global_logo.R

#!/usr/bin/env Rscript

#########################################################################
##                                                                     ##
##     global_logo.R                                                   ##
##                                                                     ##
##     Gael A. Millot                                                  ##
##     Bioinformatics and Biostatistics Hub                            ##
##     Computational Biology Department                                ##
##     Institut Pasteur Paris                                          ##
##                                                                     ##
#########################################################################




################################ Aim


################################ End Aim


################################ Introduction


################################ End Introduction


################################ Acknowlegments


################################ End Acknowlegments


################################ Initialization


# R version checking
if(version$version.string != "R version 4.1.2 (2021-11-01)"){
    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
}
# other initializations
erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
if(erase.objects == TRUE){
    rm(list = ls(all.names = TRUE))
    erase.objects = TRUE
}
erase.graphs = TRUE # write TRUE to erase all the graphic windows in R before starting the algorithm and FALSE otherwise
script <- "global_logo"


################################ End Initialization


################################ Parameters that need to be set by the user


################################ End Parameters that need to be set by the user


################################ Config import


tempo.cat <- "KIND OF RUN (SCRIPT, COPY-PASTE OR SOURCE): "
if(interactive() == FALSE){ # if(grepl(x = commandArgs(trailingOnly = FALSE), pattern = "R\\.exe$|\\/R$|Rcmd\\.exe$|Rcmd$|Rgui\\.exe$|Rgui$|Rscript\\.exe$|Rscript$|Rterm\\.exe$|Rterm$")){ # detection of script usage
    run.way <- "SCRIPT"
    cat(paste0("\n\n", tempo.cat, run.way, "\n"))
    command <- paste0(commandArgs(trailingOnly = FALSE), collapse = ",") # recover the full command
    args <- commandArgs(trailingOnly = TRUE) # recover arguments written after the call of the R script
    if(any(is.na(args))){
        stop(paste0("\n\n================\n\nERROR IN global_logo.R\nTHE args OBJECT HAS NA\n\n================\n\n"), call. = FALSE)
    }
    tempo.arg.names <- c(
        "freq", 
        "file_name", 
        "insertion_dist", 
        "cute", 
        "log"
    ) # objects names exactly in the same order as in the bash code and recovered in args. Here only one, because only the path of the config file to indicate after the global_logo.R script execution
    if(length(args) != length(tempo.arg.names)){
        stop(paste0("\n\n================\n\nERROR IN global_logo.R\nTHE NUMBER OF ELEMENTS IN args (", length(args),") IS DIFFERENT FROM THE NUMBER OF ELEMENTS IN tempo.arg.names (", length(tempo.arg.names),")\nargs:", paste0(args, collapse = ","), "\ntempo.arg.names:", paste0(tempo.arg.names, collapse = ","), "\n\n================\n\n"), call. = FALSE)
    }
    for(i1 in 1:length(tempo.arg.names)){
        assign(tempo.arg.names[i1], args[i1])
    }
    rm(tempo.arg.names, args, i1)
}else if(sys.nframe() == 0L){ # detection of copy-paste/direct execution (for debugging). With script it is also 0, with source, it is 4
    run.way <- "COPY-PASTE"
    cat(paste0("\n\n", tempo.cat, run.way, "\n"))
}else{
    run.way <- "SOURCE" # using source(), sys.nframe() is 4
    cat(paste0("\n\n", tempo.cat, run.way, "\n"))
}
rm(tempo.cat)


################################ End Config import

################################ Test

# cat("\n\n!!!!!!!!!!!!!!!!!!! WARNING: test values are activated\n\n")
# stat <- "C:/Users/Gael/Documents/Git_projects/14985_loot/dataset/test.fastq_Nremove_trim_5pAttc_1-51.stat" 
# attc_seq <- "CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCG" 
# cute <- "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v10.9.0/cute_little_R_functions.R" 
# log <- "report.txt"

