Commit a12b9b1b authored by Gael  MILLOT's avatar Gael MILLOT
Browse files

release v7.3.0: flow and files improved by Fred, because of the relative paths, no need of dev/

parent fb383cb6
......@@ -198,6 +198,11 @@ Gitlab developers
## WHAT'S NEW IN
### v7.3.0
1) flow and files improved by Fred, because of the relative paths, no need of dev/
### v7.2.0
1) better priority for slurm
......
#!usr/bin/env bash
#!/usr/bin/env bash
#########################################################################
## ##
......
#!usr/bin/env bash
#!/usr/bin/env bash
#########################################################################
## ##
......
#!usr/bin/env bash
#!/usr/bin/env bash
#########################################################################
## ##
......
#!usr/bin/env bash
#!/usr/bin/env bash
#########################################################################
## ##
......
#!usr/bin/env bash
#!/usr/bin/env bash
#########################################################################
## ##
......
#!usr/bin/env bash
#!/usr/bin/env bash
#########################################################################
## ##
......
/*
#########################################################################
## ##
## nextflow.config ##
## ##
## Gael A. Millot ##
## Bioinformatics and Biostatistics Hub ##
## Computational Biology Department ##
## Institut Pasteur Paris ##
## ##
#########################################################################
*/
//////// variables that will be used only in the main.nf
// variables exported to the main.nf environment. See https://www.nextflow.io/docs/latest/config.html#scope-env
env {
//// path and files
git_path="https://gitlab.pasteur.fr/gmillot/14985_loot/"
in_path="/mnt/c/Users/Gael/Documents/Git_projects/14985_loot/dataset"
//in_path="/mnt/share/14985_loot/dataset/B2699/00_Rawdata"
//in_path="/pasteur/zeus/projets/p01/BioIT/gmillot/14985_loot/dataset/B4985/3" // where initial fastq file is
//in_path="/pasteur/zeus/projets/p01/BioIT/gmillot/14985_loot/dataset/"
//in_path="/pasteur/zeus/projets/p01/BioIT/gmillot/14985_loot/dataset/B2699/00_Rawdata" // where initial fastq file is
fastq_file="test.fastq2.gz" // fastq file name
//fastq_file="4-4_S1_L001_R1_001.fastq.gz"
//fastq_file="3-4_S1_L001_R1_001.fastq.gz"
primer_fasta="/mnt/c/Users/Gael/Documents/Git_projects/14985_loot/dataset/20200520_adapters_TruSeq_B2699_14985_CL.fasta"
//primer_fasta="/pasteur/zeus/projets/p01/BioIT/gmillot/14985_loot/results/20200520_res_CL14985_newtrim_align/20200520_adapters_TruSeq_B2699_14985_CL.fasta" // list of primers used for the library and used by Alien trimmer to trim the raw reads
//primer_fasta="/mnt/share/14985_loot/results/20200520_res_CL14985_newtrim_align/20200520_adapters_TruSeq_B2699_14985_CL.fasta"
//// end path and files
//// alientrimmer
alientrimmer_l_param=30 // L parameter of alienTrimmer
//// end alientrimmer
//// fivep_filtering
attc_seq="CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCG" // sequence of attc, in red and purple in section 4 20200505 of the CL labbook (48 bases on the left of the cutting site). Required for plotting. Warning: never change this sequence
fivep_seq_filtering='^CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCG.+$' // regex indicating the 5' sequence of reads to select, then to trim from the selected reads. See the section 8.6 to 8.13 of the labbook 20200520, but instead of analysing and trimming in two steps (29 Nuc of AttC part of the primer then 19 Nuc between primer and Attc cutting site), perform all in a single step, and play with the regex, like Test also
// ^CAATTCATTCAAGCCGACGCCGCTTCGCG[GN][CN][GN][CN][GN][GN][CN][TN][TN][AN][AN][TN][TN][CN][AN][AN][GN][CN][GN].+$
// [CN][AN][AN][TN][TN][CN][AN][TN][TN][CN][AN][AN][GN][CN][CN][GN][AN][CN][GN][CN][CN][GN][CN][TN][TN][CN][GN][CN][GN][GN][CN][GN][CN][GN][GN][CN][TN][TN][AN][AN][TN][TN][CN][AN][AN][GN][CN][GN].+$
// ^CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCG.+$
// ^[CN][AN][AN][TN][TN][CN][AN][TN][TN][CN][AN][AN][GN][CN][CN][GN][AN][CN][GN][CN][CN][GN][CN][TN][TN][CN][GN][CN][GN]GCGCGGCTTAATTCAAGCG.+$
