsibv8G0McFsx0PHGgeYCX7++P6SuXKZkGJiGO1wXI4LgXqVqqUSqIK6+p6tBECVhNlE4kqx47FwA0/y7aqG0tF0gPsAZDopOxkrgFgXsV1/THEw43lAFhz584Va8uuXQhYPXtabGaazp0xG/eFC5lVZtGzoBpT6alZbcyqkSMx2MSSJcKvS+YUAd0hL3uQ4Y+oEBWiQlS+fpVNEZtw1yVkOgEsvC7HXYbu6KLpIhV9diNg9eihNOtxJv39N06ctWubBSUdlR3NUpHLk6FulSrRUgHr4EG3VghYbZVtJaqcPx8LN3SQuXJtpCLpMfYYSLRWtjbXAFq0UMv2toN7F7stBsDauXOnWFvc3BCwOnWy2MxUZcviEcKAgMwqe5g9UA0npVNWG3PGOlyvXsKvvV2yg+6G9yvI8EdUiApRISpfv8rZ2LMwaP+s+ZkAFl6nY09Dd/QJ7CMVfQ4gYHXsaB5gJTx4gFs/TZqYBSV60Y9Mqrx6lQR1q1GDkaiiPn58V0cErC7KLhJVrl2LgxtayA5qukhFUiGdX2NFY3MN4KefaNkZTO00Y8UMAKwrV66IAdbRo4gmrVtbZmZp0dHoYJ4r10edAwLae29zt/HwLVU2q41Zff06VuNH3BPk/P2reuDT8WA9yPBHVIgKUSEqX7/Ky6SXMGg7Mo4EsPA6FH0IusM5yFkq+hxDwGrVSmHW44y/eROdl9u2NQtKGikamaXy6FEi1K1RI1YqYJ0//1tPnMJ7K3tLVLl9OwFuaCg7FthHKpJ6qj1BoraitrkGkD+/QuZTBu4dNnoYANbbt2/FAOvsWTyn2bixZWaW+OhR5iXGz4Vr2BzyHHZyuwAuIGuNmaYxXpq9PSeXK+94ZfeTZfOXURqKDH9EhagQFaLy9avEpMXAnJWLypX+MZ0A1se9UXuhO8Z+GCsVfc6peYgxD7DiLl+G+VvTtatZUFJLUcssFR+feKhb69acVMC6enXtAASswarBElUw+KdMXlN2LshZKpJ6q73F40gZ7rE4PBEp881t996uY8eObdu2jYuLE2uLpycCVu3alplZ9IEDcHvQ4MHG2lJdUd3gYpLNjVlRvToudl665OmxARR/vJ2bDH9EhagQFaLyraiUUJbA7HMpagJYH3+P/B36YlrINKno44mAVauWeYAVe/o0zJqBn1LpSYSSyorKZql4euL+XefOGqmA5eOzdBhizCjVKIkqr1/jLuRPMs8PY6Ui6QP1A5FQW8baQlHJsty+cGPh+4XbtGkzYMAAE23x9kbAqlLFMjMLnTMHjxCuXm1Mpa+qL1RmM7M5q41ZyWfgpteu3XRuMB50OF2WDH9EhagQFaLyrag0VTfF4IXxtwhgfVwfsR6T0oTOl4o+3ghYlSubB1jRhw7pxViSAiXlFOXMUjlzBj3Qe/cOlApYDx9OnomANVI1UqIKco9MXlbmHTJNKpK+4F6IBIs31pZ79xJkZXxwM/uMIwDW/PnzTbSF93JTlC9vmZlpunbFI4RnzxpTWcIsgcqMUY3JamNmVq/GiB6DB4+41AAUFx5oSoY/okJUiApR+VZUhgQPgaHbLdqNANbHZWHLMBBA+HKp6PMAAatcOfMAK2rvXpg1pa/6CFBSnCpulsrhwxhDwdk5SKLKu5d3ij6QiezfGSokFW4oLrsfMnWqRBU/jZ9IukNjbTl7NlZW+wzc2GxHMwAsV1dXcRXuxQt0Dy9RwjIzU1WogEcI/fyMqRxi0VevhbJFVhuz+vx5JMVatRp64zrzkX3DyfBHVIgKUSEq34qKABWLwxYTwProE+8DdAX/S0WfFxwSRnHKrMcZ+fvvMGtKX/XJgBLKPCjB3DIy+ZgxH6SoyDl5/YA6oFLoqd0B5oBElZDXDEgUkD1nqleX2BaVRgUqOeQ5zGrLhg0RsnboHtdhYQcArKtXr5owAD8/TBJUoIAFZpYWGyu3s6Ny5PiYmmpM5Qn3BCpTlCqa1cbMvX8PlQnImSPvG4zR8MJtMxn+iApRISpE5VtR+TP6TyHDGwEsszvaz0/Dz+PmAVbYkiUIWJJXfQQocZA7mKWybRvmsZk6NcSkCpTfQtECs1z7yO6WyS5RJfn9+/flfgSJHHbvYs+fl/7RtJPbodPfl/leRNrCMClFiihk/ddhMLBhHQGw/IyvLX1qkgoBK0cOC8ws8ckTPEJYs6Z4W/JT+dHtnvPNamOmKlTwKs8n4b4nU1+8SIY/okJUiApR+VZU7iXcwyAAbCMCWGZ3tEqFgOXgIJf+OBOfP1cUKIBTeI0a0h+nvdzeLCiBa8mSMKjblCkmAIvhmI7KjoJf1M0K9ni8UW1aJenVK2WJEvBmO1mAsXzSxtqSW54b5DKHGzDYlvfvk8uXV4FE/rlz7d7bte3QFq6EhASTKnI+07WUtuhd0e7ueIRw4EDxtjRQoFPUSfZkVhuzqnv3pUMRsBoflnGPHpHhj6gQFaJCVL4VlcDUQBi9iyiLEMCypKPtkUnkRuZx/ccZc+oUlScPui2XKxd77py5UCLn5BI/NM+fJxYooDAZaBSIrbeyN+4MUoW81d7y3LkxQJfchErCw4eKQoXwnU5OefJQoBIXly69LaAFim+4Nybb8upVUokSSii/WTP1RPX0PHfytGnT5pdffpGiIrRFQ1Hmmlno/Pl4hHDFCnGVoaqh0IpVzKosNeZr6mvdblS1Q4iVVbso09A0Gf6IClEhKkTlG1LJq8gLA3hkWiQBLLM7mp/H5XI5Z6Kj09PDli0TllWCR41KT0oyS0WAktfcaymP89SpGIF7ypVTnTsXK6IiUEI+Kp+n2hN3owRsei2mEu/lpciXD8NM9O4NrShSBAEoNDRVeltKUiVB9Bn3TLwtDx8mFCqEjOjkxAHADQ4aXOxEMQCshQsXSlHJaMubN+aaWWD37niE8PRpcZU1zBqRmGHWG/Np9nRrZWsZfrhkDu+QrrYNyEeGP6JCVIgKUfm2VGoyNXHKS3xGAMvsji5UCFHm9WsxwEqLjQ3s2xfnymzZIl1cLFARoOQp91T8caanf1y2LIynOPmoUcFJSekiKhPpiRhkVp7rLHs2A0pKlkQoeWpUJfbCBSpnTmTEYcMEH/AyZXD/jmVTpLelIlURdO9x90Ta4uUVny+fQggzIbSiA9ehgksFAKw9e/ZIAiyhLc+emWtm9A8/wI1JOpHiDaoAAEEr6ivr29aYOQ3nxrrVU9YT0ArYd8K74feL429UtWpk+CMqRIWoEJVvS6VXYC/0J4k5SQDLfPQpiYD19KlRwEqhaaZ2bTxsX7Bg3JfH32wLJbGxaX37BvIUJ3dxMbEaOZeei0sjlMNh9vBnKKlYEaHk7l2DKjFHjlDZs6N7/pQpiHL8hSkCZfL375Olt8WRcgRpL87LWFsuXIjNmRN7ddiwYO1JvlpMrWpzqgFgXbt2TRJgCW25d88sM0uPj5fb21MODunJyeIqb7g3AgABEtnEmJPTkw9GH6ysqCygVRGqyDx63jvNO2xLwYL4+WnalAx/RIWoEBWi8m2pzA6dDUP6+oj1BLDMR5+KiAL37hmeZRPu3lUWL47BuCtXTvb3t1jFJJTQdErt2hg0oWBBxdWrceISWyO3QmnZ5Nn2Mnu/gBJHR4SSv/7KLMGsXy/n3c3CFn8Rz6NWLRR9+TJJeluE5RljeWaOHInJnp0S3PPTdRbgvld+3/CXhgBY79+/lwRYQlu8vMwys8Tnz/H8QbVqUtpSnMKVpUfcIyuNOS497vfI38upygloVZoqvZpZrXsIQFG1KuaubtmSDH9EhagQFaLybansjNwpkoKPAJYo+jgiDXh5GQAsdssWKkcOdLXu1CktIsIaFXEouXs3oXhxJR9Tnvb3TxYv3y3azQ59wexcGBe9cpT16kFt2UuX9OmKjysB/yI2btQrrXFjDLX68GGC9LY0UzaDsk6zpzP/af16Rjg0sHhx2BcLSx/THd47tG7fum3btomJiVJUMtri4WGWmcUcPoxHCPv3l9KWVopW0BB31t1iYw5PC18ZvrKosqiAVtWYar8zvzMco1eOonFjkdzVZPgjKkSFqBCVr1blatxVGN7bce0IYJmPPvWQbDw82C/ZilWNHStASejMmXohKy1QEYGSLVvYHDkQ8jp10kREpIkXfjLmZDZ5NmPH35TNmiGUnDql+yI9bRo2xN4+6sv46cLVpg2GWvX2jpfelnbKdlAB3a1J4VqyhOE7TL5xoz6MhqaG5r2dt02bNoO/TMAsBlhCW06fNsvMwhYuxFW6ZcukqIyjx2H6GnqhBcbMpXCzQ2fnU+QT0KqJusn52PPAkQbLYdauBbqC/8nwR1SIClEhKt+WSkByAGbgVZUngGU++jRDwDp9Wgew/PyUrVvL+QBZ0W5uNlExCCUsqxk7ViVAycyZoSYp7krcFQfKAekq3HBwAWW7dgglhw5l/M5x9MiR6F6dPTu7a5fBMrt0wUhgV67ESW9LV2VXqMN+dr/ui9Om0TzFyV1dozKX8zbpbfHjxQGwFi9eLBWwhLYcPmyWmQX27Al3xZw4IUVlC7sFGtJb2Vu6MUekReyN2lubrS08CPjXSdPJO96bDExEhagQFaLyn1RJTk/OJs9mL7dPSk8igGUm+rRDwDp8OAOwuDt3KP4YGlW0qPrCBVs9zsxQ4uenad1aKYQ5dXOLNlmsT7xPbgqDac0NnWsUSvgkx+y+fRmLcP36IQPkzMm6uxv7aPbpg271Z87ESm9LH2UfqMYOdscnitOMHIl0lT07tWsXa6zyFX7DI4T79u2TClhCW/bvN8vM6J9+wiOEvr5SVK6or2D+acpR3MyYFOZIzJGJHybWZGoKUezhH/wwIGjA88TnZGAiKkSFqBCV/7ZKRRqPqb1Pfv9/DVgJd+6ELV4cc+JE0tu36SkpktCnK1LO/v0IWOzRoxQfpV1RvTr35IkNH6celNy5w/3wA24LFi1KXbigNlnm48TH+RWY2mXChwliUNKnD7p4b9+uUamUXbogJubNq90xNFiys3MQz5cx0tsyWDUYarKZ2SwswvXrp+IpTu7uzhpTORlzsvrs6gBYf/31l1TA4tvC7tgh3czSExLk2bJR2bMbjFKWuRA5JwdOcpA76HlNcRrupvrmOmbd4KDBWtd14V9OKmcDtkEdts6pmFNkYCIqRIWoEJX/B5UOXAcY/z3jPP+vAQvoSjsbUjlzsnXqBA8dGrFxY9zVqymc4XOCffogYO3YwdLLl2OABJlM9fPP2gDitnqculBy9ChboADSVfXqiidPOJMqvkm+hRWF4XbnIOe0j2kiKqrBg/HA49q1ilat5PyJRF0ncYOFjxnzAd64b1+U9LaMUo2CyqxmVv+vvbOPifLI4zg019raP9pqQ0xsCG2lYsi1SFGK4sIKhKsCbvAAseaAVkX0RKuljShQqUHwKi9LXw4qOUyMmJYYLBWtNJeCaO/wNaYqENgFdnnxfEGtAlJlbxYag+yzz87zPDPLy34/IYSwzzO/mXlm5vnszPPS2tr57rvm2nv++ZbvvvtjCrBvsK/7YXfjQCORwure6vJ75SV3SyK7IufHzieC1dzcTBlluCztn39O380eXLxoLr6HB31Z3HRupCw/G39u7WytMFaktqcG64NfaH5hpFS9pHsprDMsuye7rq+uf7AfAxOiIAqiIIpDRVn7P/MFu1/c/sKxZ7Dq6m7u2NG1bFnbq68OP3X9iZ8XX9T7+bUmJLTv2WOorOxoajKrz0rzBEz2vH+YN3B2btu6tXOEio1M/P79wYaGgRMnej/++LpKZSS/yd/kP6PeMyMuJZ9+2jZkcc1hYa2PXwPz4MGDW7duGQyGq1evnj17tqampqqqqqCgIDk5Obck1/WUq3OT87KuZb8P/m5DSt5/32yWrq7m3y4uxiefcSBYjRs3XieZ0Wpv0zdNjd781DWf5vkzSv/q9GXonw4umPXrn91a3Ka3TH+6+Wmn0ZVu/nmq8amAxQGBiwMHBgZoBWuoLO27dgl+OtjX97C7e6Cxsb++vre6+l55+d2SkmurVpFdjCoVfVl8db4ke7NaZj3T/MzIDM9smRmpj/z6ztfEbgdNgxiYEAVREAVRHDZKTk8OOS98eONDhxaskTz67be+X365U1x8fePGjsBA3bRpo8/7zs46V9e4mUXkz3SnvzU/95zhm2+IXF282HH0qLG4uD0joy05+bpG0+XtbXj5Zb2ToDsM/ZBPyTZkS7J9WhrxlV8PHDj7/fe1P/54oqKioqysLDQz1CvRyydR7fGX9zwXvxcStTImPmZ5zPKwiLCgoKBAmwQHfrD6g6ysLJJUfX39jRs3hKVk6JJ2s1298krH6dM0TTM2tnvI9jpLSu6Wl9+rru6tr+9vbBzo7n7Y1yd8T5yfzs96TZgX0Vz0Lu5t7j4Gn6COoMiuyIRrCZr/akghwlaG0XcAvUZjXqudP18fE6NfskTn7697880WN7eW6dPNl61ZPxiSBGv4lc9mBWx+ak7LnPi2+K8MXz1+4D4GJkRBFERBFEQpv2d+80dEVwQEyyodFy4YDh5sS0trjYrSeXo2TZlycurUULdEL68173j8fdE7e7y88l5/PdfNTfiHfOTtna9Wa4OC0gMCkoKCPlGrM3x9t86dm/T223G+vtELF4arVBS2ZIEqWOUf7u+/wl+VoFJvUIekhITvDA9PDZ+XOG/u6rmB0YFqtXrULkuXLk1KSiLKdeDAgZqampah2TDdG2+YbWHaNME3zAjOkwUE7PLySvTw2C5Y5Ndey50zJ9fLK9fXN0+lygsJyVu6NG9hXMzclYs8VizxWE6kb2OKNmW7dnumNjNHm5NfmP8vIdLT00mek5OT6TuAzs9PxKJapkzRu7i0ubsbfHw6goK6IiOvJSR0R0cTu7pdWEgfJac9Z55+Xnp7ekNnAwYmREEUREEURLFM5EL/BXLi8Wz3hGBZ5cqVK8eOHSsqKkpLS4uLiwsODg7kgFpNkiWmFePrG//WW0menls8PHZ4Lo3yil00e3VwyD+XhZaHLjq6yPvf3u6n3WdcnPFsw7MiE0IzWmf0POrp7e29fPlyZWWlVqvdvHlzeHi4RVB1dHT0mqiotQsWfBIfn5GRkZKSsmHDhoSEhJiYmIiICKp5Ms5s2rSJvgO0ZWYSx9LHxxtycw379hm//dZ47FjHqVMdly51trZiyEAUREEUREEU+0S58+gOOR1PbZk6rgXLaQS8Bev+/fvDUlJQUEBO7dakRKNZGxCQqNGkf/SRNjOzMC+vcCSlQmRnZxPLyc/Pr6qqqq2tPXfuXENDg8Fg6OnpGRgYeGIaRme+YfDQIePOne2zZ+tKSw2Ch7N/sP/aw2tNA01n+s/81PvT8IXhmTcziS9X3KuwJovHjx8vLi6ml8WQkBCNRrNq1arExMQtW7aQHXNycoiKkbKQEgmWND+/MCen8LPPCnfs0KakaJOTtYmJ2qiotAUL1q1enVYohGA6JBA5BIcPH0ZnRhREQRREQZQJF2X4jR2dDztN4wknQSviJFiXLl3at29fampqbGys5bJaWFjY+vXrd+/ePbyspiP6M1kajdFoPHPmDPGbdevWkQKWlZUdOXKkurq6rq7u/PnzxP/a29vRzRAFURAFURAFUWRE8TWa74g62XdynArWKCVS6FiCuxO7Gjlhs2bNmqysrEOHDolcGI6miSiIgiiIgiiIgigiUVZ2m5+1VHq31CEE6wchioqKtm3btnfv3v3791dWVv4AAAAAAKCMFf9ZQQSL/LZ/6DEQLAAAAAAAO1DbV5t2M438dogZLAAAAAAAhwWCBQAAAADATbBMTO8iBAAAAACAYP3hVayegwUAAAAAAMHiHEaWt8kQPtmOSL+L05NwqgQnC8ZnjVnuRZNtkU+ZWL61RGgSF9+G1WN4RyYi6UDLK5TsA0qZOKcas9YLJLUxy80mQRuT2oM49Uq2NTm5yyK770tN0z5lYX5cFA5BDi1Yj2tK3saUlavkMjJJEqOw7DJS4FT8USctJsdUktsxz494PdhM3GYdchIshXKmsMZE2idN4uJlYTgyKinpKDlT3sasJULTxsS3UTgWCSaupFeKpMn12dTKY0lKk/dzthX2fanSxrUsUocIJWlO6CuXxq9gKd9X6vHmJ1g8ntrKSrCYF43V8MeqR9k8EUqtHyZHU8kgK7IvK0umT9zmzBbz4ygjQd41JqmNiW+jcCySansM0+Q9yrE6kY9hWZT3fbuNCTJGeIZtjOsZAYJlV62R2m/lrdyZ5K6TTkTBol9XmkCCxXaiSMYSIc3MhBJdEJzzp9QFa3P7PI6jjD44UQRLxlhEnzHmvXIMBUt2WcZQsJT0fZOC2UpOgiVviVBGmhACR2bxAAADaElEQVQs7oLF71Ink+J1BxkrcbKXSiXJn9T885A/SmNgmB+RZkDfV/npgqT1I/oBWmGNUa6V2FzPslbh9lxzoRGaSVNj8r6iyOiVIqLDpLea6KZClZdFXNm5lkVJ3zcpWLrlIVg202c18rMtCwTL3lqm8NIoO0wUyZ53lTohx2ma0PJ7J83oz2NpyeaXe3lfEGXPwUiqMXFTVFhjUqcoRCKyrTGpZ0pxM2bbxgQToWxjNvflKlhSe6X4lBur3qrckyhHGK6tgqYOpfZ9GWnarSwTq41BsJjZlUnKVd5K7lPgKlhKVMw+tU0vWGz3ZShYksZuJfezUCZi89YnqfsyFyz66Q1WdzOhjXE6+dknTSVHmcfR590qbF44weq48BsTJmUbg2Cx3J5TOBm3N5qszKuPuWDxmMCjrx/Z3/Nk14PyuwhNnC/ZprxFn22NibRPSXcR2pwI5DQfMLZtTMZdhKxOJPKmXRkuRTHsFPQth1VZmLcKqVNuysvCdUygbA82lykZpmmaaNj7OVjj8EFQ8iaW7PC4KdnXhMnLGMNjKvUZRUzyQ5MB5c8o4iFYUg+cQ9UYTROSvS+TGpOXMSVnU3m9j0mv5N32RC6alvQkMyVp8j7TMTwudhsTJnobc4gZLAAAAAAARwCCBQAAAAAAwQIAAAAAgGABAAAAAECwAAAAAAAABAsAAAAAAIIFAAAAAADBAgAAAAAAECwAAAAAAAgWAAAAAAAECwAAJtGAKPqKD/FtRNKcoC/6AABAsAAA0s73Ct/wZc02eLyocZwIlpLsQbAAgGABACa/YDE8908ydYBgAQAgWAAAxoJF/0L74b8tt7eZ2qgdxXNIv/GoPIiXQuT/glEotxdPB44FAAQLAOCIgmXpKILOZO0P+tRszgZJ3djScsRLQZNPm4IlqZgQLAAgWACAyS9YInNLIi5F86ns/yvfmH4XTiHk5QQAAMECAEwSwaL5v+Di14QQLElLeBAsAAAECwAwNoIlIhPjfAZLoRVBsAAAECwAgFLBss81WLwFy+ZMG/2FU4JRZFyDBbsCAIIFAHBQwTJJv4vQ8iPKuwj5CRZlKejv/hMvF2U6ECwAIFgAAACE1VOeueJJ7gBAsAAAAMiXMFQCAACCBQAAECwAAAQLAAAAAACCBQAAAADgmPwfdLnSnkTwT4kAAAAASUVORK5C" alt="Per base sequence content" width="800" height="600"/></p></div><div class="module"><h2 id="M5"><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[OK]"/>Per sequence GC content</h2><p><img class="indented" src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAyAAAAJYCAIAAAAVFBUnAABlMElEQVR42uzdCZxN9f/H8TMzxk6UnWxlC9mX7BWSouhX2ssvSqWy/ouk0iJUWhSJSlmyZosKyZIlIkvWuy9jHYwZxqz+n6/jd7vd2e5sd+7y+jw8eox7n3OWz/fovh/nnvM92mWKoiiKoigqT0ujBRRFURRFUQQsiqIoiqIoAhZFURRFURQBi6IoiqIoiiJgURRFURRFEbAoiqIoiqIIWBRFURRFURQBi6IoiqIoioBFURRFURRFwKIoiqIoiqIIWBRFURRFUQQsiqIoiqIoAhZFURRFURQBi6IoiqIoiiJgURRFURRFEbAoiqIoiqIIWBRFURRFURQBi6IoiqIoioBFURRFURRFwKIoKgD/nWua3y4tENsYsh2gKIqARVFB8onuqozeysNk4OW72Y0XHj5w0wkBi6IoAhZFBUO6yuivGf2cs+SUTywIEhUBi6IoAhZFBXO6ylkMSnsCzCOZebyVLna9kq7MJOq5/3qW25B2OVmeost8yRltcLpr8Wbh3gSsdLc5o9OQWQ5QLnuVs43hnx5FEbAoioCVRbpK9+d0P7kz+nTPiGW+8CwXm+VysjxFl67PJOFluZZMOpx59zIKQ97vo/cZ0fteZTToWa6UjEVRBCyKCpWAlflJjnyKCDkLTPn6es520Mu1eNPMbHXPr3qYV62gKIqARVHBE7By8HHozUepl9/xBUHA8ubLuLTLz+RXvP+K0Mu1Z+tbzhwsJ/OFXOYrQooiYFEUASuvAlZ2k01wnMHKfLHZXXiWS8jxt5B5u5wcHzkURRGwKCrIM1a27iLMq2uwMjmbksnCL+f6uiJvAlYm1yFl/tdsBSzvz2BleS1ULnuYrSHL8hqsLA8GiqIIWBQVzBkrx/NgZfcuwstZXeyV5V2EHktI6zPZBu+/qcyyOV7eOuflV4SXs3lWLJd3EWa06hz0irsIKYqARVEUFepJmiZQFAGLoiiKImBRFEXAoiiKImBRFEXAoiiKoiiKImBRFEVRFEVRBCyKoiiKoigCFkVRFEVRFAGLoiiKoiiKgEVRFEVRFEURsCiKovKvzs+da2vWTP5LKyiK8uuAle50L1HpVbq/jkQikb6UxkaNDJomf0wdO9pnzbqckkKXkLmXv1HBUgQsJBKJzFHAuvlmSVfGIkX0mGWtXfvsBx+knDtHl5C5DFic4AmCImAhkUhkjqTVapBoFRbm3LHD+sYbpho19JhlLFrU3rJlzKxZdAlJwCJgEbCQSCQye9KxfLn6crB+/avO4YhbvtzZrZsesyRj0SUkAYuARcBCIpHI7EnbmDESpCyPP+4ho0eNktePP/ooXUISsAhYBCwkEonMnjR3767OVE2Z4iHPz5olr58gYCEJWAQsAhYSiURmTzqdxrJlJUg5t2/3kBdWrJDXo+66iy4hCVgELAIWEolEZkM6NmxQ17NXqpRWxm/eLG852rWjS0gCFgGLgIVEIpHZkLZJkyRFmXv3TisTDhxQUzbUr0+XkAQsAhYBC4lEIrMhLQ88ICnK9s47aWXysWMqe1WsSJeQBCwCFgELiUQisyFNNWuq7wF/+SWtTL10SX17WLgwXUISsPytDJrvgg0BC4lEIrMn9XNUxpIlo+z2dKWxeHEBKXFx9BOZJwFLn1xN/5PRW8EdVghYBCwkEhn8Mm7RIvUlYOfOGUlL1aoCkux2+onMfcDyyATuf83oZwIWAYuAhUQiA0+eGjJEXcY+YkRG0ta4sYCEPXvoJzKXASuTQOBlVkj3FFe6p8QySnL6Dx4+k5NqHu96v+qMTtF5vJWtJWe+MQQs/uEhkUg/kvaWLdUUowsWZCSdnToJuHjlf6/0E1mAAcsjl6T7YlqQiU8bvLxZb7Z+zmRRudx4Ahb/8JBIpP/KlLg4Y6FC8sdpMGQkj91zj/x/PG7JEvqJzMOAlfYcUs6+Ecv8TFWOX8/DVXj5DWkmv5jlGglY/MNDIpH+JS+uW6ee8dy0aSbyRP/+Ys7PnEk/kXl+BivQA1a6X9hla1EZfeXnzZIJWPzDQyKRfirPvPmmesbzwIGZyNPDhok5+/779BNJwPLmV3J8BivHO0XA4h8eEon0L+ns1k1dgPXll5nIM2+/LSZ69Gj6icxlwLqcu7sIc3wNlpeXN2WSiry5CirHZ7AyX0IOrvQiYPEPD4lEFqhMTjaVKqWe8bxnTyby3GefiTn57LP0E5n7gHU5d/Ng5eyGOy/PYOXtXYRentzK1sZf5i5CAhYSifR/eWnXLjVBw403Zi5j584VdrxfP/qJzJOAFXAViFNkEbD4J4pEIgtMnvvkE/nkOPHEE5nLCz/9JCyqe3f6iSRgEbAIWEgkEpmFPH7lGc8x6V2A5S4vbd+urtNq1Yp+IglYBKwsApb2v0o3FaX7bnZfJ2AhkUg/l/ozcBIPHsxcJh49qr5JvOEG+okMzYBFZfsMVkYBK913s/s6AQuJRPqzTDKb1SMIy5XLUiafPq3myrr2WvqJJGARsHIYsHIZqjL/K//wkEik/8jz330nselY795ZLzM52RAWZggPv5yaSj+RBCwCVsEHrJUURVH+WjvvvFMC1pb+/b3BR0qUELx6/nz6RmW3CFgELM5gIZHIEJK2Ro0kM8Vv2eLNMi01a6qrtUwm+onkDBYBi4CFRCKR6cuUM2cMYWHGokVTExK8Waa9eXMJWJd27qSfSAIWAYuAhUQikenLsxMnSmCyNWni5TKdt98u/uKaNfQTScAiYOUkYF3mLkIkEhkC0tGunQQmR/v2Xi7z+H/+Iz52/nz6iczzgKVphoBLGwWyzQXbqGzPg5X7+a6YBwuJRAZewOrcWQLTmXHjvFzmyaefVlOSTptGP5E5Dlj/fobe1T++zw0eq8vZ2tP9rbS75uVavHw3u5uaJ3uawzNY+T+KBCwkEumP0lq3rnwCJOzd6+UyT7/8sviz48fTT2Tuz2Dl7Qd/gZwHyihg5WxFXspcBiyffkVIwEIikSEoUy9dMkREyB/5wctlnp0wQQLW6ZEj6ScynwJWRid+vH/dfTkZsXRfSbtYL9eVZaDxZi0ZbVLaM3wZnSHLvJ+Zb0NGDUy7LwQsJBKJzEIm7NmjHn1Tr573y4yZPl1+5eSAAfQTmR8BK924kDaFeP9z5iyjDJTWZIJzFrAy2tNcNsSbjcxBAwlYSCQSmQ0ZO3eumsO9b1/vlxm7cKH+K/QTmd9fEeYmN+ThYjP/0i1PAlZBNSRnDSRgIZFIZBYyeswYSUvyX++XeXHdOvkV56230k+kLwNWul+KeZ8PcvPrGS0nz78iJGARsJBIZJDIY336qDkX5s3zfpmXdu2SX7E3bUo/kQV1BivH+SNnv55PXxH64NwbAYt/eEgksmCkxy2E3iwzyWKRX7FUr04/kT4+g5X565mfmvLygqdMFpXJRV3Z+qYvu9dgebOF2d3IHF/LRcBCIpHIrGXaWwi9WWZKTIz8b9hUqhT9RPosYF3O0V2E3rCc3UXozRkpb+bBytYmXfbiLsJMNjIHdxESsJBIJDInMu0thF4uU8UyTXPabPQTmcuARQViEbCQSCQyM5n2FkIvl2kuV04FrH376CeSgEXAImAhkUjkvyrtLYReLtNap44KWJs3008kAYuARcBCIpHIf1XaWwi9XKajTRt1I+GKFfQTmd2ARQVHEbCQSCQyQ5n2FkIvlxnVo4cKWLNn008k0mcyUIqAhUQiQ1taLGlvIfRymccfekgFrClT6CcSScAiYCGRSOQ/5bwyIbvHLYReLvPU88/L79reeYd+IpEELAIWEolE/lP2zz9Pewuhl8vUr463jhxJP5FIAhYBC4lEIt0uwBoyJO0thF4u8+yHH6rJ3AcOpJ9IJAGLgIVEIpH/lPnOO9PeQujlMs9//bUKWA88QD+RSAIWAQuJRCL/KWPt2mlvIfRymXFLl8rvmrt1o59IJAGLgIVEIpH/qwxuIfRymfEbN6rHEbZuTT+RSAIWAQuJRCKvVka3EHq5zIR9+1TAqlePfiKRBCwCFhKJRF6tjG4h9HKZSU6n/LqxYkX6iUQSsAhYSCQSebUyuoXQy2WmXrwov24oUoR+IpEELAIWEolEXq2MbiH0fpnGIkVkCVEmE/1EIglYBCwkEolUldEthN4v01y5sizBuXs3/UQiCVgELCQSiczsFkLvl2m76SYJWI716+knEknAImAhkUjk1VsIjTfckJtlOjp0UAHrhx/oJxJJwCJgIZFI5NVbCM09e+Zmmcd69ZKF2L/5hn4ikQQsAhYSiURevYVQ/pubZZ54/HFZiG3yZPqJRBKwCFhIJBJ59RZC+9SpuVnmKT2lvfEG/UQiCVgELCQSibx6C6Fj3brcLPPMm2+qgDV0KP1EIglYBCwkEhny8n+3EMoPuVnmuU8/VQGrf386j0QSsAhYSCQy1KXrFsJcLjN29mx1pXyfPnQeiSRgEbCQSGSoS9cthLlc5oUff1TLufVWOo9EErAIWEgkMtSl6xbCXC4zfutWFbCaN6fzSCQBi4CFRCJDXbpuIczlMhMPHVJfNdauTeeRSAIWAQuJRIa6dN1CmMtlJp88qQLWtdfSeSSSgEXAQiKRoS3dbiHM5TJTExNVwCpUiM4jkQQsAhYSiQxp6X4LYe6XaSxRQpbmPHyYziORBCwCFhKJDF1pHTpUIpGpbdu8CVhVq6qA9ccfdB6JJGARsJBIZOhKiVZ5GbBuukldzrVmDZ1HIglYBCwkEhm60tyzp5qjYeDAPFmmuX17dUPiggV0HokkYBGwkEhkCAese+9VkWjKlCzlTz85rr/eKP/NLGBdiWv2L7+k80gkAYuAhUQiQzhgdemiItGcOVnKypWNmmaoUsWYibQ89JAszTZpEp1HIglYBCwkEhnC12A1aaKumlq1KnM5Y4Zd0lVYmFiD/JyRtD73nApYY8bQeSSSgEXAQiKRIRywqldXAWvLlkzkoUPOihXV6at77rHIf+VneSX9gDVqlCzNMngwnUciCVgELCQSGbrSWLq0RKKoQ4cykY89pnJVq1YmhyNK/is/yyvpStuECSpgPfoonUciCVgELCQSGaLSabOp7/wiIqKczozkpk3xYWGGyEjDhg3q8vbffnPIz/KKvJ5OwJo2TQWsXr3oPBJJwCJgIZHIUA1Ye/d6PD3Qw1y6lFq/vlUy2PDhVpeRn+UVeT0hIdXDO77/Xs2q1aEDnUciCVgELCQSGaoBa+NG9+fkpJVjx0ZLlqpTx2T9J19Fyc833qguyXr99WjPgPXTTypgNW5M55FIAhYBC4lEhqh0LFum8lDLlunKv/9OKFzYGBZmWLrU4bFAeUVel3fF/Ctgbd2qFli9Op1HIglYBCwkEhmi0v7NN5KHzN26pZWpqZfbtXNommHQoJPpLvOZZ07Ku+3bO1LdvieMOnRInRIrXZrOI5EELAIWEokMUWmbPFldk/7AA2nlZ5+duzKtqOXcuZR0lymvy7tiPv885p9lOp2G8HBDWFiU3U7nkUgCFgELiUSGorSOHaseRPjMMx5y+fK4IkXUVVZLlsRlsszFi+PEiBTvWqbhmmvUvA8HDtB5JJKARcBCIpEhGbBeeEEFrJdf9pA33aTuE6xb15rlMuvUUbJhw3+kqWZNWabzfzOX0nkkkoBFwEIikaElLY89pp5s8957HrJZM/VgnDlzzme5zNmzz4ts3tz+T8D697N36DwSScAiYCGRyBALWHffrQLWF1+4y9jYlEKFjPJHfshymR5YXjd37qyeHj13Lp1HIglYBCwkEhmK0ty+vTrbtGCBu1y9+oKmGdq2dXi5zDZt1M2GP/104eoye/dWAWvqVDqPRBKwCFhIJDIUpfGmm1TAWrPGXb788mkJTK+8ctrLZbp7dVbs8cfVWbHx4+k8EknAImAhkciQDFiVK6sL0nfudJfuZ6S8Wab7GS953frii+leOE/nkUgCFgELiUSGhDQULaoClsHgkmkvwMpyme6/ogLWa6+pgDVoEJ1HIglYBCwkEhl60myWJGQoXNhdpr0Ay5tluk56yeu2Dz5Qs8P360fnkUgCFgELiUSGnHTu2qUea1OxortMewGWN8t0/Za8bp85UwWsHj3oPBJJwCJgIZHI0AtY69apBzPXr+8u016A5c0yXee9VMBatEgFrFtuofNIJAGLgIVEIkNOpk1CR486016A5c0yXZdhyRKu5rYGDeg8EknAImAhkcjQC1hffqkCVs+eLjZnjj3tBVheLlM/9TV3rt25c6f65rFyZTqPRBKwCFhIJDLkpG3iRElClocfdrHnn7ekvQDLy2Xql2ENHmxxHj2qrp0vVozOI5EELAIWEokMvYA1erQKWM8/72LNm5vTXoDl5TL1y7BatDDLW8bISFlylNVK55FIAhYBC4lEhpa0PvusmrBqzJjML8Dycpnul2EZy5VT02vt2UPnkUgCFgELiUSGljT366eeafPBB5lfgOX9Ml2XYRlvvFE9gWfDBjqPRBKwCFhIJDLEAtYdd6inMn/1VeYXYHm/TNdlWKYWLVTAWr6cziORBCwCFhKJDC1pat1axaAffsj8Aizvl+m6DMt8++0qus2aReeRSAIWAQuJRIZYwKpTRwWs9eszvwDL+2W6LsP6+56H1JePn3xC55FIAhYBC4lEhpY0li+vLkX/6y/XBVgtWphzuUz9NNisVsPU/YlPPUXnkUgCFgELiUSGWMBym0xBvwBr8GBLLpepL2dQ1clqMvf/zRFP55FIAhYBC4lEhoRMiYlR862XKOF+AdbcufZcrl0/E9aswkb3OeLpPBJJwCJgIZHIkJBJZrMKWNWquV+AJT/kcu1XFxV+dK9W3NynD51HIglYBCwkEhlC8tKVJwaaGjd2vwArT9aunwz7WutovvVWOo9EErAIWEgkMoTkhZ9/VgGrY0f3C7DyZO1XL8PSRpiaNqXzSCQBi4CFRCJDSMbOm6cuk+rd2/0CrDxZu34+rKm2yFSzJp1HIglYBCwkEhlC8tyUKepBhE8+6X4BVp6sXS0wwhChHd5bqiKdRyIJWAQsJBIZQvLMm2+qgDVkyNixNk0z1KtnysO1161jkmWODnsqym6n80gkAYuAhUQiQ0WeeuklNdn6m2+2bKnCUKtWeRmw9GW20OY79++n80gkAYuAhUQiQ0WeePRR/Wk27durMDRypDUP1z5ihFWWeYv2nXPzZjqPRBKwCFhIJDJUZNSdd6rnMX/7bb16KmD98osjD9cuS5Nl1tFWO1asoPNIJAGLgIVEIkNFOtq0UXcRLl0RGWkICzMYjXm5dllamHY0Ujto+eY7Oo9EErAIWEgkMlSk9cYbJWBt+n67phmqVTPm+dqrFt8hS94wZgadRyIJWAQsJBIZKtJUtqwErK8+PSgx6NZbzXm+9s7VfpElz3x4Jp1HIglYBCwkEhkaMiVFfS8YHv7qaHU1+tNPW/N87U+1WCJLfqUDXxEikQQsAhYSiQwNmXz6tEHiT5kyDzygHmszaZItz9c+/t7vZcn/uXEJnUciCViaR/pxVW5eJ2AhkUh/k4mHD0vAMtas2ayZuoXwhx8ceb72xcPmqQfmlP2VziORBCwto+jj/lfXzxkZAhYSifRzGb91q7qFsHnzUqWMEoP273fm+dr3TF8oSy4ZsY/OI5EErKwDVnZfJ2AhkUg/lBdWrpSAta1DX8lA115rzI+1O1avLqPtlOXv3u2k80gkAcunAWslRVFUQdSmYcMkYE1r+pwEoIYN9+bHKn6eObOlpi7Deued9TScokKhcnUNFmewkEhkEMhzkydLwHqz3VQJQI88YsmPtTsPHeqnvXMlYFnpPBLJGSy+IkQikcEvo8eMkYD1eLNlEoDeeMOaL2t3Ol8Nf0qW/+TjJjqPRBKwCFhIJDL45clnn5WA1a727xKA5syx59PavyrdS5bfvvVhOo9EErAuZxmYuIsQiUQGujzer58ErArX/C0BaPt2Zz6tfUON9rL8iuWO0HkkkoD1r/TDPFhIJDIopbNr191aKUk/xYoZnM78WruxZati2j5Zy7lzKXQeiSRg+XB9BCwkElkQ0t6s2WKtiUSfRo1M+bd2c7duDbQVspZt2+LpPBJJwCJgIZHIIJeWGjUmaPdJ9OnTx5x/a7c88EAvbbKs5euvz9N5JJKARcBCIpFBLk0lSz6t/Z9En5Ejrfm3duvTTw/RBstaXn75NJ1HIglYBCwkEhnMMjUhwaBpt4fPkOgzfbotHwPWyy9P0XrIWnr3PkbnkUgCFgELiUQGs0w+dkwCVs2I9RJ91q935N/abePHr9Lqylrq1LHSeSSSgEXAQiKRwSwT9u8/oBWO0A5HRBis1nxcu23atINaZETYEVlRQkIqnUciCVgELCQSGbTy4oYN+omlWrWM+bp2x/z56lRZMTWd6f79CXQeiSRgEbCQSGTQyrgfftAvjere3Zy/AeuXXyRgdS01V9a1cGEsnUciCVgELCQSGbQyZsYM/ea+55+35OvanX/8IQHr6ZLjZF3jxp2h80gkAYuAhUQig1aenTBBn55q8mRb/gaso0clYE0s/JCs6+GHj9N5JJKARcBCIpFBK0+//LI+wfrKlfb8XrshMlKfMr5ZMzudRyIJWAQsJBIZtPLEgIFFtf0Seg4fdub32o0VKugPPSxe3JiayhghkQQsAhYSiQxS+ccdT0niqXztIR+s3VS3rkHTKpU/Kms0m5MYIySSgEXAQiKRwSm/a6yucO/SbL8vAlabNhKwujT/W9a4evUFxgiJJGARsJBIZHDK1yqNlrgz6EFfnMEy33GHupHwzu2yxg8/PMsYIZEELAIWEokMTvlgcXUL4SdvW3wRsB58UALWpIdXyxoHDjzJGCGRBCwCFhKJDE7ZMnyBxJ21q8/5YO3WZ5+VgLX06W9kjR06OBgjJJKARcBCIpFBKFPi4spoOyXuOJ1JPli7bfRoCVj7n39T1liunJkxQiIJWAQsJBIZhPLYbotknZLhe32zdtvEiRKwTg4cWLq0SdZ76lQyY4REErAIWEgkMtjkupl71bSfxVf7KGBNny4B61jfvq1b22W9GzfGM0ZIJAGLgIVEIoNNThmqbui7v/J3vlm7feFCCVjOLl2eeOKErHf69BjGCIkkYBGwkEhksMnne/4uQWdM4ym+Wbtz7VoJWLbGjd9776ysd+jQ04wREknAImAhkchgk10bqjNY394x0UcB688/JWBZqlZdujRO1tujRxRjhEQSsAhYSCQy2OT1ZfZI0Nkx6D0frd1olIBlLFr08OFEWW+NGhbGCIkkYBGwkEhkUMkLF1LDtKOR2sHTEz/w2doNRYpIxkqKvVi4sDEszCDbwBghkQQsAhYSiQwe+eeflzTNUEdbff7rr322dmPFiipg2e0NG9pk7bt2XWKMkEgCFgELiUQGj3zttWiJOG20OXHLl/ts7aYGDSRgJezZ07mzQ9Y+duwZxgiJJGARsJBIZPDIjh1VxGmlzY3fvNlnazffcosErIu//qqvXf7LGCGRBCwCFhKJDB7ZvXuURJxnteGJBw/6LmD17CkBK27RolGj1Pkz2QbGCIkkYBGwkEhk8Mj27dU5pLla6+STJ322dsvDD0vAivnii99+uyhrl21gjJBIAhYBC4lEBo+sUkU9iHBjWNXUpCTfBaznn5eAdXb8eKs1SdYu28AYIZEELAIWEokMEhkfnxoWZiikHTJcU9aXa7eNGSMB6/TIkcnJlyMj1UwNsiWMERJJwCJgIZHIYJAHD16Z6lNbZ61d26cB64MPJGCd+O9/5d0bbrDKNhw6lMgYIZEELAIWEokMBrlq1QUJNx20b+wtW/py7faZMyVgHbv3Xnm3a1enbINsCWOERBKwCFhIJDIY5GefnZNw86D2dtQdd/g0YC1ZIgHL0bGjvDtw4EnZBtkSxgiJJGARsJBIZDDIESNOS7gZoQ06/vDDvly749dfJWDZGjaUd8ePP6u2YcRpxgiJJGARsJBIZDDIvn2PSbj5WLvrWJ8+vly7c/duCVjmSpXk3e+/j5VtuO++Y4wREknAImAhkchgkM2a2SXcLNaaODp39unaLRYJWMbCheXd7dvVwxCbN7czRkgkAYuAhUQig0GWKWOScLNDK3vqpZd8vHZj8eKSsVJiY0+eTJZtKFvWxBghkQQsAhYSiQx4efZsiiSbEoUOSNCJ/f57H6/dcv31st4kq1VAyZIq58n2MEZIJAGLgIVEIgNb7tqlvpurX+I39dzltWt9vHZbkyay3ku7dglo3NgmWyLbwxghkQQsAhYSiQxsuWhRnMSabqXnSdBJ+OsvH6/dedttrmDXu7e61n7x4jjGCIkkYBGwkEhkYMtJk9T8CP1LjFdf1TmdPl778f/8R301OX++gJdeOiVb8v77ZxkjJJKARcBCIpGBLZ97TsWasRH/laCTmpDg47WffOYZWW/M1KkCPvpIzXf6/POnGCMkkoBFwEIikYEt77wzSmLNdO02U+nSvl979KhRErDOvP22gGXL1JeVsj2MERJJwCJgIZHIwJb166unLK/S6rqe9OzLtZ99/30JWKeHDROwd2+Cuty+vpUxQiIJWAQsJBIZwNLpjCpa1CixZp9WzN66te+38/xXX0nAOvHEEwJiY9WEEbI9slWMERJJwCJgIZHIQJW7dzsl05S75rCknKi77vL9dsYtWyarPtarl27KlzfL9shWMUZIJAGLgIVEIgNVLlvmkEDTsvZu12kkH29n/KZNsmpHu3a6ad1aPbRn+XIHY4REErAIWEgkMlDlp5+quT37NlWzjJ4ePtz325lwQM0gb61fXzf9+h2X7Zkyxc4YIZEELAIWEokMVDlypLrCfUjbRZJyzr73nu+3M/n4cVm1uUIF3bzyymnZHtkqxgiJJGARsJBIZKDKfv3UNU8ftP9ETUY1Y4bvtzM1MVFWbSxUSDfTp8fI9shWMUZIJAGLgIVEIgNV3nKLCljz2w6XlBO3dGmBbKepVClZe0pMjPy8Zs1F2Z527QhYSCQBi4CFRCIDVlatquZo+L3ZPRJx4n//vUC201Kzpqw90WSSnw2GRNmeatWMjBESScAiYCGRyICUVqszIsIgf4w31FMR5/DhAtlOe/PmsvZLO3fKz4mJqfomybYxRkgkAYuAhUQiA09u2aLmaKhRw2IqU0Z9SXfmTIFsp7NbN1n7hZ9/1ln16hbZKtk2xgiJJGARsJBIZODJ+fNVwOrS2SH5xhARcTk1tUC283i/frIBsfPm6axLFzX3qWwbY4REErAIWEgkMvDkpElqEqwnH7S4T5Tg++08+eyzsgHnpkzRWf/+J2SrZNsYIySSgEXAQiKRgScHD1Zfxr0++JDkG1vDhgW1ndFjxsgGnBk3Tmfjxp2RrXrhBStjhEQSsAhYSCQy8GTv3mqOhq9Gb5d84+zcuaC28+yHH8oGnHrpJZ1999152ap77jEzRkgkAYuAhUQiA082a2aSKLP2rR/V45bvu6+gtvP8rFnqSYiPPaazzZvjZatk2xgjJJKARcBCIpGBJ6+7Tk2CdXj8TMk3JwcNKqjtvLBihWxAVM+eOnM6k2SrZNsYIySSgEXAQiKRASaPHlU36xUpYoh+403JN9FjxhTUdsZv2SIb4GjbVmepqZdlq2TbDAYno4lEErAIWEgkMpDkunVqjoYbbzSeeuEFdRPfRx8V1HYmHlJX2Vvr1HFJ2SrZtl9/dTCaSCQBi4CFRCIDSX7zjV1CzG23mY8/9JCahmrOnILazuRTp9Q8Eddd55KyVbJts2bZGU0kkoBFwEIikYEkx41Tk2D17291du3qPpF6AWxncrIhLMwQHu6a6fTJJ62ybW+9ZWM0kUgCFgELiUQGkhwwQE2CNXas1d60qXoU4K5dBbidHs/qee01FbBkCxlNJJKARcBCIpGBJLt3V1/DzZhht1SrJuEmyWYrwO201q6tnjZ99Kj+V9kq2TbZQkYTiSRgEbCQSGQgyfr11SRYv/ziMF65Zy/14sUC3E57q1bqLNr27fpfZatk2xo0MDGaSCQBi4CFRCIDSZYooe7UO/jnUUk2phIlCnY7o+64Q10HtmqV/tdDh6Jk22QLGU0kkoBFwEIikQEj9+1Tk2Bdc43BsW2bJBtLjRoFu53HH35Y3ck4e7ZLli6tpsLav9/JaCKRBCwCFhKJDAz544/qO7jGjU2OVaskyNhbtCjY7TzZv7963vPbb7tko0bqG0zZTkYTiSRgEbCQSGRgyGnT1FXkd91lts+erR5T06NHwW6nrVEjNdfojTe6ZM+e6hp82U5GE4kkYBGwkEhkYMjRo9UkWM8+a7V9/LF60PKjjxbsdsYtXmwqVkxNKD9lii5l22QLZTsZTSSSgEXAQiKRgSEfeURNgvXuu1br669LrDk1ZEiBb6dkLNkSY7FiiQcPyuuybbKFjz5qYTSRSAIWAQuJRAaG7NhRXeE0Z47deuVBhGfeeccftvPElSux7C1aOK3W2bPVl5idOpkYTSSSgEXAQiKRgSFr1lQBa9Mmp+XK7XsxX3zhD9uZcv68tVYtdTHWiy9u3Kjuc6xZ08hoIpEELAIWEokMAGm3R0VGGsPCDGZzlLlHDwk0cUuW+Ml2xm/ebIiIkD/GhctlC2U7HQ5GE4kkYBGwkEik38sdO9TJoYoV1ckhU+vWErDiN270n+2MHj1azX1avXrFCmoqLNlaRhOJJGARsJBIpL/LRYvU5U2tWqnLm4w33CApJuHAAf/ZztTERNPNN8tWtSy3TrZz8WI7o4lEErAIWEgk0t/l4MHqBr3OndWjlI1ly0qUST51yq+207lxo6Fo0Q7aN7KdgwdbGE0kkoBFwEIikf4u27RRV7i3bWuKstsN4eHy53JKir9tp/Wdd1pp82Q729TbyWgikQQsAhYSifR3eeut5itnhmzOffsMmma+7jr/3M5nrnlbnWkrMZ/RRCIJWAQsJBLp77JdOxWwFixwODZsUHMi1K/vn9s594np6kzbdT8xmkgkAYuAhUQi/V1Wr66+ItyyxWlfskQClqNDB//czo2f/SjbeX2RrYwmEknAImAhkUi/lg7H1UmwLJYo+4wZErCO3Xuvf+6RecvOMO1oIe2QPhUWo4lEErAIWEgk0k/ln3+qSbAqVFCTYNkmTpSAdXLgQD/dI4ejvLZVtvbP342MJhJJwCJgIZFI/5XLljkksjRvruZosL78sgSs6FGj/HaPmhZZKVv7w6dbGE0kkoBFwEIikf4rP/tMzTLau7eaXMoycKAErLMffui3e3RXhe9la6c8u4rRRCIJWAQsJBLpv3LUKDXL6HPPWVXAuu8+CVjnv/3Wb/fomUbfyda+0m0xo4lEhkrA0v5X6b7o5esELCQS6WP52GMWiSzvvKMClrlLFwlYF1at8ts9GnfnXNnaRxosZDSRyJAIWO7pJ92f0wasTGITAQuJRPpM6rOMzpqlHvCnP/Lv0o4dfrtHX73wg2xtl3LLGE0kMvgDVkYhyctQ5WXGImAhkcj8kHXqqEmw1q1TMx8Yq1aVgJVkNvvtHq35YoNsbZ3CvzKaSGSoBKy0X/nlbcBaSVEUlQ9VtOjRK9O4r5KfjxQpIgFr1aJFfru1C79ZLFtbTNvHwFFUQJe3Acs9PGX3a0HOYCGRyIKSf/+tJsEqXdqghMkk6cpQpIif71GpsL9kM/dv2MNoIpGh9RUhAQuJRAaK/PlnNQlWgwZq3k7njh0SsIyVK/v5HtUvtk62efVHaxhNJJKARcBCIpH+KGfOVJNgdeumZhl1/PyzBCxTw4Z+vkddKy2Xbf5y4EJGE4m8HDp3EWZ0GRZ3ESKRSD+Ub75pk7DSv7+aZdQ+b54KWJ06+fkePXGzugzr9du+ZTSRyJAIWMyDhUQiA04OHKgmwXrtNTUJln3KFAlY5vSe9OxXe/Tq3Utlm5+qR8BCIkMgYPlifQQsJBKZ1/LOO9UkWF98YRNgGzdOApblqaf8fI+mDf1FtrnHtfMYTSSSgEXAQiKR/igbN1aTYP34o5oEyzpkiAQs68iRfr5HK2bulG1uFPkjo4lEErAIWEgk0h9l2bJGCSt79jgFWB57TAKWbfx4P9+j3X+q68bKajtSExIYTSSSgEXAQiKR/iXj4lKuzHtlcKp8FWW+6y4VsKZP9/M9kq0tHHZQtvzcX4cZTSSSgEXAQiKR/iUPHEiQmFK7tlEH5rZtJWDZFy3y/z2qWex32fJd09cxmkgkAYuAhUQi/UuuXn1BYkqnTiYdmOrWlYDl+PVX/9+jDpV+li1fPHgBo4lEErAIWEgk0r/ktGkxElMeesiiA2O5chKwnHsC4BE0DzZZJVv+QbevGE0kkoBFwEIikf4lR42KlpgycqRVv7LJEBFhCAtz2mz+v0fDe6kzWC/W+5LRRCIJWAQsJBLpX/Lhh49LTPn4YzUJVtSBA4Yrj30OiD36aPhm2dg+ZTmDhUQSsAhYSCTSz2T79upJz4sX29UJrM2b1ZOea9UKiD1a9M0B2fKWEQsZTSSSgEXAQiKR/iWrVVPPydm+XU3S4Fi2TD2IsEWLgNgj2WbZ8srappToaEYTiSRgEbCQSKS/yMTE1PBwddmVzaYClv3rr9WDCLt3D4g9km0O145EaIfjtu1gNJFIAhYBC4lE+os0mRI1zVClytVJsGwffKAC1oMPBsoeVSqqHpjz95SljCYSScAiYCGRSH+Rv/12UQJK69ZXJ8GyjR6tnvT83HOBskctK22Q7V/59AxGE4kkYBGwkEikv8hZs85LQOnb16y/ax00SD3p+bXXAmWP7mmyTrZ/SpePGU0kkoBFwEIikf4ix407o6aSetGqv2u5/371IMLJkwNljwb33qgm8bphMqOJRBKwCFhIJNJf5FNPnZSAMmGCTX/XfPvt6kGEs2YFyh5NGLlLtr9fqSmMJhJJwCJgIZFIf5Fdu6qZDubMsevvmpo1UwFr5cpA2aM5s8yy/e3Dvk1NSmI0kUgCFgELiUT6haxTxyoBZcMGx9WAVb26etLzli2Bskey5bL9tbQ1iSYTo4lEErAIWEgksuBlaurlIkWMElCMV2dpiDKWLKme9HzoUKDskcGgzsAV0f6+sGYt445EErAIWEgksuDlsWPJkk7Klbt6C2GUxaKekxMZGVh7VLbIPtmLo+9/w7gjkQQsAhYSiSx4uW1bvESTFi2uXoDl3LVLBayKFQNrj5pU/kP2Ys0THzLuSCQBi4CFRCILXs6fH3tlEqxjVwPW2rUqYDVoEFh71KulClhftnuLcUciCVgELCQSWfBy0qSzEk2GDj2tv+VYsEA9J6dDh8Dao8H99spejLn+TcYdiSRgEbCQSGTBy8GDT0k0+eijc/pb9qlT1XNyevcOrD36YJxd9uLxouMZdySSgEXAQiKRBS979Tom0WTJkjj9LcuAASpg3XlnYO2RbL/sxW3a9JSYGMYdiSRgEbCQSGQBy5tvtkk0+fPPS/pbprZtJWCZbrklsPZItl/2or62MuGvvxh3JJKARcBCIpEFLK+5xiTR5PTpZP0tc6dO6gzW4MGBtUey/bIXpbVdcUuWMO5IJAGLgIVEIgtSnjuXIrmkRAmTS5patVLPyVm8OOD2qHjkIdkX29sfMe5IJAGLgIVEIgtS7tmTIKHkpptsLmmsWFFN475jR8DtUf1Kf8m+bOw3lnFHIglYBCwkElmQcvlydW34nXdGXZVmsyEsTE3j7nAE3B51a64C1qwWIxl3JJKARcBCIpEFKT/99JyEkkGDTurSuXGjmmW0Zs1A3KOBDxyWfXmr4nDGHYkkYBGwkEhkQcqRI09LKBk//qwu7bNnq1sIO3UKxD16580Tsi8DI0ZfTklh3JFIAhYBC4lEFph84IHjEkrmzo3VpfXdd9UthI8+Goh7NGeOeuZPT+2TJLudcUciCVgELCQSWWCyTRuHhJLff4+/GrCefVYClm306EDco82b1VOrm2iLL27YwLgjkQQsAhYSiSwwWamSWUKJ3Z6kS3PPnmqOhmnTAnGPZC9kX8prW0+/8grjjkQSsAhYSCSyYOSlS6lhYYbISKN+zZK8bmrUSAKW48cfA3GPZC8KhR0O046aOtzGuCORBCwCFhKJLBh55Eiiphlq1bK6pKF0aTUJ1v79AbpH1Uvvkj3a2uMZxh2JJGARsJBIZMHINWsuShzp0sV5VR46pOZoKFEicPeoY/0/ZY8WdXudcUciCVgELCQSWTDy//7vlMSRHj2u/tXxyy9qjoYGDQJ3j7o13y17NPiGLxh3JJKARcBCIpEFdL6no7qFsFMnh/5X+5dfSsAyd+8euHvUvskB2aO2pVcy7kgkAYuAhUQiC0Z27+6UOPLKK9H6X62vvaYmwRowIHD3aMRTajL3ziUWMO5IJAGLgIVEIgvyDNavv168GrCefFJNgvXWWwF8VdkCu+xR68KLGXckkoBFwEIikQUjr7/eInHEZErU/2q+7TY1CdasWYG7R4YDajL3KmGbGHckkoBFwEIikQUgExNTw8MNERGGpKRUXRpvvFFNgvXrr4G772qntCMR2uHEmDjGHYkkYBGwkEikr6XRqCbBql7dctWlphqKFFGTYBkMAb3vlSO2yH4d3WJj3JFIAhYBC4lE+lquW3fxyi2EVyfBSnI61SRY110X6Pveuvgy2a9fZv7NuCORBCwCFhKJ9LWcOfO8BJHHHz+hs/jNm9UcDc2bB/q+31fhW9mvL17ZybgjkQQsAhYSifS1fO21aAkiY8denaPh/HffqYB1zz2Bvu9D634u+zWq3xbGHYkkYBGwkEikr+Vjj52QIPLVV+d1dmbcOAlY1hdeCPR9n9xusuzXQ+0JWEgkAYuAhUQifS49JsE60b+/mgRr0qRA3/cl970v+9Xuhj8YdySSgEXAQiKRvpYek2A5O3dWczTMnx/o+75ryAeyX9Wu2cO4I5EELAIWEon0qUw7CZalenUVsLZsCfR9PzX5UzUVVtgR2TXGHYkkYBGwkEik76THJFipiYkqbUVEOK3WQN/32NmzK2ub9JNzjDsSScAiYCGRSN9Jj0mwEg0GNQlWtWpBsO8XfvyxlTZPv7yMcUciCVgELCQS6TvpMQnWxTVr1BwN7doFwb7Hb9lyr/a+foMk445EErAIWEgk0nfSYxKsmOnTVcDq1y8I9j3x4MHB2hB97xh3JJKARcBCIpG+kx6TYJ1+5RU1CdbIkUGw78knTozX7tfPzzHuSCQBi4CFRCJ9Jz0mwTrer58ELPuUKUGw76mJid9pt+hXmDHuSCQBi4CFRCJ9Jz0mwbK3bq3maFi+PDj2/bfi9dQ9ktebGXckkoBFwEIikT6SVqvTYxIsc/nyErCcu3cHx74bqtZQU2FFGGw2J+OORBKwCFhIJNIXcutWh/skWCmxsWqOhqJFo5xBEkdsjRvrU2Ft2+Zg3JFIAhYBC4lE+kIuWGB3nwQrYe9edYV7/fpBs+/Ozp31qbAWLrQz7kgkAYuAhUQifSE//NDuPglW3LJlErCi7rwzaPb92L336lNhTZ5MwEIiCVgELCQS6RM5dKjVfRKscx99JAHr1PPPB82+n+jfX58Ka9gwK+OORBKwCFhIJNIX8j//sbhPgnXqpZckYJ19//2g2ffTw4bpU2Hdf7+FcUciCVgELCQS6QvZpo3JfRKsY717S8CKW7w4aPb9zNtv61NhtW1rZtyRSAIWAQuJRPpCVqlidJ8Ey9aokQSsS7t2Bc2+n/vss/Xa9bKPVasaGXckkoBFwEIikfku006CZSpZUgJWytmzQbPvsXPnHtIKhYcdTXcqLI4QJJKARcBCIpF5LD0mwUo+eVLSlals2WDa9wurV8tOVSm6I92psDhCkEgCFgELiUTmsfSYBOvS9u3qKYTNmwfTvus71brUynSnwuIIQSIJWAQsJBKZx9JjEqzY77+XLHLsvvuCad8TjxyRnepb6ot0p8LiCEEiCVgELCQSmcfSYxKss+PHSxY5PWJEMO178qlTslMvFBuV7lRYHCFIJAGLgIVEIvNYekyCdXLgQMki5z77LJj2PTUpSXZqfHi/dKfC4ghBIglYBCwkEpnH0mMSLGfXrpJFLqxeHWT7bipVKqOpsDhCkEgCFgELiUTmsfSYBMt6ww0SsBIPHQqyfbfUqJHRVFgcIUgkAYuAhUQi81J6ToKVnGyMjDSEhaXGxwfZvtubNs1oKiyOECSSgEXAQiKReSn1SbCqVjXqbyVZrQZNs1SpEnz77rz1VjUV1nUH0k6FxRGCRBKwCFhIJDIvpT4JVtu2Zv2ti+vXSwpxtG8ffPt+rG9fNRVWnZ1pp8LiCEEiCVgELCQSmZdSnwTr/vuvTuN+bvJkSSHHr0yCFWT7fnLAADUVVov1aafC4ghBIglYBCwkEpmXUp8Ea9gwq/6WfoW7rVGj4Nv30yNHyq691HFx2qmwOEKQSAIWAQuJROal1CfBmjzZrk5fffqpRBBj8eIXli4Nvn0/8+67sncTb5uadiosjhAkkoBFwEIikXkp9UmwFi60Jx48aCxWTCJI3JIlQbnvMVOnyt7N7TY27VRYHCFIJAGLgIVEIvNS6pNgbd1ssTdvLvnjRP/+wbrvsfPnyw5uvP3JtFNhcYQgkQQsAhYSicwz6ZoEyzj4JQkf1lq1Us6fD9Z9v/jLL7KPRzp00XfZfSosjhAkkoBFwEIikXkmr06CVf6g4UroiN+8OYj3/dKOHRKwTDffrJ+0c58KiyMEiSRgEbCQSGSeSX0SrNZFlkjyiH711eDe90SDQQWsGjVcl51xhCCRBCwCFhKJzHupT4LVR5tkuvnm1MTE4N73lOhoCViG0qVdN05yhCCRBCwCFhKJzHv50t1rJWq8UGi4c+PG4N/3lBRDWJj8GTrE4jEVFkcIEknAImAhkci8kY6vv+4TMVmixqS+c0Nk301lyhg07cO3D3tMhcURgkQGdsDSrlTaV7x/nYCFRCLzSprq1WulzXNdjRQK+26tVUsC1vxPd3pMhcURgkQGYcBKNx5l9DoBC4lE5pU03357ZW2T6366UNh3fa6vLV+v9ZgKiyMEiQzggKUHIPcYlN2wRcBCIpF5KA/fUC9cOxIRflSfESoU9t3ZtasELMuc+R5TYXGEIJGBGrDSDU95G7BWUhRFeV9Ll66PqKlphvLlDoTOTu/u0EEC1oaXXy5X7qDs+8yZP3MgUJR/lh8FLM5gIZFI76Xjt9++025xvxQpFPb95NNPS8CyTZjgMRUWRwgSGZBnsDIKVQQsJBJZUNI2ffoz2v9JyLj11hAKWKdfflkFrNGju3Qxq/kpXrBxhCCRgR2wPIqAhUQiC1ZaR47UbyFs29YUOvt+dsIE9cjF557Tz2CF1L4jkUF7kXvOQhV3ESKRyPyQ5nvuaa99KyHjxRetobPvMdOnq4vcH374xRfVXKMdO5o5QpDIoA1YzIOFRCJ9L40NGtysLZGQsXy5I3T2PXbhQglY5rvuWrZMPeW6WTPOYCGRwRKw8nF9BCwkEumldDgMRYpco/0pIWPv3hCaquDi2rUqYHXosGePU/a9TBkDRwgSScAiYCGRyLyRzi1bdmplJGGULBlak21e+vNPCVimhg3lXdl36cDBgxwhSCQBi4CFRCLzQtq/+WaJdrPEi4YNTSG170lmswQsY7Vq8q7su3Rg1SoHRwgSScAiYCGRyDyQtldfnaz1knhx992h9cDjlHPnVMAqVUrelX2XDnz+uZ0jBIkkYBGwkEhkHkjL/fcP0QZLvBg8OLQC1uXUVPWIHE2Lsttl36UDI0daOUKQSAIWAQuJROaBNDVp0kebJPHigw9sobbv6sp2TXPu3y/7Lh144AELRwgSScAiYCGRyDw4i2MsUaK5tkDixeLF9lDrkrFmTRWwfv990SK7dKBVKxNHCBJJwCJgIZHI3Mokq1USxnXhOyRe7NrlDLmzd02byu47fvzxzz/VTA3lyxs5QpBIAhYBC4lE5lZeWL16j1ZCskXRoganM+S6ZO7cWQKWfe5c2XfpgPTh6FEnRwgSScAiYCGRyNw9j+/DD1doDSRY1KtnCsEumXv3VgFr6lQB0gHpw5o1Do4QJJKARcBCIpG5kicHDJii9ZBgcccd5hDskuWJJ9Tznt99V4B0QPowfbqNIwSJJGARsJBIZK6ko127EdogCRaDBllDsEvWF19UAevllwVIB6QPo0cTsJBIAhYBC4lE5k6aypa9XxsvweK992yhGLBee00FrEGDBIwfr2ZqePhhC0cIEknAImAhkcicy+RjxyRetC6k5miYP98Rgl2yffCBet7zgw8K+P57h/ShXTszRwgSScAiYCGRyJzLi+vWSbyoVFjN0bB9uzMEu2SfMUMFrB49BGzbpgJW5cpGjhAkkoBFwEIikTmX56ZM2a8VDdOORkYa7PZQ7JJ90SIVsG65RYB0IDLSGBZmiI9P5QhBIglYBCwkEplDeeq551ZrdTTNULu2MTS75Fy7Vj3vuUED3UgfpBv79ydwhCCRBCwCFhKJzKF0dukyTesqkeL2280hGrB27FABq0oV3UgfpBtLl8ZxhCCRBCwCFhKJzKE0V6w4SntKIsVTT1lCNGAdOaICVvHiuvnvfy1XHnp9liMEiSRgEbCQSGROZEp0tGSLRyLVHA1vv20L2S4ZCxVSz3u2qmnA3npLzdTw7LMnOUKQSAIWAQuJROZExm/aJMGiY+kfJFLMnm0P3YB13XUqYO3dKz9/951dutGtm5MjBIkkYBGwkEhkTmTM9OkSLKqX3CmRYvNmZ+gGrNq1VcDatEl+lj5IN2rVsnKEIJEELAIWEonMiTw1ZMghrVBE+NGICIPVGroBy9y8uXre84oV8rP0QbohfxITUzlCkAQsAhYBC4lEZltGde++RqulaYbq1U2h3CXzbbepgPXddzqTbkhPDh9O5AhBErAIWAQsJBKZbWm5/voZWhcJE506hXbA6tNHBawpU3TWsaMKWKtWXeAIQRKwCFgELCQSmT2Zcv68pIqxkQMkTDzxhCWUu2Tt319aYXvnHZ09/riaqeGTT85xLCEJWAQsAhYSicyevLR9u6SK/uU+kTDx+uvWkA5YQ4ZIK6wjR+ps7Fir9OTFF09xLCEJWAQsAhYSicyePP/NN5Iqbq+ySsLE11/bQzpgvf66tMIycKDOpBvSk549oziWkAQsAhYBC4lEZk+e/r//k1Rxw3W7JEysX+8I5S7ZJk9WAeuBB3Qm3ZCe1K1r5VhCErAIWAQsJBKZPRl1992HtYjIiKNhYQazOaS7ZP/6awlY5u7ddWYyRUlPChc2JidzLCEJWAQsAhYSicyOtN5ww29aNU0zVKtmCfEu2ZcskYBlatPGJaUn0hmzOYljCUnAImARsJBIpLcy9eJFQ3j4rEJqjoYuXZwh3iXHunUqYNWr55KdO6v53NesucixhCRgEbAIWEgk0lt5afduiRTvVBouMWLAgJMh3iXnrl3SDWPFii751FMnpTNTp8ZwLCEJWAQsAhYSifRWRo8dK5Hi6WqfS4x4772zod4lo1G6YSha1CXHjz8rLwwffppjCUnAImARsJBIpLfS0bGjRIo7rlsoMWLhwli6ZIiMlIZEWa5ejiY9kc7cc88xjiUkAYuARcBCIpHeymN33y15on65HRIjdu++RJeM5ctLQ5x//aX/VXoinWnY0MaxhCRgEbAIWEgk0lsZddddR7WwooWPSoyIjU2hS6Y6dSRgOX77Tf/r+fMp0plixYypqRxLSAIWAYuAhUQivZP2Zs02a5UkQ1SsaKZLKmC1bKkC1rJlLlmhgln643AkcSwhCVgELAIWEon0SporVZqjtZEA0b69gy5Jmbt2lYBlnzXLJdu1U/O5//bbRY4lJAGLgEXAQiKRWcvUpCRDePi7Yf0kQDzxxAm6JGW57z4JWLZPPnHJxx8/If2ZMSOGYwlJwCJgEbCQSGTWMsnhkDDxbInXJUCMG3eGLqkzWD17Sk+sTz3lktIZ6c8rr5zmWEISsAhYBCwkEpm1vLRjh4SJu8rMlgAxd24sXVLXYLVtqyZzb9vWJaUz0p///Oc4xxKSgEXAImAhkcisZdyyZRImGpbeIAHijz8u0SUp6+DB6nnPnTq5pHRG+tO0qZ1jCUnAImARsJBIZNYyZto0CRMlIg9KgDhzJoUuRbme99yypUtGR6uZGkqVMnEsIQlYBCwCFhKJzFpGjx27TSsn6eHaa010SX/LuXOnehxhhQrusmxZk3TpxIlkuoQkYBGwCFhIJDILeXLAgPlaC4kOrVvb6dLV9xyOq0/LMRpdslUru3Tp99/j6RKSgEXAImAhkcgsZNRddz2nDZPo0LWrky653jXWrq3mGl2/3iWlP9KlV1+NpktIAhYBi4CFRCKzkPZmzVpq8yQ6dOzooEuud8233uqaa1R/S/pDl5AELAIWAQuJRHolzZUqtboSsF5//Qxdcr1rffJJNdfoW2+55NixaiqsTp0IWEgCFgGLgIVEIjOV+jTutbQ1Eh327k2gS/8ErLFjJWBZBgxwyT17EqRL9epZ6RKSgEXAImAhkcjMZJLDcUArHKEdjogwXLqUSpdc79pnzFBTYXXr5pLSH+mSq1F0CUnAImARsJBIZPry0o4dK7X67idm6JJejjVr1FRY9eq5y7p1ra5TfXQJScAiYBGwkEhk+jJu2bLJWi8JDX37HqNL7tJ5+LAELEOxYu6yT59j8tq8eTxQCEnAImARsJBIZMYyZtq057WhEhrGjImmSx7SWLasZCznnj2ud6VLrl7RJSQBi4BFwEIikenL6LFju2ufu87K0CV3YGraVE2FtWKF6139kc/62T66hCRgEbAIWEgkMn15csAAj1sI6ZKrLL17q6mwpkxxvet+IyFdQhKwCFgELCQSmb603HmPuoUw/KjrFkK69E9zBg+WgGUdOdL1rvuNhHQJScAiYBGwkEhk+vKX+vdqmqFujcN0Ka20TZqkZmro188duG4kpEtIAhYBi4CFRCLTlx+XeUziQp+eZrqUVjoWLFAB65Zb3IHrRkK6hCRgEbAIWEgkMh3ptNmeD1OPeR7z6mm6lE7A2rZNApaxShV34LqRkC4hCVgELAIWEolML2Dt2pX2FkK65B5AjYUKGcLDUxP+uQPAdSMhXUISsAhYBCwkEpmOdKxenfYWQrrkXqbq1Q2alnj4n2vUXDcS0iUkAYuARcBCIpHpSOOMb9UthGFH3G8hpEv/ClgdOkjAurB6tQu4biS0WOgSkoBFwCJgIZHINPXzkGmaZrjxmu10KSNpeeQRCVgxn3/ubvQbCdetc9AlJAGLgEXAQiKRnvVJz6kSFO5u8CtdykjaRo+WgHV6xAh3o99IOHWqnS4hCVgELAIWEon0rBcazZSgMLLnGrqUYcCaNk0C1rG+fd2NfiPhkCFWuoQkYBGwCFhIJNKz7qiwSILCNyM30KWMpGPVKvW0nKZN3Y1+I2HPnma6hCRgEbAIWEgk0rNqFdkoQWHnvF10KSPp/PtvCVim0qXdjX4j4Q03GOkSkoBFwCJgIZHIf5XFEqVuIdQOx5mddCkTaSxVSjJWSnS0y2RyIyFHHZKARcDikEIiQ1qu/VndCldb++VycjJdykSaGjaUgHVpxw53ltGNhBx1SAIWAYtDCokMafnZu/skIvQoOpMuZS7NPXtKwIqdP9+dZXQjIUcdkoBFwOKQQiJDWr700B8SEV6sNIEuZS6tgwZJwDo7frw7y+hGQo46JAGLgMUhhUSGtOzRYrs6B9PsNbqURcB6910JWCcHDnRnGd1IyFGHJGARsDikkMiQlrXL7ZaIsOG+0XQpc2mfM0cClrNrV3eW0Y2EHHVIAhYBi0MKiQxdqW4hDDsSoR2OGjOOLmUunZs3S8Cy1q7tzjK6kZCjDknAImBxSCGRoSvXrXPqtxDGTJtGl7KQFoshPNxYqFBqUpK7rF3bmPZGQo46JAGLgMUhhUSGrvz8c7uEgzu0z+KWL6dLWUpLtWoGTUs0mdzlnXea095IyFGHJGARsDikkMjQlUOGqGmcnteGekzvRJfSlc5OnSRgXVy71l3qPfS4kZCjDknAImBxSCGRoSv1sy8faXcnOZ10KUt54sknJWDFTJ/uLvWzgB43EnLUIQlYBCwOKSQydKV+/dCP4Q3STuNOl9LWmXHjJGBFjxrlLvXr2DxuJOSoQxKwCFgcUkhkiEp1C2H40Qjt8MHyVemSNzJ29mwJWMf79XOXqo1pbiSkn0gCFgGLQwqJDFHpuoXQ1LgxXfJGxm/ZIgHL3qqVh0x7IyH9RBKwCFgcUkhkiErXLYTmf0+eSZcyksnHjknAMl93nYdMeyMh/UQSsAhYHFJIZIhK1y2ElkceoUteSmPx4pKxUmJi3GXaGwnpJ5KARcDikEIiQ1S6biG0Dh9Ol7yUtoYNJWAl/PWXu0x7IyH9RBKwCFgcUkhkiMqrtxBq9WwTJtAlL+WxXr0kYMUtWeIu095ISD+RBCwCFocUEhmK8uq9b2FHDmiF7bNm0SUv5amXXpKAdfb9991l2hsJ6SeSgEXA4pBCIkNRXr2FsMgGiQuO1avpkpfy3EcfScdOPfech/S4kZB+IglYBCwOKSQyFOWIEeq67DaRCyUuOHfvpkteyrjly6VjUT16eMi2bU3Sz5EjrXQJScAiYHGgIJGhK1u1UoGghTbfEB4eZbfTJS9lwv79ErCs9ep5yNat1R0D8l+6hCRg+WPA0twqN68TsJBIZOby5ptVwBqhDTJWqECXvJepFy5IwDIWKXI5JcVdjhqlzgg2aWKiS0gClt8FLPfo45GZXD+nDViZxCYCFhKJTFc6nVGlS6trhrZq5U2NG9OlbElzpUqSsZL+d9pPf2v3bnVNm3RVekuXkAQsv/6KMLuhysuMRcBCIpEbN6o0UOXav9W85F270qVsScctt0jfLm7Y4CGrVFGZVXpLl5AErFAMWCspigr5Gjp0k0SBLjeslqCw8447aEi26q/mzaVv2/r183i9ffvd0tVhwzbRIoryWWU7YKX7/SBnsJBIZJ7IJ59UFwyN7vSdul57+HC6lL0zWO3bq7kt2rf3kGPG2KSr0lu6hOQMlp+ewco8ORGwkEhkLmWTJuoK9/ldR0tQsE2YQJeyJc9OnKj61rixh1y0yO66zp0uIQlYfhew0gYgAhYSicxDabFERUYaw8MNf996lwQF+6xZdClbMiUmxhAebixcOPXiRXd59KhTuhoZqeZzp0tIApZ/BayMQhJ3ESKRyLySK1aoEy0NGphMjRrp07jTpexKe7Nm6jr39es9ZP366tTgypXMK4YkYPlTwNLSVLpveaQl5sFCIpHZkm+9pS4Veughi7FCBX0ad7qUXak/kfDMm296yAcfVNONSofpEpKA5XdfEeb7+ghYSGRoyz59VAiY8J7FEB6uT+NOl7Ir4xYvVtn09ts95MSJKrz27WumS0gCFgGLQwqJDC1Zs6aarumXeX+pGcmvTONOl7Irk0+elO6ZSpRITUpyB2vWOKS3tWoZ6RKSgEXA4pBCIkNIRkenSAIoVsxgWakmwdKncadLOZC2Bg2kgfHbtrkDm81ZtKi8bJA+0yUkAYuAxSGFRIaK/OmnC1eeSWyyf/ONaxp3upQDefLpp6WBZydO9DDSW+mw9JkuIQlYBCwOKSQyVOSbb56Rj/9nnrFaBw9WAatHD7qUMxk7e7Y0MOruuz2M9FY6PG7cGbqEJGARsDikkMhQkXfdFSUf/9Om2UwtW6qvCFu1oks