diff --git a/README.md b/README.md
index 808d4500871c86dc24cc43ec04d6dd8ad6ce9312..9f7a37935855e6b6c6a93a6350e267f23294a077 100755
--- a/README.md
+++ b/README.md
@@ -146,7 +146,7 @@ Then run:
```bash
# distant main.nf file
-HOME="$ZEUSHOME/14985_loot/" ; nextflow run --modules ${MODULES} -hub pasteur gmillot/14985_loot -r v7.9.0 -c $HOME/nextflow.config ; HOME="/pasteur/appa/homes/gmillot/"
+HOME="$ZEUSHOME/14985_loot/" ; nextflow run --modules ${MODULES} -hub pasteur gmillot/14985_loot -r v7.10.0 -c $HOME/nextflow.config ; HOME="/pasteur/appa/homes/gmillot/"
# local main.nf file ($HOME changed to allow the creation of .nextflow into /$ZEUSHOME/14985_loot/. See NFX_HOME in the nextflow soft script)
HOME="$ZEUSHOME/14985_loot/" ; nextflow run --modules ${MODULES} main.nf ; HOME="/pasteur/appa/homes/gmillot/"
diff --git a/bin/dup_insertion_and_logo.R b/bin/dup_insertion_and_logo.R
new file mode 100644
index 0000000000000000000000000000000000000000..8c13262d9e7730aca822d5658799277312362148
--- /dev/null
+++ b/bin/dup_insertion_and_logo.R
@@ -0,0 +1,516 @@
+#!/usr/bin/env Rscript
+
+#########################################################################
+## ##
+## dup_insertion_and_logo.R ##
+## ##
+## Gael A. Millot ##
+## Bioinformatics and Biostatistics Hub ##
+## Computational Biology Department ##
+## Institut Pasteur Paris ##
+## ##
+#########################################################################
+
+
+
+
+################################ Aim
+
+
+################################ End Aim
+
+
+################################ Introduction
+
+
+################################ End Introduction
+
+
+################################ Acknowlegments
+
+
+################################ End Acknowlegments
+
+
+################################ Initialization
+
+
+# R version checking
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+ stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
+}
+# other initializations
+erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
+if(erase.objects == TRUE){
+ rm(list = ls(all.names = TRUE))
+ erase.objects = TRUE
+}
+erase.graphs = TRUE # write TRUE to erase all the graphic windows in R before starting the algorithm and FALSE otherwise
+script <- "dup_insertion_and_logo"
+
+
+################################ End Initialization
+
+
+################################ Parameters that need to be set by the user
+
+
+################################ End Parameters that need to be set by the user
+
+
+################################ Config import
+
+
+tempo.cat <- "KIND OF RUN (SCRIPT, COPY-PASTE OR SOURCE): "
+if(interactive() == FALSE){ # if(grepl(x = commandArgs(trailingOnly = FALSE), pattern = "R\\.exe$|\\/R$|Rcmd\\.exe$|Rcmd$|Rgui\\.exe$|Rgui$|Rscript\\.exe$|Rscript$|Rterm\\.exe$|Rterm$")){ # detection of script usage
+ run.way <- "SCRIPT"
+ cat(paste0("\n\n", tempo.cat, run.way, "\n"))
+ command <- paste0(commandArgs(trailingOnly = FALSE), collapse = ",") # recover the full command
+ args <- commandArgs(trailingOnly = TRUE) # recover arguments written after the call of the R script
+ if(any(is.na(args))){
+ stop(paste0("\n\n================\n\nERROR IN dup_insertion_and_logo.R\nTHE args OBJECT HAS NA\n\n================\n\n"), call. = FALSE)
+ }
+ tempo.arg.names <- c(
+ "freq",
+ "ori_coord",
+ "ter_coord",
+ "genome_size",
+ "xlab",
+ "file_name",
+ "kind",
+ "nb_max_insertion_sites",
+ "insertion_dist",
+ "cute",
+ "log"
+ ) # objects names exactly in the same order as in the bash code and recovered in args. Here only one, because only the path of the config file to indicate after the dup_insertion_and_logo.R script execution
+ if(length(args) != length(tempo.arg.names)){
+ stop(paste0("\n\n================\n\nERROR IN dup_insertion_and_logo.R\nTHE NUMBER OF ELEMENTS IN args (", length(args),") IS DIFFERENT FROM THE NUMBER OF ELEMENTS IN tempo.arg.names (", length(tempo.arg.names),")\nargs:", paste0(args, collapse = ","), "\ntempo.arg.names:", paste0(tempo.arg.names, collapse = ","), "\n\n================\n\n"), call. = FALSE)
+ }
+ for(i1 in 1:length(tempo.arg.names)){
+ assign(tempo.arg.names[i1], args[i1])
+ }
+ rm(tempo.arg.names, args, i1)
+}else if(sys.nframe() == 0L){ # detection of copy-paste/direct execution (for debugging). With script it is also 0, with source, it is 4
+ run.way <- "COPY-PASTE"
+ cat(paste0("\n\n", tempo.cat, run.way, "\n"))
+}else{
+ run.way <- "SOURCE" # using source(), sys.nframe() is 4
+ cat(paste0("\n\n", tempo.cat, run.way, "\n"))
+}
+rm(tempo.cat)
+
+
+################################ End Config import
+
+################################ Test
+
+# cat("\n\n!!!!!!!!!!!!!!!!!!! WARNING: test values are activated\n\n")
+# pos <- "C:\\Users\\gael\\Documents\\Git_projects\\14985_loot\\dataset\\obs_rd_insertions.pos"
+# freq <- "C:\\Users\\gael\\Documents\\Git_projects\\14985_loot\\dataset\\obs_rd_insertions.freq"
+# ori_coord <- "2320711 2320942"
+# ter_coord <- "4627368 4627400"
+# xlab <- "Ecoli Genome (bp)"
+# genome_size <- "4641652"
+# file_name <- "caca"
+# kind <- "dup"
+# nb_max_insertion_sites <- "6"
+# insertion_dist <- "20"
+# cute <- "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v11.2.0/cute_little_R_functions.R"
+# log <- "report.txt"
+
+
+################################ end Test
+
+################################ Recording of the initial parameters
+
+
+param.list <- c(
+ "erase.objects",
+ "erase.graphs",
+ "script",
+ "run.way",
+ if(run.way == "SCRIPT"){"command"},
+ "freq",
+ "ori_coord",
+ "ter_coord",
+ "genome_size",
+ "xlab",
+ "file_name",
+ "kind",
+ "nb_max_insertion_sites",
+ "insertion_dist",
+ "cute",
+ "log"
+)
+if(any(duplicated(param.list))){
+ stop(paste0("\n\n================\n\nINTERNAL CODE ERROR 1 IN dup_insertion_and_logo.R\nTHE param.list OBJECT CONTAINS DUPLICATED ELEMENTS:\n", paste(param.list[duplicated(param.list)], collapse = " "), "\n\n================\n\n"), call. = FALSE) # message for developers
+}
+if(erase.objects == TRUE){
+ created.object.control <- ls()[ ! ls() %in% "param.list"]
+ if( ! (all(created.object.control %in% param.list) & all(param.list %in% created.object.control))){