fivep_seq_nb=48 // must be the exact number of nuc positions indicated in fivep_seq_filtering
//// end fivep_filtering
cutoff_nb=25 // reads of length cutoff_nb after trimming are removed
ref_path="/mnt/c/Users/Gael/Documents/Git_projects/14985_loot/dataset/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/"
//ref_path="/pasteur/zeus/projets/p01/BioIT/gmillot/reference_genomes/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/" // path of the reference genome
ref_file="Ecoli-K12-MG1655_ORI_CENTERED.fasta" // fasta file of the reference genome
ori_coord="2320711 2320942" // [2320711, 2320942] // Ecoli centered coordinates
ter_coord="4627368 4627400" //[4627368, 4627400] // Ecoli centered coordinates
color_coverage="5" // three integers for the color of the three coverage plots[1, 2, 5]
xlab="Ecoli Genome (bp)" // name of the reference genome for graphics
genome_size="4641652" // in bp
cute_path="https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v10.9.0/cute_little_R_functions.R" // single character string indicating the file (and absolute pathway) of the required cute_little_R_functions toolbox. With ethernet connection available, this can also be used: "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/raw/v5.1.0/cute_little_R_functions.R" or local "C:\\Users\\Gael\\Documents\\Git_projects\\cute_little_R_functions\\cute_little_R_functions.R"
}
//////// end variables that will be used only in the main.nf
//////// variables that will be used below (and potentially in the main.nf file)
//// must be also exported
system_exec = 'local' // the system that runs the workflow. Either 'local' or 'slurm'
out_path="/mnt/c/Users/Gael/Desktop" // where the report file will be saved. Example report_path = '.' for where the main.nf run is executed or report_path = '/mnt/c/Users/Gael/Desktop'
//out_path="/pasteur/zeus/projets/p01/BioIT/gmillot/14985_loot/results" // where the report file will be saved. Example report_path = '.' for where the main.nf run is executed or report_path = '/mnt/c/Users/Gael/Desktop'
//// end must be also exported
//// general variables
result_folder_name="20220120_res_CL14985_test"
//// end general variables
//// slurm variables
fastqueue = 'common,dedicated' // fast for -p option of slurm. Example: fastqueue = 'common,dedicated'. Example: fastqueue = 'hubbioit'
fastqos= '--qos=fast' // fast for --qos option of slurm. Example: fastqos= '--qos=fast'
normalqueue = 'common,dedicated' // normal for -p option of slurm. Example: normalqueue = 'bioevo'
normalqos = '--qos=hubbioit' // normal for --qos option of slurm. Example: normalqos = '--qos=dedicated'
longqueue = 'common,dedicated' // slow for -p option of slurm. Example: longqueue = 'bioevo'
longqos = '--qos=hubbioit' // slow for --qos option of slurm. Example: longqos = '--qos=dedicated'
add_options = ' ' // additional option of slurm. Example: addoptions = '--exclude=maestro-1101,maestro-1034' or add_options = ' '
//// end slurm variables
//////// end variables that will be used below
//////// Pre processing
int secs = (new Date().getTime())/1000
out_path="${out_path}/${result_folder_name}_${secs}"
//////// end Pre processing
//////// variables used here and also in the main.nf file
env {
system_exec = "${system_exec}"
out_path = "${out_path}"
}
//////// variables used here and also in the main.nf file
//////// Scopes
// kind of execution. Either 'local' or 'slurm'
// those are closures. See https://www.nextflow.io/docs/latest/script.html#closures
executor {
name = "${system_exec}"
queueSize = 2000
}
// create a report folder and print a html report file . If no absolute path, will be where the run is executed
// see https://www.nextflow.io/docs/latest/config.html#config-report
report {
enabled = true
file = "${out_path}/reports/nf_report.html" // warning: here double quotes to get the nextflow variable interpretation
}
// txt file with all the processes and info
trace {
enabled = true
file = "${out_path}/reports/nf_trace.txt"
}
// html file with all the processes
timeline {
enabled = true
file = "${out_path}/reports/nf_timeline.html"
}
