Skip to content
Snippets Groups Projects
Select Git revision
  • 18a5e088f9c8946ede0d3f79bae28257e1b55706
  • master default protected
  • dev_fl
  • flemoine-master-patch-48018
  • v8.8
  • v8.7.0
  • v8.6.0
  • v8.5.0
  • v8.4.0
  • v8.3.0
  • v8.2.0
  • v8.1.0
  • v8.0.0
  • v7.10.0
  • v7.9.0
  • v7.8.0
  • v7.7.0
  • v7.6.0
  • v7.5.0
  • v7.4.0
  • v7.3.0
  • v7.2.0
  • v7.1.0
  • v7.0.0
24 results

plot_coverage.R

Blame
  • gmillot's avatar
    Gael MILLOT authored
    18a5e088
    History
    plot_coverage.R 19.42 KiB
    
    
    #########################################################################
    ##                                                                     ##
    ##     plot_coverage.R                                                 ##
    ##                                                                     ##
    ##     Gael A. Millot                                                  ##
    ##     Bioinformatics and Biostatistics Hub                            ##
    ##     Computational Biology Department                                ##
    ##     Institut Pasteur Paris                                          ##
    ##                                                                     ##
    #########################################################################
    
    
    
    
    ################################ Aim
    
    
    ################################ End Aim
    
    
    ################################ Introduction
    
    
    ################################ End Introduction
    
    
    ################################ Acknowlegments
    
    
    ################################ End Acknowlegments
    
    
    ################################ Initialization
    
    
    # R version checking
    if(version$version.string != "R version 4.0.5 (2021-03-31)"){
        stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
    }
    # other initializations
    erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
    if(erase.objects == TRUE){
        rm(list = ls(all.names = TRUE))
        erase.objects = TRUE
    }
    erase.graphs = TRUE # write TRUE to erase all the graphic windows in R before starting the algorithm and FALSE otherwise
    script <- "plot_coverage"
    
    
    ################################ End Initialization
    
    
    ################################ Parameters that need to be set by the user
    
    
    ################################ End Parameters that need to be set by the user
    
    
    ################################ Config import
    
    
    tempo.cat <- "KIND OF RUN (SCRIPT, COPY-PASTE OR SOURCE): "
    if(interactive() == FALSE){ # if(grepl(x = commandArgs(trailingOnly = FALSE), pattern = "R\\.exe$|\\/R$|Rcmd\\.exe$|Rcmd$|Rgui\\.exe$|Rgui$|Rscript\\.exe$|Rscript$|Rterm\\.exe$|Rterm$")){ # detection of script usage
        run.way <- "SCRIPT"
        cat(paste0("\n\n", tempo.cat, run.way, "\n"))
        command <- paste0(commandArgs(trailingOnly = FALSE), collapse = ",") # recover the full command
        args <- commandArgs(trailingOnly = TRUE) # recover arguments written after the call of the R script
        if(any(is.na(args))){
            stop(paste0("\n\n================\n\nERROR IN plot_coverage.R\nTHE args OBJECT HAS NA\n\n================\n\n"), call. = FALSE)
        }
        tempo.arg.names <- c(
            "cov", 
            "read_nb", 
            "ori_coord", 
            "ter_coord", 
            "color_coverage", 
            "ref_name", 
            "file_name", 
            "cute", 
            "log"
        ) # objects names exactly in the same order as in the bash code and recovered in args. Here only one, because only the path of the config file to indicate after the plot_coverage.R script execution
        if(length(args) != length(tempo.arg.names)){
            stop(paste0("\n\n================\n\nERROR IN plot_coverage.R\nTHE NUMBER OF ELEMENTS IN args (", length(args),") IS DIFFERENT FROM THE NUMBER OF ELEMENTS IN tempo.arg.names (", length(tempo.arg.names),")\nargs:", paste0(args, collapse = ","), "\ntempo.arg.names:", paste0(tempo.arg.names, collapse = ","), "\n\n================\n\n"), call. = FALSE)
        }
        for(i1 in 1:length(tempo.arg.names)){
            assign(tempo.arg.names[i1], args[i1])
        }
        rm(tempo.arg.names, args, i1)
    }else if(sys.nframe() == 0L){ # detection of copy-paste/direct execution (for debugging). With script it is also 0, with source, it is 4
        run.way <- "COPY-PASTE"
        cat(paste0("\n\n", tempo.cat, run.way, "\n"))
    }else{
        run.way <- "SOURCE" # using source(), sys.nframe() is 4
        cat(paste0("\n\n", tempo.cat, run.way, "\n"))
    }
    rm(tempo.cat)
    