5k0k2m2pgmTJRDoe7mTZNzYIhfaZLSAIWAYtDCokMFVm+vLqFcPt2p6FGDfWcnDffpEs5lpaaNdW9hOvWuZtt29R17tJnuoQkYBGwOKSQyJCQJlOifPaXK2d07t6tbiEsUSLKaqVLOZYnHntMPTPnnXc82HXXqfs0zeYkuoQkYBGwOKSQyOCX338fKx/83bqZ7ZMnqwuwunWjS7mRMV9+KW209Orlwbp2VacJ58+PpUtIAhYBi0MKiQx+OWzYafngHznSau7dW30/+O67dCk3MvHwYfe5xFw1YoS6zl26TZeQBCwCFocUEhn8sn17dXnQ3Dk2Q5ky6imEW7bQpVxKc8WK6jKszZvd2dy56jr3Dh0cdAlJwCJgcUghkcF+11tSarFi6tqg/fNWqfMuNWvSpdzL4/ffry7D+uADd3bggLpVs3hxo/ScLiEJWAQsDikkMpjl7t2X5FO/Th2rdfhwdeVQ//50Kffy3CefqGbef7+HvPFG9S2h9JwuIQlYBCwOKSQymOUXX8TIR/4jjxw3t2ghmcA+axZdyr1M+OvKIx2vv95DSp+l29JzuoQkYBGwOKSQyGCW//3vCfnI/2h8lCE83BAZ6TQY6FIeyJQUQ+nS6jKsnTvd5ccfn5NuP/XUSbqEJGARsDikkMhglo0a2eQjf/07K9X84x060KW8kuZu3dQZwSlT3OXWrfHSbek5XUISsAhYHFJIZNDK2NiU8HBD4cJG++MD1AQNY8bQpbyS0kx1GdZjj7nLS5dSIyON0nPpPF1CErAIWBxSSGRwyvXrL2qaoWVLu6VKFTVBw7+f7kKXciPtK1aok4J16nhI6bb0/LffLtIlJAGLgMUhhUQGp5ww4ax82A968JC6IrtiRbqUh9JptRqKFVOXYe3b5y6fe+6U9HzixLN0CUnAImBxSCGRwSnvu++YfNhP7fe9ekLOgw/SpbyVpg4d1GVYM2a4y2++OS89l87TJSQBi4DFIYVEBqesVs0iH/Yb2j6iZsWcNo0u5a20jhihLsMaONBdHjyoHq19/fUWuoQkYBGwOKSQyCCUUVHJ8kl/TWmjoXARQ0RE1MGDdClvpX3RInUZVuPG7jI19fI115ik88eOJdMlJAGLgMUhhUQGm5w0SV2A1aLuPnV5+y230KW8lyaTITJSwqvz8GF32aqVevij9J8uIQlYBCwOKSQy2GTbtupjvmWlTRKwzrzxBl3KD2lq2FB9/Tp+fNrOy3/pEpKARcDikEIig03qz8UbV26oJID4bdvoUr4ErJtvVt8S3nyzu/zkEzWfu/SfLiEJWAQsDikkMqik05kkn/ElixsOapGma6+9nJJCl/JD2q489dlQsmSUxeKSCQmpJUqoy7CiopLpEpKARcDikEIig0d+9ZWaLKBH463y8X+8Xz+6lH/S1KSJmqzh88/dZa9eaoKMr78+T5eQBCwCFocUEhk8sl+/4/IB/26j8fLZf/7rr+lS/knbe++pacauPOfR9e6UKepbQhkFuoQkYBGwOKSQyCCRKSmXr71WfUX1W7F68tmffOV36VI+Sefhw2pK97Awx9atrncNBjUbloyCjAVdQhKwCFgcUkhkMMitW+Pl0712BTVBg7VePbqU39Jy//2q1S+95A70mwy2bYunS0gCFgGLQwqJDAb5xhtn5KP9yXKfqhkEmjalS/ktHT/8oJ72WKnS5eRkF3j+efVQQhkLuoQkYBGwOKSQyGCQ+jxMXxbuIZ/6cQsW0CUfSGPt2tLtCytXusCKFRf02bDoEpKARcDikEIiA14eOBAVHm4oHHFkn1YsqkcPuuQbaRszRgLWsT59XCAuLqVwYWNEhCG9ZxTRTyQBi4CFRCIDSk6bZtM0Q/si89UJlZ9+oku+kc49e4yFCsmf5OPHXea225wyFjIidAlJwCJgcUghkYEt+/Uzy4f6y9pAW4MG6snDdMlX0txDfSd7dsIEl5k48eyVyRrMdAlJwCJgcUghkYEtK1Y0yof6j1q9mGnT6JIvpf3bb91v25TauzdBxkJGhC4hCVgELA4pJDKA5bp16jupCtoW07XXpl68SJd8Ku12S9Wq6smPGze6WJUqFhmRdescdAlJwCJgcUghkYEqx4xRcy/dr40//cordMn3MvrVVyVgnXjiCRfr3/+EjIiMC11CErAIWBxSSGSgyvatDsnH+ScRvZIcDrrke5loNBrCwozFi6fExOhs/vxYGZEOHUx0CUnAImBxSCGRASkNBmdkxJEI7fDhvv3pUkFJ5223GTTNdQFcdHRKeLghMtIgo0OXkAQsAhYSiQw8OetLdXl7M21h/LZtdKmgZOzcuRKw7C1bumSLFuq+zlmz7HQJScAiYCGRyMCTT9zys3yQD6nyHl0qQJkaH28sXVoyVuz8+bocPlxdGNe/v4UuIQlYBCwkEhlo0umsHrlJPsiXvzyXLhWstDVt6v4UyBUr7DIuNWsa6RKSgEXAQiKRASY3T14sn+JlwnfZLTa6VLBS/5bQVL785ZQU+avDEVWmjLxg2LLFQZeQBCwCFhKJDCT5Zt1x8hHe66Y1dMkfpPXGGyVSXVy3Tpe9e6vLsN5910qXkAQsAhYSiQwY6Vi27DZtunyET373MF3yBxn92msSsE4OGKDLyZPVt4TdupnpEpKARcBCIpEBIo3GQ+UqF9P2yUf47t1OuuQPMuHAAfUtYdmyqQkJ8rqMi4xOiRJGq5UuIQlYBCwkEun/0uEwd+/+nvYf+fyuXfVvuuQ/0n7lUve4pUv1t2rXVpNofPihjS4hCVgELCQS6e/S2r+/fIrfFPGjfHg3bmyiS/4jz06cKENzvF8//a1GjdRlWI0aMUZIAhYBC4lE+rc8O2mSfITvLVK2WJGj8uE9daqdLvmPTLLZ9MfmOI8elbc+/1xdhlW8uPHoUb7GRRKwCFhIJNJfZez8+fL5LX/efUSdvmrblguo/U46OnZUs7pPmaK/26aNSUZqwgQbXUISsAhYSCTSH2X8pk3GIkXkw9s6dmyDBkb301d0yX9kzNSpMkbm22/X35UxkpG66SYjXUISsAhYSCTS72TioUOma6+VT+5TgwcvX+6Qz+zy5Y1Wq5Mu+ZtMPnXKWKiQ/HH+re4/sFqjypVTaVhGjS4hCVgELCQS6UcyYf9+U4kSkq6O3XPP5ZSUvn3VpdMvvmilS/4po3r2VI/Nee89HchIyXjdd5+FLiEJWAQsJBLpLzI1KclcvryaYOnaa1MvXDh1KrlwYUN4uGHHDidd8k95/rvv1Hi1aaODP/5wynjJqMnY0SUkAYuAhUQi/UKeHjFCfVoXK5awf7/89b33znrMD06X/E2mxMYaihY1hIU5d+7UjYzXlUvdz9IlJAGLgIVEIgtexi1aJOnKGBkZ//vv6pM75XKtWur7ptmz7XTJn6W5d291O8KYMbqR8VKzwta2XnkSNF1CErAIWEgksuCkc9MmU6lS8jl97uOPdbNq1QX5nK5Rw+R00iW/lvavv1bnHRs21I3DEVW9upqvQUaQLiEJWAQsJBJZYNJpMJjq1lXTgj/4oMvcfXeUfEiPGWOjS/4urVZD6dIyfM6NG3UmoyZj16vXMbqEJGARsJBIZIFJ8z33qDvRGjZMiYvTgcWSFB5uKFLEuH+/ky75v7Q89JD6lnDoUJ3JqMnYyQjKONIlJAGLgIVEIgtA2saNU5delSyZeOiQC4waFa1phkcfPUGXAkLaFyxQg1izpks+8shxGcHRo6PpEpKARcBCIpG+lo5ly4yRkepxKzNmuN5NSEitUEHdifb77/F0KTCkw2G87jo1jp9/rksZOxnBihXNMpp0CUnAImAhkUjfScfatcaiRdVXS8895y7nzYuVz+YmTWx0KYCkqWFD90vd5fWbb1ZXYslo0iUkAYuAhUQifSeNFSqo75XKlYuy291lx47q8TjTpsXQpQCS9i++kNE0lCwZZbHoUkZQXujUyUmXkAQsAhYSifSRtL3zjvo8LlzYsW6du1y37qK8XKqUKTY2hS4FljQ1aeL6llBelxEsWVI9mvDXXy/SJSQBi4CFRCLzXTo3bjRc+XLQPnOmh9QnF61b10qXAk7a3ntPxtTcoYNL1qlj1ScdpUtIAhYBC4lE5q9MTUw0NW6sPon79fOQixfHXTmrZVy/nnMegSedhw8bihUzhIU5tm7V3/r114symjKmMrJ0CUnAImAhkch8lNGjR6uroatXdx454i7PnUupXFndPPj55zF0KUCl5f771V0LL73keldGU8a0ShWLjC9dQhKwCFhIJDJfZPzmzYbwcENEhGPZMg/5zDMn5ZO4fXtHair9DFTp+OEHdeNCpUqXk5OvnrBMvSxjKiMr40uXkAQsAhYSicx7mXL+vLVWLf0MhwdbutQRFqa+HDxwIIF+BrQ01q4tQ3xh5UoX+PvvBBlZGV8ZZbqEJGARsJBIZB7LE08+qS5sb9HCabX+63slS9SNN6ordV5/PZouBbq0jRkjo3ysTx93IyMr4yuj/O+Rp59IAhYBC4lE5k7GLV6svjwqVizx4EEPM2yYutesQQOb+6zf9DNApXPPHmOhQvIn+fhxl5GRrV9fjfLw4Va6hCRgEbCQSGTeyEs7dhiLFJGAdW7KFA/522+OyEhDWJhh06Z4+hkc0tyjh4z12QkT3JmMr4yyjLWMOF1CErAIWEgkMlcyJS4u+rXXDBER8olrqVrVQzqdUS1bmjTN8PjjFvoZNNL+7bfqSrt69TzkY49ZZKxbtTLJuNMlJAGLgIVEInMknU7bxx9bqlRRM7ZLuqpR49Kff3rId9+1XnkksPHQISf9DB5pt0uYlkGP37jRXcooy1jLiI8fb6NLSAIWAQuJRGZbOpYvNzVtqkcre+vW8Vu2pJVr1zoKFVJk5kw7/QwyGf3qqzK0J554wkPOmGGXES9UyLhunYMuIQlYBCwkEumtdKxYYbz+ej1aGStVOv/tt5dT07l0fe9eZ+nSSlWqZKSfwScTjUZDWJixePGUGM9pY2XEZdxLlzbu2+ekn0gCFgELiURmIZ0Gg3XoUP1yK/mvddgweSVdKemqXj3TlU9ZA2cyglU6b7tNjoSYadM8pIy4pCsZfTkGJGPRTyQBi4CFRCIzkKmp52fNMlasePXE1fXXO378MaNlnjiRrKer+vVN+jkM+hmUMnbuXPUFccuWaaWMu34MyH9Pnkymn0gCFgELiUR6yvjff7e3aqVHK1OzZo4VKzJZpqSrhg1tadMV/Qw+mRofb7rmGnWp+7p1aaUrY8nxkDZj0U8kAYuAhUSGrry0c6elevWrNwlWrWr75JMopzOTZWaSruhnUEprnTpXp+e48mhCD5NJxqKfSAIWAQuJDFEZt3y5PneoISIieuzYlLi4zJfpSleNGtnSpiv6GZQyfv16U4kScpCcHjEiXSlHgn5UeGQs+okkYBGwkMjQkybTyWefvXriqkqVtLNbpV3mvn0J11xj0tOVfI7Sz9CR8Zs3GyMj5VCJW7QoXSnHg56x5AjZvz+BfiIJWAQsJDIUpXPt2v9v72xjozjOOH5fEsvCduiXNqVCQPAhhShgh9RggrAbRQp8SmkiTD7lTqkURZVMXlSqoDZ2FUUkInWD1CoCRyr+YJK2SpoAbUpF8yWSo6iySkJU0ca35l6WxIYAbhEoDuE65yXkOO/Nze08e9zL76fR6W7u2ef2dp6Z+e/M7K4zN++TaGo6NzSUfwuGYj4PHrzQ1JTwelBvlILj2VCW519+Obc+r7XVfe89X0sVFZ7+VnGiooXjiSUCC4GFJZaNZOm6ycHBiZtvVp1lauXKL44dK+nTcU49/vj03FDXxK23nmR8omEtP9u2LaexVqxwJyZ8LVVsqAjxQkXFjIocjieWCCwEFpZY1qSlm0ymdu1yOjtTL7yg3ust08PDzte3D03GYlcuXiz560ePutHo1WGJoaFz+XcbpYwazfKrCxeUKFfBM/nAA8UsVYSoOPEGO1escFT8cDyxRGAhsLDEsmYsv0ylZvbundy0KdHS4gmm3HxfS8vk5s0z+/apbzWWiebm9MhIyV933VODg8m5oa6JlStTx459wZHHcvbECS+QUs89p7FU0aJiRkWOih8VRTwWGksEFgILSyyr2vJ/r7+e6ujwLpu/lpylS53OzsSSJfmZyeXL011d6vU6y/b2RDSaGR3V/3oy6Q4PpxcvdrztYrHkxYtXKCMsPdLDwzmZftNNmbff1liqmFGR44XQ4sUJFVEqrjieWCKwEFhYYllNlpnMhYMH3fvu+0YqtbZ+umVLavdud3z8mzGn8XGVo/LVt3pL319Ppb7cu3dm06bJlpaEt3Vzc2JkhEc4YzlPgnvXny5YkH71Vf3EtIqf5uarwajiavPmyX37ZlSkcTyxRGBdp36ugcDCEssKWZ44kRwYcL4enXKam1Odnf/dv//K7KzGp/p25pVX0l1d6lVjOT19eWzs0sDA2e7uzLJlybyhron2dicaTYyO8oRBLH0s3VQqsWiRZmI63+foaLq9PaEiKj/AVLypqBscPKsikFt+YInAimhkEAILSywDWF6enr40NnbmmWcyGzdOxeOfDwyolHz6aZVOxuPO6tVX7wIaiSRvu+3c0NBX588H+/Xjx91DhzL9/cm1a50NGyZXrXK8J/Xmp9ZWZ8uWT3fvTo2PszAZyxKW6QMHcqKpvf26iellyzLd3WcHB1VUq9gu8KbiSkWXijEVaQWxp6Jx9epcZKr4VFGqYpUHSGPZKAKrQPqEpLE8t3/99diOnjeupSe6X1PpoaV/WNt26KGlv/c+el/1LX+j+5bDfe1YYlljlg9++3fbv/N8f9NP+yP9Kv0o8uLayOiDkRe9jwWZ25f86skfvjvw7Bmlvh55ZKqnJxOLTc0psc/nlFhy69aT3d3O1q2T3kfvq3h8auPGzL33umvWpL27E81PCxc6d9+dvv/+U+vXZ/bsOT87e4VGHMtyLX0npq8ObrW1qZME5557nHXrTvb1eWcOKjo/+8Uvn+/67Zq2Iz/43t86Fn3Q1vQv3/hU+erbDd89uu6WP2+jDcGyiKWXjux5H4Gl4/AcP75z2LeykUikwGnBgn9Hox93dHx0xx0f9fV98NJLfz9w4J3DAIK89dbYY48dv/32D++66+No9D9zT9cxTP+IfOuPkc6fRJ76fuS19ZGROyN/ao38k2pLMk9KOVRhnagigeWhdOjPet8sSOr0Zf3C3EkMmWTWdmb0TZX58Kp3fv7oh8/uyK1BUSkWm+rtddWr91EkMx6f7ulxd+48MzZ26fTpy1mAinP59OncDPjOnW5Pz3Q8fjYvQKdiMbe3V71qMj/ZsevIo7/Zvmr/uoV/eThKG0Kmf6aXGMECAAAAaHQQWAAAAAChCaxsRa4iBAAAAGg4gRX2fbAAAAAAGktgVegnjWVcuYLP0DLUX59vbKNZS/oM4FmzlY3CLratuM/IPAR9Coa0zU6GdDyLVRNxnzZlVGxDkXokWEaabS2PZ2V8CpZR/tSHVBnN92lfRsX+Pm1dvbZ1DSqwCt7ozcpVToa/rt+BwCvSilnahIivwJIqBd+jF6Amm/gptxE3KdnAPrNC6w6LOREs8YLOxtL//MZR5CCY16ZgNUiwjEKqlSJl5Fs0lmVk0uiFEa4V6CYC+xRp66TKyHDbACJYtgcp5tMyeIr5rIM1Szf4WYT2wqXAQKp1bkyBVYG+R9an5XGoxY7BcodLVhNxn5YdWC0KrJDEZXg+q7l1kqpHUicVIYkh8bauDk4mxRtnBJZts2tiZjLqWP0Cy37KAIEVtsCSGuIWH8kQFFglfQpOvVmeeVdmitC+8y65P+I+q1xgidQjBFaoAsumHiGwbrDAMp/4KymbfEeJSzag1XmubPhHyhJtNj5LysEqUVeynbfJf7RcmiBVRvopA8tACkkBi7ez+gWI9j5tyki/rY0Q1OxPlZ/2iJSR75G0qUfiK2713U1gh7L1yOS4ScW8VH+EwBJTV9ky5xdqdw2WSPXT9+iyczGCp00hnSiLj2CFFACByyjY6kNLn5RR9Y+O1JDAEmxDGqGMNP9R5OxUfNBaqh4hsCSlg/mlFgisuvEZRkdbE523TSNuUk0EfVJG1d9518RKgKpql2qrjBqzHjWuwMqWszIu1LokJcVuSMwFuMSyXJ9hnMsKrneWXUMQhk+bMjL0KTXcInVqK15GglMbvj6lykjw6iqTK91spoZrTmBVW1tX+asIRWI+jLopUkaGPrO1SfXeByvYLUAE724V+D5YVX6vHROfNmUqdb8ZvU/Z8KvC+7iIl5G+BRdfJ0cZ2a/Hr8B+yqor+zISaYrL8lnfZaTfSZGFoYL/XbCMGldgAQAAANQ3CCwAAAAABBYAAAAAAgsAAAAAgQUAAAAACCwAAAAABBYAAAAAAgsAAAAAEFgAAAAACCwAAAAABBYAQAM3oOU8yqPWn/sBAAgsAPDv4A0zw1AhN+pxY7LPbdR8a/IgOQQWAAILAOpQYPk++bWSqq7YQ7vD243KCCzNGwQWAAILABpaYBUbavLN997rh6A0esJQaljuTzFLm831AlEvsNBYAAgsAKhDgTVfARSICd/3vvrAV6DICizf3dDsp17xiGxuKLDslSUAILAAoE4ElokOKMved9yoLIFVMtNECApurneVPwyWLTIDi8ACQGABQB0KrKx2ZKjknFpggWUuXMIWWGX9nQBjUcGUKwAgsACgPgWWiYyoA4Fl8zfNdw+BBYDAAoDGElglVVcxfVDuCFbW7irCctdgGQosw6VaJnrIREFW5mJJAEBgAUA1CqyswVWE2UADMzb3wSr3KsJiwtHwKkKTzQ3lY9bszlgAgMACAICsXkJJGQMAAgsAAAAAEFgAAAAACCwAAAAABBYAAABA4/J/l58sWlZkFsgAAAAASUVORK5C" alt="Per sequence GC content graph" width="800" height="600"/></p></div><div class="module"><h2 id="M6"><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[OK]"/>Per base N content</h2><p><img class="indented" src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAyAAAAJYCAIAAAAVFBUnAAAd8UlEQVR42u3dTW4cxxnH4b6WV/YptPDGvoMPYB9q9tYyhxDyASQBvEiW3naEOFKG/VH9VtVbPZye5w8hUChyHnJUJH/uIalpNjMzM7PUTe4CMzMzM4FlZmZmJrDMzMzMBJaZmZmZCSwzMzMzgWVmZmYmsMzMzMxMYJmZmZkJLDMzMzOBZWZmZmYCy8zMzExgmZmZmQksMzMzM4FlZmZmZgLLzMzMTGCZmZmZCSwzMzMzE1hmZmZmAsvMzMxMYJmZ2TxN0+I3m39qZgLLzC7yiX/x2X3cJ/vOW37qChFYZiawzASWwBJYZiawzKzvE//9J/i9T/bTl20+cX0Li6fvPWfPix++Jpuv9v3t177s3hOD90khsA5fh6rXrfZ1NjOBZWYPCKxFjmw+cfP3hbbofPH1W7H5IuVXu/xqlF+HyLWoTf3w7i3cY+XXLf6GmJnAMrPhgTU3PYYV+fQfeXrbi1e9URG3+X5Iv3sLV+n6/zrMTGCZ2XmBNW9dzRodWJsPjbWFQuSmqgJrzniIsD+w9h49LD/eevjMZiawzOyygXX4Ks3dDxH2BFb/EzsDq+p1i/STxjITWGZ2dmDNW99UuH561Rf9zLGvwZr7HiKs+pqq+JeClV+Hw1SquoIVeR3iX4NV9TqbmcAys8cE1lz/XYR7BRD8LsLIi++9eocPpe29bO53Ec6VX+R+yMUfvvRdhGYCy8zMzExgmZmZmZnAMjMzMxNYZmZmZgLLzMzMzASWmZmZmcAyMzMzu3pgFX6wSu0/C29mZmYmsN4002Zgbf6pf3zUzMzMrCWwOv8ZMjMzMzOBlRNYNzMzM7P3tI/Ze0BgNVzQ+mf9GoqSQqFQKBTK6yj3KydR7q0JLAqFQqFQKAJLYDk0FAqFQqFQnj2w5qbvIhRYFAqFQqFQBNabH2oV/HlXhZ+DJbAoFAqFQqEIrOQJLAqFQqFQKAJLYFEoFAqFQhFYAsvRpFAoFAqFIrAcGgqFQqFQKAJLYFEoFAqFQhFYAotCoVAoFArlKIk+TdOnt62y/r/lZxBYFAqFQqFQBNb/k+hrKq1/I7AcGgqFQqFQKAMDa/F0gUWhUCgUCoUSDaxPW9EisCgUCoVCoVAqAuv+EcD1b4JXuQQWhUKhUCgUgbWdRIsrVZs5tXmhS2BRKBQKhUIRWBtJVOgqgUWhUCgUCoUyMLDmrW8qFFgUCoVCoVAE1jKJygklsCgUCoVCoVBarmCNuzWBRaFQKBQKRWAJLIeGQqFQKBSKwHJoKBQKhUKhvIfAyp3AolAoFAqF8uqBdeYEFoVCoVAoFIElsBwaCoVCoVAoAsuhoVAoFAqFIrAEFoVCoVAoFIElsCgUCoVCoVAElkNDoVAoFApFYAksCoVCoVAoAktgUSgUCoVCEVgCy6GhUCgUCoUisAQWhUKhUCgUgSWwKBQKhUKhCCyB5dBQKBQKhUIRWAKLQqFQKBSKwBJYFAqFQqFQBJbAcmgoFAqFQqEILIeGQqFQKBSKwBJYFAqFQqFQBJbAolAoFAqFQhFYDg2FQqFQKBSBJbAoFAqFQqEILIFFoVAoFApFYAksh4ZCoVAoFIrAElgUCoVCoVAElsCiUCgUCoUisE4KrOlukacLLAqFQqFQKAKrFFj3/bQOrNpsElgUCoVCoVAEVjSqguUksCgUCoVCoQis5MC6mZmZmV16LQ8RuoJFoVAoFArFFazeK1jz3Reze4iQQqFQKBSKwMoJLF+DRaFQKBQKRWCN+hos30VIoVAoFApFYOU/RLj5dIFFoVAoFApFYLU/RNh7uwKLQqFQKBSKwBJYFAqFQqFQBJbAcjQpFAqFQqEILIeGQqFQKBSKwBJYFAqFQqFQBJbAolAoFAqFQhFYDg2FQqFQKBSBJbAoFAqFQqEILIFFoVAoFApFYAksh4ZCoVAoFIrAElgUCoVCoVAElsCiUCgUCoUisASWQ0OhUCgUCkVgOTQUCoVCoVAElsCiUCgUCoUisAQWhUKhUCgUisByaCgUCoVCoQgsgUWhUCgUCkVgCSwKhUKhUCgUgeXQUCgUCoVCEVgCi0KhUCgUisASWBQKhUKhUASWwHJoKBQKhUKhCCyBRaFQKBQKRWAJLAqFQqFQKAJLYDk0FAqFQqFQBJZDQ6FQKBQKRWAJLAqFQqFQKAJLYFEoFAqFQqEILIeGQqFQKBSKwBJYFAqFQqFQBJbAolAoFAqFIrAElkNDoVAoFApFYAksCoVCoVAoAktgUSgUCoVCEVgCy6GhUCgUCoUisAQWhUKhUCgUgSWwKBQKhUKhCCyB5dBQKBQKhUIRWA4NhUKhUCgUgSWwKBQKhUKhCCyBRaFQKBQKhSKwHBoKhUKhUCiXD6zpbpGnCywKhUKhUCgCqxRY66ha/15gUSgUCoVCEVgJgVUIL4FFoVAoFApFYJ0XWDczMzOzS6/ra7BcwaJQKBQKheIKlocIKRQKhUKhUASWQ0OhUCgUCuWlAmv2XYQUCoVCoVAEVltgzX4OFoVCoVAoFIGVHliZtyuwKBQKhUKhCCyBRaFQKBQKRWAJLEeTQqFQKBSKwHJoKBQKhUKhCCyBRaFQKBQKRWAJLAqFQqFQKBSB5dBQKBQKhUIRWAKLQqFQKBSKwBJYFAqFQqFQBJbAcmgoFAqFQqEILIFFoVAoFApFYAksCoVCoVAoAktgOTQUCoVCoVAElkNDoVAoFApFYAksCoVCoVAoAktgUSgUCoVCoQgsh4ZCoVAoFIrAElgUCoVCoVAElsCiUCgUCoVCEVgODYVCoVAoFIElsCgUCoVCoQgsgUWhUCgUCkVgCSyHhkKhUCgUisASWBQKhUKhUASWwKJQKBQKhSKwBJZDQ6FQKBQKRWA5NBQKhUKhUASWwKJQKBQKhSKwBBaFQqFQKBSKwHJoKBQKhUKhCCyBRaFQKBQKRWAJLAqFQqFQKAJLYDk0FAqFQqFQBJbAolAoFAqFIrAEFoVCoVAoFIElsBwaCoVCoVAoAktgUSgUCoVCEVgCi0KhUCgUisASWA4NhUKhUCgUgeXQUCgUCoVCEVgCi0KhUCgUisASWBQKhUKhUCgCy6GhUCgUCoVy7cCaVtv8I4FFoVAoFApFYDVewVoEVm02CSwKhUKhUCgC67iuqspJYFEoFAqFQhFYyYF1MzMzM7v06gKrXFSuYFEoFAqFQnEFq/oKlsCiUCgUCoUisDIDax1GAotCoVAoFIrASg6s2XcRUigUCoVCEVjNgbVXRX4OFoVCoVAoFIHVfgUr7XYFFoVCoVAoFIElsCgUCoVCoQgsgeVoUigUCoVCEVgODYVCoVAoFIElsCgUCoVCoQgsgUWhUCgUCoUisBwaCoVCoVAoAktgUSgUCoVCEVgCi0KhUCgUisASWA4NhUKhUCgUgSWwKBQKhUKhCCyBRaFQKBQKRWAJLIeGQqFQKBSKwHJoKBQKhUKhCCyBRaFQKBQKRWAJLAqFQqFQKBSB5dBQKBQKhUIRWAKLQqFQKBSKwBJYFAqFQqFQKALLoaFQKBQKhSKwBBaFQqFQKBSBJbAoFAqFQqEILIHl0FAoFAqFQhFYAotCoVAoFIrAElgUCoVCoVAElsByaCgUCoVCoQgsh4ZCoVAoFIrAElgUCoVCoVAElsCiUCgUCoVCEVgODYVCoVAoFIElsCgUCoVCoQgsgUWhUCgUCkVgCSyHhkKhUCgUisASWBQKhUKhUASWwKJQKBQKhSKwBJZDQ6FQKBQKRWAJLAqFQqFQKAJLYFEoFAqFQhFYAsuhoVAoFAqFIrAcGgqFQqFQKAJLYFEoFAqFQhFYAotCoVAoFApFYDk0FAqFQqFQXiGwpi/bfGI8mwQWhUKhUCgUgbWsos3fCywKhUKhUCgCqyKw9pJofTVLYFEoFAqFQhFYFYG1fiiwLbBuZmZmZpdeNLDuHwrce1jQFSwKhUKhUCiuYDU+RCiwKBQKhUKhCCyBRaFQKBQKhfLOAmsRVb6LkEKhUCgUisDKCSw/B4tCoVAoFIrAygyszNsVWBQKhUKhUASWwKJQKBQKhSKwBJajSaFQKBQKRWA5NBQKhUKhUASWwKJQKBQKhSKwBBaFQqFQKBSKwHJoKBQKhUKhCCyBRaFQKBQKRWAJLAqFQqFQKAJLYDk0FAqFQqFQBJbAolAoFAqFIrAEFoVCoVAoFIElsBwaCoVCoVAoAsuhoVAoFAqFIrAEFoVCoVAoFIElsCgUCoVCoVAElkNDoVAoFApFYAksCoVCoVAoAktgUSgUCoVCoQgsh4ZCoVAoFIrAElgUCoVCoVAElsCiUCgUCoUisASWQ0OhUCgUCkVgCSwKhUKhUCgCS2BRKBQKhUIRWALLoaFQKBQKhSKwHBoKhUKhUCgCS2BRKBQKhUIRWAKLQqFQKBQKRWA5NBQKhUKhUASWwKJQKBQKhSKwBBaFQqFQKBSBJbAcGgqFQqFQKAJLYFEoFAqFQhFYAotCoVAoFIrAElgODYVCoVAoFIElsCgUCoVCoQgsgUWhUCgUCkVgCSyHhkKhUCgUisByaCgUCoVCoQgsgUWhUCgUCkVgCSwKhUKhUCgUgeXQUCgUCoVCuXZgTW+3qKXNpwssCoVCoVAoAusgsA5rSWBRKBQKhUIRWAmBtb6aJbAoFAqFQqEIrK6HCNsC62ZmZmZ26YUCa/1FV65gUSgUCoVCcQWr6wpW8OuuBBaFQqFQKBSBJbAoFAqFQqEIrMd9DdbmQ4Sz7yKkUCgUCoUisJqvYPk5WBQKhUKhUATWwIcIe29XYFEoFAqFQhFYAotCoVAoFIrAEliOJoVCoVAoFIHl0FAoFAqFQhFYAotCoVAoFIrAElgUCoVCoVAoAsuhoVAoFAqFIrAEFoVCoVAoFIElsCgUCoVCoQgsgeXQUCgUCoVCEVgCi0KhUCgUisASWBQKhUKhUASWwHJoKBQKhUKhCCyHhkKhUCgUisASWBQKhUKhUASWwKJQKBQKhUIRWA4NhUKhUCgUgSWwKBQKhUKhCCyBRaFQKBQKhSKwHBoKhUKhUCgCS2BRKBQKhUIRWAKLQqFQKBSKwBJYDg2FQqFQKBSBJbAoFAqFQqEILIFFoVAoFApFYAksh4ZCoVAoFIrAcmgoFAqFQqEILIFFoVAoFApFYAksCoVCoVAoFIHl0FAoFAqFQhFYAotCoVAoFIrAElgUCoVCoVAElsByaCgUCoVCoQgsgUWhUCgUCkVgCSwKhUKhUCgCS2A5NBQKhUKhUASWwKJQKBQKhSKwBBaFQqFQKBSBJbAcGgqFQqFQKALLoaFQKBQKhSKwBBaFQqFQKBSBJbAoFAqFQqFQBJZDQ6FQKBQK5UUCa/rv1k9ZP11gUSgUCoVCEVjtgVWbTQKLQqFQKBSKwHoTRvd5tBdbAotCoVAoFIrAOg6szStVbYF1MzMzM7v0HhBYrmBRKBQKhUJxBWs3qgQWhUKhUCgUgdUeWIsJLAqFQqFQKAKr92uwDq9a+S5CCoVCoVAoAistsPwcLAqFQqFQKAKrK7ASbldgUSgUCoVCEVgCi0KhUCgUisASWI4mhUKhUCgUgeXQUCgUCoVCEVgCi0KhUCgUisASWBQKhUKhUCgCy6GhUCgUCoUisAQWhUKhUCgUgSWwKBQKhUKhCCyB5dBQKBQKhUIRWAKLQqFQKBSKwBJYFAqFQqFQBJbAcmgoFAqFQqEILIeGQqFQKBSKwBJYFAqFQqFQBJbAolAoFAqFQhFYDg2FQqFQKBSBJbAoFAqFQqEILIFFoVAoFAqFIrAcGgqFQqFQKAJLYFEoFAqFQhFYAotCoVAoFIrAElgODYVCoVAoFIElsCgUCoVCoQgsgUWhUCgUCkVgCSyHhkKhUCgUisByaCgUCoVCoQgsgUWhUCgUCkVgCSwKhUKhUCgUgeXQUCgUCoVCEVgCi0KhUCgUisASWBQKhUKhUASWwHJoKBQKhUKhCCyBRaFQKBQKRWAJLAqFQqFQKAJLYDk0FAqFQqFQBJbAolAoFAqFIrAEFoVCoVAoFIElsBwaCoVCoVAoAsuhoVAoFAqFIrAEFoVCoVAoFIElsCgUCoVCoVAElkNDoVAoFArl8oE13S3ydIFFoVAoFApFYJUCax1V698LLAqFQqFQKAKr/SHCvagKlpPAolAoFAqFIrCSA+tmZmZmdulVBNb6a61cwaJQKBQKheIKlocIKRQKhUKhUASWQ0OhUCgUCuWSgeW7CCkUCoVCoQis/CtYfg4WhUKhUCgUgTXwIcLe2xVYFAqFQqFQBJbAolAoFAqFIrAElqNJoVAoFApFYDk0FAqFQqFQBJbAolAoFAqFIrAEFoVCoVAoFIrAcmgoFAqFQqEILIFFoVAoFApFYAksCoVCoVAoAktgOTQUCoVCoVAElsCiUCgUCoUisAQWhUKhUCgUgSWwHBoKhUKhUCgCy6GhUCgUCoUisAQWhUKhUCgUgSWwKBQKhUKhUASWQ0OhUCgUCkVgCSwKhUKhUCgCS2BRKBQKhUKhCCyHhkKhUCgUisASWBQKhUKhUASWwKJQKBQKhSKwBJZDQ6FQKBQKRWAJLAqFQqFQKAJLYFEoFAqFQhFYAsuhoVAoFAqFIrAcGgqFQqFQKAJLYFEoFAqFQhFYAotCoVAoFApFYDk0FAqFQqFQBJbAolAoFAqFIrAEFoVCoVAoFIElsBwaCoVCoVAoAktgUSgUCoVCEVgCi0KhUCgUisASWA4NhUKhUCgUgSWwKBQKhUKhCCyBRaFQKBQKRWAJLIeGQqFQKBSKwHJoKBQKhUKhCCyBRaFQKBQKRWAJLAqFQqFQKBSB5dBQKBQKhUK5fGBNd4s8XWBRKBQKhUIRWKXAuk+iRUt9/b3AolAoFAqFIrDaHyLci6pgOQksCoVCoVAoAis5sG5mZmZml151YG0+PugKFoVCoVAoFFewGq9glYtKYFEoFAqFQhFYdYG1DiOBRaFQKBQKRWC1B9ZeFfkuQgqFQqFQKAKrJbCm1Tb/SGBRKBQKhUIRWHUPEabdrsCiUCgUCoUisAQWhUKhUCgUgSWwHE0KhUKhUCgCy6GhUCgUCoUisAQWhUKhUCgUgSWwKBQKhUKhUASWQ0OhUCgUCkVgCSwKhUKhUCgCS2BRKBQKhUIRWALLoaFQKBQKhSKwBBaFQqFQKBSBJbAoFAqFQqEILIHl0FAoFAqFQhFYDg2FQqFQKBSBJbAoFAqFQqEILIFFoVAoFAqFIrAcGgqFQqFQKAJLYFEoFAqFQhFYAotCoVAoFApFYDk0FAqFQqFQBJbAolAoFAqFIrAEFoVCoVAoFIElsBwaCoVCoVAoAktgUSgUCoVCEVgCi0KhUCgUisASWA4NhUKhUCgUgeXQUCgUCoVCEVgCi0KhUCgUisASWBQKhUKhUCgCy6GhUCgUCoUisAQWhUKhUCgUgSWwKBQKhUKhCCyB5dBQKBQKhUIRWAKLQqFQKBSKwBJYFAqFQqFQBJbAcmgoFAqFQqEILIFFoVAoFApFYAksCoVCoVAoAktgOTQUCoVCoVAElkNDoVAoFApFYAksCoVCoVAoAktgUSgUCoVCoQgsh4ZCoVAoFMq1A2v6ss1aKvypwKJQKBQKhSKwSlew9gKrNpsEFoVCoVAoFIG1G0aLpwTLSWBRKBQKhUIRWMmBdTMzMzO79FzBolAoFAqF4gqWhwgdGgqFQqFQKAJLYFEoFAqFQhFY0cCafRchhUKhUCgUgdUWWNPbLWrJz8GiUCgUCoUisBqvYKXdrsCiUCgUCoUisAQWhUKhUCgUgSWwHE0KhUKhUCgCy6GhUCgUCoUisAQWhUKhUCgUgSWwKBQKhUKhUASWQ0OhUCgUCkVgCSwKhUKhUCgCS2BRKBQKhUIRWALLoaFQKBQKhSKwBBaFQqFQKBSBJbAoFAqFQqEILIHl0FAoFAqFQhFYDg2FQqFQKBSBJbAoFAqFQqEILIFFoVAoFAqFIrAcGgqFQqFQKAJLYFEoFAqFQhFYAotCoVAoFApFYDk0FAqFQqFQBJbAolAoFAqFIrAEFoVCoVAoFIElsBwaCoVCoVAoAktgUSgUCoVCEVgCi0KhUCgUisASWA4NhUKhUCgUgeXQUCgUCoVCEVgCi0KhUCgUisASWBQKhUKhUCgCy6GhUCgUCoUisAQWhUKhUCgUgSWwKBQKhUKhCCyB5dBQKBQKhUIRWAKLQqFQKBSKwBJYFAqFQqFQBJbAcmgoFAqFQqEILIFFoVAoFApFYAksCoVCoVAoAktgOTQUCoVCoVAElkNDoVAoFApFYAksCoVCoVAoAktgUSgUCoVCoQgsh4ZCoVAoFMrlA2u6m8CiUCgUCoUisHICqzmPBBaFQqFQKBSBtQysRRJ1Ntbmi//+66//+vnnvV9/++mn9a+/fvjw52+++cuHD5t/unk7v/3ww9+//fa3H3+kUCgUCoVyeeWPX79//PgSgXXb2p++//7TNPnll19++eWXX37l/vrcGLfT94DA2tznuvz3L79U/fqcvf/47rvP/+tFvIgX8SJexIt4ES+y9+tVrmCZmZmZvewElpmZmdmwwJpTv4vQzMzMTGD9r6uyfg6WmZmZmcAazDR1W0PwNTdi/EWmtxt0J0yrvc97bP1SkVe78Kcplb93I5EbLz9P1o/hvb+Rqr/otjeq+S80eOOD7rG994KqM7Z+tgucsdr3oEHvlbn35LXflub3/drbPOdtSf976fwQ9NKB9fWeanvm4J3b82VkVRHT+bY33MKgN3/xSSvl77Sq7dJfn/L9cHjjh/fhoMDqjLPOe6xwPiM3Xn5bEj8y9rylizjrP2N7NxI5Y+Xn6fxYtHnjPe+Vhdsc+rOp+62q2zzn52w3v+/XRtvQt6X2Q0TPbT71Vy6938Dqf9nav+9xgTXip7ZmBVb6m5b14S/rPerwE2Ht/ZPyt9nzQbbwslmVHL/xwytb6X+PDTc4+h6rOmPl5+n8WFRbe4m3OfqjXNYn8ge+Lf3v+6d9TGj4CJ94xoZ+RhBYp2ZN7ftt2yN3c+vjpM8YWPHHlZ4osHIvFDU8RBi5MtGTC5vX/IO5sHdtf8TfY8P74LMEVsPHovgrlv5e+cDAan5bHhhYPe/7c8fVykGB1fYQYcNtCqzhgTXuS53m7scdGh6Ja36otCr+al//EfEXLIbE16dwDOLvq+Nyoerxo/gH6M57LPhYyeHjWXt3+JmPuUSC5jL3WNt/ojS8VxZCJ+W9dY5dCu1/W8rJPvRt6Xnfnzseuh0RWIe3n/WRP/dtEVhnZ1nnl0adcKGo+bpr7QW5QZcJ1//dGfnoP+KhpcP/uG/7D8TmazBV91i5FDvvsdpLFAUx9x6r/UxZLuPcM7Z5I8EzdviyQwOr9r2yfMkt6721v5OCH2GGnorIfVj7vt9wm6e9Lc91xgRWWl3NNV/l3fN9CkMDqyfFzrm344GV+7KJgVX1sbvn+1mCN3L4rU+1L5seWPHLG1nfzeSMDfrkd85t9vwtj/jbH30qDr9wIuvvZdzHhEueMYGV+fyDuIZvb5x3rqs/PLBGXMCL3z/N/53XfD/0fxfhPPhLtoPfop97jxXOZ9V3ER5eCBx0PeCxZ6zhuwizPpG0XXZNfCgq8Z0ifnKy3pb0U1F7ya3/bRn6MSF4Hg4fpky8zfnZdvbPwXqHPwiq7cLSCT9uqvlrwtpescS/09qfUZTy+kRegf6fUTQisGr/4l7qHoscoeaXTbnH2l6xns+mbe99Ke+Vo89e4Yumq36SWc9tjv5Ml/j3ctrHhGc/Yy9xBcvMzMzsFSawzMzMzASWmZmZmcAyMzMzE1hmZmZmJrDMzMzMBJaZmZmZwDIzMzMzgWVmZmYmsMzMzMwElpnZhT4gFv+Jj/LzFG7zSf+hDzMTWGZW9/m+81/42quNEf9Q4zsJrJ5XT2CZCSwzu35gJX7uv1g6CCwzE1hmlhxY8X/Q/o/fr5//8NYWL1h+DePPvHgdym9F4embSvD5y7ejscwElpm9YmCtG2WzmfZ+E7+1w6tBtc+8rpzyWxF5PQ8Dq+rNFFhmAsvMrh9YhWtLhZaK/Gnz0/ufOf4ig4i218TMBJaZXSSwIk/ffPDrKQKr6iE8gWVmAsvMHhNYhZh451ewOqtIYJmZwDKz3sA652uwRgfW4ZW2+BdObSoNX4OlrswElpm9aGDN9d9FuP6j4HcRjgus4FsR/+6/8tsVvB2BZSawzMxsOz3bytVPcjcTWGZm1h5h7gQzE1hmZgLLzASWmZmZmcAyMzMze839BxjgPj6hQyZuAAAAAElFTkSuQmCC" alt="N