// .dot picture of the workflow. Only one file allowed
dag {
enabled = true
file = "${out_path}/reports/nf_dag.png" // Warning: require graphviz installed in the system, see protocol 136
}
// define singularity parameters
singularity {
enabled = true
autoMounts = true // automatically mounts host paths in the executed container
//runOptions = '--home $HOME:/home/$USER --bind /pasteur' // provide any extra command line options supported by the singularity exec. HEre, fait un bind de tout /pasteur dans /pasteur du container. Sinon pas d accès
cacheDir = 'singularity' // name of the directory where remote Singularity images are stored. When rerun, the exec directly uses these without redownloading them. When using a computing cluster it must be a shared folder accessible to all computing nodes
}
//////// end Scopes
//////// directives
// provide the default directives for all the processes in the main.nf pipeline calling this config file
process {
// directives for all the processes
// executor='local' // no need because already defined above in the executor scope
if(system_exec == 'slurm'){
queue = "$fastqueue"
clusterOptions = "$fastqos $add_options"
scratch=false
maxRetries=1
errorStrategy='retry'
}else{
maxRetries=0
errorStrategy='terminate'
}
// all the processes of the main.nf file with the label 'bedtools' will use this directives by default
withLabel: bash {
container='gmillot/bash-extended_v4.0:gitlab_v8.0'
cpus=1 // only used when name = "local" in the executor part above
memory='3G' // only used when name = "local" in the executor part above
}
withLabel: alien_trimmer {
container='gmillot/alien_trimmer_v0.4.0:gitlab_v8.1' // no most recent at 20210930
cpus=1 // only used when name = "local" in the executor part above
memory='3G' // only used when name = "local" in the executor part above
}
withLabel: fastqc {
container='evolbioinfo/fastqc:v0.11.8'
cpus=1 // only used when name = "local" in the executor part above
}
withLabel: r_ext {
container='gmillot/r_v4.0.5_extended_v2.0:gitlab_v6.4'
cpus=1 // only used when name = "local" in the executor part above
memory='64G' // only used when name = "local" in the executor part above
}
withLabel: bowtie2 {
container='gmillot/bowtie2_v2.3.4.3_extended_v2.0:gitlab_v8.0'
cpus=12 // only used when name = "local" in the executor part above
memory='64G' // only used when name = "local" in the executor part above
}
withLabel: samtools {
container='gmillot/samtools_v1.14:gitlab_v8.0'
cpus=1
memory='1G'
}
withLabel: bedtools {
container='gmillot/bedtools_v2.30.0:gitlab_v8.0'
cpus=12
memory='64G'
}
// all the processes of the main.nf file with the label 'bedtools' will use this directives by
withLabel: gatk {
//scratch=true
container='broadinstitute/gatk:4.1.9.0'
memory='60G'
if(system_exec == 'slurm'){
queue = {task.attempt>1 ? "$normalqueue" : "$fastqueue" }
clusterOptions = {task.attempt > 1 ? "$normalqos $add_options" : "$fastqos $add_options" }
}
}
withLabel: bwa {
container="evolbioinfo/bwa:v0.7.17"
cpus=20
memory='30G'
}
withLabel: bcftools {
container="evolbioinfo/bcftools:f27f849"
cpus=1
memory='10G'
}
withLabel: multiqc {
container='ewels/multiqc:1.10.1'
errorStrategy='ignore'
cpus=1
}
}
//////// end directives
\ No newline at end of file
/*
#########################################################################
## ##
## nextflow.config ##
## ##
## Gael A. Millot ##
## Bioinformatics and Biostatistics Hub ##
## Computational Biology Department ##
## Institut Pasteur Paris ##
## ##
#########################################################################
*/
//////// variables that will be used only in the main.nf
// variables exported to the main.nf environment. See https://www.nextflow.io/docs/latest/config.html#scope-env
env {
//// path and files
git_path="https://gitlab.pasteur.fr/gmillot/14985_loot/"
//in_path="/mnt/c/Users/Gael/Documents/Git_projects/14985_loot/dataset"
//in_path="/mnt/share/14985_loot/dataset/B2699/00_Rawdata"
//in_path="/pasteur/zeus/projets/p01/BioIT/gmillot/14985_loot/dataset/B4985/3" // where initial fastq file is
in_path="$baseDir/dataset/"