+ stop(paste0("\n\n================\n\nINTERNAL CODE ERROR 2 IN dup_insertion_and_logo.R\nINCONSISTENCIES BETWEEN THE ARGUMENTS USED AND THE PARAMETERS REQUIRED IN THE EXECUTABLE CODE FILE\nTHE ARGUMENTS NOT PRESENT IN THE EXECUTABLE FILE (dup_insertion_and_logo.R) ARE:\n", paste(created.object.control[ ! created.object.control %in% param.list], collapse = " "), "\nTHE PARAMETERS OF THE EXECUTABLE FILE (dup_insertion_and_logo.R) NOT PRESENT IN THE ARGUMENTS ARE:\n", paste(param.list[ ! param.list %in% created.object.control], collapse = " "), "\n\n================\n\n"), call. = FALSE) # message for developers
+ }
+}
+char.length <- nchar(param.list)
+space.add <- max(char.length) - char.length + 5
+param.ini.settings <- character(length = length(param.list))
+for(i in 1:length(param.list)){
+ param.ini.settings[i] <- paste0("\n", param.list[i], paste0(rep(" ", space.add[i]), collapse = ""), paste0(get(param.list[i]), collapse = ",")) # no env = sys.nframe(), inherit = FALSE in get() because look for function in the classical scope
+}
+
+
+################################ End Recording of the initial parameters
+
+
+################################ Functions
+
+
+# Functions are built such that they should have no direct use of Global objects (going through the R scope), and only use function arguments
+# 1) Cute little function is sourced for the moment into the .GlobalEnv environment, but may be interesting to put it into a new environement just above .GlobalEnv environment. See https://stackoverflow.com/questions/9002544/how-to-add-functions-in-an-existing-environment
+# 2) Argument names of each function must not be a name of Global objects (error message otherwise)
+# 3) Argument name of each function ends with "_fun" in the first function, "_2fun" in the second, etc. This prevent conflicts with the argument partial names when using these functions, notably when they are imbricated
+
+
+################ import functions from cute little functions toolbox
+
+
+if(length(cute) != 1){
+ stop(paste0("\n\n============\n\nERROR IN dup_insertion_and_logo.R\ncute PARAMETER MUST BE LENGTH 1: ", paste(cute, collapse = " "), "\n\n============\n\n"), call. = FALSE)
+}else if(grepl(x = cute, pattern = "^http")){
+ tempo.try <- try(suppressWarnings(suppressMessages(source(cute, local = .GlobalEnv))), silent = TRUE)
+ if(any(grepl(x = tempo.try, pattern = "^[Ee]rror"))){
+ stop(paste0("\n\n============\n\nERROR IN dup_insertion_and_logo.R\nHTTP INDICATED IN THE cute PARAMETER DOES NOT EXISTS: ", cute, "\n\n============\n\n"), call. = FALSE)
+ }else{
+ source(cute, local = .GlobalEnv) # source the fun_ functions used below
+ }
+}else if( ! grepl(x = cute, pattern = "^http")){
+ if( ! file.exists(cute)){
+ stop(paste0("\n\n============\n\nERROR IN dup_insertion_and_logo.R\nFILE INDICATED IN THE cute PARAMETER DOES NOT EXISTS: ", cute, "\n\n============\n\n"), call. = FALSE)
+ }else{
+ source(cute, local = .GlobalEnv) # source the fun_ functions used below
+ }
+}else{
+ tempo.cat <- paste0("\n\n================\n\nINTERNAL CODE ERROR 3 IN dup_insertion_and_logo.R: CODE HAS TO BE MODIFIED\n\n============\n\n")
+ stop(tempo.cat, call. = FALSE)
+}
+
+
+# required cute function checking
+req.function <- c(
+ "fun_check",
+ "fun_pack",
+ "fun_df_remod",
+ "fun_gg_scatter",
+ "fun_gg_palette",
+ "fun_open",
+ "fun_gg_empty_graph",
+ "fun_report"
+)
+tempo <- NULL
+for(i1 in req.function){
+ if(length(find(i1, mode = "function")) == 0L){
+ tempo <- c(tempo, i1)
+ }
+}
+if( ! is.null(tempo)){
+ tempo.cat <- paste0("ERROR IN dup_insertion_and_logo.R\nREQUIRED cute FUNCTION", ifelse(length(tempo) > 1, "S ARE", " IS"), " MISSING IN THE R ENVIRONMENT:\n", paste0(tempo, collapse = "()\n"))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
+}
+# end required function checking
+
+
+################ local function: package import
+
+
+# R Packages required
+req.package.list <- c(
+ "lubridate",
+ "ggplot2",
+ "ggseqlogo"
+)
+for(i in 1:length(req.package.list)){suppressMessages(library(req.package.list[i], character.only = TRUE))}
+# fun_pack(req.package = req.package.list, load = TRUE, lib.path = NULL) # packages are imported even if inside functions are written as package.name::function() in the present code
+
+
+################################ End Functions
+
+
+################################ Pre-ignition checking
+
+
+# reserved words
+# end reserved words
+# argument primary checking
+arg.check <- NULL #
+text.check <- NULL #
+checked.arg.names <- NULL # for function debbuging: used by r_debugging_tools
+ee <- expression(arg.check <- c(arg.check, tempo$problem) , text.check <- c(text.check, tempo$text) , checked.arg.names <- c(checked.arg.names, tempo$object.name))
+tempo <- fun_check(data = freq, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = ori_coord, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = ter_coord, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = genome_size, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = xlab, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = file_name, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = kind, options = c("dup", "nodup"), length = 1) ; eval(ee)
+tempo <- fun_check(data = nb_max_insertion_sites, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = insertion_dist, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = cute, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = log, class = "vector", typeof = "character", length = 1) ; eval(ee)
+if(any(arg.check) == TRUE){ # normally no NA
+ stop(paste0("\n\n================\n\n", paste(text.check[arg.check], collapse = "\n"), "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between == #
+}
+# end argument primary checking
+# second round of checking and data preparation
+# management of NA arguments
+# end management of NA arguments
+# management of NULL arguments
+tempo.arg <-c(
+ "freq",
+ "ori_coord",
+ "ter_coord",
+ "genome_size",
+ "xlab",
+ "file_name",
+ "kind",
+ "nb_max_insertion_sites",
+ "insertion_dist",
+ "cute",
+ "log"
+)
+tempo.log <- sapply(lapply(tempo.arg, FUN = get, env = sys.nframe(), inherit = FALSE), FUN = is.null)
+if(any(tempo.log) == TRUE){# normally no NA with is.null()
+ tempo.cat <- paste0("ERROR IN dup_insertion_and_logo.R:\n", ifelse(sum(tempo.log, na.rm = TRUE) > 1, "THESE ARGUMENTS\n", "THIS ARGUMENT\n"), paste0(tempo.arg[tempo.log], collapse = "\n"),"\nCANNOT BE NULL")
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
+}
+# end management of NULL arguments
+# code that protects set.seed() in the global environment
+# end code that protects set.seed() in the global environment
+# warning initiation
+ini.warning.length <- options()$warning.length
+options(warning.length = 8170)