################################ end Test

################################ Recording of the initial parameters


param.list <- c(
    "erase.objects", 
    "erase.graphs", 
    "script", 
    "run.way",
    if(run.way == "SCRIPT"){"command"}, 
    "freq", 
    "file_name", 
    "insertion_dist", 
    "cute", 
    "log"
)
if(any(duplicated(param.list))){
    stop(paste0("\n\n================\n\nINTERNAL CODE ERROR 1 IN global_logo.R\nTHE param.list OBJECT CONTAINS DUPLICATED ELEMENTS:\n", paste(param.list[duplicated(param.list)], collapse = " "), "\n\n================\n\n"), call. = FALSE) # message for developers
}
if(erase.objects == TRUE){
    created.object.control <- ls()[ ! ls() %in% "param.list"]
    if( ! (all(created.object.control %in% param.list) & all(param.list %in% created.object.control))){
        stop(paste0("\n\n================\n\nINTERNAL CODE ERROR 2 IN global_logo.R\nINCONSISTENCIES BETWEEN THE ARGUMENTS USED AND THE PARAMETERS REQUIRED IN THE EXECUTABLE CODE FILE\nTHE ARGUMENTS NOT PRESENT IN THE EXECUTABLE FILE (global_logo.R) ARE:\n", paste(created.object.control[ ! created.object.control %in% param.list], collapse = " "), "\nTHE PARAMETERS OF THE EXECUTABLE FILE (global_logo.R) NOT PRESENT IN THE ARGUMENTS ARE:\n", paste(param.list[ ! param.list %in% created.object.control], collapse = " "), "\n\n================\n\n"), call. = FALSE) # message for developers
    }
}
char.length <- nchar(param.list)
space.add <- max(char.length) - char.length + 5
param.ini.settings <- character(length = length(param.list))
for(i in 1:length(param.list)){
    param.ini.settings[i] <- paste0("\n", param.list[i], paste0(rep(" ", space.add[i]), collapse = ""), paste0(get(param.list[i]), collapse = ",")) # no env = sys.nframe(), inherit = FALSE in get() because look for function in the classical scope
}


################################ End Recording of the initial parameters


################################ Functions


# Functions are built such that they should have no direct use of Global objects (going through the R scope), and only use function arguments
# 1) Cute little function is sourced for the moment into the .GlobalEnv environment, but may be interesting to put it into a new environement just above .GlobalEnv environment. See https://stackoverflow.com/questions/9002544/how-to-add-functions-in-an-existing-environment
# 2) Argument names of each function must not be a name of Global objects (error message otherwise)
# 3) Argument name of each function ends with "_fun" in the first function, "_2fun" in the second, etc. This prevent conflicts with the argument partial names when using these functions, notably when they are imbricated


################ import functions from cute little functions toolbox


if(length(cute) != 1){
    stop(paste0("\n\n============\n\nERROR IN global_logo.R\ncute PARAMETER MUST BE LENGTH 1: ", paste(cute, collapse = " "), "\n\n============\n\n"), call. = FALSE)
}else if(grepl(x = cute, pattern = "^http")){
    tempo.try <- try(suppressWarnings(suppressMessages(source(cute, local = .GlobalEnv))), silent = TRUE)
    if(any(grepl(x = tempo.try, pattern = "^[Ee]rror"))){
        stop(paste0("\n\n============\n\nERROR IN global_logo.R\nHTTP INDICATED IN THE cute PARAMETER DOES NOT EXISTS: ", cute, "\n\n============\n\n"), call. = FALSE)
    }else{
        source(cute, local = .GlobalEnv) # source the fun_ functions used below
    }
}else if( ! grepl(x = cute, pattern = "^http")){
    if( ! file.exists(cute)){
        stop(paste0("\n\n============\n\nERROR IN global_logo.R\nFILE INDICATED IN THE cute PARAMETER DOES NOT EXISTS: ", cute, "\n\n============\n\n"), call. = FALSE)
    }else{
        source(cute, local = .GlobalEnv) # source the fun_ functions used below
    }
}else{
    tempo.cat <- paste0("\n\n================\n\nINTERNAL CODE ERROR 3 IN global_logo.R: CODE HAS TO BE MODIFIED\n\n============\n\n")
    stop(tempo.cat, call. = FALSE)
}