    
    ################################ End Config import
    
    ################################ Test
    
    # cat("\n\n!!!!!!!!!!!!!!!!!!! WARNING: test values are activated\n\n")
    # stat <- "C:/Users/Gael/Documents/Git_projects/14985_loot/dataset/test.fastq_Nremove_trim_5pAttc_1-51.stat" 
    # attc_seq <- "CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCG" 
    # cute <- "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v10.9.0/cute_little_R_functions.R" 
    # log <- "report.txt"
    
    ################################ end Test
    
    ################################ Recording of the initial parameters
    
    
    param.list <- c(
        "erase.objects", 
        "erase.graphs", 
        "script", 
        "run.way",
        if(run.way == "SCRIPT"){"command"}, 
        "cov", 
        "read_nb", 
        "ori_coord", 
        "ter_coord", 
        "color_coverage", 
        "ref_name", 
        "file_name", 
        "cute", 
        "log"
    )
    if(any(duplicated(param.list))){
        stop(paste0("\n\n================\n\nINTERNAL CODE ERROR 1 IN plot_coverage.R\nTHE param.list OBJECT CONTAINS DUPLICATED ELEMENTS:\n", paste(param.list[duplicated(param.list)], collapse = " "), "\n\n================\n\n"), call. = FALSE) # message for developers
    }
    if(erase.objects == TRUE){
        created.object.control <- ls()[ ! ls() %in% "param.list"]
        if( ! (all(created.object.control %in% param.list) & all(param.list %in% created.object.control))){
            stop(paste0("\n\n================\n\nINTERNAL CODE ERROR 2 IN plot_coverage.R\nINCONSISTENCIES BETWEEN THE ARGUMENTS USED AND THE PARAMETERS REQUIRED IN THE EXECUTABLE CODE FILE\nTHE ARGUMENTS NOT PRESENT IN THE EXECUTABLE FILE (plot_coverage.R) ARE:\n", paste(created.object.control[ ! created.object.control %in% param.list], collapse = " "), "\nTHE PARAMETERS OF THE EXECUTABLE FILE (plot_coverage.R) NOT PRESENT IN THE ARGUMENTS ARE:\n", paste(param.list[ ! param.list %in% created.object.control], collapse = " "), "\n\n================\n\n"), call. = FALSE) # message for developers
        }
    }
    char.length <- nchar(param.list)
    space.add <- max(char.length) - char.length + 5
    param.ini.settings <- character(length = length(param.list))
    for(i in 1:length(param.list)){
        param.ini.settings[i] <- paste0("\n", param.list[i], paste0(rep(" ", space.add[i]), collapse = ""), paste0(get(param.list[i]), collapse = ",")) # no env = sys.nframe(), inherit = FALSE in get() because look for function in the classical scope
    }
    
    
    ################################ End Recording of the initial parameters
    
    
    ################################ Functions
    
    
    # Functions are built such that they should have no direct use of Global objects (going through the R scope), and only use function arguments
    # 1) Cute little function is sourced for the moment into the .GlobalEnv environment, but may be interesting to put it into a new environement just above .GlobalEnv environment. See https://stackoverflow.com/questions/9002544/how-to-add-functions-in-an-existing-environment
    # 2) Argument names of each function must not be a name of Global objects (error message otherwise)
    # 3) Argument name of each function ends with "_fun" in the first function, "_2fun" in the second, etc. This prevent conflicts with the argument partial names when using these functions, notably when they are imbricated
    