+warn <- NULL
+# warn.count <- 0 # not required
+# end warning initiation
+# other checkings
+ori_coord <- strsplit(ori_coord, split = " ")[[1]]
+if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){# normally no NA with is.null()
+ tempo.cat <- paste0("ERROR IN dup_insertion_and_logo.R:\nTHE ori_coord PARAMETER MUST BE TWO INTEGERS SEPARATED BY A SINGLE SPACE\nHERE IT IS: \n", paste0(ori_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
+}else{
+ ori_coord <- as.integer(ori_coord)
+ if(any(is.na(ori_coord))){
+ tempo.cat <- paste0("ERROR IN dup_insertion_and_logo.R:\nTHE CONVERSION OF THE ori_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ori_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
+}
+ter_coord <- strsplit(ter_coord, split = " ")[[1]]
+if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally no NA with is.null()
+ tempo.cat <- paste0("ERROR IN dup_insertion_and_logo.R:\nTHE ter_coord PARAMETER MUST BE TWO INTEGERS SEPARATED BY A SINGLE SPACE\nHERE IT IS: \n", paste0(ter_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
+}else{
+ ter_coord <- as.integer(ter_coord)
+ if(any(is.na(ter_coord))){
+ tempo.cat <- paste0("ERROR IN dup_insertion_and_logo.R:\nTHE CONVERSION OF THE ter_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ter_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
+}
+if(length(genome_size) != 1 & any(grepl(genome_size, pattern = "\\D"))){# normally no NA with is.null()
+ tempo.cat <- paste0("ERROR IN dup_insertion_and_logo.R:\nTHE genome_size PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(genome_size, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
+}else{
+ genome_size <- as.integer(genome_size)
+ if(any(is.na(genome_size))){
+ tempo.cat <- paste0("ERROR IN dup_insertion_and_logo.R:\nTHE CONVERSION OF THE genome_size PARAMETER INTO INTEGER RETURNS NA: \n", paste0(genome_size, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
+}
+if(length(insertion_dist) != 1 & any(grepl(insertion_dist, pattern = "\\D"))){# normally no NA with is.null()
+ tempo.cat <- paste0("ERROR IN dup_insertion_and_logo.R:\nTHE insertion_dist PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(insertion_dist, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
+}else{
+ insertion_dist <- as.integer(insertion_dist)
+ if(any(is.na(insertion_dist))){
+ tempo.cat <- paste0("ERROR IN dup_insertion_and_logo.R:\nTHE CONVERSION OF THE insertion_dist PARAMETER INTO INTEGER RETURNS NA: \n", paste0(insertion_dist, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
+}
+# end other checkings
+# reserved word checking
+# end reserved word checking
+# end second round of checking and data preparation
+# package checking
+# end package checking
+
+
+################################ End pre-ignition checking
+
+
+################################ Main code
+
+
+################ Ignition
+
+
+fun_report(data = paste0("\n\n################################################################ dup_insertion_and_logo PROCESS\n\n"), output = log, path = "./", overwrite = FALSE)
+ini.date <- Sys.time()
+ini.time <- as.numeric(ini.date) # time of process begin, converted into seconds
+fun_report(data = paste0("\n\n################################ RUNNING DATE AND STARTING TIME\n\n"), output = log, path = "./", overwrite = FALSE)
+fun_report(data = paste0(ini.date, "\n\n"), output = log, path = "./", overwrite = FALSE)
+fun_report(data = paste0("\n\n################################ RUNNING\n\n"), output = log, path = "./", overwrite = FALSE)
+
+
+################ End ignition
+
+
+################ Graphical parameter initialization
+
+
+pdf(file = NULL)
+par.ini <- par(no.readonly = TRUE) # to recover the initial graphical parameters if required (reset)
+invisible(dev.off()) # close the new window
+zone.ini <- matrix(1, ncol=1)
+if(erase.graphs == TRUE){
+ graphics.off()
+}else{
+ tempo.warn <- paste0("GRAPHICS HAVE NOT BEEN ERASED. GRAPHICAL PARAMETERS MAY HAVE NOT BEEN REINITIALIZED")
+ fun_report(data = paste0("WARNING\n", tempo.warn), output = log, path = "./", overwrite = FALSE)
+ warn <- paste0(ifelse(is.null(warn), tempo.warn, paste0(warn, "\n\n", tempo.warn)))
+}
+
+
+################ End graphical parameter initialization
+
+
+################ Data import
+
+
+freq <- read.table(freq, header = TRUE, stringsAsFactors = FALSE)
+
+################ end Data import
+
+
+############ modifications of imported tables
+
+
+tempo <- max(freq$freq) + 20
+ori.freq <- data.frame(x= c(ori_coord[1], ori_coord[1], ori_coord[2], ori_coord[2], ori_coord[1]), y = c(-tempo, tempo, tempo, -tempo ,-tempo), ZONE = "Ori", stringsAsFactors = TRUE)
+dif.freq <- data.frame(x= c(ter_coord[1], ter_coord[1], ter_coord[2], ter_coord[2], ter_coord[1]), y = c(-tempo, tempo, tempo, -tempo ,-tempo), ZONE = "Ter", stringsAsFactors = TRUE)
+structure.freq <- rbind(ori.freq, dif.freq, stringsAsFactors = TRUE)
+
+
+############ end modifications of imported tables
+
+
+############ plotting
+
+text.size <- 20
+title.text.size <- 15
+
+# insertion freq / genome raw distribution on both sides
+
+png(filename = paste0("plot_", file_name, "_insertion_", kind, "_raw.png"), width = 5000, height = 1800, units = "px", res = 300)
+if(ncol(freq) > 0){
+ tempo <- freq
+ tempo$freq[tempo$orient == "Reverse"] <- tempo$freq[tempo$orient == "Reverse"] * -1
+ fun_gg_scatter(
+ data1 = list(structure.freq, tempo), # res # res[res$KIND == "obs", ]
+ x = list("x", "Position"),
+ y = list("y", "freq"),
+ categ = list("ZONE", NULL),
+ geom = list("geom_step", "geom_stick"),
+ geom.stick.base = 0,
+ color = list(c("blue", "brown"), fun_gg_palette(n = 2)[1]), # fun_gg_palette(n = 2) # fun_gg_palette(n = 2)[1]
+ legend.width = NULL,
+ title = "RAW",
+ x.lim = c(0, genome_size),
+ x.lab = xlab,
+ x.left.extra.margin = 0,
+ x.right.extra.margin = 0,
+ x.second.tick.nb = 4,
+ y.lab = "Insertion frequency\n<- reverse forward ->",
+ y.second.tick.nb = 4,
+ text.size = text.size,
+ title.text.size = title.text.size
+ )
+}else{
+ fun_gg_empty_graph(text = "EMPTY .freq FILE: NO PLOT DRAWN")
+}
+
+
+
+
+############ end plotting
+
+
+################ Pdf window closing
+
+
+graphics.off()
+
+
+################ end Pdf window closing
+
+
+################ Seeding inactivation
+
+
+set.seed(NULL)
+
+
+################ end Seeding inactivation
+
+
+################ Environment saving
+
+
+save(list = ls(), file = "all_objects.RData")