//in_path="/pasteur/zeus/projets/p01/BioIT/gmillot/14985_loot/dataset/B2699/00_Rawdata" // where initial fastq file is
fastq_file="test.fastq2.gz" // fastq file name
//fastq_file="4-4_S1_L001_R1_001.fastq.gz"
//fastq_file="3-4_S1_L001_R1_001.fastq.gz"
//primer_fasta="/mnt/c/Users/Gael/Documents/Git_projects/14985_loot/dataset/20200520_adapters_TruSeq_B2699_14985_CL.fasta"
primer_fasta="$baseDir/dataset/20200520_adapters_TruSeq_B2699_14985_CL.fasta" // list of primers used for the library and used by Alien trimmer to trim the raw reads
//primer_fasta="/mnt/share/14985_loot/results/20200520_res_CL14985_newtrim_align/20200520_adapters_TruSeq_B2699_14985_CL.fasta"
//// end path and files
//// alientrimmer
alientrimmer_l_param=30 // L parameter of alienTrimmer
//// end alientrimmer
//// fivep_filtering
attc_seq="CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCG" // sequence of attc, in red and purple in section 4 20200505 of the CL labbook (48 bases on the left of the cutting site). Required for plotting. Warning: never change this sequence
fivep_seq_filtering='^CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCG.+$' // regex indicating the 5' sequence of reads to select, then to trim from the selected reads. See the section 8.6 to 8.13 of the labbook 20200520, but instead of analysing and trimming in two steps (29 Nuc of AttC part of the primer then 19 Nuc between primer and Attc cutting site), perform all in a single step, and play with the regex, like Test also
// ^CAATTCATTCAAGCCGACGCCGCTTCGCG[GN][CN][GN][CN][GN][GN][CN][TN][TN][AN][AN][TN][TN][CN][AN][AN][GN][CN][GN].+$
// [CN][AN][AN][TN][TN][CN][AN][TN][TN][CN][AN][AN][GN][CN][CN][GN][AN][CN][GN][CN][CN][GN][CN][TN][TN][CN][GN][CN][GN][GN][CN][GN][CN][GN][GN][CN][TN][TN][AN][AN][TN][TN][CN][AN][AN][GN][CN][GN].+$
// ^CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCG.+$
// ^[CN][AN][AN][TN][TN][CN][AN][TN][TN][CN][AN][AN][GN][CN][CN][GN][AN][CN][GN][CN][CN][GN][CN][TN][TN][CN][GN][CN][GN]GCGCGGCTTAATTCAAGCG.+$
fivep_seq_nb=48 // must be the exact number of nuc positions indicated in fivep_seq_filtering
//// end fivep_filtering
cutoff_nb=25 // reads of length cutoff_nb after trimming are removed
//ref_path="/mnt/c/Users/Gael/Documents/Git_projects/14985_loot/dataset/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/"
ref_path="$baseDir/dataset/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/" // path of the reference genome
ref_file="Ecoli-K12-MG1655_ORI_CENTERED.fasta" // fasta file of the reference genome
ori_coord="2320711 2320942" // [2320711, 2320942] // Ecoli centered coordinates
ter_coord="4627368 4627400" //[4627368, 4627400] // Ecoli centered coordinates
color_coverage="5" // three integers for the color of the three coverage plots[1, 2, 5]
xlab="Ecoli Genome (bp)" // name of the reference genome for graphics
genome_size="4641652" // in bp
cute_path="https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v10.9.0/cute_little_R_functions.R" // single character string indicating the file (and absolute pathway) of the required cute_little_R_functions toolbox. With ethernet connection available, this can also be used: "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/raw/v5.1.0/cute_little_R_functions.R" or local "C:\\Users\\Gael\\Documents\\Git_projects\\cute_little_R_functions\\cute_little_R_functions.R"
}
//////// end variables that will be used only in the main.nf
//////// variables that will be used below (and potentially in the main.nf file)
//// must be also exported
system_exec = 'slurm' // the system that runs the workflow. Either 'local' or 'slurm'
//out_path="/mnt/c/Users/Gael/Desktop" // where the report file will be saved. Example report_path = '.' for where the main.nf run is executed or report_path = '/mnt/c/Users/Gael/Desktop'
out_path="$baseDir/results/" // where the report file will be saved. Example report_path = '.' for where the main.nf run is executed or report_path = '/mnt/c/Users/Gael/Desktop'
//// end must be also exported
//// general variables
result_folder_name="20220120_res_CL14985_test"
//// end general variables
//// slurm variables