content graph" width="800" height="600"/></p></div><div class="module"><h2 id="M7"><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAEpklEQVR42s1XfUyUdRz/URrktNpaW/aHW1LLNdN0+U9WSzdfcq31/uLrWvZP+Y/2T+mc54GplSCOt4CBgqicpICGwokvSYkc3B3nQJxmBSo0K6fsiJe759Pn+zzccRx3xyGwvO07fvye5/f9fH7f90cBUP+nDP+QSd1XZ1LT6hPU/FqzWi4ia9mTZ2NGwLZZvUag/Dqzul2XoDzOROVu3KI6RGQte/JM3pF3R41AbaJ6pT5RNdgT1L+tyXGezpJFgM0MNGYDV34ALhUAtZugWZeh0/IiWpNiPfKunJGzd03glEmNo6L0erPqbkse59WqvwD+bgJuXQL+cgF/2oAbPwPXTgJ/HAOulgKXLYArHdqRxWjfGeuVs6JDdA2LgMOkHrGbVbVri+rsyZ9K5YeBfy4CNxsIXEvgaqC1Cvi9nM9KCFwENNMSjTk6ATiSgfMb0XtgJkSH6BKdURHQb84DzVtVl5gVN+0UJ9B+Hrh+lsAnjBsL+K8Ev3KQbtgLXMgkcBJQt5Xgm4Fz6wFaTds/A6JLdIayxCACYjJhrVV+RGAHgWsI/BPQYgV+O0rQQ1xXAJ4uwNvNv5TeTuBiHoFNwC9fAWfXAWfWACc/BayroBVOMyxB3REJ6AFHv/XkTuZN6dvrpwlWSeAjfQG3j0C7DRKaB/6frF2pBF4LnP4cqFpN4JXA8Q+AH98CypagN+dRiO7gwBxAQCK3bYfywv4NzcxbXi0jcDGBC4GmPMPMDSmGv4MJ1G8n8CdA5XLg2PsEfpPAzMbD84Hil4B9z6E9KcYrGCEJSO5K+mhlC/oimr5tpm+bcgmcATh3EoTEbAnG/4EEvL1AzUYCvwccfQMoXUzgeQSeCxS9oIOj4BloWQ9DMALrRP/tWUBavovx6PkdGNHOZON25zZQ+RLAMpumfYegPQEEuLby5haCWeYYoPtnAoXPAvlPAbmPAwRHZixavlUewRpIQMorq5h7z9NGgXGl9UX0Nj2SYZnFw+OBdGVI8Rwj+Hw/Wcue73kEuZOiIFi+sq0TkDoupRTlNJ9jR18qmQyfZk8crGgEBDSKXrald/gISDOReo7KpQTexFT6kv58l7d+ILSiERAQESzB9BOQjiZNBdYVRipVsAZk3B9eyQgJCJZgDiYgwFUfM2gei6xktAn4XVDCFCx6fmglo+0CfxCyZEY0/VgFoS8N7+yKie4WAtZ1iz3AbYisR5KG/kLEIhEVgawJLDLxA0X2hjqXGRemEAWUYm9adH7Ui9PlA4bIOtK7GezCRS9D2xMfvhQPaEbRWKCjpT8GZB3OAlmT2JRYU8pXGFNSuGYU2I67U4cgUPrq4G4oe8Hv7Z4CnPiMLXoderKjaMeBA0lEV+Q8BLjb+gnIWvb8Jmd8FROnmlW15mt4C+KjG0iCR7KIJKRty8AiIms/OY5+Vk5CNvYURwY0tuRhjWTBQ+mQ7vDJ93H65AMbu2gDO6p9F4fS2cMfSkOO5QzMkNYQU+c/SeDX+W3AmeECpyZnKrTjH6I95cG7H8vDfZhIDnekTYCW9wSnnOnsmOyeFWxg5W9DK10I997pzPOY0fkwuWc+ze6Zj9Oxkv8AsrpUzUM9ceYAAAAASUVORK5C" alt="[WARN]"/>Sequence Length Distribution</h2><p><img class="indented" src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAyAAAAJYCAIAAAAVFBUnAABSVklEQVR42u3dC3xTZZ7wcSgXQVgugsILCiJWbo51BIarMNYXFAYVEYEBVxQVV1YUYVBRVlAGXJlFQUWFhVVkhKEMviAgcumAg8gIaxEGBsTck1MKLbS0pfSavs/TMljaXE5ynqS5/P4fPn6wtMm3yXOSX09OT+qUMwzDMAzDMEqnDjcBwzAMwzAMgcUwDMMwDENgMQzDMAzDEFgMwzAMwzAMgcUwDMMwDENgMQzDMAzDEFgMwzAMwzAMgcUwDMMwDENgMQzDMAzDEFgMwzAMwzAMgcUwDMMwDENgMQzDMAzDEFgMwzAMwzAEFsMwDMMwDENgMQzDMAzDEFgMwzAMwzAEFsMwDMMwDENgMQzDMAzDEFgMwzAMwzAEFsMwPreoOnUinBfhwoi95aPrdrusjdW7m2EILIaJxMK4PPqfQXX+a6DPZwEZ4ioRav27C+ddQ2AxDIHFMDH1NKz/6UfnZxoMrOhKEAKLwGIYhsBiGM/PNx6fiqrt4qq506vyL5c/4vEzq11gzSv1drHerrTmF/r4Nv1+Cx4/3/eF+PgefeRIoN9IQBi111j1DvVxj+sB+707vC1C33I9F64nsKL3Hvd7azMMgcUwERpYep6ofDyfefu7nh0Mei7HR7cFZPD21KgfoL8Y9H8jHi/Txxcqv8Yg7vEg7g4fwa3/W9azrnzfVlF3j/u9tRmGwGKY6Agsv89k+oMppB8PwqbkQkL98SC+6/Dc1Ppfg9PfQEFfhcHFHEX3OFHFEFgME8WBVe7pZYgYDixv329ALwzpec0riMvxfSGhuMZAA6vc34tWAQWWHrnvG0d/VUfpPc5LhAyBxTBRHFiq9mdES2AFvbsr6L0vRvZn1Io8iFve4B4sPd9+cC8Rxtg9zjAEFsNEXGDpP6pGf2DpOXbEyIEsep7R1R6DZfAbDOj29HtEjp4UNnKNRpI6oLtDz/8GFFj692BF7z3OMVgMgcUwkRtYes6D5feFCZ2vj3i8ao+f78Og/5XKgL7Wm833hZT7/E1JjwdxB/qNhPS3CP1+vp67pjyQlwj93pJG7jgf60rnCom6e5yXCBkCi2GYuAhWviPucYZhCCyGYXi69fpdsGuEwGIYAothGJ5uVX4j1BWBxTAEFsMwDMMwDIHFMAzDMAxDYDEMwzAMwzAEFsMwDMMwDIHFMAzDMAxDYDEMwzAMwzAEFsMwDMMwsTPZS5a4Bg0S/yWwrrw+RedQSVc0qr4vPHjw4MGDJwI9e5hQDoHFBowHDx48eOI0sNjpFaIhsNiA8eDBgwcPgcUQWGwwePDgwYMHD4FFYBFYePDgwYMHD4FFYBFYbMB48ODBg4fAYggsNhg8ePDgwYOHwCKwCCw8ePDgwYOHwCKwCCw8ePDgwYOHwGIILDZgPHjw4MGDh8AisAgsPHjw4MGDh8CKijH5jBYCiw0YDx48ePAQWJeK4fKfWO0ehZdMYLEB48GDBw8ePH4iIKB6ILAILDZgPHjw4MGDJ+DA0rNnq+rHL/+TjwrxeDmVf/d9+QHtZvP48aCv+vI/eftOvWEILDZgPHjw4MFDYJX76JWqSaHn7x5zR8/X+vh8v1/o4xsxeNU+vjWPX05gsQHjwYMHDx4CS9duHo8VEs6P63+RzmNghZRqNLDqVBm/H69z5ei5HAILDx48ePDgqcXA8rHnSf9Lgb73YAV9Ob4vRM8eLCXfgvrAqhlP+j/uraIILDx48ODBgyfyA8v3JxjZI2VwD5aeCwzdt6BsD5aeEvIbWDX3ZhFYePDgwYMHT60Hlp5jp8oDPFBJ5wFPfq/X74Xo2YMV9FVHXGB5e+nQx+VsYRiGYRgmXKPzPFgB/RZh+ZW/WKfztwg9/m/Qv0Xo8dXA4K7a44WEKrB07p3S89Ihe7Dw4MGDBw+eCHyJMNCJ6nOThuJbCziwAq0r3y8dElh48ODBgwcPgRWxURX0ee0DC6zg6orAwoMHDx48eAisqGssI+8aFNhpGvTXlbffLizntwjx4MGDBw+eiAksJnSjK7Dq1BjfHy8P8LxZBBYePHjw4MGDx4jH3KmTqU4dbd8+8Xf700+Lv9tnzw6pJ+jhTO5sMHjw4MGDB0+UBFbr1jKwDh8Wf3fMmycD67HHCCwCCw8ePHjw4METvMd01VUiqtItFvF35yefiL9b/+//JbAILDx48ODBgwdPsB67XRSVuUGDyv/Tdu0S/2vp0oXAIrDw4MGDBw8ePEF6tKNHZWC1bHnpf0+ckP/bpAmBRWDhwYMHDx48eIL0uPbvl7usOna8/BFzs2bykKxjxwgsAgsPHjx48ODBE1Rg7dghA6tHj58Dq3t38RHX9u0EFoGFBw8ePHjw4AnG49ywQR7V3rfv5Y9Yhw4VH3GuWEFgEVh48ODBgwcPnqACq/LXBocMufwR2xNPyDM1zJ1LYBFYePDgwYMHD55gPI733pOBNWrU5Y/Y58wRHxGZRWARWHjw4MGDBw+eYDz2+fOrnVnUuWKFTK577iGwCCw8ePDgwYMHT1CBNWuW3F/17LOXP+L66it5pobu3QksAgsPHjx48ODBE4xHpJXIKccrr1z+iHbsmPiIqVkzAovAwoMHDx48ePAEFVgTJ8qXCBcsqPpB89VXy1NhnThBYBFYePDgwYMHD56APdZRo+QerPfeq/pBS5cuMrBSUwksAgsPHjx48ODBE3hgDRkiz3q1atUVH7z7bvnBTz4hsAgsPHjw4MGDB0/ggdW3r2ypDRuqftD+2GNyt9a8eQQWgYUHDx48ePDgCdhz6Y1xdu6s+kHH7NnywKynnyawCCw8ePDgwYMHT8AeS4cOMrD2778isD76SJ4Ka/hwAovAwoMHDx48ePAEvgerZUt5PPuxY1U/6NyyRb4D9G23EVgEFh48ePDgwYMn8MCqX18Glt1e9YPa4cPyXKMtWxJYBBYePHjw4MGDJ0CPxSLPKXrVVdU/rmnigzK8TCYCiwWKBw8ePHjw4AnAo/3wg9xTde21HvZsde4sj83avZvAYoHiwYMHDx48eAIJrG++kYHVqVPNf7IOHixP37B6NYHFAsWDBw8ePHjwBOBxbdsmD2ZPSqr5T7ZHHqn5FjoEFgsUDx48ePDgweMvsFJS5OkYBg6s+U/2l18W/2SbMoXAYoHiwYMHDx48eALwOFeulIF1770e/mnpUhlY999PYLFA8eDBgwcPHjwBeBzvvCMraswYDzu3Nm2S7XXHHQQWCxQPHjx48ODBE0hgzZsnA2vSpJr/pKWl1fwFQwKLBYoHDx48ePDg8eOxz5wpj2SfNs3Dv7lcpgYNTHXrplutBBYLFA8ePHjw4MGjO7CeeUYG1uzZHv/VcuON8lyje/cSWCxQPHjw4MGDB49eT+W5GBwLF3r8V+vAgfJUWGvXElgsUDx48ODBgwePXo/1/vtlQn34oed/HTeuWn4RWCxQPHjw4MGDB4+/wEpOrnm69p9fQPzd7+QLiM89R2CxQPHgwYMHDx48ej2WXr3kGw5u2uTxXx1LlsgzNTz4IIHFAsWDBw8ePHjw6A6srl1lYKWmevxX54YN8o10evcmsFigePDgwYMHDx69HnO7dvL3BA8e9Piv2oED8lRYbdsSWCxQPHjw4MGDB4/uwGrWTCRU+okTngPL4TDVq2dKSNDsdgKLBYoHDx48ePDg0eHRNBFPMrBcLq8Fdv318jXEb78lsFigePDgwYMHDx7/Hu3kSfkKYJMmPgDWvn3lrxmmpBBYLFA8ePDgwYMHj47Aqny3wTZtfABsDz8sA+vttwksFigePHjw4MGDx7/HtWeP/CXBxEQfAPsLL8hTYU2fTmCxQPHgwYMHDx48/j3OzZvlaa7uuMMHwPn22+JzbA8/TGCxQPHgwYMHDx48OgJr7VoZWIMH+wC4UlLk5/TrR2CxQPHgwYMHDx48/j2OZcvk3qkRI3wF1rffyuO0rr+ewGKB4sGDBw8ePHh0BNaiRTKwfvtbXwK73ZSQYK5fP93pJLBYoHjw4MGDBw8ePx77nDnyAPbJk30bzG3byrO9HzhAYLFA8eDBgwcPHjz+AmvGDBlYM2b4NlS+IbTz888jLrDqVJlQfJzAwoMHDx48ePAE6rE99ZQMrLlzfRusDz4oPs2xZElkBVbV9KnWRpf/XjOkAvo4gYUHDx48ePDgCdRjHTdOltOiRb4N9qlTZYfNnBnRLxGqiirf/8sCxYMHDx48ePD42YM1YoQMrOXLfRscCxfKMzWMGxePgbWFYRiGYRgmkDn8y1+Kcto9b57vT9v9xhvi0w4nJYUNFnBgeXx9kD1YePDgwYMHD55aeInwjjvk0eubN/s2aHv3ynfUufHGCN2DpbOQCCw8ePDgwYMHTxg85ptvFuXk+vprPwiLRXyaqUGDdJcr4gLL72HpBBYePHjw4MGDJ6yB1aaNPMFVWppfhvnaays/M7ICy1v98FuEePDgwYMHD55aC6yrr5bZ9NNPfhmWiqO1XF98EUGBVafGePynarXEebDw4MGDBw8ePCH0OJ3yhb+EhHRN88uw3X+/PFpr6dKIe4kw5NdHYOHBgwcPHjx49HtOnJCB1ayZHoZ9yhR5KqxZswgsFigePHjw4MGDx6tHO3BANJO5fXtdgbVggXxb6EceIbBYoHjw4MGDBw8erx5Xaqo8+ULXrnoYzk8/leca/fWvCSwWKB48ePDgwYPHe2Bt3CgDq3dvPQzX7t1yd1fnzgQWCxQPHjx48ODB49XjXL1a7pRKTtbD0H76SR6w1agRgcUCxYMHDx48ePB4D6wPPpCB9cADOiXmli3F55dmZBBYLFA8ePDgwYMHj2eP4623Ko9b1ymx3Hab+PzC774jsFigePDgwYMHDx7PHvvs2fLMC1Om6JRYhw8Xn5+3bh2BxQLFgwcPHjx48HgJrOefl4H14os6Jfannxafn71wIYHFAsWDBw8ePHjwePbYJk0SweSYN0+nRHym+PzMKVMILBYoHjx48ODBg8dLYD38sAysxYt1SpyffCI+P/03vyGwWKB48ODBgwcPHs8e6733yrcXXLlSp0TbtUsGWY8eBBYLFA8ePHjw4MHjJbAGDpSBlZKiN7Aq3rvQ0rQpgcUCxYMHDx48ePB49lSedsG1bZt+jLlZM3kqrKwsAosFigcPHjx48ODx4DF36iRqSdu3L4DA6t5dngrr++8JLBYoHjx48ODBg8dTYLVuLQPr8GH9GOvQoeJL8jdsILBYoHjw4MGDBw8eDx7TVVfJ3wq0WPRjbE88IU+F9fbbBBYLFA8ePHjw4MFTw2O3i1QyN2gQEMY+Z448FdZzzxFYLFA8ePDgwYMHT3WPdvSoDKyWLQPCOFesEF916oEHCCwWKB48ePDgwYOnuse1f78850LHjgFhXF99JU+FlZREYLFA8eDBgwcPHjw1AmvHDhlYPXoEhNGOHZNf1aIFgcUCxYMHDx48ePBU9zg3bBCpZO3bN1CPpUkT8YVlOTkEFgsUDx48ePDgwXNlYFW8saB1yJBAPY4ePcQXFh0+TGCxQPHgwYMHDx48V3bSe+/JwBo1KmDQ8OHyVFibNhFYLFA8ePDgwYMHzxVjnz9fdJL9sccC9WROmSK+MGfJEgKLBYoHDx48ePDguTKwZs0SnWR79tlAPdlvvSW+MGv6dAKLBYoHDx48ePDguWJEWskTLrzySqCevHXr5KmwRo0isFigePDgwYMHD54rA2viRPkS4YIFgXou/u1v4gudPXsSWCxQPHjw4MGDB88VYx01Su7Beu+9QD2lGRny6PhWrQgsFigePHjw4MGD58rAGjJE7ohatSpgj9ttbtRIngorP5/AYoHiwYMHDx48eKoEVt++MrA2bAjCY+/SRZ4K6+hRAosFigcPHjx48OD5eczdu4tIcu3cGYQnfehQ8bUXtm4lsFigePDgwYMHD56fx9Khgwys/fuD8JyZPFmeCmvpUgKLBYoHDx48ePDgqbIHq2VLEUnasWNBeM5VnKQ068UXCSwWKB48ePDgwYOnSmDVry8Dy24PwpP32WfiazPGjCGwWKB48ODBgwcPnssvEFpEIZmuuio4z8VvvpEvL/bpQ2CxQPHgwYMHDx48l0b74QdRSOZrrw3OU+JyyVNhtWlDYLFA8eDBgwcPHjz/DKyKXVDmTp2C9JSVmRs2NNWt6754kcBigeLBgwcPHjx45Li2bROBZUlKCtpj79xZXELxiRMEFgsUDx48ePDgwVMRWCkp8jW+gQOD9mjJyfJUWNu3E1gsUDx48ODBgwePHOfKlTKw7r03aM/pSZPEJZxftozAYoHiwYMHDx48eOQ43nlH5JFtzJigPedef11cwtlXXiGwWKB48ODBgwcPnorAmjdPBtakSUF7cletkqfCGj+ewGKB4sGDBw8ePHjk2GfOFHlknzYtaE/Bnj3yVFgDBhBYLFA8ePDgwYMHT0VgPfOMDKzZs4P2lNhsch9Y+/YEFgsUDx48ePDgwSPH9sgjIo8cCxcG7XGXlJjq1TMlJLiLiwksFigePHjw4MGDJ916//0isJwffmjEY+vYUZ4Ky2SqtcCq88+pmUTVxuPHvX0JgYUHDx48ePDgCSawKs5i5Vy92ohHGzRIXEhBamot78HyG0BVAyuIzyGw8ODBgwcPHjx6PJZeveQh6ps2GfGcfvRRcSG5K1dGdGBV/Vdvn1lzbxaBhQcPHjx48OAJOLC6dpWBlZpqxHP2P/5DngrrtdeiKbA8vhTou6i2MAzDMAzD6JjjrVuLNtr+8cdGLuSb558XF/J9cnIohGoCy/c/eXtZkD1YePDgwYMHD54gPOZmzUQbpZ84YcRTsGuXuBBt8ODI3YOlc+cWgYUHDx48ePDgMerRNFNCggwsl8uIp9hkkqfC6tgxQgMr6IPfCSw8ePDgwYMHT6Ae7eRJEUbmJk0MetxFRSLUzPXrl5eWRkdg1Twey29sEVh48ODBgwcPHl2BlZYmA6tNG+MeW/v24qJKbLbaCSzf57XyVl2cBwsPHjx48ODBo9zjqngbQUtionGPq39/eSqsr7+uzT1YIb8+AgsPHjx48ODB48/j3LxZVJH1jjuMezLGj5enwlq1isBigeLBgwcPHjzxHVhr18rAGjzYuOfsrFnios698QaBxQLFgwcPHjx44trjWLZM/vbfiBHGPecrLur0pEkEFgsUDx48ePDgie/AWrRIBtZvf2vcc+Grr+SpsO6+m8BigeLBgwcPHjxx7bHPmSOqyD55snFP8YkT8qI6dyawWKB48ODBgwdPfAfWjBmyimbMMO5xFxTIMz40bFheVkZgsUDx4MGDBw+e+PXYnnpKBtbcuUo81jZt5KmwXC4CiwWKBw8ePHjwxK/HOm6cSCLHokVKPM5f/Upc2sV9+wgsFigePHjw4METx3uwRoyQgbV8uRJPxpgx4tLyPvuMwGKB4sGDBw8ePPHrsQwaJJLIuXatEk/WzJnyVFgLFhBYLFA8ePDgwYMnjl8ivOMOGVibNyvx5CxdKi7tzOTJBBYLFA8ePHjw4Ilfj/nmm0USub7+WonnwpYt4tLS77mHwGKB4sGDBw8ePHEcWBW/96elpSnxFB09Kn8nsUsXAosFigcPHjx48MRxYF19tQysn35S4inLy5OnwmrcmMBigeLBgwcPHjzx6nE6RQ+ZEhLSNU2Vx9qqlbjM0owMAosFigcPHjx48MSlp+LNbUzNmin0OHv2FJdZ+N13BBYLFA8ePHjw4IlHj3bggHxFr317hZ5To0bJU2GtW0dgsUDx4MGDBw+eePS4UlNFDFm6dlXoyZo+XVxm9sKFBBYLFA8ePHjw4InLwNq4UQZW794KPTlLlojLzJwyhcBigeLBgwcPHjzx6HGuXi1iyJqcrNCTv2mTPBXWb35DYLFA8eDBgwcPnrgMrA8+kIH1wAMKPUU//CDf3LBHDwKLBYoHDx48ePDEo8fx1lsihmyPPKLQU5aTI192bNqUwGKB4sGDBw8ePPHosc+eLU+8PmWKWo+leXN5KqysLAKLBYoHDx48ePDEX2A9/7wMrBdfVOtxJCXJU2F9/z2BxQLFgwcPHjx44s5jmzRJHi81b55az6n77xcXm79hA4HFAsWDBw8ePHjiL7AeflgG1uLFaj2Zzz0nT4X19tsEFgsUDx48ePDgiTuP9d57RQk5V65U68letEieCuu55wgsFigePHjw4METf4E1cKAMrJQUtZ78DRvExZ564AECiwWKBw8ePHjwxJ3HctttooRc27ap9RT+7//KVx6TkggsFigePHjw4METdx5zp06ihLR9+9R6SrOy5KmwWrQgsFigePDgwYMHT/wFVuvWMrAOH1busTRpIi65LCeHwGKB4sGDBw8ePPHlMV11lXzfQItFucfRo4e45KLDhwksFigePHjw4METTx67XTSQuUGDUHjShw+Xp8LatInAYoHiwYMHDx48ceTRjh6VgdWyZSg8mVOmiAvPWbKEwGKB4sGDBw8ePHHkce3fLw9F79gxFJ7sireRzpo+ncBigeLBgwcPHjzxFFg7dsjA6tEjFJ68devkqbBGjSKwWKB48ODBgwdPHHmcFacDtfbtGwrPxb/9TZ7CtGdPAosFigcPHjx48MRTYH3yiQysIUNC4SnNyJAX3qoVgcUCxYMHDx48eOLI43jvPdlAo0aFxON2mxs1kqfCys8nsFigePDgwYMHT7x47PPniwCyP/ZYiDz2Ll3kqbCOHiWwWKB48ODBgwdP3ATWrFkigGzPPhsiT/rQoeLyL2zdSmCxQPHgwYMHD5548Yi0km/J/MorIfKcmTxZngpr6VICiwWKBw8ePHjwxE1gTZwoXyJcsCBEnnMVL0FmvfgigcUCxYMHDx48eOLFYx01Su7Beu+9EHnyPvtMXH7GmDEEFgsUDx48ePDgiZvAGjJEnqpq1aoQeS5+8424fFefPgQWCxQPHjx48OCJm8Dq21cG1oYNIfKUuFzyNBBt2oQpsOr8c2omUdXx9k96Pk5g4cGDBw8ePHh8e8zdu8s9TDt3hspTVmZu2NBUt6774sXw7cEKKIku/1PNwAri0ligePDgwYMHDx5Lhw4ysPbvD53H3rmzuIriEyciMbB0RpXv/2WB4sGDBw8ePHiu2IPVsqWoH+3YsdB5tORkeSqs7dtrObA8vuQXXGBtYRiGYRiG8T6mevVE/WzZuDF0V/G/FcfRf/PsswYvx1Bg1Ywt9mDhwYMHDx48eELisVhE+piuuiqknnOvvy6u5ewrr9TmHiyDx10RWHjw4MGDBw8enaP98INIH/O114bUk7tqlTwV1vjxBBYLFA8ePHjw4ImDwKo4SZW5U6eQegr27JHH0Q8YUMvHYHl8ibCc3yLEgwcPHjx48Cj1uLZtE+ljSUoKqafEZpPvJ92+fTgCS+H5rjgPFh48ePDgwYMnmMBKSZFnAR04MKQed0mJPJQ+IcFdXBymPVihHgILDx48ePDgweNtnCtXysC6995Qe2wdO8pTYZlMBBYLFA8ePHjw4Ilxj+Odd+SLd2PGhNqjDRokrqggNZXAYoHiwYMHDx48sR5Y8+bJwJo0KdSe048+Kq4od+VKAosFigcPHjx48MS4xz5zpuge+7Rpofac/Y//kKfCeu01AosFigcPHjx48MR6YD3zjAys2bND7Sn4+mtRVxf/+lcCiwWKBw8ePHjwxLjH9sgjIrAcCxdGiIfAYoHiwYMHDx48Ue+x3n+/CCznhx8SWAQWHjx48ODBg0dRYCUny8BavZrAIrDw4MGDBw8ePGrG0quXfBObTZsILAILDx48ePDgwaMosLp2lYGVmkpgEVh48ODBgwcPHjVjbtdOBJZ28CCBRWDhwYMHDx48eBQFVrNmIrDST5wgsAgsPHjw4MGDB4+KcbtNCQkysFwuAovAwoMHDx48ePAomLLcXFFX5iZNIuf2IbBYoHjw4MGDB090e0pcLhlYbdoQWAQWHjx48ODBg0eNp+jYMRFYlsREAovAwoMHDx48ePCo8Vzcv18ElvWOOwgsAgsPHjx48ODBo8ZzYft2GViDBxNYBBYePHjw4MGDR40nLyVFBJZtxAgCi8DCgwcPHjx48KjxnF+xQgbWb39LYBFYePDgwYMHDx41nuxFi0Rg2SdPJrAILDx48ODBgwePGs/ZOXNkYM2YQWARWHjw4MGDBw8eNZ7MadNkYM2dS2ARWHjw4MGDBw8eNZ7TkyaJwHIsWkRgEVh48ODBgwcPHjWejNGjZWAtX05gEVh48ODBgwcPHjUebcgQEVjOtWsJLAILDx48ePDgwaPG4+rTRwbW5s0EFoGFBw8ePHjw4FHjsXftKgLL9fXXBBaBhQcPHjx48OBR47G1aycCS0tLI7AILDx48ODBgwePGo+lSRMZWD/9RGARWHjw4MGDBw8eFZ7SUlFXpoSEdE0jsAgsPHjw4MGDB48CT1l2tgysZs0i6vYhsFigePDgwYMHTxR7Smw2EVjm9u0JLAILDx48ePDgwaPGU3TkiAgsS9euBBaBhQcPHjx48OBR47m4d68MrN69CSwCCw8ePHjw4MGjxnNh61YRWNbkZAKLwMKDBw8ePHjwqPHkrVkjA+uBBwgsAgsPHjx48ODBo8Zz/qOPRGDZHnmEwCKw8ODBgwcPHjxqPNkLF4rAsk+ZQmARWHjw4MGDBw8eNZ6zr74qA+vFFwksAgsPHjx48ODBo8aTOXWqCCzHvHkEFoGFBw8ePHjw4FHjOf3oozKwFi8msAgsPHjw4MGDB48az6mRI0VgOVeuJLAILDx48ODBgwePGo+WnCwDKyWFwCKw8ODBgwcPHjxqPM6ePUVgubZtI7AILDx48ODBgwePGo89MVEElrZvH4FFYOHBgwcPHjx41His110nA+vw4VgLrDr/HI9VVPNf61w5fj+fwMKDBw8ePHjweBtzo0YisNItltjcg+U7iao2k49U8vE5BBYePHjw4MGDp9q4i4pEXZkbNIi02yeEgaU/njx+3Pf/skDx4MGDBw8ePKWZmfKdnlu1IrC8vkTou6i2MAzDMAzDXDnbV6wQgXW8bdvoYisLLB97rbzt2WIPFh48ePDgwYPH9xSmpcmTYN1+ezzuwdLZXgQWHjx48ODBgyegKdizR/4K4aBBcRdYQR+bRWDhwYMHDx48eHxP/qZNIrBO3XdffAWW3w96OwyL3yLEgwcPHjx48Pid3NWrRWBlTJgQg4Hl46B1Pf9UraI4DxYePHjw4MGDR+fkvP++CKzMKVNidg9WyK+PwMKDBw8ePHjwXDnnFiwQgZX18ssEFoGFBw8ePHjw4FHjEWklAiv7zTcJLAILDx48ePDgwaPGc+aZZ0Rg5SxdSmARWHjw4MGDBw8eNZ6MCRNEYOWuXk1gEVh48ODBgwcPHjWe9BEjRGDlf/EFgUVg4cGDBw8ePHjUeLRBg0RgFezZQ2ARWHjw4MGDBw8eNR5HUpIIrMJDhwgsAgsPHjx48ODBo8Zj79RJBFax2UxgEVh48ODBgwcPHjUea6tWIrBKs7IILAILDx48ePDgwaPGY65fXwSWu7iYwCKw8ODBgwcPHjwKPO6CAlFX5kaNIvD2IbBYoHjw4MGDB09UekpPnRKBZW3ThsAisPDgwYMHDx48ajzFP/4oAsuemEhgEVh48ODBgwcPHjWewoMHRWA5e/UisAgsPHjw4MGDB48aT8GuXSKwtORkAovAwoMHDx48ePCo8eR//rkIrFMjRxJYBBYePHjw4MGDR40n9+OPRWCdnjiRwCKw8ODBgwcPHjxqPDlLlojAypw6lcAisPDgwYMHDx48ajzn3nhDBNbZ2bMJLAILDx48ePDgwaPGk/W734nAyl64kMAisPDgwYMHDx48ajxnJk8WgXV+2TICi8DCgwcPHjx48KjxZIwdKwIrb+1aAovAwoMHDx48ePCo8aQPGyYC68LWrQQWgYUHDx48ePDgUeNx9e8vAuviN98QWAQWHjx48ODBg0eNx3HrrSKwio4cIbAILDx48ODBgwePGo/thhtEYJXY7QQWgYUHDx48ePDgUeOxNG8uAqssO5vAIrDw4MGDBw8ePCo8brcpIUEEVnlZGYFFYOHBgwcPHjx4FHjKcnNFXVmaNo3M24fAYoPBgwcPHjx4os9T4nKJwLK1a0dgEVh48ODBgwcPHjWeomPHRGA5unUjsAgsPHjw4MGDB48az8X9+0Vgufr0IbAILDx48ODBgwePGs+F7dtFYKUPHUpgEVh48ODBgwcPHjWevJQUEVgZo0cTWAQWHjx48ODBg0eN5/yKFSKwzjzxBIFFYOHBgwcPHjx41HiyFy0SgZX1wgsEFoGFBw8ePHjw4FHjOTtnjggs8V8Ci8DCgwcPHjx48KjxZE6bJgIr++23CSwCCw8ePHjw4MGjxnN60iQRWOdXrCCwCCw8ePDgwYMHjxpPxujRIrDy1q8nsAgsPHjw4MGDB48ajzZkiAisC9u3E1gEFh48ePDgwYNHjcfVp48IrIv79xNYBBYePHjw4MGDR43H3rWrCKyif/yDwCKw8ODBgwcPHjxqPLZ27URglbhcBBaBhQcPHjx48OBR47E0aSICqywvj8AisPDgwYMHDx48KjylpaKuTAkJ5W43gUVg4cGDBw8ePHgUeMqys0VgWVq0iNjbR0Fg1fnneKwij/8a6McJLDx48ODBgwfP5Smx2URg2Tp0iOXA8hFAlz9YM6QC+jiBhQcPHjx48OC5PEVHjojActx6azwGlsGo8v2/LFA8ePDgwYMnbj0X9+4VgeUaMIDAMhpYWxiGYRiGYSpmz9y5IrAO9+oVpX72YPETCR48ePDgwRNxnrw1a0RgZYwbxx4sAgsPHjx48ODBo8Zz/qOPRGCdmTyZwCKw8ODBgwcPHjxqPNkLF4rAypo5Mx4Dq5zfIsSDBw8ePHjwhMBz9tVXRWCdmzcvlgOrzpVTrYo4DxYePHjw4MGDR60nc+pUEVg5S5bE/h6skF8fgYUHDx48ePDgqZjTjz4qAiv3k08ILAILDx48ePDgwaPGc2rkSBFY+Z9/TmARWHjw4MGDBw8eNR4tOVkEVkFqKoFFYOHBgwcPHjx41HicPXuKwCo8eJDAIrDw4MGDBw8ePGo89sREEVjFJ08SWAQWHjx48ODBg0eNx3rddSKwSjMyCCwCCw8ePHjw4MGjxmNu1EgElruggMAisPDgwYMHDx48CjzuoiJRV+YGDSL59iGw2GDw4MGDBw+eaPKUZmaKwLK2akVgEVh48ODBgwcPHjWeYrNZBJb9ppsILAILDx48ePDgwaPGU5iWJgLLefvtBBaBhQcPHjx48OBR4ynYs0cEljZoEIFFYOHBgwcPHjx41HjyN20SgXXqvvsILAILDx48ePDgwaPGk7t6tQisjAkTCCwCCw8ePHjw4MGjxpPz/vsisDKnTCGwCCw8ePDgwYMHjxrPuQULRGBlvfwygUVg4cGDBw8ePHjUeERaicDKfvNNAovAwoMHDx48ePCo8Zx55hkRWDlLlxJYBBYePHjw4MGDR40nY8IEEVi5q1cTWAQWHjx48ODBg0eNJ33ECBFY+V98QWARWHjw4MGDBw8eNR5t0CARWAV79hBYBBYePHjw4MGDR43HkZQkAqvw0CECi8DCgwcPHjx48Kjx2Dt1EoFVbDYTWAQWHjx48ODBg0eNx9qqlQis0qwsAovAwoMHDx48ePCo8Zjr1xeB5S4uJrAILDx48ODBgwePAo+7oEDUlblRowi/fQgsNhg8ePDgwYMnajylp06JwLK2aUNgEVh48ODBgwcPHjWe4h9/FIFlT0wksAgsPHjw4MGDB48aT+HBgyKwnL16EVgEFh48ePDgwYNHjadg1y4RWFpyMoFFYOHBgwcPHjx41HjyP/9cBNapkSMJLAILDx48ePDgwaPGk/vxxyKwTk+cSGARWHjw4MGDBw8eNZ6cJUtEYGVOnUpgEVh48ODBgwcPHjWec2+8IQLr7OzZBBaBhQcPHjx48OBR48n63e9EYGUvXEhgEVh48ODBgwcPHjWeM5Mni8A6v2wZgUVg4cGDBw8ePHjUeDLGjhWBlbd2LYFFYOHBgwcPHjx41HjShw0TgXVh61YCi8DCgwcPHjx48KjxuPr3F4F18ZtvCCwCCw8ePHjw4MGjxuO49VYRWEVHjhBYBBYePHjw4MGDR43HdsMNIrBK7HYCi8DCgwcPHjx48KjxWJo3F4FVlp1NYBFYePDgwYMHDx4VHrfblJAgAqu8rIzAIrDw4MGDBw8ePAo8Zbm5oq4sTZtG/u1DYLHB4MGDBw8ePNHhKXG5RGDZ2rUjsAgsPHjw4MGDB48aT9GxYyKwHN26xUVg1akxHj9erZY8fpzAwoMHDx48ePB4m4v794vAcvXpE497sKoGlpHPIbDw4MGDBw8ePFXnwvbtIrDShw6Nu8CqmkHekqjm3iwCCw8ePHjw4MHjd/JSUkRgZYweHe+B5fGlwOACawvDMAzDMPE9e597TgTW90OHRvs3Elhg+X5N0NvLguzBwoMHDx48ePDomexFi0RgZb3wQnztwfLdQAQWHjx48ODBg8eI5+ycOSKwxH/jKLD8BhCBhQcPHjx48OAx4smcNk0EVvbbb8d1YNU8HstvbBFYePDgwYMHDx5vc3rSJBFY51esiJfA8vELg5wHCw8ePHjw4MGjxJMxerQIrLz16+NoD1bIr4/AwoMHDx48eOLbow0ZIgLrwvbtBBaBhQcPHjx48OBR43H16SMC6+L+/QQWgYUHDx48ePDgUeOxd+0qAqvoH/8gsAgsPHjw4MGDB48aj61dOxFYJS4XgUVg4cGDBw8ePHjUeCxNmojAKsvLI7AILDx48ODBgwePCk9pqagrU0JCudtNYBFYePDgwYMHDx4FnrLsbBFYlhYtouL2IbDYYPDgwYMHD54o8JTYbCKwbB06EFgEFh48ePDgwYNHjafoyBERWI5bbyWwCCw8ePDgwYMHjxrPxb17RWC5BgwgsAgsPHjw4MGDB48az4WtW0VgpQ8bRmARWHjw4MGDBw8eNZ68NWtEYGWMG0dgEVh48ODBgwcPHjWe8x99JALrzOTJBBaBhQcPHjx48OBR48leuFAEVtbMmQQWgYUHDx48ePDgUeM5++qrIrDOzZtHYBFYePDgwYMHDx41nsypU0Vg5SxZQmARWHjw4MGDBw8eNZ7Tjz4qAiv3k08ILAILDx48ePDgwaPGc2rkSBFY+Z9/TmARWHjw4MGDBw8eNR4tOVkEVkFqKoFFYOHBgwcPHjx41HicPXuKwCo8eJDAIrDw4MGDBw8ePGo89sREEVjFJ08SWAQWHjx48ODBg0eNx3rddSKwSjMyCCwCCw8ePHjw4MGjxmNu1EgElruggMAisPDgwYMHDx48CjzuoiJRV+YGDaLl9iGw2GDw4MGDBw+eSPeUZmaKwLK2akVgEVh48ODBgwcPHjWeYrNZBJb9ppsILAILDx48ePDgwaPGU5iWJgLLefvtBBaBhQcPHjx48OBR4ynYs0cEljZoEIFFYOHBgwcPHjx41HjyN20SgXXqvvsILAILDx48ePDgwaPGk7t6tQisjAkTCCwCCw8ePHjw4MGjxpPz/vsisDKnTCGwCCw8ePDgwYMHjxrPuQULRGBlvfwygUVg4cGDBw8ePHjUeERaicDKfvNNAovAwoMHDx48ePCo8Zx55hkRWDlLlxJYBBYePHjw4MGDR40nY8IEEVi5q1cTWAQWHjx48ODBg0eNJ33ECBFY+V98QWARWHjw4MGDBw8eNR5t0CARWAV79hBYBBYePHjw4MGDR43HkZQkAqvw0CECi8DCgwcPHjx48Kjx2Dt1EoFVbDYTWAQWHjx48ODBg0eNx9qqlQis0qwsAovAwoMHDx48ePCo8Zjr1xeB5S4uJrAILDx48ODBgwePAo+7oEDUlblRoyi6fQgsNhg8ePDgwYMnoj2lp06JwLK2aUNgEVh48ODBgwcPHjWe4h9/FIFlT0wksAismPW4li61/OIX4r/cPnjw4MGDJzyewoMHRWA5e/UisAismPWIuhKr3HLbbdw+ePDgwYMnPJ6CXbvEU4+WnExgEVgx6rHbzf/yLzKwOnfm9sGDBw8ePOHx5H/+uXjqOTVyZHwFVp0rp1oVBfRxAivCPY5ly8QSNyUkmOrW1Q4f5vbBgwcPHjxh8OR+/LF49jk9cWLcBZbfKqoZWIFmE4EVCR5rcrLcfXXLLeK/jnff5fbBgwcPHjxh8OQsWSKedzKnTiWwAogqneVEYNW6R0tLM9WrZ2rY0DFrlljotoce4vbBgwcPHjxh8Jx74w3xvHN29mxeIlQfWFuY2p79EyeK9X3ozjt3fvSR+MuPLVps2byZm4VhGIYJ9RwYNUo873z7+OMx8x3pCqyaB1exBysmPeaKN9p0fvaZ/Hv79uLvrh07uH3w4MGDB0+oPWcmTxZPOueXLYuvPVgGj7sisKLC49q4Ub5NQdu26S6X+F/b+PHyMKxXX+X2wYMHDx48ofZkjB0rnnTy1q4lsAisWPNYKxa3/bnnKv/XsXy5fNeCAQO4ffDgwYMHT6g96cOGiSedC1u3xt0xWB5fIizntwhjxaP99JO5SRN5krdvv730oePH5QHvDRpoJhO3Dx48ePDgCanH1b+/eA66+M03cbcHi/NgxbbH+c478uwMffpcsU+rZ095SNann3L74MGDBw+ekHoct94qnnGKjhyJ65cIQ3V9BFbteSy/+pU84uqdd6p+0D5jhjxZw6RJ3D548ODBgyekHtsNN4hnnBK7ncAisGLHo+3bJw9vb9Kk2quBri++kB/38p45PKDgwYMHDx5VHkvz5uIZpyw7m8AisGLHY586VR7PPm5cjRcOnaZmzeSBWQcO8ICCBw8ePHhC5XG75Vu0iQwoKyOwCKxY8Tid5rZt5SmvNm6seaXW4cPlS4cLF/KAggcPHjx4QuQpy82VxwE3bRpdtw+BxQbjy+P84x/l64CdOnm8UpFWcufWb37DAwoePHjw4AmRp8Tlkof8tmtHYBFYseOx3XefPP3VrFker1Q7cED8q6lZs3SnkwcUPHjw4METCk/RsWPy1ZJu3QgsAitGPJpY0w0amOrV0w4d8na95ptuki8gbt7MAwoePHjw4AmF5+L+/fKJpk8fAovAihGP4/e/l68AJif7uF7bpElyF9eMGTyg4MGDBw+eUHgubN8unmjShw4lsAisGPFYevSQe2WXL/dxvc5PP5UR1rMnDyh48ODBgycUnryUFPFEkzF6NIFFYMWCx7Vzpzy8vWXLdLvdx/VqJlPly4jpx4/zgIIHDx48eJR7zq9YIZ6PzjzxBIFFYMWCp/K1P9sTT/i9auuAATV3dPGAggcPHjx4lHjOzp0rnmUyn36awCKwot9jt5tbtpQHFe7c6feqHa+8IlNs/HgeUPDgwYMHj1qPu7Cw8n1yHD16EFgEVtR7HMuWybO63Xqrnqt27dghX0xs354HFDx48ODBo9ZzeuJE+XzUvHn+//t/BBaBFfUea3Ky/HHh97/Xdd2aZm7dWr5nzl//ygMKHjx48OBR5cn+wx9kXTVpUvTDD1F3+xBYbDDVPVpamqlePVPDhun/+IfOa7eOGiWDbN48HlDw4MGDB48Sz4UtW+RbENatm//559F4+xBYbDDVPfZZs+QxVfffr//aHe++K0/WcPfdPKDgwYMHDx7jnqJjxyzNmolnlnPz5kXp7UNgscFU95g7dRJr2vnZZ/qvXfvhB/FDhqlx43SbjQcUPHjw4MFjxFOalWXv3Fme+2rcuOi9fQgsNpgrxrVxozxivW3bdJcrIIC5e3eZZSkpPKDgwYMHD56gPe6SEu2uu+QTSq9e7oICAovAihGPdexY+dY3zz0XKMA2ZYp8YXHKFB5Q8ODBgwdP0J4z//Zv8tmkXbsSTYvq24fAYoP5ecry8sxNmsjfB/z220ABroq3MrD06MEDCh48ePDgCc6T8/778lWURo0KDxyI9tuHwGKD+Xly/+d/ZCT16ROMwGYzNW5sqltXO3yYBxQ8ePDgwROop2DXLnP9+uJpKG/Nmhi4fQgsNpifxzVwoDzbwjvvBGew3n23/PJ33+UBBQ8ePHjwBOQpPnnSUvEOImdfeSU2bh8Ciw2m/PLiljtmmzTRTKbgDI433pAvnD/0EA8oePDgwYNHv6csJ8fetat4Bjk1cmS5201gEVgx5Tlbcfor67hxQRu0v/5VJlrr1ukBHpnI/YUHDx488espLU2/9175Ashtt5Xl5cXM7UNgscFUTGmprX17+e7OGzcaYZgrL2THDh5Q8ODBgwePnsl64QX54/2115bYbLF0+xBYbDByLnz5pTw7Q2KiQYZt/Hj5U8irr/KAggcPHjx4/I7z7bflSx8NG17cuzfGbh8Ciw1GTsbDD8t3JFiwwCDDsXy5/EFkwAAeUPDgwYMHj++Rp7Zu0EA8a+SuXBl7tw+BxQYj35RA/PRgqlevRNOMOo4fl28U3aBBWX4+9xcePHjw4PE22nffmVu1EnWV9cILMXn7EFhsMOU5FW/VnD5smBKPtWdPcWkXtmzh/sKDBw8ePJ7r6qefLN26yVc87rqrvLSUwCKwYnODcd5+uzyx2/r1Sjz2GTPEpWVOncr9hQcPHjx4POWVZr3nHnno1c03aydOxOrtQ2DF+wZTeOiQ/BmiVSt3UZESj+uLL+Tx8l26cH/hwYMHDx4PP4dPnSqeJkwtWlS+LRuBRWDF5gaTWbHQM597TpnH6TQ1ayYu0+Av3HJ/4cGDB0/seZxLl8p9V/Xru1JSYvv2IbDieoNxFxVZK44xLDx0SKHHOny4uMzzy5Zxf+HBgwcPnp9f4ti61XTVVfJVjiq/tE5gEVgxuMHkpaSIhe785S/VehwLF8p3PHjoIe4vPHjw4MFTOVpamrlNG/mOahMnxsPtQ2DF9QaTPmyYWOs5776r1qMdOCAu1tKihfHfDeH+woMHD55Y8FgslttuqzxRouZwEFgEVixvMCUul6lePfNVV5WdPavcY7/lFrEhXfz2W+4vPHjw4MFjvf9++YP3jTem/+MfcXL7EFjxu8GcW7BALPeMMWNC4ak8dv7snDncX3jw4MET5x77zJnywPZ/+RfX11/Hz+1DYMXvBmNPTJRnBN22LRSeC1u2yHd97tuX+wsPHjx44tnjXLHCVLeuKSHBuXp1XN0+BFacbjAX9+6VRxq2b19eVhYKT1l+fuXb75SdO8f9hQcPHjzx6XHt3Gm++mr5a4OvvRZvtw+BFacbzOnHH5cv4b3ySug82l13XT5BPPcXHjx48MSbx7Vrl6lxY/nD/NixcXj7EFjxuMGU5eVZmjYVi774p59C58l+801xFWeefJL7Cw8ePHjizeNYssTUoIE89Oqaa9LtdgKLwIqLDSb3f/5HHiB1550h9RSmpckfXDp04P7CgwcPnvjxaIcOWYcMkW+GI+qqbVtXamp83j4EVjxuMK6BA8W6z/3449B63G7rddfJ/WTHj3N/4cGDB088eOSOq4p3SzM1b+549914vn0IrLjbYIpPnpQnI2natCw/P9SejAkT5IlMlyzh/sKDBw+e2PZU3XEl/iL+N85vHwIr7jaYs7NmidV/etKkMHhyP/1UXFf68OHcX3jw4METw54gdlwRWARWbC2I0lJb+/byHOt794bBU3rqlKluXfPVV7sLC7m/8ODBgyf2PEHvuCKwCKyYWhAXvvxSno8kMTFsHkdSkrjGgtRU7i88ePDgiTGPkR1XBJauwKpTZTx+sFoeefs4gRVqT8bDD4st4dyCBWHzZL34orhG8V/uLzx48OCJGU+JphnccUVg+Q+smlHlN4n0fA6BpdxTmpVVeXZ1sWGEzVOwa5fY/Jy33879hQcPHjyx4cldtcrSooXBHVcEVsAvEfqNp5p7swis8Hhy3n1XHnI+bFg4Pe7CQvk+CXXrlmZkcH/hwYMHT1R7xM/n6SNGKNlxRWAZCixvLx0GUU5bGMNz7KabxCbx9axZYb7eH3r1Etf71+nTuQsYhmGid/ZOn/5jkybi8fzHpk15SDc4AQeWj71W3vZssQcrPJ4LX30lf+Bo2dJdVBRmT87ixfLEEI88wv2FBw8ePNHoqbrjSvyltOJCuH3CtwfLdwMRWLXrsd98s9gwHF27ht9TfPy4bLvrrit3u7m/8ODBgye6PJePuLK0bJn76afcPuEOLL8BRGDVoqdg5075nlANGoi/1IrH1qGDABSmpXF/4cGDB0+0eDzuuOL2CWtgeawfb79dWM5vEYbX4y4qsnfpIjaP7Lfeqi3PmSeflID//E/uLzx48OCJCo+3HVfcPuELrDo1xuM/VaslzoMVNo/IGnly0a5d3cXFteXJW79eGLS77uL+woMHD57I/YG8sLDo8OGcpUvtiYnedlxxf4X7JcKQXx+BFZSnxOm0VPzSh98XB0PqKTt3zlSvnrlhQ4/vMM39hSe6PW533p//7OjRI/+LL7h98ESRpzKn8tasOTt79qkHH7Tfcot4oK7sKnlUSaNGHndccX8RWCwIOZWnbhf/rXWPq29fIbng83dTub/wRJPH7b64f3/WCy/Ybrjh0hNSQsLpxx8vNpu5ffBEosdm01JTnR984DGnLv2pV8/epYs2fLjj1lsvbNzI/UVgsQF79lQe225p0qTE6ax1z9k5cwQmc+pU7i880e2p0VXyl2TbtXP06GGueLoy16/vLbO4v/CEz/PPnLJPm2YdNsx8003ecurUqFEiufLWri06csRdWMj9RWCxAfvxBHRsexg8F/ftk4eCdenC/YUnKj2eusrWoUPW9Oni45WnIBFRJdJKBJa3zOL+whM6j5aW5pg1y9K7t6VfP285Ze7c2Tp8eHA5xf1FYLEgLk1Ax7aH4/YpLa38hZQSm437C0/UeDTNuXmz766qNj4yi/sLj0rP8eOuP/3J/tJL1nvuMbdp4y2n7NOmOT/80JWamm6zcX8RWLUZWK5t28w33OD66quoXhCBHtsengV6atQoQTq/bBkbMJ5I91R0lX3yZHO7djq7Sk9mcX/hMeSxWFybNjlef9364IPmG2+sXlTNm1uSkiy9e9tnzqyaU9xfBFakBJb5+uvlSm3UyJmSEr0LItBj28OzQEVaCdWphx5iA8YToR5PXWVu315/V/nOLOvYsa79+7m/8Ogcd0lJ4aFD55cvP/Pkk46kpMqF9POfRo0svXrZnnrKuXSptm+fWL3cXwRW5AaW68svTXXrmhIS5NpNSLDPmJHuckXdggji2PbwLNASm03CWrQoLy1lA8YTQR4vXWV/+mnxcfGvBhnKM4v1E7Met7v45Mm8P/4x8/nnXf37mxs3rlpUYvFYevSwTZjg+MMftF27NIeD+4vAiprAsvTpI18I+Pd/F2lVmVnWgQO1H36IogUR3LHtYVug8heD69S5+O23bMB4IsHjXLPG0rmzuW1bj12l1iMyS6SVksxi/dSax+nUjhxx7d7tXL/e8dFHtieftPTrZx0zRjxl+Phzds4c339OT5rkuvNOZ8+elQeq/vynbl17YmLG+PE5ixdf3Lcv3WLh/iKwojKwnCtWyAe+1q21H3+U/5uSYr7uOvmRa6+t+XJhxC6I4I5tD9sCzZw6VfDEAwobMJ5a9ziWLDE1bOijq0LhEVFlPLNYPyHxlJaWnj5ddPRowV/+krduXc7779unT7dNnGgbMcLat68lMdF8zTWXXt8I5R9bu3anRo48N39+wY4dZdnZ3F8EVtQHlma3Vx4z6HjzzZ8/ePiwdeBAjy8XRuaCCPrY9rAt0Atbtgieq29fNmA8tejRDh2yDhlS+Xxm6djR+emnvo9fUe4xmFmsH0Metzvngw/Eo9Cp0aMzRo/WBg1ydOtmbd1aVzwlJIjMstxyi7VfPxle995r7d/fNnas7z1Y5+bO9f3nzBNPaHfeKaKqxOfr0WzvBFZUBpbjjTfkQ21iYrrTeeVhWS6PLxdG5oII+tj2sC3Qsvx8c8OGpnr1ys6dYwPGUyseueOqWbPK37pyvPtuLXqCzqzw3F/aTz/ZZ8+29O5te/xx+/z5jnfecSxbJmLU+ec/u7780rV7t/bdd9rf/66ZTEEc/l8L68fTmcyqxZPILEf37trgwSK8MqdMkXkkvnHxXYtvWXy/f/+7t6Ny2b7wEFhe7oDjx00Vr3zLH2Q9vnpY4+XCCFwQRo5tD+cC1e66Szjz1q9nA8YTZk/VHVfiL+J/I+H2uSKz6tWzdO9uf+stLS2tVjwiqpyffWb793+33nFH9d9Z8/Gnbl3z1VeLOrF17CgCxdmrl2iU9OHDRaacnjhRlErGhAmuAQOyFy4sy8sL9/rxeOb9Nm1c/fplvfxyXkpKwe7dRUePlp45U15WxvaFh8BSfAfYn35apsnAgb5+mLvy5cKam2LtLgiDx7aHc4Fmv/mmcJ558kk2YDzh9ASx4yqct8+lzKryKpW5TRvrPffYX3rJ9ac/iR8CQ+fxFlXyd9ZuucXyq19ZH3rI/thjtrFjbffdZ737bmv//pbbbxf/ZL7hBnOrVqbGjeUvX+tLMXGZrj59sl566cK2bTVjS+X60XHmfbYvPARWaAPL9e23pgYNRDa5du70c6tXeblQS04uPXUqchaEwWPbw7lAC9PSKh/p2IDxhMcT9I6r8N8+juXLLd27i6YRFVg9TW680frgg47XX3dt2uQuKDAoEXEjEsdjVFl79rQ9+6xzzRoRXnpvH7fbfeFC6ZkzJTZb0bFjhQcOFOzZc2Hr1ryUlNxPPslZujTz2WddAwc6unevdl3VYkvB0gn8zPtsX3gIrFAFlm3ECPmwO3aszpv+8suF1jZtClJTI2FBaN9/b/DY9rAuULfbWnEDFh8/zgaMJ9QeIzuuavP20TRt3z7n0qW2p56y9OplatSo2n4gR1LSmSefPL98eeGhQ+6SEv1RJYJGZI3xqAru9pGGr77KevllV9++NWNLBJ/zs8+CMRg+8z7bFx4CS/EdIH4WlJti48YB/VCrHT6sJSdXvlwozzhg4OVCJavBdt99Bo9tD/MCzZgwQYBzlixhA8YTOk+JphnccRU5t4/mcGi7djn+8AfbhAmWHj2qHR1lbtzY1b9/5vPP5/3xj8UnT1btCR9RJRLHSFQZv318xJb1jjt0xZbqM++zfeEhsJTdAWIzlq+sTZ8e8B1QVnZu7lzjLxcaXwqudeuMH9se5gWa++mnwpw+fDgbMJ4QeXJXrbp0zkYDO64i9vZxFxRc3LcvZ/HijPHj7YmJ1Q6BEt+4s3dvV79+Hl6S69tXBI3IGmUvySm6fSpjSwSftWdP/7EV4jPvs33hIbCM3gHODz+sPJJUM5mCuwMKUlOtFeeADvrlQqMLwW43d+5s/Nj2MC9Q0aOVv3bkLixkA8aj1lOiaekVr/sb33EVLbdP2blzBTt2nJs//9TIkbYqzeExqiJ//ciD7tes8Rhblq5dLUlJ5tatw3DmfbYvPARWsHeAzWauOArSsWiRkTugNCPDyMuFBteB49VX5UPMzTcbPLY9/AvU3rWrkOeuWsUGjEeh5/KOK0vLlrlezroS87ePSMxzb73l6tcv++23a+G0CEpvH6+xFa4z77N94SGwAr4D7LNny620WzcFJ44z8HKhkUWgff+9+eqr5YnR162LugXqSEqqPH2O+Jnbx1sTsgHjCWLHlfhLacWFcPvEkkee+HT+fMvtt9v/67/CfOZ97i88BJbuXdBHj5orfrFInmBG0R0Q3MuFRhZB5bHt4r/RuEDz168XjWX+5zvBuQYMyN+4seZBqWzAeILYccXtgwcPHgKrdgLL9vjjsoSSk9XeAUG8XBg0oPLYdvPVV2vffx+9C1TcYmdffdVyzTWVmWXv2vX8f/931QOz2IDxBLHjitsHDx48BFYtBJa2d698Lb9ePdfu3ervgCovF1r/z/+5+Le/hWRB/PPYdsfs2TGwQMvy83OWLLF17HjpwOS2bc8tWFD5NvJswIZeUklLs7/0kuVXv7I9/bTjo4+c69fL91M7cqT6G25G7e3jbccVTwB48OAhsGohsKxDh8pX1v71X0N3BxSkppobN5Z7mOrWPf3448Vms9oFcfnYds1uj5kF6i4pyVuzxvnLX176VfOmTTOnTdMOHmQDDsBz/LjrT38SUWW95x5zmzZe37EkIcF8zTWWxERr3762ESNsEyeefe21nPffz1u3ruAvf5Hvy3b6dHlpaW3ePm63yG55ZnCrVXjkmcF3776wZYs8M/jHHwvq2dmz7bfc4m3HFU8AePDgIbDCHVjOP/9ZpknTptrhwyG9Ay5+952tU6dLb+Bav763zAriqqse2x6TC7Rg5870igi+dBacUaO0XbvYgD17LBbXpk2O11+3Pvig+cYbq4dU8+bmpCRLnz624cNFSFn79ZPvH3fNNaYqb3jnI8KsrVs7unXTBg3KGD06/YEHXIMHn37ssbNz5vj4Y58xw/cf25gxln79rA88IN/bbswYqbr7bgkTTmG7/nrJ0/3eduLHGI87rngCwIMHD4EV3sByuy2/+IU81uell8JzB4ioEmnlI7OCuOqqx7bH8AIt+uGHjAkTLv9itnXw4KpBGbcbsLukpPDQofPLl5958kn5WwJXntHb1KiRpVcv21NPOZcu1fbt8/qbVk6n9ve/u3bvFj9vOJYts8+fL9ooc8oUEVLa4MGO7t1FWumKsND9qThNmvXaa2033ig8zt69tV//On348IyHHxaRJ6hnnnnG8Ytf5G/YwBMAHjx4CKzaD6zcVatk6LRrJ37uD+cd4COzAr3ease2x/wC1Q4elOdrrninRfm64a23Oj/4QHM44mgDdruLT57M++MfM59/3tW/f+VLz1ecerFHD9uECY4//EHbtSuIW8arp7S09MyZoqNHC3bvzktJEdcuEkcs3XNz5/r443cPlnXsWGv//rZHH7UvWOBYvFjknXP1aueGDa4vv3Tt2aMdOCDKL11sHYbf5IQnADx48BBYYQosd0GB7frr5YHhht83I7g7wGNmBXatNY5tj5cN5sQJ+6xZle+xLW+96693vPFGQOff9xwQp0/LgPjLX/LWrZP5ovAlsDFjfH+a72sRf05PmuS6805nz56X3u+lyq4de2JixvjxOYsXX9y3z/iPCjzg4sGDBw+BZWjO/f73chfIbbf5PkNdqO+AapklfqB37d+v80prHtseXxuMzeb4r/8S3/7lA4zszz/v+Vg6p1M7ckS+BLZ+veOjj+RLYK+9duaZZ+RLYIMGObp1q/2XwAL5Y2vX7tTIkefmzy/YsaPylyt5gMODBw8eAisiAqs0I8PStKl4rnJu2BAJd0AQmeXx2PZ43GA0zfnJJ5bevS/1R4MGll/8wvrgg/Jw6b59LYmJgR3E3b27NniwCC9RMCpfAhs71ven+b4W8efME09od94poqrE5zvX8gCHBw8ePARWbQbWmcmTxXPqqQceiKg7QGSWeD7WmVkej22P5w3GtXmzddgwz79uVnkagltusfbrJ8LLXvHCnzwNQUpKwe7d8jQEZ84E+q6RPKDgwYMHDx4C64oRT6imevVEwRT/+GMELggRVX4zy9ux7Wwwjvfft9x2m336dHm49J//LE+k+fe/13x/SR5Q8ODBgwcPgaU4sNLvvVfUSebUqZG8IHxllvdj29lg8ODBgwcPHgKrFgLrwvbt8tj25s1Ls7Iif0F4zCwfx7azweDBgwcPHjwEVtgDq6zMUXFm0eyFC6NoQVTLrMq/+D7NJhsMHjx48ODBQ2CFKbDO//d/y/O2d+rkLiyMugVxKbMqDuK2dOjABoMHDx48ePAQWLUfWGX5+da2bUWd5P3pT9G7IJybNplvvFH8lw0GDx48ePDgIbBqP7DOvvaafGWtb18WBB48ePDgwYOHwFIQWCUuV+VpOS/u28eCwIMHDx48ePAQWAoC6/Rjj4m6ynj4YRYEHjx48ODBg4fAUhBYhYcOyXN5N2xYbDazIPDgwYMHDx48BJaCwNKSk0116mTNmMGCwIMHDx48ePAQWAoC68LmzfK8BtdcU5adzYLAgwcPHjx48BBYRgPLXVLi6NZNBFbO4sUsCDx48ODBgwcPgaUgsHKWLpVnFk1MdBcXsyDw4MGDBw8ePFEcWHWqTC0GVtn589ZrrxWBlf/55ywIPHjw4MGDB0/UB1ZA+5lCFFhZL78szyx6550sCDx48ODBgwdPdAdWtfQJUWP5vdgSm83cqJGpbt3CAwdYEHjw4MGDBw8eAsv/bPE331ecmuH7X/96C8MwDMMwTARPBAWW3ymx208/+qj4bznDMAzDMEx0TsQFFsMwDMMwDIHFMAzDMAzDeAms8rD8FiHDMAzDMEzcBVaoz4PFMAzDMAwTX4EVquvw1G11rpyAvtZgC0aap+olBOrx+LVGPN6uV4/Hx+cYvH2Cvr88fq3C26fqTt9Abx9v3w7bVyi2r6BXmu+P67EFcZnetmvl35eR+yuI20T5/RjEbWjk+/J9v4Th+1Ly+By2x+2gDQE9NgZxmcrvr1oLrJq3VM2PB/G1Qb+a6e1Qs0A91b7W+KurNVeVwThTcvsE5PG9AQR9+3i8WXRejrevVfVquJLvK5bWs7ev1enx9rVhPnohoK1Apy2ILUv5E4DH5xiDt3NAlxmi+zHQwDJyf4UnsPTctoE+PgdxmeG/v4J+zA/oMmMnsEL0hBTc2opYT+WXBBdYfr820FYLRWDFjMfvo4DxrzVy+6gKrJjxhDqw9NsCXck1t+twPrEZecIOw+N20LehqvvL20qIscAK8/1l5LEx0PwKxf0VWYEV6O7HUAdWbXl8/NSuZ2e18ids5S8RGn/CDtrj7WtDEVgBrZ8wBJbO2ydsgVUrnigNrFrfcxDQS/CRGVgGHxsDul/Cdn8ZeXwO4jJjNbDCtkc8rIGlZ1ek/iczI3v59ISC/q816PF7Z+t5TlJ7+/j+2kAPCzPi0fO1ej6uyqNzUw90aze4foJezz4erGPs/iKwyg28iKnkiS1092P8BJbxx2f9lxnm+0vPHRTc9+Vjs42dwNK5HXo71M5H5SjZgxWQx8cODCM/8evcU+XxirwdnBhLt0+gHh9fa/z2iZD1HIG3j56v9Xb7+FjeStZz2ALL7/4AnZcZzmOVglvPgT6xheJ+1H8bGrm/9FxmLR6rZPz+CsXjZIgCy8g6DN39VWuBFfRCMfi1Ch9J1X6tx10I+l89Mf61UXT7GN8NoNATaes5Mm+fyFk/0bgHS+d2Hc67Q+GxZaG4H/XfhkbuL52/QRy2l9LKg/3NiVrf7mJ1+6qdwNK5eyPorzWC8fsSWxBfq+SG0nn7KP+JSs9vFenfZaXk9vH7W0g6X0JVeH/p/82pUO+xiLT1rPOn/IC263D+xGmkU5X/FmF49ogYeXw2cplh+wFe+W8Rhq3+g/utT4OPP8qf1+Jn+6qFwFJyfgsfX2uQpOfjAX2twmUX9EHTMXb7RKAnoOsK6Gtj6f4K7vYJ7pRRIXq88vvxIB7H9Fym8icAnQYjj8+hftwOyGDkcdXI/RLq+8vI9m7kMsNwfwX9uBrEZcZOYDEMwzAMw8TbEFgMwzAMwzAEFsMwDMMwDIHFMAzDMAxDYDEMwzAMwzAEFsMwDMMwDIHFMAzDMAxDYDEMwzAMwzAEFsMwDMMwDIHFMAzDMAxDYDEMw8TWY6K+d8/w8RbCAX0twzAEFsMw0VoMYXsvv1rvHuOXrD+wjNgILIYhsBiGie66io3ndQKLYRgCi2GYKOgSH29BX/OffFSIx8up/Lvvy9eD8f2NBH3Vl//J23caEMbjLebj4zQWwxBYDMPEZmBVSwo9f/d4sXq+1sfn+/1CH9+Iwav28a353Tvl40t0qggshiGwGIaJ+sbytpvHY4WE8+O+P9lvYIWUGjTYyCUzDENgMQwTlbFVs7p07qkKxeX4vhC/gaXqWyCwGIYhsBiGURNYvj8huDoJ9HL0p4b+Y5gILIZhCCyGYcJUVDWf+4M+UEnnAU9+r9fvhfgNLCNXbTCD9Nwgem4ohmEILIZhorWxAvrFPb+/E1eu+7cIfeRIEL9F6PHVwOCu2uOFGAysgH6LkMBiGAKLYZi4jjO+NR/BF9xVcCZ3hiGwGIYhsGLw2wlP4lBRDENgMQzDxEUihPNdgwgshiGwGIZhGIZhGAKLYRiGYRgmUuf/A6cumUthkoBAAAAAAElFTkSuQmCC" alt="Sequence length distribution" width="800" height="600"/></p></div><div class="module"><h2 id="M8"><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAEkklEQVR42s2XV2hUaxSF/4nRiaIoiKA+CDYMdsQnS8CAFREVsV4VUR9sWMECVuzYsETsGnvvivVaImhyU+Hq9VUfzKtKkptk5nz3rPkz42RyJskE5Xpgw8yZ8++1Zu+1yzGA+T8t8UPGJP1lTGquMenZxvwh02fd02+/jECOMSNdoEwX6KtrgQJjSv425rtMn3VPv+kZPfvTCLj/MM11WphnTNnnlJRA6fDhsGkTHDsG16/D2bOwfj3OtGmUDhjAZ78/oGd1RmcbTOBPY5JdRxmuo/IvyclBZ/lyeP8ePn6EoiLIyYE3b+D5c3j4EG7fhitXICMDZ8QIiv3+oM7Kh3wlRCDfmFbuwawiY0orOnWCmzfhwwcoLITsbMjKgmfP4MEDuHULLl+2kTh+PESAvXth7Voq+/RBPuRLPutFoOqfZ/1jzL8KK3l5UFAA797B69fw9Cncv29JXboEmZk2HYcOwZ49sG0bbNwIa9aAGzWnd2/kSz69IlGDgEIm1s6UKZCfD2/fwqtX8OQJ3LsHN27AxYtw5gwcPQoHDsDu3bB1K2zYAKtXw7JlsHAhzJ0LM2fipKaGI5FRK4EqwZVXtGtnc/viBTx+DHfvWsFduACnT8ORI7B/P+zaBVu2hETIqlUWeMECmDMHZsyASZNg3DgYNYrK1q2R71hhViMg5X4xJsjOnfDoEdy5A9euwfnzcOqUTUNurgXevBnWrYOVK2HJEli0yGpDaZk4EcaOhZFuNaanw6BB0KsXxT6fhFnoSUC1q/Jxhg61ir56Fc6dg5Mn4fBhq/jKSggE7GcBL14M8+bZUEsfwSCUl8OJEzBkCAwcCP37h8Dp1g2nZUuEEd0nov995iefLxASVKyiX76Eigoil4jouY4doUcPmyIRC18isW8fdO8OXbpA27bgguP388ltWMKqTsC2168lXbtWV/T27bBihRWdQKMvERI5kY0G16XvSllSkoWIsm+uCSvctkME1MfVShkzxipapSRFz54NzZtbR1J7LIlwSmLBVZrJyTXAZY4lEAjNjjABDRP1c6ZO/aHoCROgSZMfh+OR8AJv3NgTPGzCEmaEgCaahgrTp8PSpaAe0KhRzcMicfCgNwmBKx11gMuEJcyaBAQ8axa0aeN9WGFVbmPDHk6HNOHzJU4gkgKVYN++iYNHC1PirYNEjRREROi2TM/QxwPXd6/qkJDjkPAUYbgMv3kdUt7VjOKVmpcmRELd0sOfZxlGGpGi4BU2db2ysprgioxXdZSW2qEU6yclJU4jimrFwXi5C5OIBvcqUYGrjGNTOHgwTufO8VtxtWFUGwmlw6vJiIQmZCx4ixa2p7glXrUlFdY5jstrKyOP9hqx2Jx36ADz54fGdEV9xnH0QhKso5api2Ramu2q7qISdENfr4UkdiVrEIlWrex4Vim6Y9xxR3JCK1nsUlpeX2BX4dp8Qo1IE9XVQ2W/fokvpZ5ruSvMYLxQaycYPRp27Ij0BWfyZIqbNm34Wh7vxUQ1/L1ZM5z27aFnT0LTUwNs/HicYcMoce9pqfkpLya/zavZb/Ny+qvsPyB3ge/Rlc06AAAAAElFTkSuQmCC" alt="[FAIL]"/>Sequence Duplication Levels</h2><p><img