+fun_report(data = paste0("\n\n################################ RUNNING END"), output = log, path = "./", overwrite = FALSE)
+end.date <- Sys.time()
+end.time <- as.numeric(end.date)
+total.lapse <- round(lubridate::seconds_to_period(end.time - ini.time))
+fun_report(data = paste0("\n\nEND TIME: ", end.date), output = log, path = "./", overwrite = FALSE)
+fun_report(data = paste0("\n\nTOTAL TIME LAPSE: ", total.lapse), output = log, path = "./", overwrite = FALSE)
+fun_report(data = paste0("\n\nALL DATA SAVED IN all_objects.RData"), output = log, path = "./", overwrite = FALSE)
+
+
+################ end Environment saving
+
+
+################ Warning messages
+
+
+fun_report(data = paste0("\n\n################################ RECAPITULATION OF WARNING MESSAGES"), output = log, path = "./", overwrite = FALSE)
+if( ! is.null(warn)){
+ fun_report(data = paste0("\n\n", warn), output = log, path = "./", overwrite = FALSE)
+}else{
+ fun_report(data = paste0("\n\nNO WARNING MESSAGE TO REPORT"), output = log, path = "./", overwrite = FALSE)
+}
+
+
+################ end Warning messages
+
+
+################ Parameter printing
+
+
+fun_report(data = paste0("\n\n################################ INITIAL SETTINGS OF PARAMETERS"), output = log, path = "./", overwrite = FALSE)
+fun_report(data = param.ini.settings, output = log, path = "./", overwrite = FALSE, , vector.cat = TRUE)
+fun_report(data = paste0("\n\n################################ R SYSTEM AND PACKAGES"), output = log, path = "./", overwrite = FALSE)
+tempo <- sessionInfo()
+tempo$otherPkgs <- tempo$otherPkgs[order(names(tempo$otherPkgs))] # sort the packages
+tempo$loadedOnly <- tempo$loadedOnly[order(names(tempo$loadedOnly))] # sort the packages
+fun_report(data = tempo, output = log, path = "./", overwrite = FALSE, , vector.cat = TRUE)
+fun_report(data = paste0("\n\n################################ JOB END\n\nTIME: ", end.date, "\n\nTOTAL TIME LAPSE: ", total.lapse, "\n"), output = log, path = "./", overwrite = FALSE)
+
+
+################ end Parameter printing
+
+
+################################ End Main code
+
+
+
+
+
+
+
diff --git a/bin/final_insertion_files.R b/bin/final_insertion_files.R
index 353c227009bf9079e93caf969069b4b2598ccadf..47586c3beeb0673685c5842bee172d5ae39c11fe 100755
--- a/bin/final_insertion_files.R
+++ b/bin/final_insertion_files.R
@@ -36,8 +36,8 @@
# R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
- stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+ stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
}
# other initializations
erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -74,6 +74,7 @@ if(interactive() == FALSE){ # if(grepl(x = commandArgs(trailingOnly = FALSE), pa
"pos",
"ori_coord",
"ter_coord",
+ "nb_max_insertion_sites",
"file_name",
"cute",
"log"
@@ -100,11 +101,16 @@ rm(tempo.cat)
################################ Test
# cat("\n\n!!!!!!!!!!!!!!!!!!! WARNING: test values are activated\n\n")
-# stat <- "C:/Users/Gael/Documents/Git_projects/14985_loot/dataset/test.fastq_Nremove_trim_5pAttc_1-51.stat"
-# attc_seq <- "CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCG"
-# cute <- "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v10.9.0/cute_little_R_functions.R"
+# pos <- "C:/Users/Gael/Documents/Git_projects/14985_loot/dataset/test.fastq2_q20.pos"
+# ori_coord <- "2320711 2320942"
+# ter_coord <- "4627368 4627400"
+# nb_max_insertion_sites <- "6"
+# file_name <- "caca"
+# cute <- "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v11.2.0/cute_little_R_functions.R"
# log <- "report.txt"
+
+
################################ end Test
################################ Recording of the initial parameters
@@ -119,6 +125,7 @@ param.list <- c(
"pos",
"ori_coord",
"ter_coord",
+ "nb_max_insertion_sites",
"file_name",
"cute",
"log"
@@ -229,6 +236,7 @@ ee <- expression(arg.check <- c(arg.check, tempo$problem) , text.check <- c(text
tempo <- fun_check(data = pos, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = ori_coord, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = ter_coord, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = nb_max_insertion_sites, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = file_name, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = cute, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = log, class = "vector", typeof = "character", length = 1) ; eval(ee)
@@ -244,6 +252,7 @@ tempo.arg <-c(
"pos",
"ori_coord",
"ter_coord",
+ "nb_max_insertion_sites",
"file_name",
"cute",
"log"
@@ -270,6 +279,10 @@ if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){# normally n
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
ori_coord <- as.integer(ori_coord)
+ if(any(is.na(ori_coord))){
+ tempo.cat <- paste0("ERROR IN final_insertion_files.R:\nTHE CONVERSION OF THE ori_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ori_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
ter_coord <- strsplit(ter_coord, split = " ")[[1]]
if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally no NA with is.null()
@@ -277,9 +290,21 @@ if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally n
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
ter_coord <- as.integer(ter_coord)
+ if(any(is.na(ter_coord))){
+ tempo.cat <- paste0("ERROR IN final_insertion_files.R:\nTHE CONVERSION OF THE ter_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ter_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
+}
+if(length(nb_max_insertion_sites) != 1 & any(grepl(nb_max_insertion_sites, pattern = "\\D"))){# normally no NA with is.null()
+ tempo.cat <- paste0("ERROR IN final_insertion_files.R:\nTHE nb_max_insertion_sites PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(nb_max_insertion_sites, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
+}else{
+ nb_max_insertion_sites <- as.integer(nb_max_insertion_sites)
+ if(any(is.na(nb_max_insertion_sites))){
+ tempo.cat <- paste0("ERROR IN final_insertion_files.R:\nTHE CONVERSION OF THE nb_max_insertion_sites PARAMETER INTO INTEGER RETURNS NA: \n", paste0(nb_max_insertion_sites, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
-
-
# end other checkings
# reserved word checking
@@ -298,7 +323,7 @@ if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally n
################ Ignition
-fun_report(data = paste0("\n\n################################################################ final_insertion_files PROCESS\n\n"), output = log, path = "./", overwrite = FALSE)