# required cute function checking
req.function <- c(
    "fun_check",
    "fun_pack", 
    "fun_mat_op", 
    "fun_gg_scatter", 
    "fun_gg_palette", 
    "fun_gg_empty_graph", 
    "fun_report"
)
tempo <- NULL
for(i1 in req.function){
    if(length(find(i1, mode = "function")) == 0L){
        tempo <- c(tempo, i1)
    }
}
if( ! is.null(tempo)){
    tempo.cat <- paste0("ERROR IN global_logo.R\nREQUIRED cute FUNCTION", ifelse(length(tempo) > 1, "S ARE", " IS"), " MISSING IN THE R ENVIRONMENT:\n", paste0(tempo, collapse = "()\n"))
    stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}
# end required function checking


################ local function: package import


# R Packages required
req.package.list <- c(
    "lubridate", 
    "ggplot2", 
    "ggseqlogo"
)
for(i in 1:length(req.package.list)){suppressMessages(library(req.package.list[i], character.only = TRUE))}
# fun_pack(req.package = req.package.list, load = TRUE, lib.path = NULL) # packages are imported even if inside functions are written as package.name::function() in the present code


################################ End Functions


################################ Pre-ignition checking


# reserved words
# end reserved words
# argument primary checking
arg.check <- NULL #
text.check <- NULL #
checked.arg.names <- NULL # for function debbuging: used by r_debugging_tools
ee <- expression(arg.check <- c(arg.check, tempo$problem) , text.check <- c(text.check, tempo$text) , checked.arg.names <- c(checked.arg.names, tempo$object.name))
tempo <- fun_check(data = freq, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = file_name, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = insertion_dist, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = cute, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = log, class = "vector", typeof = "character", length = 1) ; eval(ee)
if(any(arg.check) == TRUE){ # normally no NA
    stop(paste0("\n\n================\n\n", paste(text.check[arg.check], collapse = "\n"), "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between == #
}
# end argument primary checking
# second round of checking and data preparation
# management of NA arguments
# end management of NA arguments
# management of NULL arguments
tempo.arg <-c(
    "freq", 
    "file_name", 
    "insertion_dist", 
    "cute", 
    "log"
)
tempo.log <- sapply(lapply(tempo.arg, FUN = get, env = sys.nframe(), inherit = FALSE), FUN = is.null)
if(any(tempo.log) == TRUE){# normally no NA with is.null()
    tempo.cat <- paste0("ERROR IN global_logo.R:\n", ifelse(sum(tempo.log, na.rm = TRUE) > 1, "THESE ARGUMENTS\n", "THIS ARGUMENT\n"), paste0(tempo.arg[tempo.log], collapse = "\n"),"\nCANNOT BE NULL")
    stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}
# end management of NULL arguments
# code that protects set.seed() in the global environment
# end code that protects set.seed() in the global environment
# warning initiation
ini.warning.length <- options()$warning.length
options(warning.length = 8170)
warn <- NULL
# warn.count <- 0 # not required
# end warning initiation
# other checkings
tempo <- strsplit(freq, split = " ")[[1]]
if(length(tempo) != 4){
    tempo.cat <- paste0("ERROR IN global_logo.R:\nTHE freq PARAMETER MUST BE A STRING OF FOUR FILE NAMES\nHERE IT IS: \n", paste0(tempo, collapse = " "))
    stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
    freq <- tempo
    freq_name_test <- tempo[1]
}
if(length(insertion_dist) != 1 & any(grepl(insertion_dist, pattern = "\\D"))){# normally no NA with is.null()
    tempo.cat <- paste0("ERROR IN global_logo.R:\nTHE insertion_dist PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(insertion_dist, collapse = " "))
    stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
    insertion_dist <- as.integer(insertion_dist)
}
# end other checkings
# reserved word checking
# end reserved word checking
# end second round of checking and data preparation
# package checking
# end package checking