class="indented" src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAyAAAAJYCAIAAAAVFBUnAABj1klEQVR42uzdB3hT5dvH8ZRVZCOyQZYiIKBYkCEIiKAMARUBEdkiIKIsFf+oKMOBAgoow4GCshWhDBmCKMgQkSEze9GWQlsoLZ2899P6ItI2TdLTNmm/99XLq5Y2Oedz7uc5v5wkT3TXKIqiKIqiKE1LBwFFURRFURQBi6IoiqIoioBFURRFURRFwKIoiqIoiqIIWBRFURRFUQQsiqIoiqIoAhZFURRFURRFwKIoiqIoiiJgURRFURRFEbAoiqIoiqIoAhZFURRFURQBi6IoiqIoioBFURRFURRFwKIoiqIoiqIIWBRFURRFUQQsiqIoiqIoAhZFURRFURRFwKIoiqIoiiJgURRFURRFEbAoivKlAZxSOOQYpqfaXh+dXDms9BJFEbAoSvsz6/XKrW3gdOjR3mmy+9dvxM1by/mA5d0taPtXGY0ON0dN2t9J96aYiCgCFkXl8XO5v1w84JyU8/7+cgVLw4CV0ei4MSS5uLubclW62ZFOpghYFJXvAla6j9GvnyduOtm48/j+xr9N++fuX0Jw/SceXW/I6AJeppuUEYILQE+hMhJz5xeuuXFt8qa/dY3petdc/77rmJLp3nl0WLO+te4MFncelrj+IQGLImBRVD4NWGlPWmm/z+ihvPt/6841AI8uG2R0+55+n+lp0gVCprfjTvJwU8zFL2T0O+77e+HmzsFy//fd/NdMf+5pZ2oYsDLKmjdd0KIoAhZF5cGA5foqQtYfu3t6RvTipnJse9xBcD9geXp5Iyshw7uAlRW3rP/co8s8bu67R0QZXTxzM7+6DnNpv6EoAhZF5dkrWBkFL0/P3J4+VaRVwHJxOvRoX9x5itCj23fxvYs/9NmAlZXjq2HAcnMzvO5kFyA3PfnraQq/lvGrsiiKgEVReTxgeXHxRpMrIln8k6wHCE9/6NHzldrmJ1+4gpV9V7xc32MWL01lMWBlsUl4MRZFwKKofH0Fy52zlxevHPL0cpSL+3In03j6QiV3XoPlqZWbL+LWMGDlzGuwvPDMjtdgZXoFK4tEnh5Z1x1IwKIIWBSVfwPWtcze4Jb21zz9W9fvQ/R0M7zYnmtZexehRxuZ6VOE2l7Buub2uwjd74GsvC8vo93U6l2ErtspK+8izPRvM03ebv4acxFFwKIoKt9lTXYNcIqiCFgURXG+v+bpGgSAUxRFwKIoivO9W3vky08/EbAoioBFURRFURRFEbAoiqIoiqIIWBRFURRFUQQsiqIoiqIoKuOA5eaHybvzc4qiKIqiKALWfzJTugEr3X9l+V2KoiiKoihvAlbWP4adoiiKoiiKgKVBwAqmKIqiqDxUuygqTeVCwPKpC1pOXyqfytfIIIMMMsi4Wa7PplQ+LAIWEx8yyCCDDDIELIqAxfBGBhlkkEGGgEXl7YB1zat3ERKwmPiQQQYZZAhYFAHrP4taubnelYt1sAhYTHzIIIMMMgQsioClcRGwmPiQQQYZZAhYFAGLgMXEhwwyyCCDDAGLImAx8SGDDDLIIEPAoghYDG8mPmSQQQYZAhZFwCJgMfEhgwwyyCCTywFL7+0pVZ8b52J9vvnoPAIWEx8yyCCDDDJaBizJEDfFCBepIvWXr3/lSsDKyfslYBGwmPiQQQYZZJDx+GyaNrW4jhTuRzFfu4JFwCJgMfEhgwwyyCDjHwHrpp9kdHEr3eteGWW1jC6SpfuHmd6diw3zaGszupLn+n692H0XW5vp/Xq0MQQsJj5kkEEGGWRyKGBlesHGRcBKG2gy/d7T23H9m5nebNqc4f73LsJQju2+O/fr/p3etAEELCY+ZJBBBhlksuU1WGm/8TRg5czPPXoxljtXjNz/Nfd/mPMsXmwMAYuJDxlkkEEGmewKWGmfhPIoW2T01F4uBiw3N8PTZ+5cP9Gm4e5n5XZc3whPETLxIYMMMsggk6MBy8344v4VrOy7tKPJxRtPt9bTK2Ra7b53F6U8urZHwGLiQwYZZJBBxrcCVtpLIxldkkn3+3T/VsPXYGV6Bcv9rXWx19m3++5f8XJ/YwhYTHzIIIMMMsjkUMByHT4yffYt3X91569u/El2vIsw3Zv1emtdP0Wo1e5fc/kuQhfRlncRMryRQQYZZJDxxddg+Ujl7aWnfHbvCFhMfMgggwwyyBCwCFgELIY3MsgggwwyBCwCFgGLgMXEhwwyyCBDwKLyVRGwmPiQQQYZZJAhYFEELIY3MsgggwwyBCyKgEXAYuJDBhlkkCFgUQQsAhYTHzLIIIMMMgQsioDF8EYGGWSQQYaARRGwGN5MfMgggwwyBCyKgEXAYuJDBhlkkEHGDwKWTqcn3xCwGN5MfMgggwwyeSpgpX42nTuJ578fqadP+4feJScCFgGL4c3EhwwyyCCTpwLW9XCT9pscS04ELAIWw5uJDxlkkEGGgJXO76S9ppXuVa6Mfuj6gpnrO0r36lq6t+zmlri+fY82hoBFwGLiQwYZZJAhYHl5zSltrso032Qa6dJNYC7uyKMNcOdvXfy++3fqRxmLgMXEhwwyyCCDTLa8BivtN+4HLPeTkxcBy9M7yu6fZ2WvCVgELCY+ZJBBBpl8EbDSPkGWaVDwOmC580SeiyfaMnqJvReBKSu34/pGeIqQgMXEhwwyyCBDwMowTGgesLy+5ONOFMv6FaksXsFy5wYJWAQsJj5kkEEGGQKWBwHL09dgZXoFK9PXQl3z/OVQ7tyOiyte7m8MAYuAxcSHDDLIIEPAchWY3Lww4+YzZTf+xIunCK95+C7CjO7xmnvvZ8z0WT/eRUjAYuJDBhlkkEHG3bOpvxcLaxGwmPiQQQYZZJAhYBGwCFgMbyY+ZJBBBhkCFgGLgEXAYuJDBhlkkEEm7dmUom4qAhYTHzLIIIMMMsggk3MyBCyaGBlkkEEGGWSQIWDRxMgggwwyyCCDDAGLQ0UTI4MMMsgggwwByycCVswvv1x48035L4eKJkYGGWSQQQYZPw5YuhvKnZ9na8CSdKXX6eS/HCqaGBlkkEEGGWT8NWDdmJ/SBixPY1PWA1bUwoUSsMKGDuVQ0cTIIIMMMsgg48cBy51Q5WZyynrAuhIcLAHL2bkzh4omRgYZZJBBBhkClqrgLNe2jz+WgHW8Zs1giqIoiqIo3ytvniLM9StYiaGhErBM5cqRhXmUgAwyyCCDDDL+egXr2g0vZveFpwivJScbihSRjJUcG8uhoomRQQYZZJBBxl8Dlk+9BkvKXKOGBKx4g4FDRRMjgwwyyCCDjN+/BssX3kUoZW/VSgJW7O7dHCqaGBlkkEEGGWTywlOE6f48hwNWyFNPScC6vHw5h4omRgYZZJBBBpm88BRhFkuTgHX+5ZclYEV89BGHiiZGBhlkkEEGGQKWNgEr4oMPJGCFjxvHoaKJkUEGGWSQQYaApU3AuvzttxKwQvr04VDRxMgggwwyyCBDwNImYMXs2iUBy966NYeKJkYGGWSQQQYZApY2ASv+7FkJWJZatThUNDEyyCCDDDLIELC0CVjJMTESsAyBgRwqmhgZZJBBBhlkCFjaBCwpY9mykrESz5/nUNHEyCCDDDLIIEPA0uaWrQ0bSsCKO3KEQ0UTI4MMMsgggwwBS5tbdnbqJAHryqZNHCqaGBlkkEEGGWQIWNrccujgwRKwohYv5lDRxMgggwwyyCBDwNLmli9MniwB6+KUKRwqmhgZZJBBBhlkCFja3HLUZ59JwAp77jkOFU2MDDLIIIMMMgQsbW45ev16CVjOLl04VDQxMsgggwwyyBCwtLnlq4cOScCy3nMPh4omRgYZZJBBBhkClja3nBgSIgHLVL48h4omRgYZZJBBBhkClka3nJRkKFRIHxCQHBdHE9PEyCCDDDLIIEPA0qbM1avrdboEk4kmpomRQQYZZJBBhoClTdlbtJCAFfvbbzQxTYwMMsgggwwyBCxt6tyTT0rAurxyJU1MEyODDDLIIIMMAUubOj9mjASsiFmzaGKaGBlkkEEGGWQIWNpUxPvvS8AKHz+eJqaJkUEGGWSQQYaApU1dXrZMAlbI00/TxDQxMsgggwwyyBCwtKmYn3+WgOV48EGamCZGBhlkkEEGGQKWNhV/+rQELEudOjQxTYwMMsgggwwyBCxtKik6WgKWoWhRmpgmRgYZZJBBBhkClmZlLF1aMlbShQs0MU2MDDLIIIMMMgQsbcraoIEErLijR2limhgZZJBBBhlkCFjalKNjRwlYVzZvpolpYmSQQQYZZJAhYGlToYMGScC69MUXNDFNjAwyyCCDDDIELG3qwuuvS8C6+M47NDFNjAwyyCCDDDIELG0qcv58CVhhzz9PE9PEyCCDDDLIIEPA0qai162TgOXs1o0mpomRQQYZZJBBhoClTV09eFAClq1JE5qYJkYGGWSQQQYZApY2leh0SsAyVahAE9PEyCCDDDLIIEPA0qiSkvQFC+oDApLj42limhgZZJBBBhlkCFjalLlaNb1Ol2Cx0MQ0MTLIIIMMMsgQsLQp2/33S8CK3buXJqaJkUEGGWSQQYaApU2de/xxCViXV6+miWliZJBBBhlkkCFgaVPnR4+WgBU5Zw5NTBMjgwwyyCCDDAFLm4p4910JWOETJ9LENDEyyCCDDDLIELC0qUvffCMBK6RfP5qYJkYGGWSQQQYZApY2FbNjhwQsR9u2NDFNjAwyyCCDDDIELG0q/tQpCViWO++kiWliZJBBBhlkkPGngKW7odz5eU4GrKRLlyRgGYoVo4lpYmSQQQYZZJDxm4CVNlSl/T4XA5aUsWRJyVhJERE0MU2MDDLIIIMMMv4dsFwErxwOWJZ69SRgxR0/ThPTxMgggwwyyCCTHwNWcDbUkXvukYC1c+rUYIqiKIqiqNyuLL0Gy3euYIUOGCAB69KXX/IogUcJyCCDDDLIIMNThNrUhUmTJGBdnDqVJqaJkUEGGWSQQYaApU1FzpsnASts5EiamCZGBhlkkEEGGf8OWNd85l2E0d9/LwHrXPfuNDFNjAwyyCCDDDL+EbCu+fY6WFJX9++XgGULCqKJaWJkkEEGGWSQ8ZuApWFlR8BKsNslYJkqVaKJaWJkkEEGGWSQIWBpVImJ+oIF9QUKJCck0MQ0MTLIIIMMMsgQsLQpc5Uqep0uwWqliWliZJBBBhlkkCFgaVO2Zs0kYMX+/jtNTBMjgwwyyCCDDAFLmzrXs6cErOi1a2limhgZZJBBBhlkCFja1PlRoyRgRX7yCU1MEyODDDLIIIMMAUubujh9ugSs8FdfpYlpYmSQQQYZZJAhYGlTl5YskYAV2r8/TUwTI4MMMsgggwwBS5uK2bZNApajfXuamCZGBhlkkEEGGQKWNhV34oQELEvdujQxTYwMMsgggwwyBCxtKikqSgKWsUQJmpgmRgYZZJBBBhkClmYl6UoyliQtmpgmRgYZZJBBBhkCljZlqVtXAlbciRM0MU2MDDLIIIMMMgQsbcrRvr0ErJht22himhgZZJBBBhlkCFjaVGj//hKwLi1ZQhPTxMgggwwyyCBDwNKmwl99VQLWxenTaWKaGBlkkEEGGWQIWNpU5CefSMA6P2oUTUwTI4MMMsgggwwBS5uKXrtWAta5Hj1oYpoYGWSQQQYZZAhY2lTsvn0SsGzNmtHENDEyyCCDDDLIELC0qQSrVQKWuUoVmpgmRgYZZJBBBhkCljaVnJCgL1BAX7DgtcREmpgmRgYZZJBBBhkCljZlqlRJr9Ml2O00MU2MDDLIIIMMMgQsbcoWFCQB6+r+/TQxTYwMMsgggwwyBCxt6lz37hKwor//niamiZFBBhlkkEGGgKVNhY0cKQErcu5cmpgmRgYZZJBBBhkCljZ1cdo0CVgXJk2iiWliZJBBBhlkkCFgaVOXvvxSAlbogAE0MU2MDDLIIIMMMgQsberKTz9JwHJ06EAT08TIIIMMMsggQ8DSpuKOH5eAZalXjyamiZFBBhlkkEGGgKVNJUVESMAylixJE9PEyCCDDDLIIEPA0qwMxYpJxkq6dIkmpomRQQYZZJBBhoClTVnuvFMCVvzJkzQxTYwMMsgggwwyBCxtytGunQSsmB07aGKaGBlkkEEGGWQIWNpUSL9+ErAuffMNTUwTI4MMMsgggwwBS5sKnzhRAlbEu+/SxDQxMsgggwwyyBCwtKnIOXMkYJ0fPZompomRQQYZZJBBhoClTV1evVoC1rnHH6eJaWJkkEEGGWSQIWBpU7F790rAst1/P01MEyODDDLIIIMMAUubSrBYJGCZq1aliWliZJBBBhlkkCFgaVPJ8fH6gAB9wYLXkpJoYoY3MsgggwwyyBCwtClThQp6nS7RjZ2niZFBBhlkkEEGGQKWW2Vr0kQC1tWDB2lihjcyyCCDDDLIELA0OgDduknAil63jiZmeCODDDLIIIOMjwYsXZpK9598J2CFPf+8BKzI+fNpYoY3MsgggwwyyPjHFaybApansSkHAtbFd96RgHXh9ddpYoY3MsgggwwyyPhBwEo3XXmUnHIgYF364gsJWKEDB9LEDG9kkEEGGWSQyRcBKzj7a2fKFawjTZoEUxRFURRF5Xh5FrBcJyrfuYIVd/SoBCxrgwY8SuDxEzLIIIMMMsj4+hUsfwlYSRcuSMAyli5NEzO8kUEGGWSQQcanA1baYOSzAUvKcMstkrGSoqNpYoY3MsgggwwyyPhTwLrmq+8ilLLUqSMBK/70aZqY4Y0MMsgggwwyPhqwMkpFvrkOlpTjwQclYMX8/DNNzPBGBhlkkEEGGd+9gqVV5UzACnn6aQlYl5YupYkZ3sgggwwyyCBDwNKmwidMkIAV8f77NDHDGxlkkEEGGWQIWNpUxKxZErDOjxlDEzO8kUEGGWSQQYaApU1dXrlSAta5J5+kiRneyCCDDDLIIEPA0qZif/tNApa9RQuamOGNDDLIIIMMMgQsbSrBZJKAZa5enSZmeCODDDLIIIMMAUubSo6L0wcEGAoVupaURBMzvJFBBhlkkEGGgKVNmcqX1+t0iefO0cQMb2SQQQYZZJAhYGlTtnvvlYB19dAhmpjhjQwyyCCDDDIELI0OQ5cuErCi16+niRneyCCDDDLIIEPA0qbCnntOAlbUZ5/RxAxvZJBBBhlkkCFgaVMXp0yRgHVh8mSamOGNDDLIIIMMMgQsbSpq8WIJWKGDB9PEDG9kkEEGGWSQIWBpU1c2bZKA5ezUiSZmeCODDDLIIIMMAUubijtyRAKW9e67aWKGNzLIIIMMMsgQsLSpxPBwCVjGsmVpYoY3MsgggwwyyBCwNCtDYKBkrOSYGJqY4Y0MMsgggwwyBCxtylKrlgSs+LNnaWKGNzLIIIMMMsgQsLQpe+vWErBidu2iiRneyCCDDDLIIEPA0qZC+vSRgHX5229pYoY3MsgggwwyyBCwtKnwceMkYEV88AFNzPBGBhlkkEEGGQKWNhXx0UcSsM6/9BJNzPBGBhlkkEEGGQKWNnV5xQoJWCFPPUUTM7yRQQYZZJBBhoClTcXu3i0By96qFU3M8EYGGWSQQQYZApY2FW8wSMAy16hBEzO8kUEGGWSQQYaApU0lx8ZKwDIUKXItOZkmZngjgwwyyCCDDAFLmzKVKycZKzE0lCZmeCODDDLIIIMMAUubsjZuLAHr6p9/0sQMb2SQQQYZZJAhYGl0MDp3loB1ZcMGmpjhjQwyyCCDDDIELG0qbNgwCVhRCxfSxAxvZJBBBhlkkCFgaVMX3nxTApb8lyZmeCODDDLIIIMMAUubilq4UAJW2NChNDHDGxlkkEEGGWQIWNrUleBgCVjORx+liRneyCCDDDLIIEPA0qauHj4sAcvaqBFNzPBGBhlkkEEGGQKWNpUYFiYBy3jrrTQxwxsZZJBBBhlkCFgaVXKyoUgRyVjJsbE0McMbGWSQQQYZZAhY2pS5Zk0JWPEGA03M8EYGGWSQQQYZApY2ZW/VSgJW7O7dNDHDGxlkkEEGGWQIWNpUyFNPScC6vHw5TczwRgYZZJBBBhkCljZ1/uWXJWBFfPghTczwRgYZZJBBBhkCljYVMXOmBKzwsWNpYoY3MsgggwwyyBCwtKnL330nASukd2+amOGNDDLIIIMMMgQsbSrml18kYNkfeIAmZngjgwwyyCCDjG8FLN3/V7o/dD825XzAitfrJWBZatWiiRneyCCDDDLIIONDAevGVJTu974csJJjYiRgGQIDaWKGNzLIIIMMMsj4SsDKKBKlvZrlmwFLyli2rGSsxPPnaWKGNzLIIIMMMsj4UMBK+1SgdwErODfq7xo1JGBtnzs3mKIoiqIoKpvL3YB141OBGT0t6MtXsJyPPCIB68rGjTxK4PETMsgggwwyyPjiU4T+GLBChwyRgBW1aBFNzPBGBhlkkEEGGQKWNnXhjTckYF146y2amOGNDDLIIIMMMj4RsG4KVX73LkKpqAULJGCFPfccTczwRgYZZJBBBhkfClj+uw6WVPT69RKwnF260MQMb2SQQQYZZJDxlYClYeVKwLp66JAELOs999DEDG9kkEEGGWSQIWBpU4khIRKwTLfdRhMzvJFBBhlkkEGGgKVRJScbCheWjJV89SpNzPBGBhlkkEEGGQKWNmW+/XYJWPFGI03M8EYGGWSQQQYZApY2ZW/ZUgJW7K+/0sQMb2SQQQYZZJAhYGlTIb16ScC6vHIlTczwRgYZZJBBBhkCljZ1fswYCVgRs2bRxAxvZJBBBhlkkCFgaVMR778vASt8/HiamOGNDDLIIIMMMgQsberysmUSsEL69qWJGd7IIIMMMsggQ8DSpmJ27pSAZW/ThiZmeCODDDLIIIMMAUubij9zRgKWpXZtmpjhjQwyyCCDDDIELG0q+coVCViGokVpYoY3MsgggwwyyBCwNCtjmTKSsZIuXKCJGd7IIIMMMsggQ8DSpqwNGkjAijt6lCZmeCODDDLIIIMMAUubcnTsKAHryubNNDHDGxlkkEEGGWQIWNpU6KBBErCiPv+cJmZ4I4MMMsgggwwBS5u68L//ScC6+PbbNDHDGxlkkEEGGWQIWNpU1KefSsAKGz6cJmZ4I4MMMsgggwwBS5uK/vFHCVjOrl1pYoY3MsgggwwyyBCwtKmrf/whAcvWpAlNzPBGBhlkkEEGGQKWNpXodErAMlWoQBMzvJFBBhlkkEGGgKVRJSUZChXSBwQkx8XRxAxvZJBBBhlkkCFgaVPmatX0Ol2C2UwTM7yRQQYZZJBBhoClTdmbN5eAFbtnD03M8EYGGWSQQQYZApY2de6JJyRgXV61iiZmeCODDDLIIIMMAUubOv/iixKwImfPpokZ3sgggwwyyCBDwNKmIt57TwJW+MSJNDHDGxlkkEEGGWQIWNrUpW++kYAV0q8fTczwRgYZZJBBBhkCljYVs2OHBCxH27Y0McMbGWSQQQYZZAhY2lT8qVMSsCx33EETM7yRQQYZZJBBhoClTSVdviwBy3DLLTQxwxsZZJBBBhlkCFialbFUKclYSRcv0sQMb2SQQQYZZJAhYGlT1vr1JWDFHTtGEzO8kUEGGWSQQYaApU05Hn5YAtaVn36iiRneyCCDDDLIIEPA0qZCBwyQgHXpyy9pYoY3MsgggwwyyBCwtKkLkyZJwLo4dSpNzPBGBhlkkEEGGQKWNhU5b54ErLARI2hihjcyyCCDDDLIELC0qegffpCAde6xx2hihjcyyCCDDDLIELC0qasHDkjAst13H03M8EYGGWSQQQYZApY2leBwSMAyVaxIEzO8kUEGGWSQQYaApVElJuoLFtQXKJCckEATM7yRQQYZZJBBhoClTZmrVNHrdAlWK03M8EYGGWSQQQYZApY2ZWvWTAJW7O+/08QMb2SQQQYZZJDJnYCl+2/dlJbS/bmPB6xzPXtKwIpes4YmZngjgwwyyCCDTK4FrEzTkn8FrPMvvCABK/Ljj2lihjcyyCCDDDLI+FbASns1y18C1sUZMyRghb/yCk3M8EYGGWSQQQYZ33qK0LuAFewD9eu4cRKwDrVrF0xRFEVRFKV1uRWw0r7oyt+vYMVs3y4By9G+PY8SePyEDDLIIIMMMrlzBcvN1135UcCKO3FCApalbl2amOGNDDLIIIMMMgQsbSopKkoClrF4cZqY4Y0MMsgggwwyufYarHSfIrzmt+8ilDKWKKGeJTx1iiZmeCODDDLIIINM7lzBymPrYElZ7rpLApZ91y6amOGNDDLIIIMMMrn/FGEWy0cCluOhh1TAWrGCJmZ4I4MMMsgggwwBS5sKffZZCVjW2bNpYoY3MsgggwwyyBCwtKnw115TbyR87TWamOGNDDLIIIMMMgQsbSryk09UwBo0iCZmeCODDDLIIIMMAUubil67VgKW6ZFHaGKGNzLIIIMMMsgQsLSp2H371FJY99xDEzO8kUEGGWSQQYaApU0l2GwSsAwVK9LEDG9kkEEGGWSQIWBpU8kJCfoCBeTLabPRxAxvZJBBBhlkkCFgaVOmypXVYu6HDtHEDG9kkEEGGWSQIWBpU7amTdVaoxs30sQMb2SQQQYZZJAhYGlT57p3l4Bl++ILmpjhjQwyyCCDDDIELG0qbORItZj79Ok0McMbGWSQQQYZZAhY2tTFadMkYJlHj6aJGd7IIIMMMsggQ8DSpi599ZUKWL160cQMb2SQQQYZZJAhYGlTMVu3qsXcW7emiRneyCCDDDLIIEPA0qbi/v5brTVapw5NzPBGBhlkkEEGGQKWNpUUGakCVokSNDHDGxlkkEEGGWQIWJqVoVgxtdbomTM0McMbGWSQQQYZZAhYGgWsWrVUwNq9myZmeCODDDLIIIMMAUubMrVqpRZzX7WKJmZ4I4MMMsgggwwBS6OA9cQTaq3Rjz+miRneyCCDDDLIIEPA0qbMo0ZJwLJMmkQTM7yRQQYZZJBBhoClTVmnTlUBa/BgmpjhjQwyyCCDDDIELG3KtnixWmu0c2eamOGNDDLIIIMMMgQsbcq+YYMELGOTJjQxwxsZZJBBBhlkCFjalOPgQbXWaKVKNDHDGxlkkEEGGWQIWBoFLItFHxCgL1jQabPRxAxvZJBBBhlkkCFgaXOoDOXLq7VGDx+miRneyCCDDDLIIEPA0uZQGRs1UmuNbtpEEzO8kUEGGWSQQYaApc2hMnXsKAHL9uWXNDHDGxlkkEEGGWQIWNocKvOAAWoprBkzaGKGNzLIIIMMMsgQsLQ5VJaJE1XAGjOGJmZ4I4MMMsgggwwBS5tDZZs1SwKWuXdvmpjhjQwyyCCDDDIELI0C1nffqbVG27ShiRneyCCDDDLIIEPA0uZQ2X/+WQWsO++kiRneyCCDDDLIIEPA0uhQnTypFnMvWZImZngjgwwyyCCDDAFLs0OlL1pUrTV69ixNzPBGBhlkkEEGGQKWNofKULOmCli//UYTM7yRQQYZZPKAzAcfWJs2Ncl/kSFg5eahMrVoodYaXb2a4c3EhwwyyCCTB2QkXel0+mbNTMgQsHI1YPXsKQHLOncuw5uJDxlkkEEmD8jUr2+UgNWggREZAlZuHirLyJEqYP3vfwxvJj5kkEEGGX+XsdudxYsbJGDJf+V7ZAhYuXaorG+/rdYaHTKE4c3EhwwyyCDj7zI7dtglXRUqJGc2/c8/25EhYOVewFq4UNrQ1KULw5uJDxlkkEHG32VmzrRKtKpWTV3E+vBDKzJ+ELB0KZX2J2l/7l8By75+vQpY993H8GbiQwYZZJDxd5mnnzZLtOrcWf1XvkfGXwOWp7HJBwOW48ABtdZolSoMbyY+ZJBBBhl/l7nrLvUK948+ssh/5XtkfD1gpQajG+NRRmHL7wKW02LRBwQYChVyZv3VgDQxMsgggwwyuSdz+rSjQAF9kSL6s2edhQvr5Xv5CTK+G7DSvVLlXcAK9sk6Xbq0XqfbsnRpMEVRFEX5bU2fvjPlwtVx+V7+K9/LT2DJ+cqFgOWLV7CcTuPdd0vAsm/ZwuMnHlkigwwyyPivzKuvqmcGhw1TL72S/8r38hNkfPQKVkahKi8FLNPDD6vF3JcsYXgz8SGDDDLI+K9Mx45qDffPPrPJ959+apPv5SfI+G7AuqnyXsAy9++v1hp9912GNxMfMsggg4z/ypQrp1Zn2L9fve5q3z61IJb8BBnffQ1Wplet/PpdhFKWCRMkYFleeonhzcSHDDLIIOOnMr//rhLVbbf9m6jke/mJ/Jye8b+AlQfWwZKyfvSRWgqrTx+GNxMfMsggg4yfysyfr54T7NTJdNMzhp9+aqNnfD1gZb18M2DZli1TAattW4Y3Ex8yyCCDjJ/KDBmiXtU+adK/r2p/7TX1mvehQ830DAErdw6VY8cOCVjGu+5ieDPxIYMMMsj4qUyTJmqJ0VWr/r1eJd/LT+Tn9AwBK5cC1t9/q0/FLFWK4c3EhwwyyCDjjzJm8z8ri5458+/KovK9/ER+bjbTMwSsXDpU+sBAyVhOg4HhzcSHDDLIION3Mhs2qFe4169/88WqevXUZa0NG2z0DAErdw6VsUYNCViOPXsY3kx8yCCDDDJ+J/P221YJUv363XypSn4iP5d/pWcIWLkUsJo3V2uNrlnD8GbiQwYZZJDxO5nu3U0pn/F8c5CSn8jP5V/pGQJW7hwqU48eKmDNn8/wZuJDBhlkkPE7mWrV1JJXO3fevOTVzz+rpw6rVzfQMwSs3DlUluefV2uNTp7M8GbiQwYZZJDxL5m//nJIiipZ0mBPs6So/KRECZW9jhxx0DMErNwIWG+9JQHLPGwYw5uJDxlkkEHGv2S++kotx9C6dfrLMcjP5V/ld+gZAlYuHCrbggUqYHXrxvBm4kMGGWSQ8S+Z0aPVK9lfesmS7r+OGaOWG33xRQs9Q8DKhUNlX7dOrTUaFMTwZuJDBhlkkPEvmVat1Cvcv/46/WtU8nP51wceMNEzBKzcCFj79knAMlStyvBm4kMGGWSQ8SMZm81ZvLh6ldWxY+m/ykp+Lv8qv2O30zMErJw/VGazCliFCzsdDoY3Ex8yyCCDjL/I7Nih8lONGq4+D0f+VX5HfpOeIWDlwqEy3HqrWmv06FGGNxMfMsggg4y/yHzwgVrp6vHHXT0D2LOneg5x5kwrPUPAyo2AVb++BCz71q0MbyY+ZJBBBhl/kenTR4WnadNchaepU1UI69vXRM8QsDKs/fuvTpwYLv/V/FCZHnpIrTX69dcMbyY+ZJBBBhl/kalbVz39t3GjqxdYyb/K78hv0jMErAxL0pV0ySuvhGt+qMz9+knAsr7/PsObiQ8ZZJBBxi9kTp1yBAToixTRW1wuwiD/Kr9ToID+9GkHPUPASr927IiRgNW4sVXzQ2UZP14t5j52LMObiQ8ZZJBBxi9kVqxQl6aCgjK/NBUUpJ5JXLnSTs8QsNKvuLjk4sXV5VCnM1HbQ2WdOVMClqlvX4Y3Ex8yyCCDjF/IvPKKWkT0uefMmf6m/E7K8z8WeoaAlWF16+ZMWfX/kraHyrZ0qQpY7doxvJn4kEEGGWT8Qubhh9V1qQULMv8YHPkd+U35fXqGgJVhzZsXKV3Sp0+ItofKsX27Wsy9fn2GNxMfMsggg4xfyNx6q1pi9MCBzF9ZtX+/Wi5Lfp+eIWBlWHp9fEqXGJOSNA1Yx45JwNKXKcPwZuJDBhlkkPF9mb171QuwKlRwNzOVL6/SmPwVPUPAyrDq1FHPOu/bF6vloXI49IULS8ZyGo0MbyY+ZJBBBhkfl5k3Tz3r98gj7j7rJ78pvy9/Rc8QsDKsF144L13y9tsXtT1UhurV1Vqje/cyvJn4kEEGGWR8XGbwYPW69ddfd3d99kmT1LWJIUPM9AwBK8Navz5auqRlS7u2h8rYrJlaa/T77xneTHzIIIMMMj4uc8896j31a9a4e0Vq9Wp1xevee430DAErw4qOTipSxFCwoP7ixSQND5W5e3cVsD79lOHNxIcMMsgg48syJpOzcGF1Hjx71t21Q+U3CxTQy1+ZTPQMASvjeugh9YaIVasua3ioLMOHq7VG33iD4c3EhwwyyCDjyzLr16tXuNev79m7AuvXVxe9Nmyw0zMErAzr/fcjUp5LDtUyYL35pgpYw4czvJn4kEEGGWR8Weatt9QLqvr3N3u0p888o162NWWKhZ4hYGVYR47ESZdUrWrW8FDZPv1UApa5e3eGNxMfMsggg4wvy3TvrqLSrFk2j/ZUfl/+Sv6WniFguarKldU7To8di9MsYH3/vVprtFkzhjcTHzLIIIOML8tUraoWtdq1y7PPFpTfT7k2YaBnCFiuatCgUGmUmTMjtDpU9r17JWAZqldneDPxIYMMMsj4rMzhw+pVyKVKGRwOz/bUbneWLKmS2V9/OegZAlaGtWLF5ZRPVnJodqhMJrWYe+HCTk97lokPGWSQQQaZnJL58kv1TF+bNt4siy1/JX8rt0DPELAyrAsXkgoU0AcGGq5cSdbqUOnLlJGM5Th2jOHNxIcMMsgg45syL7ygXoD18ssWL3ZW/kr+Vm6BniFguarmzdXTycHBV7Q6VMb69dVi7tu2MbyZ+JBBBhlkfFOmZUv1EuRvvrF5sbNff62ufrVqZaJnCFiu6q23LkijvPjiea0Olal9e7XW6NKlDG8mPmSQQQYZH5Sx2ZzFiqnXUR0/7s2rWeSv5G/lFmw2eoaAlXHt3RsrjXLnnRbNAlbfvhKwrDNnMryZ+JBBBhlkfFBm+3aVkGrWNHq9v/K3cgtyO/QMASvDSky8VrasahSDIV6TQ2UZO1atNTp+PMObiQ8ZZJBBxgdl3n/fKme9J54web2/jz+unmH84AMrPUPAclVPPRUijfLpp1GaHCrr+++rtUb79WN4M/EhgwwyyPigTJ8+6hXu06dbvd7fadNUROvTx0TPELBc1RdfXEpZl/acJofK9vXXErBMDz3E8GbiQwYZZJDxQZk771TP22zaZPd6f+VvU15dY6RnCFiuym5PkEYpUcIYH5+c9UNl37pVrTVavz7Dm4kPGWSQQcbXZE6dcgYE6AMD9RaL9+s1yt/KLcjtnDrloGcIWK6qYUN1tXPnzpisHyrH0aMqYJUty/Bm4kMGGWSQ8TWZ5cvVIgtNmxqzuMtBQeoy2IoVdnqGgOWqJkwIl0Z59dVwDQ6Vw2EoXFgyltNsZngz8SGDDDLI+JTMhAlqmdDnn7dkcZeHD1e3M3GihZ4hYLmq7dtjpFHuvdemyaEyVK2q1hrdt4/hzcSHDDLIIONTMh06qDcALlhgzeIuyy3I7cit0TO5GbB0N5Q7P8/5gHX1anKxYoaAAP25c4lZP1TGoCAVsNatY3gz8SGDDDLI+JRM2bJqidGDB7P6gbkHDqjFtOTW6JlcC1hpQ1Xa73M9YEl17eqUXvn660tZP1Tmbt3UYu4LFjC8mfiQQQYZZHxHZs8elYoqVjRostcVKqistnevg57xiacIMwpVbian7AtYn3wSKY3y9NMhGgSsYcPUWqNvvcXwZuJDBhlkkPEdmblz1fN6jz5q0mSv5Xbk1uQ26Zm8ELCCs60WLdoqjVKq1OkNGzZm8ab2Dh4sAetAz57BFEVRFOUz1a3bH3KmGzTod01uTW5Hbk1uE1jNy4OAlfa1Vr52BUuqdm31nogDB65mMQvb5s9Xa412787jJx5ZIoMMMsj4jkzjxmpthbVrbZrs9Zo1asWHe+4x0jM8RZhJjRwZJr3yzjsXsxqw1q6VgGVs3pzhzcSHDDLIIOMjMkajs3BhQ8GCer3eocley+3Ircltmkz0DAHLZf34Y7QErFat7Fk8VI49e1TAqlGD4c3EhwwyyCDjIzI//qg+36ZBA4OGOy63Jrcpt0zP5ELA8pd3EUpdvpyUmu4jIpKydKgMBglY+sBAhjcTHzLIIIOMj8i8+aZ6Gcyzz2q5CHb//upzo996y0LP5M4VLN9fB+t6tWun3sK6evXlLB4qfalSkrEcf//N8GbiQwYZZJDxBZlu3VQYmj3bquGOz56tXob12GNmeib3nyLMYmV3wHrvvQjplWHDwrJ4qIx33aUC1o4dDG8mPmSQQQYZX5CpUkU9nffLL3YNd1xuTW5TbpmeIWBlUocPX5VeqVbNnMVDZWrbVq01umwZw5uJDxlkkEEm12UOH3akLEWkdzi03HG5tVKlVG6T26dnCFiuKjn5WqVKauW048fjshSw+vSRgGX98EOGNxMfMsggg0yuy3z+uXour21bk+b7/uCDaumHL76w0TMErExq4MBQ6ZWPPorIyqGyvPyyWsx9wgSGNxMfMsggg0yuy4wapV6ANXasRfN9l9uUW5bbp2cIWJnUd99dll7p2NGRlUNlffddCVjm/v0Z3kx8yCCDDDK5LtOihXpyZulSm+b7Lrcptyy3T88QsDKp8PDEAgX0gYGGmJhkrw+VbckStZj7ww8zvJn4kEEGGWRyV8Zqddxyi1o+6O+/HZrvu9ym3HKxYgabjZ4hYGVWzZqpPL5p0xWvD5V9yxa11ujddzO8mfiQQQYZZHJXZts29V6/mjUN2bT7csty+3Iv9AwBK5N6440L0itjxpz3+lA5/vpLApahXDmGNxMfMsggg0zuyrz3nlVOak8+ac6m3ZdbltuXe6FnCFiZ1J49sdIrd91l8f5Q2e2GQoX0AQFOi4XhzcSHDDLIIJOLMr17qwA0fXp2nY+mT1cBrk8fMz1DwMqkEhOvlSmj3ndqMiV4fagMVaqotUb372d4M/EhgwwyyOSiTJ066im8LVvs2bT7mzerpyDvuMNAzxCwMq9evUKkXT77LMrrQ2UKCpKAZV+/nuHNxIcMMsggk1syJ086AwL0gYF6i8WRTbsvtyy3L/dy6hQ9Q8DKrD7/PEoCVs+e57wPWF26qLVGFy5keDPxIYMMMsjklsx336m3bTVrZsxWgaZN1dM+y5fb6BkCViZlsyVIr5QsaYyPT/buUJmHDFEB6+23Gd5MfMgggwwyuSUzfrxaCHTEiOx9QfDzz6t7mTDBQs8QsDKvu++2pnwuZox3h8r6v/+pxdxHjmR4M/EhgwwyyOSWzEMPqSVGFy60ZquA3L7ci9wXPUPAyrzGjQuXdpk06YKXAWvuXLXWaM+eDG8mPmSQQQaZ3JIpU0YtMfrHH45sFZDbl3uR+6JnCFiZ19atMdIuTZrYvDtUttWrVcBq0YLhzcSHDDLIIJMrMr/9pnJPxYqGHECQe5H72rPHQc8QsDKpq1eTixUzBAToQ0ISvThUjt9+U4u516zJxMfEhwwyyCCTKzIff6yeuevSxZQDCJ07q+ciP/nESs8QsDKvzp2d0i7ffHPJm4Cl16vLskWLMvEx8SGDDDLI5IrMoEHqteeTJ1tzAEHuRe5L7pGeIWBlXh9/HCnt0q9fiHeHylCypGQstQgJEx8THzLIIINMjss0aqRWT/j+e1sOIKxdq9aDaNzYSM8QsDKv06fjpV3KlzclJ3tzqIx33qnWGv35ZyY+Jj5kkEEGmRyWMRqdhQoZChbUG3LiJVhOvd4h9yX3aDTSMwQsN6pmTfURTgcPXvUmYLVpIwHL9t13THxMfMgggwwyOSyzbp36BJu77zbmmIPcl9yj3C89Q8DKvEaMCJN2mTbtoheHyty7twpYs2Yx8THxIYMMMsjksMwbb6gXYA0YYM4xB7kvuUe5X3qGgJV5/fBDtLRL69Z2Lw6VZcwYtdboxIlMfEx8yCCDDDI5LNO1q3pb35w51hxzmD1bvc69WzczPUPAyrwuXUoqXNhQqJAhMjLJ44A1Y4YELPOzzzLxMfEhgwwyyOSwTOXKamGq3bsdOeYg9yX3KPdLzxCw3Kq2bVXHrF0b7emhsn31lVprtGNHJj4mPmSQQQaZnJT580915ipVSu/IuXzllPuSe5T7lXunZwhYmdeMGRelXZ57LszTQ2XftEmtNdqoERMfEx8yyCCDTE7KLF6sFk1o186UwxRt26rnJT//3EbPELAyrz//vCrtcvvtZk8PlePwYQlYhvLlmfiY+JBBBhlkclJm5Ej1Cvfx4y05TDFunLrfUaMs9AwBK/NKTr5WsaKK5CdOxHl2qGw2fcGC+oAAh8XCxMfEhwwyyCCTYzLNm6sVE5Yts+Uwhdyj3K/cOz1DwHKrnn02VDpm1qwITw+VoVIlvU7nOHiQiY+JDxlkkEEmZ2SsVsctt+hTrgvkNIXco9yv3LtsAz1DwMq8vv32snTMI484PT1UxiZN1GLuGzYw8THxIYMMMsjkjMxPP6klRmvXNuSKRq1a6t2LW7fa6RkCVuYVFpYYEKAvWtQQE5Ps0aEyde4sAcu6aBETHxMfMsggg0zOyLz7rlqPqlcvc65oyP3Kvcs20DMELLeqaVP1vPLmzVc8OlTmwYNVwJo6lYmPiQ8ZZJBBJmdknnpKRZwZMyy5oiH3K/cu20DPELDcqsmTL0jHvPzyeY8OlWXSJLXW6KhRTHxMfMgggwwyOSNTu7Z6ku6nn+y5orFli3qCsk4dAz1DwHKrfv01VjqmXj2LR4fK+vHHaq3RJ55g4mPiQwYZZJDJgTpxwpnympZ/Xmae8yX3K/cu23DyJD1DwHKjEhKSS5dW73o1mxPcP1T2VatUwGrViomPiQ8ZZJBBJgfq22/VC1ruv9+YiyBy77INsiX0DAHLrXriiXPSMQsXRrl/qBy7d6u1RmvVYuJj4kMGGWSQyYEaP169BGrkSEsugowY8c8yp/QMAcutWrQoSjrm8cfPeRCwzpzRpywJwsTHxIcMMsggkwPVrp1aGXvxYlsugixapN7G2L69iZ4hYLlVFktCymdnGhMSkt0/VIYSJSRjOU+dYuJj4kMGGWSQydZKTr5WurR6XH/okCMXQeTeZRtkS5KT6RkClntVv75K5bt3x3oQsO64Q601umsXEx+nBGSQQQaZbK1Tp+LlJFWpkiHXTWQbZEtOn46nZwhYbtXYseHSMa+/fsH9Q2Vq3VoFrBUrmPg4JSCDDDLIZGstWXJJTlJdu5py3aRLF/VM5ddfX6JnCFhu1U8/XZGOCQqyuX+ozL16qbVGZ89m4uOUgAwyyCCTrTVyZJicpCZPtuS6iWxDymvtw+gZApZbFRubfMsthoAAfVhYorsBa/RoCViWV19l4uOUgAwyyCCTrdWkiVqj4Ycf7LluItsgWyLbQ88QsNytRx9VHxW+bNllNxGt06erxdwHDmTi45SADDLIIJN9deVKcqFCBvky5P5LsJyyDakbI1tFz2RXwNLdUO783McD1uzZkRKw+vcPdRPR9sUXaq3RTp2Y+DglIIMMMshkX/3yS4ycnho1MvoIS8OGxutvC6NntA9YN0aim7LU9e/9K2CdPKneo1Ghgsnh3ntg7Rs3SsAyNm7MxMcpARlkkEEm++qDDyLk9DRwoNlHWGRLZHtkq+iZnHiKMKNQ5WZy8oWAJVWjhtn9z9F0/PmnWsy9YkUmPk4JyCCDDDLZV6kfN/Lxx1YfYZkzRy1s9OST5+gZPwhYwb5Rjz76hzTNgAG/u/PLG9evPxsQIF/BP/4YTFEURVHZU7feeirl89y2+sj2LFiwVbanXLlTHBpPy+OAle7zg/54Bev776OlaZo3d/d5bkPFinqdznHoEI8secyNDDLIIJMdZbOpzxopW9bocPgKi2yJbI9slWwbPZONV7BcJyr/ClhRUUmpb444fdqtRjbec48ELFtwMBMfpwRkkEEGmeyo1asvS5R59FGfgnGmvu9eto2eya6AlTYY+XXAkmrTRq3w8cUXbn2apumRR1TA+vxzJj5OCcgggwwy2VHjx6sPGpky5aJPybz11gXZqgkTwumZbAlYGaUiP30XYWpNn35RmubZZ916s4Zl0CC1mPu0aUx8nBKQQQYZZLKjWrdWD/s3b77iUzKyPbJVsm30jPYBS5em0v0nvwtYf/xxVZqmWjW3VnOzvPaaWmv0hReY+DglIIMMMshoXgkJ/3zKyMWLST4lI9sjWyXbJltIz2TLU4Rale8ErOTka7fdZkhZQi3zl2FZ58xRAatXLyY+TgnIIIMMMtn0mP+uuyw+KFO3rvpQwkOHrtIzBCx368kn1WpY77yT+Yoj9hUr1GLurVsz8XFKQAYZZJDRvObNi0xZYjTUB2UGDAiVbZs/P5KeIWC5W3PnqiXU2rc3ZR6wdu1Sa43WqcPExykBGWSQQUbzevZZFWI+/TTKB2Vkq1JeshxKzxCw3K2jRx0BAfqiRfWmzCKW49QpFbCKF2fi45SADDLIIKN53Xmnehruzz+v+qDMoUPq6cu6dS30DAHLg0PVqJFaQm358swXazAUK6bWGj19momPUwIyyCCDjIZ14UKSnImKFfvnheS+JiNbJdsmWyjbSc8QsNw9VGPGqAcNw4dbMg9YtWtLwLL/8gsTH6cEZJBBBhkNa9MmtRRCmzZ2n5VJXTlStpOeIWC5e6h++MGecuUz88/MMT3wgApYK1cy8XFKQAYZZJDRsN58Uy3mOXFiuM/KyLbJFsp20jMELHcPldXqKFlSXfn8449MFmswP/mkWmv044+Z+DglIIMMMshoWJ06qY+jWbs22mdl1qxRH+D7yCNOeoaA5cGh6tzZJH0zc2YmizWYR42SgGWZNImJj1MCMsggg4xWlZx8rUwZ9Wpguz3BZ2Vk22QLZTuTk+kZApbbh+qDD9RiDV27ZvJOQuvUqSpgDR7MxMcpARlkkEFGqzp5Mj7lY0XMPi4jWyjbKVtLzxCw3D1UBw44pGlKlTJYra6eJbQtXqzWGs22Dzpn4kMGGWSQyYcyX311Sc5BvXqF+LjMk0+ek+1csuQSPUPA8uBQ3XGHehnWjz/aXQWsDRskYBnvvZeJj1MCMsggg4xW9fzzYXIC+vDDCB+XmTkzQrZzxIgweoaA5cGhGjZMXfl8+WVXizU4/vhDrTVasSITH6cEZJBBBhmt6t57bXIC+vXXWB+XkS2U7ZStpWcIWB4cqm+/Vf19zz2uFmtwWK36AgX0BQs6bTYmPk4JyCCDDDJZr+jopIIF9YUKGWJikn1cRrZQtlO29sqVZHqGgOXuoTIanYGBKj4dP+7qZViGChXUYu6HDzPxcUpABhlkkMl67doVIw/vg4JsfiFz333qYsQvv8TQMwQsDw5V27amlE8Ld3V1ytiokVprdNMmJj5OCcgggwwyWa/331cvbBo16rxfyMh2ytbKNtMzBCwPDtWUKZaU93GYXWiaOnaUgGX78ksmPk4JyCCDDDJZr8cfV2/N++abS34hI9spWyvbTM8QsDw4VLt2qc/MKV/e4Mj4SULzgAFqKazp05n4OCUggwwyyGS9KldWT56cORPvFzKnT6slu6pUMdMzBCzPDlWVKmqxhq1bM1yswfLKKypgvfgiEx+nBGSQQQaZLJbFopZHv/VWox/JyNbKNlutCfQMAcuDQ/XMM2qxhtdfz/Azc2yzZ0vAMj/1FBMfpwRkkEEGmSzWqlWX5aTTubPTj2Rka2WbZcvpGQKWB4dq8WL1/oiWLTP8zBzb8uVqrdHWrZn4OCUggwwyyGSxxo0Ll5PO229f9COZKVMuyjaPHx9OzxCwPDhUp045ChUyFC5sOHMm/ddh2XfuVAHrzjuZ+DglIIMMMshksVq1Uq/9/emnK34ks2XLFdnmBx6w0zMELM8O1f33q2eXv/oqg8UaTp5Ui7mXLMnExykBGWSQQSYrFR+fXLSoISBAHxGR5EcyFy8myTbLlsv20zMELA8O1SuvqMUaBgzIcLEG/S23qLVGz55l4uOUgAwyyCDjdR08eFVON/XqWfxORrZZtly2n54hYHlwqDZvVhdsb789w8/MMdSsqQLWr78y8XFKQAYZZJDxuubOjZTTzaBBoX4nM3BgqGz5vHmR9AwBy4ND5XA4b71VLdbw22/pvwzL1LKlWmt01SomPk4JyCCDDDJeV//+KqZ89lmU38nINsuWy/bTMwQszw7V44+rZd+mTk1/sQbT449LwLJ+8gkTH6cEZJBBBhmv64471BNthw9f9TsZ2WbZctl+eoaA5dmh+uQTq7ROhw7pL9ZgGTVKBazXX2fi45SADDLIIONdhYcnyommeHFjYqL/ycg2FyumnuqRvaBnCFgeHKojRxwBAeq17Ob0XulufecdtdbokCFMfJwSkEEGGWS8q+BgtdhB27YOP5V58EGHbP/GjVfoGQKWZ4eqYUO1WMOKFel8Zo514UIJWKYuXZj4OCUggwwyyHhXb7xxQc4yr7wS7qcysuWy/bIX9AwBy7ND9eKL6qnxESMsaf/Jvn69Clj33cfExykBGWSQQca76thRXQH6/vtoP5VZuzZatr9TJyc9Q8Dy7FCtXas+M+euu9JZrMFx4IBaa7RyZSY+TgnIIIMMMl5UcvK10qXV8yROZ6Kfyjgc6mOqZS+Sk+kZApYnh8picZQooV7Bd+jQzYs1OCwWfUCAoVAhp93OxMcpARlkkEHG0zpxIk7OL9Wrm/1aRrZf9kL2hZ4hYHl2qB55RC3W8NFH6SzWYLjtNrXW6OHDTHycEpBBBhlkPK0vv7wk55enngrxaxnZftkL2Rd6hoDl2aF67z21WEO3bum8k9DYsKEELPvmzUx8nBKQQQYZZDyt4cPDUh7AR/i1zIcfRshePP98GD1DwPLsUO3fr16BWKqU3pbmc59NHTuqxdyXLGHi45SADDLIIONp3XOPNeXzQmL9Wka2X/ZC9oWeIWB5fKhq11Yvw1q//ubXWpn791drjb77LhMfpwRkkEEGGY8qOjqpYEF94cKG2Nhkv5aJiUmWvZB9kT2iZwhYnh2qoUPVK/jGjr15sQbLhAkSsCwvvcTExykBGWSQQcaj2rkzRs4sTZva8oBMUJB6x/2uXTH0DAHLs0O1dKlqnSZNbl6swfrRR2ox9z59mPg4JSCDDDLIeFTvvqteujR69Pk8IPPCC+dlX957L4KeIWB5dqgMBmeRIvoCBfR///2fxRps334rAcv44INMfJwSkEEGGWQ8qp49z0koWbr0Uh6Qkb2QfZE9omcIWB4fqgcfVGvBffbZf17obt+xQwWsunWZ+DglIIMMMsh4VJUqqTWAzp6NzwMyZ87Ey75UrmyiZwhYHh+qN99Un5nTu/d/F2s4cUIt5l6qFBMfpwRkkEEGGffLbFYLoJcrZ8ozMrIvskcWSwI9Q8Dy7FDt3GmX1qlQwXDTz/WBgWqtUb2eiY9TAjLIIIOMm7Vy5WU5p3Tp4swzMrIvskeyX/SMNwFL9/+Vblpy8a95IGBJVa6sFmvYvv0/L8My1qihAtaePUx8nBKQQQYZZNyssWPD5YTyzjsX84yM7EvK2+3D6Rnvr2BlFLA8jU1+F7Ceflot1vC///3nM3OMzZurtUbXrGHi45SADDLIIONmtWypnhXZujUmz8j89NMV2aNWrez0jJYB66afuJmc/C5gLVqkltx94AHTjT809eihAta8eUx8nBKQQQYZZNypuLjkwEBDQIA+MjIpz8hERCTJHhUtaoiPT6ZncjlgBftbrVy5uUCBs4UK6des2XT9hwcef1wC1u+DBwdTFEVRlBs1e/YOebhevfqJPLZfskeyX7J3HOIbiytYblXTpmqxhiVL/l2swTJlilprdOhQHlnymBsZZJBBxp365JNIOZUMHhyax2QGDQqV/Zo7N5Ke4SlCjw/VxIlqsYZBg/79zBzrggUSsExduzLxcUpABhlkkHGn+vULkVPJwoVReUxmwYIo2a9nngmhZwhYHh+qjRvVyxJr1Pj3M3PsP/6o1hoNCmLi45SADDLIIONO1amjHqv/9VdcHpORPZL9kr2jZzQLWNfyx7sIVZyyO8uWVYs17Nnzz2IN9n371FqjVasy8XFKQAYZZJDJtMLCEuUkUry4MTExr8nIHsl+yd6dP59Iz3gWsHT/rZvSUp5fByu1evZUi9VOn/7/izWYzSpgFS7sdDiY+DglIIMMMsi4rg0b1HIG7do58qRM27YO2bvg4Cv0jDdXsLQqPw1Yc+aoxRoefvjfxRoMt96q1ho9coSJj1MCMsggg4zrmjz5gpxEXn01PE/KyH7J3sk+0jMELI8P1V9/OQIC9MWKGcz//7GEhgYNJGDZf/qJiY9TAjLIIIOM63r4YXWN54cfovOkjOxXyjUIBz1DwPLmUDVooF6GtWqVPfV/TR06qLVGv/6aiY9TAjLIIIOMi0pKulaqlHqV0rlziXlSxulUrzArXdqYnEzPELA8P1QvvKA+M2fkyH8WazA/84wELOt77zHxcUpABhlkkHFRx4/HpbwV3ZyHZW6/XZ0i//47jp4hYHl8qNassUn31K//z2INlvHjJWBZxo5l4uOUgAwyyCDjor744pKcPnr3DsnDMrJ3so+yp/QMAcvjQ2WxOIoXV88S/vmneuegdeZMtdZo375MfJwSkEEGGWRc1HPPhcm5Y9asiDws89FHEbKPw4eH0TMELG8OVadOppRBoj4zx7Z0qQpY7dox8XFKQAYZZJBxUY0aqfeh790bm4dl9uyJlX1s3NhKzxCwvDlUM2aodXi7d1fvJHRs364Wc69Xj4mPUwIyyCCDTEZ1+XJSgQL6woUNsbHJeVhG9k72sWBBvewvPUPA8vhQ/f67PeWNEnqbzek4flyf8j9MfJwSkEEGGWQyqp9/jpFzRbNmtjwvI/soeyr7S88QsLw5VLVqqZdhbdigniXUFykiGctpNDLxcUpABhlkkEm3Zsy4KGeNF188n+dlRo8+L3v67rsR9AwBy5tDNXiweifq+PFqsQbj7berxdz37mXi45SADDLIIJNu9ehxTs4ay5ZdzvMyso+yp7K/9AwBy5tD9c036hLoffepz8wx3n+/Wmv0+++Z+DglIIMMMsikWxUrqndH6fXxeV5G9lH2VPaXniFgeXOo9HpHkSL6AgX0J044zd27q4D16adMfJwSkEEGGWTSlsmUIJnjtttM+URG9lT212xOoGcIWN5U69bqEw8WLLBZhg9Xa42+8QYTH6cEZJBBBpm0tXy5etasWzdnPpHp2tUp+7tixWV6hoDlTb3xhlqsoU8fk+XNNyVgmZ97jomPUwIyyCCDTNp6+WX1uu+pUy/mExnZU9lf2Wt6hoDlTe3YYU95mtlg++wzFbAee4yJj1MCMsggg0zaatFCnS+2bYvJJzJbt6o1KVq2tNMzBCwvq1IltVjDttmb1VqjTZsy8XFKQAYZZJC5qeLikgMDDQUK6KOikvKJTGRkUkCAXvZa9p2eIWB5U337qtfx/W/0EQlYhmrVmPg4JSCDTPbJLFpka9DAOG2a9eef7RYLMn7TM/v3X5UzRYMG1nwlI/srey37Ts8QsLypBQtUA7VuZVCLuRcu7HQ4OCVwskQGGc1ljh51DBliLlBAzTSpX4UKGerWNT72mHnCBMvnn9t+/dVhs9EzPtozH38cKYdsyJDQfCUj+yt7LftOzxCwvKmTJ50FC0qy0h8rXUmtNXrsGKcETpbIIKOhzJkzjnHjLMWLq1cjSMCqX9/Ytq2pVi3DjWEr9atIEX2DBoYnnjBNmmT5+mvbvn12F4/46JmclHn66RA5QIsWReUrmYULo2Sv+/ULoWcIWF5WUJBarOHz6gNlhrNv28YpgZMlMshoImM2O6dMsdx6qyE1P3XqZPr5Z/v1fzWZnFu32j/5xPrCC+aHHzZVq2YICLg5chUrZrj3XmOfPuY337R8953t0CEHPZMrPVOrlnrL+dGjcflK5siRONnr2rUt9AwBy8saP16NnAFVF6u1Rr/5hpMlJ0tkkMmijM3mnD3bWrXqP9GqeXPj+vX2TP/q7FlHcLBt1izb8OGWtm1NFSsabspb8lWqlKFpU2P//uaPP47csSMmNDSRnsnunhFkkS9RwpiUlL9kEhOvyV7LvoeFJdIzBCxvSmY0aaAaxX5XKzWMGOGwWjlZcrJEBhmvZb780la3rjE1DzVoYFi61Ob17p886Vy3zv7ee9bBg82tWpnKlUsnct12m6ldO8cLL5z/7LOo3btjL15Mome0rfXro8W5fXtHPpSR1pJ937DhCj1DwPKm7HZnmTJqnvpZpz7yWV+6tKlnT9v8+Wpu42RJjEAGGbdl1qyxBQWZUnNPjRrG+fNtWrxt5j919Khj1SrbtGnW4cPDHnjAXqaMMW3kqlLF3LGjY+zY8M8/j9q3L/bSpSR6Jiv1+usXRHXSpAv5UOa118LVG+3/d4GeIWB5Wd27qznx7dtfN1St+u8sVbCgqUULy+TJ9l9+4WRJjEAGGRfbuXWrvV27f6JV+fKG6dMtFosjZ2Ts9oQtW658+GHE4MGhzZrZihe/OXIFBEjaM3ft6nzllfBvvrl06NDVmJhkesb96tBBXcVZty46H8rIXsu+iwDzDAHLy5o9Wy3W0LGjSV3Q2rvX+s47xjZtDIULX5+ijDVrmocNs69c6XRj7RpOlsggk39k9u519OhhSn19eqlShldftej1jlyUSU6+ZjTGr18f/e67Ec88E3LvvbaiRW9+YrFAAf0dd1jatLHL16RJF3bujDGZEhIT6Zl0KinpWsmSKrOGhCTmQ5lz5xJTGtub158RsAhYqg4fdqS+YefG+OQ4fdq6aJG5d29DuXLXZyZDiRLmbt2sc+a4WNCBkyUyyOQHGZk3BgwwFyqk4ktgoH7kSMuJE74oI8np9On4tWuj3377Yu/eIQ0aWAsXTue1XLIjtWpZ2rd3DBkSOnXqxaVLL/32W6zDkZCcnK975tgx9U46eYidb0dTjRpmETh+PI55hoDlZdWooWacl16ypLPCst1u37DBMmaMoX79Gx8DmoKCLK+95tixg5MlMQKZfCVz6pRz9GjzLbekvpRA//TT5hsXUPB9mfj4ZMkNU6ZcbNPG/sgjztat7dWqmdOuy5X6FRhoqFvXIr/2/PNh770XsXLl5f37r970trI83DOff67WgurTJyTfjibZd7WS0edRzDMELC+raVOjOyssOw4etMyYYXroIfWI9fplrapVzQMH2pYtUyvbcLIkRiCTd2WMRufkydbSpf8Z/V27mnbvduQNmbi45DNn4rdujVm4MOq118L79g1p3txeoYIp3dQlX8WLG+++29qtm/PFF89PmWL54gvbtm32U6cceaxnhg0Lk52dPTsy344m2XcREAfmGQKWl/XBB1bJWC1bur3Cst5g++orc79+hooV//29W24xdeoUtWhRgsPByZIYgUxekklISJZZ4vraVK1bGzdtsucHmStXkv/+Oy44+MrcuZHjx4c/8cS5Jk1sZcsaMwpepUrpGzY0duliev55y/Tp1m++se3caTcY/FWmYUP1Ct3ff4/Nt6Np795YEWjUyMo8Q8DSoDxdYfnb6bv3DX/T2Lix/vrvBQTYgoIuvPXW1YMHryUnc7IkRiDjvzIygleuvFy3riV1cDdubFy50o5MZGTS4cNXf/ghetasiCFDzB07murVM6Z+IlC6X7fdZmjSxNi9u2n0aPP771uXL7ft2ePI4ideZ7fMpUtJ8ni7SBHD1avJ+XY0yb6LgDhou94HASufBqy05e4Ky/ec7tdi+9SGM5cFttuv++el8abKlcOGDYtety4pOpqTJTECGf+S2bo1JijIljrGa9c2LFxodTiQcdUzx487Nm2yL1hgnTzZOmCAuV07k7gVKZJ+6pLHpJUqGe6/39ihgykoyDhtmtVqdfiOzI4dMbKR999vy+ejSQTEQTSYZwhYOVHurLB8a9FjLYqu7a+b8o6u33Jdsz8DKzg7d46cPz/BYuFkSYxAxsdl9u+/+tBDjtSxXLWqedGiqKyf+/Ntz0gqPXzY8eOP9nnzbK+8Yunb19S6ten2242p78G88at0aX3Pnqb5823ervSspcz06Rdlk8aMOZ/PR9OLL54XhxkzLjLPELByp9xZYbmCbm9r3ZLBuv99UG3s1kGzw7b/fi0piZMlMQIZn5I5eTL+iSfOpY7ZsmWNH3wQkboyJzKa94zN5jxwwLFmjW3cOPUq2Ouf3pj69swWLUyTJ1t++cWeWzKPPaba4LvvLufz0fTtt5fFoXv3c8wzBCxfOVQ3r7Bc7ObHagG6s1UL/tax2uaXe+z5emEoKyzTM8jkrozNljB0aJic2lNfZzlp0oWIiCRkcrJn9u61v/OOtU0b442LddWsaRw2zLxypd2d12xpuF+pb6I0GOLz+WgSAXWBoIKJeYaA5aOH6voKyzOmhfft8FfD8vsCA07cvMJywNk6NfSpKyxPnBgeHHzlr7/izp9P5GRJjEAmWys8PHH8+PDURc/l1D5yZJjTmYhMLvbM6dOORYusvXubb3wBRokShm7dzHPmWI8dc2S3jEzXKR98ZGI0SYmDaIgJ8wwByz8OVWLitb83n/pmwLcTanzYJWDuHbothXSnMlrrr1YtS+vW9r59Q+Q0MGuWWu5vz55YszkhPj6ZkyUxAhmvKzo6aerUi6VKGVNfcy1DTK+PR8Z3esZud27YYB8zxlK/vuHGT/sJCjK99pplxw5HNsl89516Xuyxx84xmqS6dXOKxvLll5lnCFj+d6iSLl68/N13tj7PbCnVdIxuTDPd8va6xQ/qvrxLt7G07lBG73xOPSVUqGC67z6bTAQjRoTJqeKrry5t3Rrz999xkZFJnBKIEchkVPLgZN68yIoV/1lL89FHnYcPX0XGl3vm4EHHjBmWhx4y3bDSs75qVcPAgeZly2wpKz1rJvPSS+qV3dOmXWQ0SYlDyoednGeeIWD588SXmBg5d669VStnly721q3N1arJg7XjuqI7dDW+093/ka7HK7rhA3VvPKqbd2+BHyoX2lco4IyL+FWsmKFOHUPr1qZevcyjR5unT7d8+aVt0yb74cMOu51TAifLfCqTlHRt2bLLtWv/s7RVixb2XbtikPGjnjEYnF99ZevXz3zjojm33KLv1Mm0aFGUw5GQ9Z1q3twut7l9ewyjSUocRENMmGcIWHlq4kuOi4s/cyZm69aohQvDX3stpG9fe/PmpgoVUieVM7oCe3UVftA1+kzXcYqu/wjdhCcKzW5V/Ps6JfYWL3zSRfYqWFBfubLhvvtMXbqYhgwxT55snTfPtmaNWv0vm5ZdJkYg4wsywcFXGje2po6CBg2s69ZFI+O/PeNwOLdssY8fb2nc2HjDSs/6oCDbW29dOHjwqncrPWu1umae6ZmoKLXmamCgIS4umXmGgJX3J77kK1fi/v77SnBw5Ny54ePHn3viCVuTJsayZW+MUX/pSmzR3bFE1/p93ZPjAsc+c+u8DhXWNbxtz20ljqddnv6m1Wjq1TO2a2fq0MHUsqWxTx+TTGFZ/JL5LotfAweGtm1rHzEibP78yCVLLq1efXnjxiu7dsXINHriRJzFkhAenhgbm0zPMJrSrd9+i23Txp7a4bffbv7qq0seLZNCz/i4zOHDjg8/tHbvfq7YDW/ZrlzZNGxYmMTo6GgPDvbvv6vPh2nY0Mpoul53360eluzbF8s8Q8DKvxNfUmTk1cOHo3/4IWLWLPOQIaaOHY316hmKF78pQ53SFfpFV3WV7r65JXtPrjr5uTqfP3bnxvtr7bu9wt9FCp91kb18/0seaZUsaaxUyVS7tqVRI2uLFvYOHRwy7T79dIhMtS+9dP711y+8+qrl7betM2da58+3ffWVbeVK+4YN9h07HHv32v/6y3H69L+f8M3JMg+MpmPH4lLXNEr5zBbT7NmRXnz4iTc7YLc7jh+379plW7vWunChnOqNLVqYhw2T7+Un8nP5V6dXa8PTMy5k5FHWpk1XRo06LzH6+rRQtKihc2enPDaTR2KZ7tGcOeoTjocODWM0XS/REBORYZ4hYPHI8mYZNdFv2mRN+QwL84ABpnbtDLVr6zP4DIuDAbcG39bmy7rDh1ef17xU8FN1Vo99cM3Y9j+M7fDj2E7BYx/dNK7rT2Mf2zau58/jntg17qlfx/XZM67fvnH9D4wfeGjc4MPjhh4ZP/z4+BEnxr9wevyLZ8e/bBw/zjxlysUsfg0aFNqunaNv3xCZOgcODO3VK0RmzAcfdAQF2erVs1Svbi5XzpT6TntNvsSmTBl9lSqGO+4wNG4sZ0bTQw+ZunY1PfWUeeBAc48e5pYtjb17c20vl0eT7Jfsneyj7Knsr+y17LsIiINoTJp0oXFja+onuJcoYRQrr5/0Sef5KUniEsnXr7d9+aWkdcurr5qHDjX16GFq3dpYv76hfHl96pparr8KFpTflN9Xq5tLVw0dKrcjtya3Kbcsty/3QsDyumeOHImbPv1iy5b21B5I/ZLHXfIoa+/e2IwuYcokI7+2eHEU56brtWhRlJjIw1TO2ukHLN0NRcDiakTqSxgchw/bf/zRNm+e5ZVXTCmfYWG8/XZDoULZcWXJEBhoLFnSeOutpkqVzNWrW+rUsdSrZ23UyBYUZG/RwiFZqUMHZ+fO57p3D5H09PTToQMHhg0bFjZy5PmXXgqfMCH0mWfsbduGDhsW8cEHkfJIav78qEWLLi1Zcvnbby+vXh29bt2VTZtitm27vHN32PbfLVsOnQw++scPJ3ev1m/51vzDEtuyRecWzQ2dPfP89KnhY8ZYhg0z9+tn7tnT1KmTqU0bY1CQOifWrGmsUMFQooTBnTMj1/ayUnI7cmuHD6tbltuXe5H7knuU+5V7l22QLZHtka2SbZMtlO2UrZVtli2X7Ze9kH258azpOsOMGXM+LMyDJeWSY2ISzOarBw9e2bjx0ldfRbz/vmXECPNTT5natzc2amSoXDmjByc3v8u3TBlJ6MbmzVU2f/RRo6TyRx+V7+Un8nMV4V0/W///YV/uUe5X7l22QbZEtke2SrZNtlC2U7aWGdj1DCxHXzK3zCupS3KkfpUvbxowIFTieFTUf6JWzZrq0texY3Gcm67X0aNxYlKrloWzdoYBS6t4RMDK45fubTbHgQO2NWsso0ebWrY09+plGTXKPGyYZdAglUp69zY9/ri5WzfTI4+YHnrI2KaNqUULlVAaNzbUr2+8805jzZqGqlUNElXKlpW0og8M1Lt5JszJrCEnLdk2Of/JdlaporZZToSy/Y0bm4KCZI9Otmr/Z5vH9j7YZ0e7oevbjV7V/pUl7d76tN17H7X9eGqbBc/UWtqidHCvWqvGtlqRxa9X232fxa++d6xtWWZjz9rrh7bc+vT9u3o02dOx4f4H7vqzSa0jdaser3bbyVtLnSla5GxOXtvr0cMk38tP5Ofyr/I78pvy+/JX8rfuhBM3v4oWNZQrZ6pe3VyvniUoyCYpvXNnp5xHBw4MHTXq/PDhYffea1ux4j/r9yTHxyc6nXF//RWzdevlZcsiZ8++MGlS2NCh5x57zN68uaV2baM0hhv3bShe3FijhuqWTp1kXFhefFGCoSREiYoOyYwSHq3WzB/jWK3qN3fskL+Sv5VbkNuRW1PBX8ZUjRppn99P90u2WbZcHqjIXsi+yB7JfsneyT7Knsr+yl4zA19LWZ5j27YYCe7y+O66X+HCBonvs2dH6vXxISGJ8hOJ71n/JLO8dG4SDTERmdDQRM7aNwesmyJRFhMSAYvXRngsk5SUfPVq0qVLSRcuJJ47l2C1xstkdvJk3JEjV//4I/b332N++SVm+/YrmzZF//jjZXlQ+d13l5YsiVq8OHL+/Mg5cyJmzgwdNszRrl1o//7hEyeelwly1KiwYcNCBw4M6dcvpFevcz16ODt3djz8sOPBB+0tW9qCgqyNG1vr17fUqWO+/XZTpUqmcuWMJUsaihb1ubSXU1+ndQWP6Ir/riv/s+72YF291bomX+seWKjrMFv32Axd78m6QeN1I0cGTBhU8K0+hWc+VmT+w4FLHghccV/g+npFtt5e5LfyhQ4WL3i8oMuVQdz/ktspXuRk+eJHa5T5s375/fdV2dO6xq5Od2zvUW9z30Ybhtz3/ejmqyY/tHrGoyvmPLZ00ZNLvu27+PtnF2wZOm/3iDl/jPnw5Pj3LJOmhb35tutnT0MGDbK3bevs0ePck0/a27Sx3HWXeiOIGxeNDIGB5urVpYucjz4aOmBA+IQJlsmTrXPm2JYutW/e7Dh40Jm67FLOlMkk9yj3K/dunT1btkRd0B0wQLZNtlC203DjwlAZX06TfRcBcRANMVHXgwcNupDlp6gtWX6aXB6zGVu2NPXunfWb8mjL970wa0rHVa1q7L2xq6sU+1P+e+9tu/OzTLpfjcr9JjKP1/rxlbZrs/j1csvlmnytfmdLHgxYwRTlz7Vxw4aNP/ywafXqzcuXb1m69KclS35avHjbggXb583bPmfO9g8/3PHeezunT985ZcquN974ZdKk3RMn/jp27K8vvvjbyJF7hw/fO2TIH488crRRo0MPP7yvX79c/5LNkI35s337A08+eaB79z+6dj30yCOHOnT4s127ww888FeLFkeaNj1y773HGjY8Vq/e8TvuOF6z5onq1U9WrnyyfPlTZcueLlnyzC23nC1S5Kw7T1fpdH/rAv/QlflVV/knXZ11uobLdc2+0LWd93/t3UGLHEUYxvEmH0D3I+TkTSIiRMkhVy/m4NEQSMBrIB8gCPGkEoiS454FWXJWDAh7EHIQBQ8GIR8hwYsgBGTHEkXi7kx19VRV9zuZ359hWWZ6ut966p2pZ6rfrh7e/Wx4/85w9YPh44vDl+lv+j89k55Pr6Zt0pZp+/Su9N60hwWN5pNz5349OPjl/PmfL1z46fLlpNija9e+v3nz+Pbt7+7efXh4+PXR0c6ldIo5RZ7iT61IbUkt+uHKldS61MbU0tTeJ/v6u6Lk8ePwavqZ8d5w77+Fnd8YHpDl1OOt4atoQX34+mHvT9YCBgvAy0mricbr13+rv66h+pHCSME8vXXr96OjP46Pnz9+/OezZ6uTk33s2ZOT1PakQNIhqZE0+bubbtyI000RcubpR3c+fef+m688/PzSPcqcenzy9v2LB99cfe1BfVVDq8e3Xzxa8CPFYAEAADBYAAAAu2KwVk2vIgQAAGCw/vVVrdbBAgAAywztkQbxsI6id2BDzDaHMnmhfGdAExwhmOH/SONNyoSKx6epMGHmjzOTM/MEs4Ua/QLbQo3ZumzTURZJ6U1CzZ+3hWmzjwYrlOc91RnLRhWzTi7IsB02e/2UjJnAL+ZtqJ8rmSfnHKhGX5ohmElq9AtsCzVm7rI4BivC10552jBYogodzD8xMFjxUzdgN+2b2yv5KTI6UraKMx9M4UhZE0xbNSoDa6tG81W7K4VqmNv1Qi2uxpxmi8EykDcIwCnCtaYzWjkjg7V4MKNZOpvBygdTeK6nyWDZRI36wBqq0bzLaoTqesJ0qlBNgumRNp0+/gzW7oUUqmokpu8Mde4p4MnuIFY4Tp4sEs+m2p1FjOBo8cpsbm8pg9VQja5dNkmopSrA1grVZYqoRdr0U4nBYvgaHF1nhZ2nCRVGNGVe/HZmsEqmBBis1fS6q6UM1mxnvUuEmjNvJ6VN32s1GKwddVerGDXCMZf2YLBiJnDk1YydIiwRZz9PES5usLYWquuk0VSh2pYPNkwbM1giCT0+hSruCXVVY7STuRJ4U87M5q626Kke5+LLq5U71dM0V6MmsOZqNOyyyrLuHvNnU4VaXI3VWGH7HtVghV22xzJCkcdvCyzF/4Ww2p2lp0J97y0iWpB1sIIsPRV/HaxMAf7iaTNbMFPTZn+vIgQAANhRGCwAAAAGCwAAgMECAABgsAAAAMBgAQAAMFgAAAAMFgAAABgsAAAABgsAAIDBAoClv8WGQTMBMFgAagfagPejrGlF/W2DayxIj1tQd7odnuQHGCwAvXzJyzHoNmxIK38W3AwxWACDBWAmX3LqpdHbyG+a7Dl1V/lNt53P778kmExDRmPbNOm19o2FUeWVmSpFvpvKeyHfTAAMFoCZDNZZ0zD6f2Zoz/+f2X70jfUGK3/cklfrDzfqe9a27uwe1h66sMsAMFgAGnus0emNGldR83x+43qDlX9+khdpLkVh66YGz2ABDBaABczWWddVOFPVYz/5nSxusFpJtJ3Byh99ahcAYLAAzGGw8hts5x6m7qfcCsxvsHpP5hW2brTVk+q6ADBYAFo6qrOjckmNVKaUe3Q/o8etqVLatP2kerLyGqzKcrTtDFZJG8u7AACDBaCxx5p04V7m4ru11daTarxWFVcRZrZZG1vDqwjX7jazk0Ip8q3Ld9CoegwWwGABiGvOBA8ADBYAHoXBAsBgAeBRBA/A9y0JAAAAGCwAAIDQ/AXZS70byryYBwAAAABJRU5ErkJg" alt="Duplication level graph" width="800" height="600"/></p></div><div class="module"><h2 id="M9"><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAEkklEQVR42s2XV2hUaxSF/4nRiaIoiKA+CDYMdsQnS8CAFREVsV4VUR9sWMECVuzYsETsGnvvivVaImhyU+Hq9VUfzKtKkptk5nz3rPkz42RyJskE5Xpgw8yZ8++1Zu+1yzGA+T8t8UPGJP1lTGquMenZxvwh02fd02+/jECOMSNdoEwX6KtrgQJjSv425rtMn3VPv+kZPfvTCLj/MM11WphnTNnnlJRA6fDhsGkTHDsG16/D2bOwfj3OtGmUDhjAZ78/oGd1RmcbTOBPY5JdRxmuo/IvyclBZ/lyeP8ePn6EoiLIyYE3b+D5c3j4EG7fhitXICMDZ8QIiv3+oM7Kh3wlRCDfmFbuwawiY0orOnWCmzfhwwcoLITsbMjKgmfP4MEDuHULLl+2kTh+PESAvXth7Voq+/RBPuRLPutFoOqfZ/1jzL8KK3l5UFAA797B69fw9Cncv29JXboEmZk2HYcOwZ49sG0bbNwIa9aAGzWnd2/kSz69IlGDgEIm1s6UKZCfD2/fwqtX8OQJ3LsHN27AxYtw5gwcPQoHDsDu3bB1K2zYAKtXw7JlsHAhzJ0LM2fipKaGI5FRK4EqwZVXtGtnc/viBTx+DHfvWsFduACnT8ORI7B/P+zaBVu2hETIqlUWeMECmDMHZsyASZNg3DgYNYrK1q2R71hhViMg5X4xJsjOnfDoEdy5A9euwfnzcOqUTUNurgXevBnWrYOVK2HJEli0yGpDaZk4EcaOhZFuNaanw6BB0KsXxT6fhFnoSUC1q/Jxhg61ir56Fc6dg5Mn4fBhq/jKSggE7GcBL14M8+bZUEsfwSCUl8OJEzBkCAwcCP37h8Dp1g2nZUuEEd0nov995iefLxASVKyiX76Eigoil4jouY4doUcPmyIRC18isW8fdO8OXbpA27bgguP388ltWMKqTsC2168lXbtWV/T27bBihRWdQKMvERI5kY0G16XvSllSkoWIsm+uCSvctkME1MfVShkzxipapSRFz54NzZtbR1J7LIlwSmLBVZrJyTXAZY4lEAjNjjABDRP1c6ZO/aHoCROgSZMfh+OR8AJv3NgTPGzCEmaEgCaahgrTp8PSpaAe0KhRzcMicfCgNwmBKx11gMuEJcyaBAQ8axa0aeN9WGFVbmPDHk6HNOHzJU4gkgKVYN++iYNHC1PirYNEjRREROi2TM/QxwPXd6/qkJDjkPAUYbgMv3kdUt7VjOKVmpcmRELd0sOfZxlGGpGi4BU2db2ysprgioxXdZSW2qEU6yclJU4jimrFwXi5C5OIBvcqUYGrjGNTOHgwTufO8VtxtWFUGwmlw6vJiIQmZCx4ixa2p7glXrUlFdY5jstrKyOP9hqx2Jx36ADz54fGdEV9xnH0QhKso5api2Ramu2q7qISdENfr4UkdiVrEIlWrex4Vim6Y9xxR3JCK1nsUlpeX2BX4dp8Qo1IE9XVQ2W/fokvpZ5ruSvMYLxQaycYPRp27Ij0BWfyZIqbNm34Wh7vxUQ1/L1ZM5z27aFnT0LTUwNs/HicYcMoce9pqfkpLya/zavZb/Ny+qvsPyB3ge/Rlc06AAAAAElFTkSuQmCC" alt="[FAIL]"/>Overrepresented sequences</h2><table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGTT</td><td>2628</td><td>30.17568033069239</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGAT</td><td>1004</td><td>11.528304053278218</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCG</td><td>139</td><td>1.59605006315306</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGGT</td><td>110</td><td>1.2630612010563786</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGCT</td><td>76</td><td>0.872660466184407</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGTTA</td><td>74</td><td>0.8496957170742909</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAGTTCAAGCGTT</td><td>74</td><td>0.8496957170742909</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGG</td><td>72</td><td>0.826730967964175</td><td>No Hit</td></tr><tr><td>AATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGTTA</td><td>54</td><td>0.6200482259731313</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAGTTCAAGCGAT</td><td>38</td><td>0.4363302330922035</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGACGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGTT</td><td>36</td><td>0.4133654839820875</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCG</td><td>35</td><td>0.40188310942702954</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGG</td><td>28</td><td>0.3215064875416236</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGTTAT</td><td>26</td><td>0.29854173843150766</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGTCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGTT</td><td>22</td><td>0.25261224021127565</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTGATTCAAGCGTT</td><td>21</td><td>0.24112986565621772</td><td>No