+fun_report(data = paste0("\n\n################################################################ final_insertion_files PROCESS WITH FILE ", pos, "\n\n"), output = log, path = "./", overwrite = FALSE)
ini.date <- Sys.time()
ini.time <- as.numeric(ini.date) # time of process begin, converted into seconds
fun_report(data = paste0("\n\n################################ RUNNING DATE AND STARTING TIME\n\n"), output = log, path = "./", overwrite = FALSE)
@@ -318,7 +343,7 @@ fun_report(data = paste0("\n\n################################ RUNNING\n\n"), ou
################ Data import
-obs <- read.table(pos, stringsAsFactors = FALSE) # does not take the header
+obs.ini <- read.table(pos, stringsAsFactors = FALSE) # does not take the header
################ end Data import
@@ -326,7 +351,10 @@ obs <- read.table(pos, stringsAsFactors = FALSE) # does not take the header
############ modifications of imported tables
+fun_report(data = paste0("\nHEAD OF THE INITAL FILE ", pos), output = log, path = "./", overwrite = FALSE)
+fun_report(data = head(obs.ini), output = log, path = "./", overwrite = FALSE)
+obs <- obs.ini # obs.ini will be only filtered for highest most frequent position and then returned for the seq_around_insertion process
names(obs) <- c("orient", "pos")
obs <- obs[2:1]
@@ -344,23 +372,44 @@ obs$fork<- factor(obs$fork, levels = c(0, 16), labels = c("Leading", "Lagging"))
obs <- data.frame(Sequence = "obs", Position = obs$pos, names = paste(obs$fork, obs$orient, sep = "_"), fork = obs$fork, orient = obs$orient)
obs$orient[obs$orient == 0] <- "Forward"
obs$orient[obs$orient == 16] <- "Reverse"
+fun_report(data = paste0("\nHEAD OF THE MODIFIED FILE ", pos), output = log, path = "./", overwrite = FALSE)
fun_report(data = head(obs), output = log, path = "./", overwrite = FALSE)
fun_report(data = paste0("\nNUMBER OF OBS POSITIONS:\n", format(nrow(obs), big.mark=",")), output = log, path = "./", overwrite = FALSE)
# saving position file
-options(scipen = 1000) # to avoid writing of scientific numbers in tables, see https://stackoverflow.com/questions/3978266/number-format-writing-1e-5-instead-of-0-00001
-write.table(obs, file = paste0("./", file_name, "_annot.pos"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
-options(scipen = 0)
-
# freq file
+
res <- aggregate(x = obs$Position, by = list(Sequence = obs$Sequence, Position = obs$Position, names = obs$names, fork = obs$fork, orient = obs$orient), FUN = length)
names(res)[names(res) == "x"] <- "freq"
+if( ! grepl(x = file_name, pattern = "^.*nodup.*$")){
+ if(nb_max_insertion_sites > nrow(res)){
+ res <- res[order(res$freq, decreasing = TRUE)[1:nrow(res)], ]
+ tempo.cat <- paste0("\nWARNING: nb_max_insertion_sites PARAMETER IS GREATER THAN THE NUMBER OF DIFFERENT SITES: \n", format(nrow(res), big.mark=","))
+ fun_report(data = tempo.cat, output = log, path = "./", overwrite = FALSE)
+ cat(tempo.cat)
+ }else{
+ res <- res[order(res$freq, decreasing = TRUE)[1:nb_max_insertion_sites], ]
+ }
+}
+options(scipen = 1000) # to avoid writing of scientific numbers in tables, see https://stackoverflow.com/questions/3978266/number-format-writing-1e-5-instead-of-0-00001
+write.table(res, file = paste0("./", file_name, "_annot.freq"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
+options(scipen = 0)
+
+if( ! grepl(x = file_name, pattern = "^.*nodup.*$")){
+ obs <- obs[obs$pos %in% res$Position, ]
+ obs.ini <- obs.ini[obs.ini[ , 2] %in% res$Position, ] # obs.ini[ , 2] because no column names
+}
options(scipen = 1000) # to avoid writing of scientific numbers in tables, see https://stackoverflow.com/questions/3978266/number-format-writing-1e-5-instead-of-0-00001
-write.table(res, file = paste0("./", file_name, "_annot_insertion.freq"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
+write.table(obs, file = paste0("./", file_name, "_annot.pos"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
options(scipen = 0)
+options(scipen = 1000)
+write.table(obs.ini, file = paste0("./", file_name, ".pos"), row.names = FALSE, col.names = FALSE, append = FALSE, quote = FALSE, sep = "\t")
+options(scipen = 0)
+
+
############ end modifications of imported tables
diff --git a/bin/global_logo.R b/bin/global_logo.R
index 0d305ff7b2cbf6a37c401fefc29e93d3294033e7..8c1d8bdea261310d59951ff582a99adf62941447 100755
--- a/bin/global_logo.R
+++ b/bin/global_logo.R
@@ -36,8 +36,8 @@
# R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
- stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+ stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
}
# other initializations
erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -265,6 +265,7 @@ if(length(tempo) != 4){
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
freq <- tempo
+ freq_name_test <- tempo[1]
}
if(length(insertion_dist) != 1 & any(grepl(insertion_dist, pattern = "\\D"))){# normally no NA with is.null()
tempo.cat <- paste0("ERROR IN global_logo.R:\nTHE insertion_dist PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(insertion_dist, collapse = " "))
@@ -368,13 +369,16 @@ for(i0 in 1:length(freq)){
-png(filename = paste0("global_logo_", file_name, ".png"), width = 5000, height = 1800, units = "px", res = 300)
-
+if( ! grepl(x = freq_name_test, pattern = "^.*nodup.*$")){
+ png(filename = paste0("global_logo_dup_", file_name, ".png"), width = 5000, height = 1800, units = "px", res = 300)
+}else{
+ png(filename = paste0("global_logo_nodup_", file_name, ".png"), width = 5000, height = 1800, units = "px", res = 300)
+}
width <- 7
height <- 2.5
-text.size <- 5
-title.text.size <- 4
+text.size <- 6
+title.text.size <- 5
angle <- 90
tempo.just <- fun_gg_just(angle = angle, pos = "bottom")
@@ -389,7 +393,8 @@ if(ncol(tempo) > 0){
gg4 <- ggplot2::scale_x_discrete(labels = c((-insertion_dist):(-1), 1:insertion_dist)) #remove the x initial numbers
gg5 <- ggplot2::annotate("text", x = 1:(insertion_dist * 2 - abs(decal)), y = -0.01, hjust = 1, vjust = 0.5, label = c((-insertion_dist + abs(decal)):(-1), 1:(insertion_dist - abs(decal) + 1)), size = text.size, angle = angle)
gg6 <- ggplot2::coord_cartesian(clip = "off")
- suppressMessages(print(ggplot2::ggplot() + gg1 + gg2 + gg3 + gg4 + gg5 + gg6))
+ gg7 <- ggplot2::theme(text = ggplot2::element_text(size = text.size * 4))
+ suppressMessages(print(ggplot2::ggplot() + gg1 + gg2 + gg3 + gg4 + gg5 + gg6 + gg7))
}
diff --git a/bin/logo.R b/bin/logo.R
index 3b180b560ad691bdbda5de74cf948226f1ea204c..99ed3d3fcf5b87a149dfcb6dfc11bce36dea9c09 100755