    
    ################ import functions from cute little functions toolbox
    
    
    if(length(cute) != 1){
        stop(paste0("\n\n============\n\nERROR IN plot_coverage.R\ncute PARAMETER MUST BE LENGTH 1: ", paste(cute, collapse = " "), "\n\n============\n\n"), call. = FALSE)
    }else if(grepl(x = cute, pattern = "^http")){
        tempo.try <- try(suppressWarnings(suppressMessages(source(cute, local = .GlobalEnv))), silent = TRUE)
        if(any(grepl(x = tempo.try, pattern = "^[Ee]rror"))){
            stop(paste0("\n\n============\n\nERROR IN plot_coverage.R\nHTTP INDICATED IN THE cute PARAMETER DOES NOT EXISTS: ", cute, "\n\n============\n\n"), call. = FALSE)
        }else{
            source(cute, local = .GlobalEnv) # source the fun_ functions used below
        }
    }else if( ! grepl(x = cute, pattern = "^http")){
        if( ! file.exists(cute)){
            stop(paste0("\n\n============\n\nERROR IN plot_coverage.R\nFILE INDICATED IN THE cute PARAMETER DOES NOT EXISTS: ", cute, "\n\n============\n\n"), call. = FALSE)
        }else{
            source(cute, local = .GlobalEnv) # source the fun_ functions used below
        }
    }else{
        tempo.cat <- paste0("\n\n================\n\nINTERNAL CODE ERROR 3 IN plot_coverage.R: CODE HAS TO BE MODIFIED\n\n============\n\n")
        stop(tempo.cat, call. = FALSE)
    }
    
    
    # required cute function checking
    req.function <- c(
        "fun_check",
        "fun_pack", 
        "fun_df_remod", 
        "fun_gg_scatter", 
        "fun_gg_palette", 
        "fun_open", 
        "fun_gg_empty_graph", 
        "fun_report"
    )
    tempo <- NULL
    for(i1 in req.function){
        if(length(find(i1, mode = "function")) == 0L){
            tempo <- c(tempo, i1)
        }
    }
    if( ! is.null(tempo)){
        tempo.cat <- paste0("ERROR IN plot_coverage.R\nREQUIRED cute FUNCTION", ifelse(length(tempo) > 1, "S ARE", " IS"), " MISSING IN THE R ENVIRONMENT:\n", paste0(tempo, collapse = "()\n"))
        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
    }
    # end required function checking
    
    
    ################ local function: package import
    
    
    # R Packages required
    req.package.list <- c(
        "lubridate", 
        "ggplot2", 
        "lemon"
    )
    for(i in 1:length(req.package.list)){suppressMessages(library(req.package.list[i], character.only = TRUE))}
    # fun_pack(req.package = req.package.list, load = TRUE, lib.path = NULL) # packages are imported even if inside functions are written as package.name::function() in the present code
    
    
    ################################ End Functions
    
    
    ################################ Pre-ignition checking
    
    
    # reserved words
    # end reserved words
    # argument primary checking
    arg.check <- NULL #
    text.check <- NULL #
    checked.arg.names <- NULL # for function debbuging: used by r_debugging_tools
    ee <- expression(arg.check <- c(arg.check, tempo$problem) , text.check <- c(text.check, tempo$text) , checked.arg.names <- c(checked.arg.names, tempo$object.name))
    tempo <- fun_check(data = cov, class = "vector", typeof = "character", length = 1) ; eval(ee)
    tempo <- fun_check(data = read_nb, class = "vector", typeof = "character", length = 1) ; eval(ee)
    tempo <- fun_check(data = ori_coord, class = "vector", typeof = "character", length = 1) ; eval(ee)
    tempo <- fun_check(data = ter_coord, class = "vector", typeof = "character", length = 1) ; eval(ee)
    tempo <- fun_check(data = color_coverage, class = "vector", typeof = "character", length = 1) ; eval(ee)
    tempo <- fun_check(data = ref_name, class = "vector", typeof = "character", length = 1) ; eval(ee)
    tempo <- fun_check(data = file_name, class = "vector", typeof = "character", length = 1) ; eval(ee)
    tempo <- fun_check(data = cute, class = "vector", typeof = "character", length = 1) ; eval(ee)
    tempo <- fun_check(data = log, class = "vector", typeof = "character", length = 1) ; eval(ee)
    if(any(arg.check) == TRUE){ # normally no NA
        stop(paste0("\n\n================\n\n", paste(text.check[arg.check], collapse = "\n"), "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between == #
    }
    # end argument primary checking
    # second round of checking and data preparation
    # management of NA arguments
    # end management of NA arguments
    # management of NULL arguments
    tempo.arg <-c(
        "cov", 
        "read_nb", 
        "ori_coord", 
        "ter_coord", 
        "color_coverage", 
        "ref_name", 
        "file_name", 
        "cute", 
        "log"
    )
    tempo.log <- sapply(lapply(tempo.arg, FUN = get, env = sys.nframe(), inherit = FALSE), FUN = is.null)
    if(any(tempo.log) == TRUE){# normally no NA with is.null()
        tempo.cat <- paste0("ERROR IN plot_coverage.R:\n", ifelse(sum(tempo.log, na.rm = TRUE) > 1, "THESE ARGUMENTS\n", "THIS ARGUMENT\n"), paste0(tempo.arg[tempo.log], collapse = "\n"),"\nCANNOT BE NULL")
        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
    }
    # end management of NULL arguments
    # code that protects set.seed() in the global environment
    # end code that protects set.seed() in the global environment
    # warning initiation
    ini.warning.length <- options()$warning.length
    options(warning.length = 8170)
    warn <- NULL
    # warn.count <- 0 # not required
    # end warning initiation
    # other checkings
    