fastqueue = 'common,dedicated' // fast for -p option of slurm. Example: fastqueue = 'common,dedicated'. Example: fastqueue = 'hubbioit'
fastqos= '--qos=fast' // fast for --qos option of slurm. Example: fastqos= '--qos=fast'
normalqueue = 'common,dedicated' // normal for -p option of slurm. Example: normalqueue = 'bioevo'
normalqos = '--qos=hubbioit' // normal for --qos option of slurm. Example: normalqos = '--qos=dedicated'
longqueue = 'common,dedicated' // slow for -p option of slurm. Example: longqueue = 'bioevo'
longqos = '--qos=hubbioit' // slow for --qos option of slurm. Example: longqos = '--qos=dedicated'
add_options = ' ' // additional option of slurm. Example: addoptions = '--exclude=maestro-1101,maestro-1034' or add_options = ' '
//// end slurm variables
//////// end variables that will be used below
//////// Pre processing
int secs = (new Date().getTime())/1000
out_path="${out_path}/${result_folder_name}_${secs}"
//////// end Pre processing
//////// variables used here and also in the main.nf file
env {
system_exec = "${system_exec}"
out_path = "${out_path}"
}
//////// variables used here and also in the main.nf file
//////// Scopes
// kind of execution. Either 'local' or 'slurm'
// those are closures. See https://www.nextflow.io/docs/latest/script.html#closures
executor {
name = "${system_exec}"
queueSize = 2000
}
// create a report folder and print a html report file . If no absolute path, will be where the run is executed
// see https://www.nextflow.io/docs/latest/config.html#config-report
report {
enabled = true
file = "${out_path}/reports/nf_report.html" // warning: here double quotes to get the nextflow variable interpretation
}
// txt file with all the processes and info
trace {
enabled = true
file = "${out_path}/reports/nf_trace.txt"
}
// html file with all the processes
timeline {
enabled = true
file = "${out_path}/reports/nf_timeline.html"
}
// .dot picture of the workflow. Only one file allowed
dag {
enabled = true
file = "${out_path}/reports/nf_dag.png" // Warning: require graphviz installed in the system, see protocol 136
}
// define singularity parameters
singularity {
enabled = true
autoMounts = true // automatically mounts host paths in the executed container
//runOptions = '--home $HOME:/home/$USER --bind /pasteur' // provide any extra command line options supported by the singularity exec. HEre, fait un bind de tout /pasteur dans /pasteur du container. Sinon pas d accès
cacheDir = 'singularity' // name of the directory where remote Singularity images are stored. When rerun, the exec directly uses these without redownloading them. When using a computing cluster it must be a shared folder accessible to all computing nodes
}
//////// end Scopes
//////// directives
// provide the default directives for all the processes in the main.nf pipeline calling this config file
process {
// directives for all the processes
// executor='local' // no need because already defined above in the executor scope
if(system_exec == 'slurm'){
queue = "$fastqueue"
clusterOptions = "$fastqos $add_options"
scratch=false
maxRetries=1
errorStrategy='retry'
}else{
maxRetries=0
errorStrategy='terminate'
}
// all the processes of the main.nf file with the label 'bedtools' will use this directives by default
withLabel: bash {
container='gmillot/bash-extended_v4.0:gitlab_v8.0'
cpus=1 // only used when name = "local" in the executor part above
memory='3G' // only used when name = "local" in the executor part above
}
withLabel: alien_trimmer {
container='gmillot/alien_trimmer_v0.4.0:gitlab_v8.1' // no most recent at 20210930
cpus=1 // only used when name = "local" in the executor part above
memory='3G' // only used when name = "local" in the executor part above
}
withLabel: fastqc {
container='evolbioinfo/fastqc:v0.11.8'
cpus=1 // only used when name = "local" in the executor part above
}
withLabel: r_ext {
container='gmillot/r_v4.0.5_extended_v2.0:gitlab_v6.4'
cpus=1 // only used when name = "local" in the executor part above
memory='64G' // only used when name = "local" in the executor part above
}
withLabel: bowtie2 {
container='gmillot/bowtie2_v2.3.4.3_extended_v2.0:gitlab_v8.0'