--- a/bin/logo.R
+++ b/bin/logo.R
@@ -36,8 +36,8 @@
# R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
- stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+ stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
}
# other initializations
erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -260,6 +260,10 @@ if(length(insertion_dist) != 1 & any(grepl(insertion_dist, pattern = "\\D"))){#
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
insertion_dist <- as.integer(insertion_dist)
+ if(any(is.na(insertion_dist))){
+ tempo.cat <- paste0("ERROR IN logo.R:\nTHE CONVERSION OF THE insertion_dist PARAMETER INTO INTEGER RETURNS NA: \n", paste0(insertion_dist, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
# end other checkings
# reserved word checking
@@ -338,8 +342,8 @@ png(filename = paste0("logo_", sub(x = freq, pattern = "\\.stat$", replacement =
width <- 7
height <- 2.5
-text.size <- 5
-title.text.size <- 4
+text.size <- 6
+title.text.size <- 5
angle <- 90
decal <- -1 # indicate the position occupied by the +1 position of the read (that correspond to first base of coli part of read) after rev complementation. Before rev-comp, it is 201 (as mentioned above). After, it is 400-201+1 = 200, thus -1. Allow to overlay consensus that are not centered on the +1 position
tempo.just <- fun_gg_just(angle = angle, pos = "bottom")
@@ -355,7 +359,8 @@ if(ncol(tempo) > 0){
gg4 <- ggplot2::scale_x_discrete(labels = c((-insertion_dist):(-1), 1:insertion_dist)) #remove the x initial numbers
gg5 <- ggplot2::annotate("text", x = 1:(insertion_dist * 2), y = -0.01, hjust = 1, vjust = 0.5, label = c((-insertion_dist):(-1), 1:insertion_dist), size = text.size, angle = angle)
gg6 <- ggplot2::coord_cartesian(clip = "off")
- suppressMessages(print(ggplot2::ggplot() + gg1 + gg2 + gg3 + gg4 + gg5 + gg6)) #
+ gg7 <- ggplot2::theme(text = ggplot2::element_text(size = text.size * 4))
+ suppressMessages(print(ggplot2::ggplot() + gg1 + gg2 + gg3 + gg4 + gg5 + gg6 + gg7))
}
diff --git a/bin/motif.R b/bin/motif.R
index 4602c8941fc9877b179b0bfd62b4df6c2249b554..bc7dff490c30cb0f85733aa5e558a88ee7bb09d7 100755
--- a/bin/motif.R
+++ b/bin/motif.R
@@ -36,8 +36,8 @@
# R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
- stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+ stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
}
# other initializations
erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -293,6 +293,10 @@ if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){# normally n
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
ori_coord <- as.integer(ori_coord)
+ if(any(is.na(ori_coord))){
+ tempo.cat <- paste0("ERROR IN motif.R:\nTHE CONVERSION OF THE ori_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ori_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
ter_coord <- strsplit(ter_coord, split = " ")[[1]]
if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally no NA with is.null()
@@ -300,12 +304,20 @@ if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally n
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
ter_coord <- as.integer(ter_coord)
+ if(any(is.na(ter_coord))){
+ tempo.cat <- paste0("ERROR IN motif.R:\nTHE CONVERSION OF THE ter_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ter_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
if(length(genome_size) != 1 & any(grepl(genome_size, pattern = "\\D"))){# normally no NA with is.null()
- tempo.cat <- paste0("ERROR IN random_insertion.R:\nTHE genome_size PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(genome_size, collapse = " "))
+ tempo.cat <- paste0("ERROR IN motif.R:\nTHE genome_size PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(genome_size, collapse = " "))
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
genome_size <- as.integer(genome_size)
+ if(any(is.na(genome_size))){
+ tempo.cat <- paste0("ERROR IN motif.R:\nTHE CONVERSION OF THE genome_size PARAMETER INTO INTEGER RETURNS NA: \n", paste0(genome_size, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
diff --git a/bin/plot_coverage.R b/bin/plot_coverage.R
index 4270903cc10a7e28dad183190d1fba3550b2be23..f281b50d4a7f2dc3f79e326d576fdae4c55c5ea3 100755
--- a/bin/plot_coverage.R
+++ b/bin/plot_coverage.R
@@ -36,8 +36,8 @@
# R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
- stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+ stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
}
# other initializations
erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -282,6 +282,10 @@ if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){# normally n
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
ori_coord <- as.integer(ori_coord)
+ if(any(is.na(ori_coord))){
+ tempo.cat <- paste0("ERROR IN plot_coverage.R:\nTHE CONVERSION OF THE ori_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ori_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
ter_coord <- strsplit(ter_coord, split = " ")[[1]]
if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally no NA with is.null()
@@ -289,6 +293,10 @@ if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally n
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
ter_coord <- as.integer(ter_coord)
+ if(any(is.na(ter_coord))){
+ tempo.cat <- paste0("ERROR IN plot_coverage.R:\nTHE CONVERSION OF THE ter_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ter_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
if(length(color_coverage) != 1 & any(grepl(color_coverage, pattern = "\\D"))){# normally no NA with is.null()
tempo.cat <- paste0("ERROR IN plot_coverage.R:\nTHE color_coverage PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(color_coverage, collapse = " "))
diff --git a/bin/plot_fivep_filtering_stat.R b/bin/plot_fivep_filtering_stat.R
index 54b139072316933ccca7a274a999c40687c0f9f5..e23f2f7c1ad378343979031206f989ee3c86998d 100755
--- a/bin/plot_fivep_filtering_stat.R
+++ b/bin/plot_fivep_filtering_stat.R
@@ -36,8 +36,8 @@
# R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
- stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+ stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
}
# other initializations
erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
diff --git a/bin/plot_insertion.R b/bin/plot_insertion.R
index 8d9fabf33cc7b688aec0811d38220ed28f2c24e0..03ba90dca3a49515ccddaea9ee229301a545a797 100755
--- a/bin/plot_insertion.R