################################ End pre-ignition checking


################################ Main code


################ Ignition


fun_report(data = paste0("\n\n################################################################ global_logo PROCESS\n\n"), output = log, path = "./", overwrite = FALSE)
ini.date <- Sys.time()
ini.time <- as.numeric(ini.date) # time of process begin, converted into seconds
fun_report(data = paste0("\n\n################################ RUNNING DATE AND STARTING TIME\n\n"), output = log, path = "./", overwrite = FALSE)
fun_report(data = paste0(ini.date, "\n\n"), output = log, path = "./", overwrite = FALSE)
fun_report(data = paste0("\n\n################################ RUNNING\n\n"), output = log, path = "./", overwrite = FALSE)


################ End ignition


################ Graphical parameter initialization


pdf(file = NULL)
par.ini <- par(no.readonly = TRUE) # to recover the initial graphical parameters if required (reset)
invisible(dev.off()) # close the new window
zone.ini <- matrix(1, ncol=1)
if(erase.graphs == TRUE){
    graphics.off()
}else{
    tempo.warn <- paste0("GRAPHICS HAVE NOT BEEN ERASED. GRAPHICAL PARAMETERS MAY HAVE NOT BEEN REINITIALIZED")
    fun_report(data = paste0("WARNING\n", tempo.warn), output = log, path = "./", overwrite = FALSE)
    warn <- paste0(ifelse(is.null(warn), tempo.warn, paste0(warn, "\n\n", tempo.warn)))
}


################ End graphical parameter initialization


################ Data import


decal <- -1 # indicate the position occupied by the +1 position of the read (that correspond to first base of coli part of read) after rev complementation. Before rev-comp, it is 201 (as mentioned above). After, it is 400-201+1 = 200, thus -1. Allow to overlay consensus that are not centered on the +1 position
final <- NULL
for(i0 in 1:length(freq)){
    tempo <- read.table(freq[i0], sep = "\t", stringsAsFactors = TRUE)
    row.names(tempo) <- tempo[, 1]
    tempo <- as.matrix(tempo[, -1])
    if(ncol(tempo) > 1){ # some of the 4 files, like leading reverse, may not have any insertion sites
        if(grepl(x = freq[i0], pattern = "LEADING_16|LAGGING_16")){
            # equivalent to reverse - complement for contingency
            row.names(tempo)[row.names(tempo) == "A"] <- "Tf"
            row.names(tempo)[row.names(tempo) == "T"] <- "A"
            row.names(tempo)[row.names(tempo) == "G"] <- "Cf"
            row.names(tempo)[row.names(tempo) == "C"] <- "G"
            row.names(tempo)[row.names(tempo) == "Tf"] <- "T"
            row.names(tempo)[row.names(tempo) == "Cf"] <- "C"
            tempo <- tempo[, ncol(tempo):1]
            tempo <- tempo[order(row.names(tempo)), ]
            tempo <- tempo[, 1:(ncol(tempo) - abs(decal))]
            # end equivalent to reverse - complement for contingency
        }else{
            tempo <- tempo[order(row.names(tempo)), ]
            tempo <- tempo[, (1 + abs(decal)):ncol(tempo)]
        }
        if(is.null(final)){
            final <- tempo
        }else{
            final <- fun_mat_op(list(final, tempo))
        }
    }
}




################ end Data import


############ modifications of imported tables


############ end modifications of imported tables


############ plotting




if( ! grepl(x = freq_name_test, pattern = "^.*nodup.*$")){
    png(filename = paste0("global_logo_dup_", file_name, ".png"), width = 5000, height = 1800, units = "px", res = 300)
}else{
    png(filename = paste0("global_logo_nodup_", file_name, ".png"), width = 5000, height = 1800, units = "px", res = 300)
}

width <- 7
height <- 2.5
text.size <- 6
title.text.size <- 5
angle <- 90
tempo.just <- fun_gg_just(angle = angle, pos = "bottom")