Hit</td></tr><tr><td>AATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGATC</td><td>18</td><td>0.20668274199104375</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAGGCGTT</td><td>16</td><td>0.18371799288092777</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAG</td><td>15</td><td>0.17223561832586978</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGTTG</td><td>14</td><td>0.1607532437708118</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGGGCGGCTTAATTCAAGCGTT</td><td>14</td><td>0.1607532437708118</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGGTTAATTCAAGCGTT</td><td>14</td><td>0.1607532437708118</td><td>No Hit</td></tr><tr><td>AATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGTTG</td><td>13</td><td>0.14927086921575383</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGC</td><td>13</td><td>0.14927086921575383</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGG</td><td>12</td><td>0.13778849466069584</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTGAAGCGTT</td><td>12</td><td>0.13778849466069584</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGTTAG</td><td>12</td><td>0.13778849466069584</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTA</td><td>12</td><td>0.13778849466069584</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGGGGCGCGGCTTAATTCAAGCGTT</td><td>12</td><td>0.13778849466069584</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGGCGCTTCGCGGCGCGGCTTAATTCAAGCGTT</td><td>12</td><td>0.13778849466069584</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCACGCGTT</td><td>12</td><td>0.13778849466069584</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCGTAATTCAAGCGTT</td><td>11</td><td>0.12630612010563783</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGACGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGAT</td><td>11</td><td>0.12630612010563783</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGATA</td><td>10</td><td>0.11482374555057985</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGC</td><td>10</td><td>0.11482374555057985</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGGGGCTTAATTCAAGCGTT</td><td>10</td><td>0.11482374555057985</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTGAATTCAAGCGTT</td><td>10</td><td>0.11482374555057985</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCTGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGTT</td><td>9</td><td>0.10334137099552188</td><td>No Hit</td></tr><tr><td>AATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGATA</td><td>9</td><td>0.10334137099552188</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGAG</td><td>9</td><td>0.10334137099552188</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCGAGCGTT</td><td>9</td><td>0.10334137099552188</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGGGGCTTAATTCAAGCGAT</td><td>9</td><td>0.10334137099552188</td><td>No Hit</td></tr><tr><td>CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTGATTCAAGCGAT</td><td>9</td><td>0.10334137099552188</td><td>No Hit</td></tr></tbody></table></div><div class="module"><h2 id="M10"><img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACAAAAAgCAYAAABzenr0AAAFlUlEQVR42s2XCUzTVxzHybIs0IgCLYqyQ9RtmhjCNKKbikajYVc22NThNjYjeC0yWBESxAV1Ckw8QEUF5ChnS4FyFETucwWU+7ClHKKiImLI4nCz9bv3/pS7ra1HtM1Lm/b/fp/ve+93PQMABq9y6D/Bz+ANNvethWxPw3Xs3wx/YAb9Tn6j/700AeZc1qccrhGPw2UNkk8Fx9voIceX9Tcz6Hf62/B/PPrsCxNgzjW043iyGjheRkOWQRzFt2IH/Nl4DDFyHjJ6siDoSoZ/YwB2VuyEffpGzA5iK+izdA6d+8wCyHa+SYyEsj2N/jU/aaL0vbIf0sF2tA92oOVBG+ruN6CqrwZldypR0FuMnBuXkX49C5GyaGwq3ASLU2ZKOpfaoLb0EmDibmLC8TQq5/iw/vlIaA1xjxiyQTmaH7Sitr8ekr5qlN6pQP6tImTfyIXoeiYEnSmIlSfiooyHc20R8G84htUZq0FtUFvUpk4ChldO4H6sRzvKXdEw0ISmgRZc7a/DXwRccrscebcKIb5xCWndGeB3CsGTJyBCGoPQtnCcajlLjugk/qgPxO+1h7Eqyw7UFrWpbiemCKBbRlW7lrmgcaAZV/prUXm3CsW3y3D5VgGyenKQ2p2OpM5k8NoTEC6Nxtm2MJxsPoPAxhM4XB+AA1cPwbvmADyqvPFLpQdsM1aodoIVqlUAdRp6bgv5HzBbXHFXgqLbpci9mY/MnmykdIuQ2CFATHs8wqRRONN6ASeaTyOg8TgO1fnDl4C9anzhLvHCnkp3uJTvgXOJC7YUOWN+0nww/jTJMSevvsHs+DRlSOsZFPaW4NLNPOLpYgi70pBAwFHtcbhwLRKnW8/jeHMIOecgHKw7iv1XD2Jf9X78KtmHyNZoiOQi/FiyHZsJ+Ov87/DZZUesEq8H+4SxkjLUCmDinISPY74jcm4Oe3RyVyriO/iIksUS8EWEtJ5DUFMwjhIH86s7Ap8rfvCs9oGbxBO7KtwQ3hKBrgdd6H94D3ypgIAdsD7nc6wWb8DyzDWYy58HyhifJ8ZWT5NMoLGCJ48jsZ2COHkSCSkezl+LQHBLKI40BGJLsRPW5qzDskxbLE5bDBuRDWwzV5DV2SGwNhCdAx0Yed172AdeWyyWpa/ColQbzE1+H7MTLcEOmKagrAkCaAqlWWwZf6kqlMY8+gDZ3jXZazEz0Rym8TPUDg+yetl9Kca/HikeIUUmgEXizAnPml2YDsoaSduMAJrHaSrdWvw9AYcR8LBHu0m4eJtvqRGsDS4k8DlJFlPnxM0AZVHmmABSTGg+31GxW+XRAfi51AWztKxaI/zxELNytXDVoCzKHBNAKhotKrsr9zIe7Vq+G5wEs9EJi1I+hFDKx7zkuTrAk7XCGQGERZlTBLiSuN1Ltn2BcMEEeGF3PoaI8dzObFgJ3nsuuHoBqiNwLNgMu+x1ow9SByrsyoNC+ZiBPFb8h5LrhWrhqTKhTnD1R6BywuWZn0zYejq2FTuj/k7tKEz5RPlccLVOOBKG7DATtZO+yXNATW81npD3ZHhaux5wTWE4kohoktA0cWPOelT3SkZFDMNT9ICbwCJplvpEND4Vm8ZqNrJBJWJIT7h5Ioek5a+wRLRUcyoeX4y0GaMiaEjqCn9X8A62le0ADXGLYLbmYjS+HJtGTdf5TLUNa5E1Kc8+8K09iPkJVk8vx+MbEm1H8bTBTjDFF3lfMlmVNipLREt0a0gmt2TPIsKKZEv3Ki5TU2gZt8+1168lm9yU6noc1MO3FDkxYNojhpH+YW2Gnf5Nqbq2nHHMWPVbbZNuA6firQghpZt2TRHSSGwn/eScYPNnb8s1XUxoDFtGWpD6sAgrxSvhSi4juypJ31f6ExwLSNsl/BicAOMXczF5ba5mr83l9GWN/wE1f784zfWjGwAAAABJRU5ErkJg" alt="[OK]"/>Adapter Content</h2><p><img class="indented" src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAyAAAAJYCAIAAAAVFBUnAAAjMklEQVR42u3dT68seV3H8XoU6BoxMRGVf0FHTeAhuJolsCOsWRuWLliyICpzDzqgok5IuEchhoU7NhPYsLyR0RlMWPgYmjuMc9Onq+pb39+fqq6ufn1yQy5n+vSru+tOn/et7nNmOJmZmZlZ1w0eAjMzMzOBZWZmZiawzMzMzASWmZmZmQksMzMzM4FlZmZmJrDMzMzMTGCZmZmZCSwzMzMzgWVmZmZmAsvMzMxMYJmZmZkJLDMzMzOBZWZmZmYCy8zMzExgmZmZmQksMzMzMxNYZmZmZgLLzMzMTGCZme3pKWzwJGZmAsvM7juGLnpoMY/Gn9IrsJSZmQksMztCXc39RmCZmcAyM9sosOYuOTzd5MfjCxd9eqbzzMwElpldP7CSp6/GgTXupLkIK7384qeYmQksM9tjY12cEIrzZS6wJi+T+dzMx+OLmZkJLDPbb2ktRkxFGM29Gpi8nsynm5kJLDPbb11lAqsxmKpDLfNxMzOBZWY3GVhzn7X4nqrMG6qC92CdvERoZgLLzG6xriazZu5ik40VfBtg6YXHl4xviZmZwDIzSWdmJrDMzASWmQksMzOBZWYmsMzMzMwElpmZmZnAMjMzMxNYZmZmZtY7sMY/AGb8j4L/uISH0szMzOwysF4102RgTf5TP+zYzMzMrCawGv9LXmZmZmYCq09gPZqZmW2+/zTbcFcIrOoTWv9bu+rGJBKJROJhxPhrnlnHCSwikUgkCiwzgeWph0gkEokCy44dWKeq7yIUWEQikUgUWCawnvxQq+TPuwp+DpbAIhKJRKLAMoHVeQKLSCQSiQLLBJbAIhKJRKLAMhNYnnqIRCKRKLBMYHkiIBKJRKLAMoElsIhEIpF484H14sMvSS/8V91ya3mg7udBFlhEIpFIvMfAGndV+9f+LvUwvpLFq924WgLu5T+Kb0z1Tb25MhNYRCKRSBRYO/oSXhFY+zmDJbAEFpFIJBIFVqq0zj/+6tf5/527zvEFxldSFFixm7zZ46u6uNjirV285cGVXFxP/MHFu5C5XwLLEwGRSCQS9x5Yk5ExeQ3xBYJSiQMr7rnxZ40zJb6q0sch80DN3YDF+xhfPnO/BJYnAiKRSCQeKrAyL29VBFb88br7knwBrjqwih6Kuhu8w+9UEFhEIpFIFFjbBdbc62XrBdbci25jJX6JMI6YijDKXHnyZUeBJbCIRCKReL+B1f4SYeMZrMwpq7qXCJPF0/3j+fslsDwREIlEInEvgTXXCu2BFZzBytyA5NVWvBus6HHInMFafE9V5g1VwXuwvEQosIhEIpF4Gz+m4eK7Bdd4iTA+DZP59r1ktyW/EzB+iTCOmDi5Fr+LsPTCRfdLYHkiIBKJROJ2gWX73GF+1LvAIhKJRKLAMoElsDz1EIlEIlFgCSyBJbCIRCKRKLDsriawiEQikSiwzASWpx4ikUgkCiwTWAKLSCQSiQLLBJbAIhKJRKLAMhNYnnqIRCKRKLBMYHkiIBKJRKLAMoElsIhEIpF4wMAahhcXvznYDnMHb+v2CywikUgk3mNgjbOj/et3rwI4/8/xrR1YT//Tfy8uPh7cu8WbN3e18eXXeHivUmYCi0gkEokCa0cnSOKsWSOw5i7cEljB1QosgUUkEonEewysuDledUBwembuApmzU8HHY33xpFFpYF380/x1lkZe/OAHJ9iCD84dtcUHqteJQ4FFJBKJRIGVDaxkbSQTJ1M8sVh0s/cQWEUFNu6k/Fm3+PKLnyKwPPUQiUQicY+BVdpM+RNRwe/rAit53qsisPLvJFt8kOvOfmWuZ6XXiAUWkUgkEgXWdoE1FzTV5ZF5jSx5Biv+fWk+5i9TEUbxPS162VFgeeohEolE4m0HVkuaXOUlwrnAqs7ExTN2dcHU5WEXWJ56iEQikbhRYM19vW8PrLk0ac+7uZtdzZ1yb4HKXG3pGazF91Rl3lAVf/+jM1ieeohEIpG4RWCdnr55aKWXCE8rvAcrvtnJ99RP3rb4Ni++u6v05Nbc2bLFe7p44eQjLLA89RCJRCKxJrDseNvVj3oXWEQikUgUWCawBJanHiKRSCQKLBNYAotIJBKJAsvuagKLSCQSiQLLTGB56iESiUSiwDKBJbCIRCKRKLBMYAksIpFIJAosM4HlqYdIJBKJAstuMbCGs2U+LrCIRCKRKLBMYEWBdd5P48AqzSaBRSQSicSdBNbwYrj4zcF2mDt4W7e/ILAyUZUsJ4FFJBKJxOsG1jg72r9+9yqA8/+k3tqB9fQ/3zdcfDy4d/HNC642/pQ1Ht6rlNl1AuvRzMxs860dWGucp+mYfXOBNXfhxsAqbZ37DazzqHIGi0gkEolHPYMVN8erDghOz8xdIHN2Kvh4rM9deXVgXfzT/HW2fDy4R+MTbMEH547a4gPV68RhzZvcvURIJBKJxPsMrGRtJBMnUzyxWHSzNw6sohc65x7kyYc0c9Ytvvzip2waWB1fIhRYRCKRSDx2YDWezonfvZR5V1M+sJLnvYoCq+i1v8yDXHf2K3M9K71GXPMeLN9FSCQSiUSBVRdYvU7t5K88fwYr/n1pPuYvUxFG8T0tetnxyoF18RLh5McFFpFIJBIFVvWplMbAWuMlwrnAqs7EzOuJ1Q9j48N+tcDqOIFFJBKJxJsIrLmv9+2BNZcm7Xk3d7OruVPuLVDx2aa6M1iL76nKvKEq/v7H65/BElhEIpFIvIfAOj39Hr2VXiI8rfAerPhmJ99TP3nb4tu8+O6u0pNbc2fLFu/p4oWTj7DA8tRDJBKJxJrAsuNtVz/qXWARiUQiUWCZwBJYnnqIRCKRKLBMYAksIpFIJAosu6sJLCKRSCQKLDOB5amHSCQSiQLLBJbAIhKJRKLAMoElsIhEIpEosMwElqceIpFIJAosE1ieCIhEIpEosExgCSwikUgkCiwzgeWph0gkEokzgfX53+z8Yhf/N7OKT0le7Xj3Fii3ft8FFpFIJBIF1r4Ca7Pr33Nd3frjILCIRCKReKeBdfGV++L3F6dPxl/yJ0+xzH3wIumSp2cmO2Pxes4vNnezF+9IcCPXu3CmqDK3Njhq+SPVeEcEFpFIJBIF1pOvvuOCGV8gqK7490WnZ4LrD65n7mKldzZ+EOLHoULMPCYtt7b0XgeXz9wRgUUkEonE+w2sZDaVXjK+WNHZmvwrZUW5U3qbk/elRcycqWq8tb0+nrkjAotIJBKJdx1Y47NZwRvMF7/eZ16oil+YK2qR6tfFqpMl82LZolj6/v3FQ1MRTC3Xk7kjAotIJBKJAuvzmZM0pWewkp1UHVgVbdR+Lqf7hTPLH5rG83AtZ7AuJrCIRCKReO+BdUq/EWfx63fRW5RO829CKg2s0tMw670HK3Ph4BRa5sxT0b2oO8Tx9WfuiMAiEolEosA6LX4zYPANfcnvTZt8denU9h6syespfYmw73cRlr6eGNz3ulsVvEZZeqRa7ojAIhKJROI9BpZVv2DnTmUmsIhEIpEosASWOyWwPPUQiUQiUWAJLIElsIhEIpEosOyuJrCIRCKRKLDMBJanHiKRSCQKLBNYAotIJBKJAssElsAiEolEosAyE1ieeohEIpEosExgeSIgEolEosAygSWwiEQikSiwdrZh7a/YPW6bwBJYRCKRSLyjwBrOfo2/AI4/PoR9E1xbEu0eWHO3avGuZW5e5p7ecZkJLCKRSCTeZWAFhZH5fdw3Q+7ravuX2cXACnJQYAksTz1EIpFIXDewKioq+Y+S4XV+nmnu/Nnkuai6wMp05FAedvE5s+CDQ/qSp9G92GWQCSwikUgkCqwdBFZR6wy7DKxh5iRZ5kTasBRt8e8FlsAiEolE4q7fg7VqYGXQoSTIqt+DFXdSdWCdqm588uP5myewPBEQiUQi8WqB1bGihqovoYuZknlBLXkGK/590ZvJKsIovvGL15P5dIElsIhEIpEosMoCa42XCOcCa/E7IofmYGo5g7V6pAgsTz1EIpFIrA6sXX0XYVFgDV0D65SLpOTVLr6namh7D9bJGSyBRSQSicSdn8Gq+DlY42/3C14COy2d/inNu2H+Fb3ke+qHsGCKciporODbAEsvnHzQBJbAIhKJROIeXyK07XfoH/VeEFjD2TIfF1hEIpFIFFgmsKK7Po6q8e8FFpFIJBIFlgmsDoEVhJfAIhKJROLeAstss10hsB7NzMzMDr2m92A5g0UkEolEIpFYJHqJkEgkEolEIlFgOZxEIpFIJBJvPbBOvouQSCQSiUQisS6wTn4OFpFIJBKJRGL3wOo4gUUkEolEIlFgCSwikUgkEolEgeVwEolEIpFIFFgOJ5FIJBKJRIElsIhEIpFIJBIFFpFIJBKJRKLAcjiJRCKRSCQKLIFFJBKJRCKRKLCIRCKRSCQSBZbDSSQSiUQiUWAJLCKRSCQSiUSBRSQSiUQikSiwHE4ikUgkEokCy+EkEolEIpEosAQWkUgkEolEosByOIlEIpFIJAosh5NIJBKJRKLAElhEIpFIJBKJAotIJBKJRCJRYDmcRCKRSCQSBZbAIhKJRCKRSBRYRCKRSCQSiQLL4SQSiUQikSiwBBaRSCQSiUSiwCISiUQikUgUWA4nkUgkEolEgeVwEolEIpFIFFgCi0gkEolEIlFgOZxEIpFIJBIFlsNJJBKJRCJRYAksIpFIJBKJRIFFJBKJRCKRKLAcTiKRSCQSiQJLYBGJRCKRSCQKLCKRSCQSiUSB5XASiUQikUgUWAKLSCQSiUSiwBJYRCKRSCQSiQLL4SQSiUQikSiwHE4ikUgkEokCS2ARiUQikUgkCiyHk0gkEolEosByOIlEIpFIJB48sIbRJv+RwCISiUQikUisPIN1EVil2SSwiEQikUgkCqzluioqJ4FFJBKJRCJRYHUOrEczMzOzQ68ssOKicgaLSCQSiUQisfgMlsAiEolEIpFI7BlY4zASWEQikUgkEomdA+vkuwiJRCKRSCQSqwNrror8HCwikUgkEonE+jNYvSawiEQikUgkCiyBRSQSiUQikSiwHE4ikUgkEokCy+EkEolEIpEosAQWkUgkEolEosAiEolEIpFIFFgOJ5FIJBKJRIElsIhEIpFIJBIFFpFIJBKJRKLAcjiJRCKRSCQKLIFFJBKJRCKRKLCIRCKRSCQSBZbDSSQSiUQiUWA5nEQikUgkEgWWwCISiUQikUgUWA4nkUgkEolEgeVwEolEIpFIFFgCi0gkEolEIlFgEYlEIpFIJAosh5NIJBKJRKLAElhEIpFIJBKJAotIJBKJRCJRYDmcRCKRSCQSBZbAIhKJRCKRSBRYRCKRSCQSiQLL4SQSiUQikSiwHE4ikUgkEokCS2ARiUQikUgkCiyHk0gkEolEosByOIlEIpFIJAosgUUkEolEIpEosIhEIpFIJBIFlsNJJBKJRCJRYAksIpFIJBKJRIFFJBKJRCKRKLAcTiKRSCQSiQJLYBGJRCKRSBRYAotIJBKJRCJRYDmcRCKRSCQSBZbDSSQSiUQiUWAJLCKRSCQSiUSB5XASiUQikUgUWA4nkUgkEonEuwis4cNNfjCfTQKLSCQSiUSiwLqsosnfCywikUgkEonEgsCaS6Lx2SyBRSQSiUQikVgQWOOXAusC69HMzMzs0MsG1vlLgXMvCzqDRSQSiUQikVj5EqHAIhKJRCKRSBRYDieRSCQSicSdBdZFVPkuQiKRSCQSicQ+geXnYBGJRCKRSCT2DKyOE1hEIpFIJBIFlsAiEolEIpFIFFgOJ5FIJBKJRIHlcBKJRCKRSBRYAotIJBKJRCJRYBGJRCKRSCQKLIeTSCQSiUSiwBJYRCKRSCQSiQKLSCQSiUQiUWA5nEQikUgkEgWWwCISiUQikUgUWEQikUgkEokCy+EkEolEIpEosBxOIpFIJBKJAktgEYlEIpFIJAosh5NIJBKJRKLAcjiJRCKRSCQKLIFFJBKJRCKRKLCIRCKRSCQSBZbDSSQSiUQiUWAJLCKRSCQSiUSBRSQSiUQikSiwHE4ikUgkEokCS2ARiUQikUgkCiwikUgkEolEgeVwEolEIpFIFFgOJ5FIJBKJRIElsIhEIpFIJBIFlsNJJBKJRCJRYDmcRCKRSCQSBZbAIhKJRCKRSBRYRCKRSCQSiQLL4SQSiUQikSiwBBaRSCQSiUSiwCISiUQikUgUWA4nkUgkEolEgSWwiEQikUgkCiyBRSQSiUQikSiwHE4ikUgkEokCy+EkEolEIpEosAQWkUgkEolEosByOIlEIpFIJAosh5NIJBKJROLBA2t4uotamvy4wCISiUQikUhcCKzFWhJYRCKRSCQSiR0Ca3w2S2ARiUQikUgkNr1EWBdYj2ZmZmaHXiqwxm+6cgaLSCQSiUQisekMVvJ9VwKLSCQSiUQiUWARiUQikUgkXu89WJMvEZ58FyGRSCQSiURi9RksPweLSCQSiUQiccWXCBsnsIhEIpFIJAosgUUkEolEIpEosBxOIpFIJBKJAsvhJBKJRCKRKLAEFpFIJBKJRKLAIhKJRCKRSBRYDieRSCQSiUSBJbCIRCKRSCQSBRaRSCQSiUSiwHI4iUQikUgkCiyBRSQSiUQikSiwiEQikUgkEgWWw0kkEolEIlFgOZxEIpFIJBIFlsAiEolEIpFIFFgOJ5FIJBKJRIHlcBKJRCKRSBRYAotIJBKJRCJRYBGJRCKRSCQKLIeTSCQSiUSiwBJYRCKRSCQSiQKLSCQSiUQiUWA5nEQikUgkEgWWwCISiUQikUgUWEQikUgkEokCy+EkEolEIpEosBxOIpFIJBKJAktgEYlEIpFIJAosh5NIJBKJRKLAcjiJRCKRSCQKLIFFJBKJRCKRKLCIRCKRSCQSBZbDSSQSiUQiUWAJLCKRSCQSiUSBRSQSiUQikSiwHE4ikUgkEokCS2ARiUQikUgUWAKLSCQSiUQiUWA5nEQikUgkEgWWw0kkEolEIlFgCSwikUgkEolEgeVwEolEIpFIFFgOJ5FIJBKJxHsJrOE3G39k/HGBRSQSiUQikVgfWKXZJLCIRCKRSCQKrCdhdJ5Hc7ElsIhEIpFIJBKXA2vyTFVdYD2amZmZHXpXCCxnsIhEIpFIJDqDNRtVAotIJBKJRCKxPrAuJrCIRCKRSCQSW9+DtXjWyncREolEIpFIJHYLLD8Hi0gkEolEIrEpsNonsIhEIpFIJAosgUUkEolEIpEosBxOIpFIJBKJAsvhJBKJRCKRKLAEFpFIJBKJRKLAIhKJRCKRSBRYDieRSCQSiUSBJbCIRCKRSCQSBRaRSCQSiUSiwHI4iUQikUgkCiyBRSQSiUQikSiwiEQikUgkEgWWw0kkEolEIlFgOZxEIpFIJBIFlsAiEolEIpFIFFgOJ5FIJBKJRIHlcBKJRCKRSBRYAotIJBKJRCJRYBGJRCKRSCQKLIeTSCQSiUSiwBJYRCKRSCQSiQKLSCQSiUQiUWA5nEQikUgkEgWWwCISiUQikUgUWEQikUgkEokCy+EkEolEIpEosBxOIpFIJBKJAktgEYlEIpFIJAosh5NIJBKJRKLAcjiJRCKRSCQKLIFFJBKJRCKRKLCIRCKRSCQSBZbDSSQSiUQiUWAJLCKRSCQSiUSBRSQSiUQikSiwHE4ikUgkEokCS2ARiUQikUgUWAKLSCQSiUQiUWA5nEQikUgkEgWWw0kkEolEIlFgCSwikUgkEolEgeVwEolEIpFIFFgOJ5FIJBKJxOMH1nC2zMcFFpFIJBKJRGIUWOOoGv9eYBGJRCKRSCTWv0Q4F1XJchJYRCKRSCQSBVbnwHo0MzMzO/QKAmv8XitnsIhEIpFIJBK9REgkEolEIpEosBxOIpFIJBKJhwws30VIJBKJRCKR2P8Mlp+DRSQSiUQikbjiS4SNE1hEIpFIJBIFlsAiEolEIpFIFFgOJ5FIJBKJRIHlcBKJRCKRSBRYAotIJBKJRCJRYBGJRCKRSCQKLIeTSCQSiUSiwBJYRCKRSCQSiQKLSCQSiUQiUWA5nEQikUgkEgWWwCISiUQikUgUWEQikUgkEokCy+EkEolEIpEosBxOIpFIJBKJAktgEYlEIpFIJAosh5NIJBKJRKLAcjiJRCKRSCQKLIFFJBKJRCKRKLCIRCKRSCQSBZbDSSQSiUQiUWAJLCKRSCQSiUSBRSQSiUQikSiwHE4ikUgkEokCS2ARiUQikUgkCiwikUgkEolEgeVwEolEIpFIFFgOJ5FIJBKJRIElsIhEIpFIJBIFlsNJJBKJRCJRYDmcRCKRSCQSBZbAIhKJRCKRSBRYRCKRSCQSiQLL4SQSiUQikSiwBBaRSCQSiUSiwCISiUQikUgUWA4nkUgkEolEgSWwiEQikUgkCiyBRSQSiUQikSiwHE4ikUgkEokCy+EkEolEIpEosAQWkUgkEolEosByOIlEIpFIJAosh5NIJBKJROLxA2s4W+bjAotIJBKJRCIxCqzzJLpoqVe/F1hEIpFIJBKJ9S8RzkVVspwEFpFIJBKJRIHVObAezczMzA694sCafH3QGSwikUgkEonEyjNYcVEJLCKRSCQSicSywBqHkcAiEolEIpFIrA+suSryXYREIpFIJBKJNYE1jDb5jwQWkUgkEolEYtlLhL0msIhEIpFIJAosgUUkEolEIpEosBxOIpFIJBKJAsvhJBKJRCKRKLAEFpFIJBKJRKLAIhKJRCKRSBRYDieRSCQSiUSBJbCIRCKRSCQSBRaRSCQSiUSiwHI4iUQikUgkCiyBRSQSiUQikSiwiEQikUgkEgWWw0kkEolEIlFgOZxEIpFIJBIFlsAiEolEIpFIFFgOJ5FIJBKJRIHlcBKJRCKRSBRYAotIJBKJRCJRYBGJRCKRSCQKLIeTSCQSiUSiwBJYRCKRSCQSiQKLSCQSiUQiUWA5nEQikUgkEgWWwCISiUQikUgUWEQikUgkEokCy+EkEolEIpEosBxOIpFIJBKJAktgEYlEIpFIJAosh5NIJBKJRKLAcjiJRCKRSCQKLIFFJBKJRCKRKLCIRCKRSCQSBZbDSSQSiUQiUWAJLCKRSCQSiUSBRSQSiUQikSiwHE4ikUgkEokCS2ARiUQikUgUWAKLSCQSiUQiUWA5nEQikUgkEgWWw0kkEolEIlFgCSwikUgkEolEgeVwEolEIpFIFFgOJ5FIJBKJxIMH1vDhJmsp+KcCi0gkEolEIjE6gzUXWKXZJLCIRCKRSCQKrNkwuvhIspwEFpFIJBKJRIHVObAezczMzA49Z7CIRCKRSCQSvUTocBKJRCKRSBRYAotIJBKJRCIxG1gn30VIJBKJRCKRWBdYw9Nd1JKfg0UkEolEIpFYeQar1wQWkUgkEolEgSWwiEQikUgkEgWWw0kkEolEIlFgOZxEIpFIJBIFlsAiEolEIpFIFFhEIpFIJBKJAsvhJBKJRCKRKLAEFpFIJBKJRKLAIhKJRCKRSBRYDieRSCQSiUSBJbCIRCKRSCQSBRaRSCQSiUSiwHI4iUQikUgkCiyHk0gkEolEosASWEQikUgkEokCy+EkEolEIpEosBxOIpFIJBKJAktgEYlEIpFIJAosIpFIJBKJRIHlcBKJRCKRSBRYAotIJBKJRCJRYBGJRCKRSCQKLIeTSCQSiUSiwBJYRCKRSCQSiQKLSCQSiUQiUWA5nEQikUgkEgWWw0kkEolEIlFgCSwikUgkEolEgeVwEolEIpFIFFgOJ5FIJBKJRIElsIhEIpFIJBIFFpFIJBKJRKLAcjiJRCKRSCQKLIFFJBKJRCKRKLCIRCKRSCQSBZbDSSQSiUQiUWAJLCKRSCQSiQJLYBGJRCKRSCQKLIeTSCQSiUSiwHI4iUQikUgkCiyBRSQSiUQikSiwHE4ikUgkEokCy+EkEolEIpF4/MAaziawiEQikUgkEvsEVmMeCSwikdgkvvPOL3/+8/d+8pNf/vjH733/+++++ea73/zm/3z96+984Qv/9dprv3j99f/+6lcnf/3f1742+etXX/zie5/73K++9KW5C8xd4Tuvv04kEu9W/ODXu2+91SGwLpKosbHmPv2vv/zw7NPfjX596juTv57/zo/e/shPf/CxH85dYO4Kn3/s/U98/vITiUTifsRPfufZJ9589om/f/ZHf/fsD7/97A8e3vj4szd+/+WvNyZ/Pf/ov78vfvTf5i7gE32iT/SJHT/xg1/f+Iu/2l1gPc7sW598833TL7/88ssvv/zya9+//vYz//AY7gqBNbe/+cq3n33muxW/nv/uD9/+rZ++/F+f6BN94gE+8eGz//jw2X96+OPvPfzJ9x5e++eHP/2Xhz/714c/f2vu1/Pf+4+3f/tnL/83uIxP9Ik+0Sf2+sQPfr3xl4/1L+VtHFhmZmZmh5/AMjMzM1stsE5dv4vQzMzMTGD9f1f1+jlYZmZmZgJrfakh3arLrzEZSz9xeLoNHqJhtP0/qvGdzdyd4J+u9JeEuavNcPFlVvr7zMXVFv0hqbubHf8YJLnNHtW5f8uK/qyOL3Ynf1ZL/21d6Rlg1dMHd34fq59zSq/z5k4DbX0T6/79rPs3vP1dZRXJ0uWRqb6eDR6ciy8w3f88VN+F7rct81gtcouP82aB1Rhn3R/V4M98hovv3arPvy2PxkWcrfFnde5qM39W48u0PKpzV9jy7Fd0nRu8ASZ+Nqu7DUXXeZX72P6cUxpta9/H+wqsXtdQcZ6m4ivTtR6Wxpu6ZbauGljdH9X819cMN/kpa5wWavyiFXxur1tbnaSLt2GlR7X9L0LbP6pFf1bjyzQ+qvl/W9d4Btj4maFjmldf58b3sf0554rPRQJr64ipy+SWV+tOba+iHimw8q8Q3XRgrX1aqOIlwswZhb4pMPnqSTIF5l4l2ewLTOm/77cbWO2PalEMdX8G2GFgVd/HHQZWy3POqeHspsDqHFjbvLGp1xNK9etujS+kVuRg3f1qfyEm8yab0jjrddsW/yDl/23fMgWKXgnKP1F2f1STr24svlY1d1BWeuG1+t/3ybeS3M+jWvfXoYpngCBoVnpmyD+bdXmWi3P/Kvex5Tnn1PBSr8DqGVibxVmXt0NtfFqo5dWK6hN1GxyU8d/5Ms/I27xItPhX8Lq/lnU8v1L0qMbt2P1RLT3ZENyGtR/V0q92cU+v/Wd18mqTf1YXP3fjwCp9BohPwm32zNDxT07F3zA3vo8tzzkV17nBfbzHwNrytcWWb827SmC1B9m1jks+sPp+7qqBVfRM2vc7YpJXu/itSaWfu0Fg5U9UrPfdef6stnxHdmNgbXOda/wJWeNPztX/RHV83ljjOgXW1p+1AV39DY+nmbPZOwysvicJ8t8j0/HvUh0fq/bvIjxt/nbs5E9qWPtRDf7MF30X4eLJws3+7r63P6sV30W4XprUndDt+NLSBl+V838Oe93HDf5E1Z2Ka7+PGz8X3XxgdflxTZv9qKeWk0kb/3CpxneJtdzUlf48lP5soe63Lf9Ytf9soc3+rln9dmyP6mnpzSV1Xz+2/NFipY9q37/LlR7oLs8A2/wZjm9Py09Ba7nOa30F73gcN34uOsgZLDMzM7PDT2CZmZmZCSwzMzMzgWVmZmYmsMzMzMxMYJmZmZkJLDMzMzOBZWZmZmYCy8zMzExgmZmZmQksM7MDPSGG/02P+DLBdd7Kf9nDzASWmdU3RMf/RmeX/6R6snKuG1gtN09gmQksMzt+YHX82n+wdBBYZiawzKxzYM2d2Rp/8IPfjy+/eG0XnxjfwvyFL25DfC+Cj08qycvH16OxzASWmd1jYI0bZbKZ5n6Tv7bFs0GlFx5XTnwvMrdzMbCK7qbAMhNYZnb8wArOLQUtlfmn1R9vv3D+U1Yi6m6JmQksMztIYGU+Pvni100EVtFLeALLzASWmV0nsIKY2PkZrMYqElhmJrDMrDWwtnkP1tqBtXimLf/GqUml4j1Y6spMYJnZnQbWqfy7CMf/KPldhOsFVvJe5L/7L75fyesRWGYCy8zMptOzrlz9JHczgWVmZvUR5kEwM4FlZiawzExgmZmZmQksMzMzs/vcrwEC1MZbloFDIgAAAABJRU5ErkJg" alt="Adapter graph" width="800" height="600"/></p></div></div><div class="footer">Produced by <a href="http://www.bioinformatics.babraham.ac.uk/projects/fastqc/">FastQC</a>  (version 0.11.8)</div></body></html>