+++ b/bin/plot_insertion.R
@@ -36,8 +36,8 @@
# R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
- stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+ stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
}
# other initializations
erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -73,10 +73,15 @@ if(interactive() == FALSE){ # if(grepl(x = commandArgs(trailingOnly = FALSE), pa
tempo.arg.names <- c(
"pos",
"freq",
+ "tss_path",
+ "ess_path",
+ "cds_path",
"ori_coord",
"ter_coord",
"xlab",
"genome_size",
+ "prop_coding_genome",
+ "prop_ess_coding_genome",
"window_size",
"step",
"file_name",
@@ -104,16 +109,21 @@ rm(tempo.cat)
################################ Test
-# pos <- "C:\\Users\\gael\\Documents\\Git_projects\\14985_loot\\work\\a3/86699ab6517b4040f39a7fb45cbf27\\obs_rd_insertions.pos"
-# freq <- "C:\\Users\\gael\\Documents\\Git_projects\\14985_loot\\work\\a3/86699ab6517b4040f39a7fb45cbf27\\obs_rd_insertions.freq"
+# pos <- "C:\\Users\\gael\\Documents\\Git_projects\\14985_loot\\dataset\\obs_rd_insertions.pos"
+# freq <- "C:\\Users\\gael\\Documents\\Git_projects\\14985_loot\\dataset\\obs_rd_insertions.freq"
+# tss_path <- "C:\\Users\\gael\\Documents\\Git_projects\\14985_loot\\dataset/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/TSS_compatible_essential.txt"
+# ess_path <- "C:\\Users\\gael\\Documents\\Git_projects\\14985_loot\\dataset/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/Essential_genes_MG1655.tsv"
+# cds_path <- "C:\\Users\\gael\\Documents\\Git_projects\\14985_loot\\dataset/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/cds_ORI_CENTERED.txt"
# ori_coord <- "2320711 2320942"
# ter_coord <- "4627368 4627400"
# xlab <- "Ecoli Genome (bp)"
# genome_size <- "4641652"
+# prop_coding_genome = "0.88"
+# prop_ess_coding_genome = "0.08"
# window_size <- "50000 200000"
# step <- "100"
# file_name <- "test.fastq2"
-# cute <- "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v11.0.0/cute_little_R_functions.R"
+# cute <- "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/b137cbbd1ac92a62c9099e3d7b57b70c7771f093/cute_little_R_functions.R"
# log <- "plot_insertion_report.txt"
@@ -131,10 +141,15 @@ param.list <- c(
if(run.way == "SCRIPT"){"command"},
"pos",
"freq",
+ "tss_path",
+ "ess_path",
+ "cds_path",
"ori_coord",
"ter_coord",
"xlab",
"genome_size",
+ "prop_coding_genome",
+ "prop_ess_coding_genome",
"window_size",
"step",
"file_name",
@@ -201,7 +216,6 @@ req.function <- c(
"fun_df_remod",
"fun_gg_scatter",
"fun_gg_palette",
- "fun_open",
"fun_gg_empty_graph",
"fun_report"
)
@@ -225,7 +239,8 @@ if( ! is.null(tempo)){
req.package.list <- c(
"lubridate",
"ggplot2",
- "lemon"
+ "lemon",
+ "pdftools"
)
for(i in 1:length(req.package.list)){suppressMessages(library(req.package.list[i], character.only = TRUE))}
# fun_pack(req.package = req.package.list, load = TRUE, lib.path = NULL) # packages are imported even if inside functions are written as package.name::function() in the present code
@@ -246,10 +261,15 @@ checked.arg.names <- NULL # for function debbuging: used by r_debugging_tools
ee <- expression(arg.check <- c(arg.check, tempo$problem) , text.check <- c(text.check, tempo$text) , checked.arg.names <- c(checked.arg.names, tempo$object.name))
tempo <- fun_check(data = pos, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = freq, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = tss_path, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = ess_path, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = cds_path, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = ori_coord, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = ter_coord, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = xlab, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = genome_size, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = prop_coding_genome, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = prop_ess_coding_genome, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = window_size, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = step, class = "vector", typeof = "character", length = 1) ; eval(ee)
tempo <- fun_check(data = file_name, class = "vector", typeof = "character", length = 1) ; eval(ee)
@@ -265,10 +285,15 @@ if(any(arg.check) == TRUE){ # normally no NA
# management of NULL arguments
tempo.arg <-c(
"freq",
+ "tss_path",
+ "ess_path",
+ "cds_path",
"ori_coord",
"ter_coord",
"xlab",
"genome_size",
+ "prop_coding_genome",
+ "prop_ess_coding_genome",
"window_size",
"step",
"file_name",
@@ -290,26 +315,61 @@ warn <- NULL
# warn.count <- 0 # not required
# end warning initiation
# other checkings
-
+if(( ! (tss_path != "NULL" & ess_path != "NULL" & cds_path != "NULL")) & ! (tss_path == "NULL" & ess_path == "NULL" & cds_path == "NULL")){
+ tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE tss_path PARAMETER CANNOT BE \"NULL\" IF ess_path IS NOT \"NULL\" AND VICE VERSA\n", paste0(ori_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+}
ori_coord <- strsplit(ori_coord, split = " ")[[1]]
-if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){ # "\\D" means at least something other than 0123456789 to have TRUE
+if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){# normally no NA with is.null()
tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE ori_coord PARAMETER MUST BE TWO INTEGERS SEPARATED BY A SINGLE SPACE\nHERE IT IS: \n", paste0(ori_coord, collapse = " "))
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
ori_coord <- as.integer(ori_coord)
+ if(any(is.na(ori_coord))){
+ tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE CONVERSION OF THE ori_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ori_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
ter_coord <- strsplit(ter_coord, split = " ")[[1]]
-if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){ # "\\D" means at least something other than 0123456789 to have TRUE
+if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally no NA with is.null()
tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE ter_coord PARAMETER MUST BE TWO INTEGERS SEPARATED BY A SINGLE SPACE\nHERE IT IS: \n", paste0(ter_coord, collapse = " "))
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
ter_coord <- as.integer(ter_coord)
+ if(any(is.na(ter_coord))){
+ tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE CONVERSION OF THE ter_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ter_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