    ori_coord <- strsplit(ori_coord, split = " ")[[1]]
    if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){# normally no NA with is.null()
        tempo.cat <- paste0("ERROR IN plot_coverage.R:\nTHE ori_coord PARAMETER MUST BE TWO INTEGERS SEPARATED BY A SINGLE SPACE\nHERE IT IS: \n", paste0(ori_coord, collapse = " "))
        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
    }else{
        ori_coord <- as.integer(ori_coord)
    }
    ter_coord <- strsplit(ter_coord, split = " ")[[1]]
    if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally no NA with is.null()
        tempo.cat <- paste0("ERROR IN plot_coverage.R:\nTHE ter_coord PARAMETER MUST BE TWO INTEGERS SEPARATED BY A SINGLE SPACE\nHERE IT IS: \n", paste0(ter_coord, collapse = " "))
        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
    }else{
        ter_coord <- as.integer(ter_coord)
    }
    if(length(color_coverage) != 1 & any(grepl(color_coverage, pattern = "\\D"))){# normally no NA with is.null()
        tempo.cat <- paste0("ERROR IN plot_coverage.R:\nTHE color_coverage PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(color_coverage, collapse = " "))
        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
    }else{
        color_coverage <- as.integer(color_coverage)
    }
    
    
    # end other checkings
    # reserved word checking
    # end reserved word checking
    # end second round of checking and data preparation
    # package checking
    # end package checking
    
    
    ################################ End pre-ignition checking
    
    
    ################################ Main code
    
    
    ################ Ignition
    
    
    fun_report(data = paste0("\n\n################################################################ plot_coverage PROCESS\n\n"), output = log, path = "./", overwrite = FALSE)
    ini.date <- Sys.time()
    ini.time <- as.numeric(ini.date) # time of process begin, converted into seconds
    fun_report(data = paste0("\n\n################################ RUNNING DATE AND STARTING TIME\n\n"), output = log, path = "./", overwrite = FALSE)
    fun_report(data = paste0(ini.date, "\n\n"), output = log, path = "./", overwrite = FALSE)
    fun_report(data = paste0("\n\n################################ RUNNING\n\n"), output = log, path = "./", overwrite = FALSE)
    
    
    ################ End ignition
    
    
    ################ Graphical parameter initialization
    
    
    pdf(file = NULL)
    par.ini <- par(no.readonly = TRUE) # to recover the initial graphical parameters if required (reset)
    invisible(dev.off()) # close the new window
    zone.ini <- matrix(1, ncol=1)
    if(erase.graphs == TRUE){
        graphics.off()
    }else{
        tempo.warn <- paste0("GRAPHICS HAVE NOT BEEN ERASED. GRAPHICAL PARAMETERS MAY HAVE NOT BEEN REINITIALIZED")
        fun_report(data = paste0("WARNING\n", tempo.warn), output = log, path = "./", overwrite = FALSE)
        warn <- paste0(ifelse(is.null(warn), tempo.warn, paste0(warn, "\n\n", tempo.warn)))
    }
    
    
    ################ End graphical parameter initialization
    
    
    ################ Data import
    print(cov)
    
    df <- read.table(paste0(cov, ".cov"), stringsAsFactors = TRUE) # does not take the header
    ori <- data.frame(x= c(ori_coord[1], ori_coord[1], ori_coord[2], ori_coord[2], ori_coord[1]), y = c(0, Inf, Inf, 0 ,0), stringsAsFactors = TRUE)
    ter <- data.frame(x= c(ter_coord[1], ter_coord[1], ter_coord[2], ter_coord[2], ter_coord[1]), y = c(0, Inf, Inf, 0 ,0), stringsAsFactors = TRUE)
    
    ################ end Data import
    
    
    ############ modifications of imported tables
    
    
    