cpus=12 // only used when name = "local" in the executor part above
memory='64G' // only used when name = "local" in the executor part above
}
withLabel: samtools {
container='gmillot/samtools_v1.14:gitlab_v8.0'
cpus=1
memory='1G'
}
withLabel: bedtools {
container='gmillot/bedtools_v2.30.0:gitlab_v8.0'
cpus=12
memory='64G'
}
// all the processes of the main.nf file with the label 'bedtools' will use this directives by
withLabel: gatk {
//scratch=true
container='broadinstitute/gatk:4.1.9.0'
memory='60G'
if(system_exec == 'slurm'){
queue = {task.attempt>1 ? "$normalqueue" : "$fastqueue" }
clusterOptions = {task.attempt > 1 ? "$normalqos $add_options" : "$fastqos $add_options" }
}
}
withLabel: bwa {
container="evolbioinfo/bwa:v0.7.17"
cpus=20
memory='30G'
}
withLabel: bcftools {
container="evolbioinfo/bcftools:f27f849"
cpus=1
memory='10G'
}
withLabel: multiqc {
container='ewels/multiqc:1.10.1'
errorStrategy='ignore'
cpus=1
}
}
//////// end directives
\ No newline at end of file
......@@ -20,15 +20,15 @@
env {
//// path and files
git_path="https://gitlab.pasteur.fr/gmillot/14985_loot/"
//in_path="/mnt/c/Users/Gael/Documents/Git_projects/14985_loot/dataset"
//in_path="/mnt/share/14985_loot/dataset/B2699/00_Rawdata"
in_path="/pasteur/zeus/projets/p01/BioIT/gmillot/14985_loot/dataset/B4985/4" // where initial fastq file is
//in_path="/pasteur/zeus/projets/p01/BioIT/gmillot/14985_loot/dataset/B2699/00_Rawdata" // where initial fastq file is
in_path="$baseDir/dataset"
//in_path="$baseDir/dataset/B4985/4" // where initial fastq file is
//in_path="$baseDir/dataset/B2699/00_Rawdata" // where initial fastq file is
//fastq_file="test.fastq.gz" // fastq file name
// fastq_file="Pool-B2699_S1_L001_R1_001.fastq.gz"
fastq_file="4-4_S1_L001_R1_001.fastq.gz"
//primer_fasta="/mnt/c/Users/Gael/Documents/Git_projects/14985_loot/dataset/20200520_adapters_TruSeq_B2699_14985_CL.fasta"
primer_fasta="/pasteur/zeus/projets/p01/BioIT/gmillot/14985_loot/results/20200520_res_CL14985_newtrim_align/20200520_adapters_TruSeq_B2699_14985_CL.fasta" // list of primers used for the library and used by Alien trimmer to trim the raw reads
fastq_file="test.fastq2.gz"
//fastq_file="4-4_S1_L001_R1_001.fastq.gz"
//primer_fasta="$baseDir/dataset/20200520_adapters_TruSeq_B2699_14985_CL.fasta"
primer_fasta="$baseDir/dataset/20200520_adapters_TruSeq_B2699_14985_CL.fasta" // list of primers used for the library and used by Alien trimmer to trim the raw reads
//primer_fasta="/mnt/share/14985_loot/results/20200520_res_CL14985_newtrim_align/20200520_adapters_TruSeq_B2699_14985_CL.fasta"
//// end path and files
......@@ -47,7 +47,8 @@ env {
added_nb=3 // number of nucleotids taken after fivep_seq_nb for graphic display, to see that the frequency of each base tends toward 0.25 after fivep_seq_nb on the graph
//// end fivep_filtering
cutoff_nb=25 // reads of length cutoff_nb after trimming are removed
ref_path="/pasteur/zeus/projets/p01/BioIT/gmillot/reference_genomes/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/" // path of the reference genome
ref_path="$baseDir/dataset/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/" // path of the reference genome
//ref_path="/pasteur/zeus/projets/p01/BioIT/gmillot/reference_genomes/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/" // path of the reference genome
ref_file="Ecoli-K12-MG1655_ORI_CENTERED.fasta" // name of the the reference genome fasta file
ori_coord="2320711 2320942" // [2320711, 2320942] // Ecoli centered coordinates
ter_coord="4627368 4627400" //[4627368, 4627400] // Ecoli centered coordinates
......@@ -65,10 +66,10 @@ env {
//////// variables that will be used below (and potentially in the main.nf file)
//// must be also exported
system_exec = 'slurm' // the system that runs the workflow. Either 'local' or 'slurm'
system_exec = 'local' // the system that runs the workflow. Either 'local' or 'slurm'
//docker_exe = true // true for docker and false for singularity
//out_path="/mnt/c/Users/Gael/Desktop" // where the report file will be saved. Example report_path = '.' for where the main.nf run is executed or report_path = '/mnt/c/Users/Gael/Desktop'