if(ncol(final) > 0){
    title <- "GLOBAL CONSENSUS (LEADING / LAGGING AND FORWARD / REVERSE OVERLAY USING POSITION 1 AS ORIGIN"
    gg1 = ggseqlogo::geom_logo(data = final, method = "bits", seq_type = "dna") # Derived from https://weblogo.berkeley.edu/logo.cgi because the website does not work
    gg2 <- ggplot2::theme(
        # axis.text.x = ggplot2::element_text(angle = tempo.just$angle, hjust = tempo.just$hjust, vjust = tempo.just$vjust, size = text.size), #not required anymore because I used annotate() finally
        panel.background = ggplot2::element_blank()
    )
    gg3 <- ggplot2::annotate("text", x = 0, y = 2.05, hjust = 0, vjust = 0, label = title, size = title.text.size) # ggplot2::labs(title = title) to boring to fix the size
    gg4 <- ggplot2::scale_x_discrete(labels = c((-insertion_dist):(-1), 1:insertion_dist)) #remove the x initial numbers
    gg5 <- ggplot2::annotate("text", x = 1:(insertion_dist * 2 - abs(decal)), y = -0.01, hjust = 1, vjust = 0.5, label = c((-insertion_dist + abs(decal)):(-1), 1:(insertion_dist - abs(decal) + 1)), size = text.size, angle = angle)
    gg6 <- ggplot2::coord_cartesian(clip = "off")
    gg7 <- ggplot2::theme(text = ggplot2::element_text(size = text.size * 4))
    suppressMessages(print(ggplot2::ggplot() + gg1 + gg2 + gg3 + gg4 + gg5 + gg6 + gg7))
}



# insertion freq / genome binning (sliding windows)





############ end plotting


################ Pdf window closing


graphics.off()


################ end Pdf window closing


################ Seeding inactivation


set.seed(NULL)


################ end Seeding inactivation


################ Environment saving


save(list = ls(), file = "all_objects.RData")
fun_report(data = paste0("\n\n################################ RUNNING END"), output = log, path = "./", overwrite = FALSE)
end.date <- Sys.time()
end.time <- as.numeric(end.date)
total.lapse <- round(lubridate::seconds_to_period(end.time - ini.time))
fun_report(data = paste0("\n\nEND TIME: ", end.date), output = log, path = "./", overwrite = FALSE)
fun_report(data = paste0("\n\nTOTAL TIME LAPSE: ", total.lapse), output = log, path = "./", overwrite = FALSE)
fun_report(data = paste0("\n\nALL DATA SAVED IN all_objects.RData"), output = log, path = "./", overwrite = FALSE)


################ end Environment saving


################ Warning messages


fun_report(data = paste0("\n\n################################ RECAPITULATION OF WARNING MESSAGES"), output = log, path = "./", overwrite = FALSE)
if( ! is.null(warn)){
    fun_report(data = paste0("\n\n", warn), output = log, path = "./", overwrite = FALSE)
}else{
    fun_report(data = paste0("\n\nNO WARNING MESSAGE TO REPORT"), output = log, path = "./", overwrite = FALSE)
}


################ end Warning messages


################ Parameter printing


fun_report(data = paste0("\n\n################################ INITIAL SETTINGS OF PARAMETERS"), output = log, path = "./", overwrite = FALSE)
fun_report(data = param.ini.settings, output = log, path = "./", overwrite = FALSE, , vector.cat = TRUE)
fun_report(data = paste0("\n\n################################ R SYSTEM AND PACKAGES"), output = log, path = "./", overwrite = FALSE)
tempo <- sessionInfo()
tempo$otherPkgs <- tempo$otherPkgs[order(names(tempo$otherPkgs))] # sort the packages
tempo$loadedOnly <- tempo$loadedOnly[order(names(tempo$loadedOnly))] # sort the packages
fun_report(data = tempo, output = log, path = "./", overwrite = FALSE, , vector.cat = TRUE)
fun_report(data = paste0("\n\n################################ JOB END\n\nTIME: ", end.date, "\n\nTOTAL TIME LAPSE: ", total.lapse, "\n"), output = log, path = "./", overwrite = FALSE)


################ end Parameter printing


################################ End Main code