    
    ############ end modifications of imported tables
    
    
    ############ plotting
    
    
    # fun_open(width = 12, height = 4, pdf.name = "plot_fivep_filtering_stat") # must be systematically opened for main.nf
    png(filename = paste0(cov, ".png"), width = 5000, height = 1800, units = "px", res = 300)
    
    if(ncol(df) > 0){
        fun_gg_scatter(data1 = list(ori, ter, df), 
            x = list("x", "x", "V3"), 
            y = list("y", "y", "V4"), 
            geom = "geom_step", 
            alpha = 1, 
            color = list(fun_gg_palette(n = 1), fun_gg_palette(n = 4)[4], fun_gg_palette(n = 7, "dark")[color_coverage]), 
            x.lab = ref_name, 
            x.tick.nb = 6, 
            x.second.tick.nb = 3, 
            x.left.extra.margin = 0, 
            x.right.extra.margin = 0, 
            y.lab = "Number of reads", 
            x.lim = NULL, 
            y.lim = NULL, 
            y.tick.nb = 6, 
            y.second.tick.nb = 3, 
            y.top.extra.margin = 0, 
            y.bottom.extra.margin = 0, 
            grid = TRUE, 
            article = FALSE, 
            legend.width = 0, 
            text.size = 16, 
            title = paste0(cov, " | NB OF READS: ", format(read_nb, big.mark = ","), " | Ori POSITION IN RED | Ter IN "), 
            title.text.size = 8
        )
    }else{
        fun_gg_empty_graph(text = "EMPTY .cov FILE: NO PLOT DRAWN")
    }
    
    
    ############ end plotting
    
    
    ################ Pdf window closing
    
    
    graphics.off()
    
    
    ################ end Pdf window closing
    
    
    ################ Seeding inactivation
    
    
    set.seed(NULL)
    
    
    ################ end Seeding inactivation
    
    
    ################ Environment saving
    
    
    save(list = ls(), file = "all_objects.RData")
    fun_report(data = paste0("\n\n################################ RUNNING END"), output = log, path = "./", overwrite = FALSE)
    end.date <- Sys.time()
    end.time <- as.numeric(end.date)
    total.lapse <- round(lubridate::seconds_to_period(end.time - ini.time))
    fun_report(data = paste0("\n\nEND TIME: ", end.date), output = log, path = "./", overwrite = FALSE)
    fun_report(data = paste0("\n\nTOTAL TIME LAPSE: ", total.lapse), output = log, path = "./", overwrite = FALSE)
    fun_report(data = paste0("\n\nALL DATA SAVED IN all_objects.RData"), output = log, path = "./", overwrite = FALSE)
    
    
    ################ end Environment saving
    
    
    ################ Warning messages
    
    
    fun_report(data = paste0("\n\n################################ RECAPITULATION OF WARNING MESSAGES"), output = log, path = "./", overwrite = FALSE)
    if( ! is.null(warn)){
        fun_report(data = paste0("\n\n", warn), output = log, path = "./", overwrite = FALSE)
    }else{
        fun_report(data = paste0("\n\nNO WARNING MESSAGE TO REPORT"), output = log, path = "./", overwrite = FALSE)
    }
    
    
    ################ end Warning messages
    
    
    ################ Parameter printing
    
    
    fun_report(data = paste0("\n\n################################ INITIAL SETTINGS OF PARAMETERS"), output = log, path = "./", overwrite = FALSE)
    fun_report(data = param.ini.settings, output = log, path = "./", overwrite = FALSE, , vector.cat = TRUE)
    fun_report(data = paste0("\n\n################################ R SYSTEM AND PACKAGES"), output = log, path = "./", overwrite = FALSE)
    tempo <- sessionInfo()
    tempo$otherPkgs <- tempo$otherPkgs[order(names(tempo$otherPkgs))] # sort the packages
    tempo$loadedOnly <- tempo$loadedOnly[order(names(tempo$loadedOnly))] # sort the packages
    fun_report(data = tempo, output = log, path = "./", overwrite = FALSE, , vector.cat = TRUE)
    fun_report(data = paste0("\n\n################################ JOB END\n\nTIME: ", end.date, "\n\nTOTAL TIME LAPSE: ", total.lapse, "\n"), output = log, path = "./", overwrite = FALSE)
    
    
    ################ end Parameter printing
    
    
    ################################ End Main code