-if(any(grepl(genome_size, pattern = "\\D"))){ # "\\D" means at least something other than 0123456789 to have TRUE, not need of length(step) != 1 because of the space between two numbers
+if(length(genome_size) != 1 & any(grepl(genome_size, pattern = "\\D"))){# normally no NA with is.null()
tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE genome_size PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(genome_size, collapse = " "))
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
genome_size <- as.integer(genome_size)
+ if(any(is.na(genome_size))){
+ tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE CONVERSION OF THE genome_size PARAMETER INTO INTEGER RETURNS NA: \n", paste0(genome_size, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
+}
+if( ! all(grepl(prop_coding_genome, pattern = "^0\\.[0123456789]+$"))){
+ tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE prop_coding_genome PARAMETER MUST BE A SINGLE NUMERIC VALUE\nHERE IT IS: \n", paste0(prop_coding_genome, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
+}else{
+ prop_coding_genome <- as.numeric(prop_coding_genome)
+ if(any(is.na(prop_coding_genome))){
+ tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE CONVERSION OF THE prop_coding_genome PARAMETER INTO INTEGER RETURNS NA: \n", paste0(prop_coding_genome, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
+}
+if( ! all(grepl(prop_ess_coding_genome, pattern = "^0\\.[0123456789]+$"))){
+ tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE prop_ess_coding_genome PARAMETER MUST BE A SINGLE NUMERIC VALUE\nHERE IT IS: \n", paste0(prop_ess_coding_genome, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
+}else{
+ prop_ess_coding_genome <- as.numeric(prop_ess_coding_genome)
+ if(any(is.na(prop_ess_coding_genome))){
+ tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE CONVERSION OF THE prop_ess_coding_genome PARAMETER INTO INTEGER RETURNS NA: \n", paste0(prop_ess_coding_genome, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
window_size <- strsplit(window_size, split = " ")[[1]]
if(any(grepl(window_size, pattern = "\\D"))){ # "\\D" means at least something other than 0123456789 to have TRUE
@@ -317,12 +377,20 @@ if(any(grepl(window_size, pattern = "\\D"))){ # "\\D" means at least something o
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
window_size <- as.integer(window_size)
+ if(any(is.na(window_size))){
+ tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE CONVERSION OF THE window_size PARAMETER INTO INTEGER RETURNS NA: \n", paste0(window_size, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
if(any(grepl(step, pattern = "\\D"))){ # "\\D" means at least something other than 0123456789 to have TRUE, not need of length(step) != 1 because of the space between two numbers
tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE step PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(step, collapse = " "))
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
step <- as.integer(step)
+ if(any(is.na(step))){
+ tempo.cat <- paste0("ERROR IN plot_insertion.R:\nTHE CONVERSION OF THE step PARAMETER INTO INTEGER RETURNS NA: \n", paste0(step, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
@@ -378,7 +446,15 @@ if(erase.graphs == TRUE){
obs.rd.freq <- read.table(freq, stringsAsFactors = FALSE, header = TRUE, sep = "\t")
obs.rd.pos <- read.table(pos, stringsAsFactors = FALSE, header = TRUE, sep = "\t")
-
+if(tss_path != "NULL"){
+ ess <- read.table(ess_path, sep = "\t", stringsAsFactors = FALSE, header = TRUE)
+ tss <- read.table(tss_path, stringsAsFactors = FALSE, header = TRUE, sep = " ")
+ cds <- read.table(cds_path, sep = "\t", stringsAsFactors = FALSE, header = FALSE)
+ common.ess.tss <- fun_comp_1d(ess$gene, tss$name)$common.elements
+ common.ess.cds <- fun_comp_1d(ess$gene, cds$V1)$common.elements
+ cat(paste0("\n\nNUMBER OF COMMON GENES BETWEEN THE tss FILE AND THE essential GENE FILE: ", length(common.ess.tss), "\n\n"))
+ cat(paste0("\n\nNUMBER OF COMMON GENES BETWEEN THE cds FILE AND THE essential GENE FILE: ", length(common.ess.cds), "\n\n"))
+}
################ end Data import
@@ -403,6 +479,11 @@ obs.pos <- obs.rd.pos[obs.rd.pos$KIND == "obs", ]
############ plotting
+
+text.size <- 24
+title.text.size <- 22
+annotate.text.size <- 7
+
# histogram: insertion_number / site_number
png(filename = paste0("plot_", file_name, "_insertion_hist_tot.png"), width = 5000, height = 1800, units = "px", res = 300)
@@ -431,8 +512,8 @@ if(ncol(obs.freq) > 0){
y.lab = "Site number",
y.log = "no",
y.second.tick.nb = 5,
- text.size = 24,
- title.text.size = 16
+ text.size = text.size,
+ title.text.size = title.text.size
)
}else{
fun_gg_empty_graph(text = "EMPTY .freq FILE: NO PLOT DRAWN")
@@ -461,8 +542,8 @@ if(ncol(obs.freq) > 0){
y.lab = "Site number",
y.log = "no",
y.second.tick.nb = 5,
- text.size = 24,
- title.text.size = 16
+ text.size = text.size,
+ title.text.size = title.text.size
)
}else{
fun_gg_empty_graph(text = "EMPTY .freq FILE: NO PLOT DRAWN")
@@ -495,8 +576,8 @@ if(ncol(obs.freq) > 0){
y.lab = "Site number",
y.log = "no",
y.second.tick.nb = 5,
- text.size = 24,
- title.text.size = 16
+ text.size = text.size,
+ title.text.size = title.text.size
)
}else{
fun_gg_empty_graph(text = "EMPTY .freq FILE: NO PLOT DRAWN")
@@ -528,8 +609,8 @@ if(ncol(obs.freq) > 0){
y.lab = "Site number",
y.log = "no",
y.second.tick.nb = 5,
- text.size = 24,
- title.text.size = 16
+ text.size = text.size,
+ title.text.size = title.text.size
)
}else{
fun_gg_empty_graph(text = "EMPTY .freq FILE: NO PLOT DRAWN")
@@ -559,8 +640,8 @@ if(ncol(obs.rd.freq) > 0){
x.second.tick.nb = 4,
y.lab = "Insertion frequency\n<- reverse forward ->",
y.second.tick.nb = 4,
- text.size = 24,
- title.text.size = 16
+ text.size = text.size,
+ title.text.size = title.text.size
)
}else{
fun_gg_empty_graph(text = "EMPTY .freq FILE: NO PLOT DRAWN")
@@ -625,10 +706,10 @@ for(i0 in window_size){
y.bottom.extra.margin = 0,
grid = FALSE,
article = TRUE,
- legend.width = 0.2,
- text.size = 16,
+ legend.width = 0.2,
title = paste0("INSERTION SITE FREQUENCY (WARNING: MAX ~ 100 INTEG PER POSITION, SEE 24.7.2) | WINDOW SIZE: ", i0, " | STEP: ", step, " | GRAPH "),
- title.text.size = 7,
+ text.size = text.size,
+ title.text.size = title.text.size / 2,
return = TRUE
)
ggplot2::ggsave(paste0("plot_", file_name, "_insertion_bin_", i0, ".png"), plot = res$gtable, device = "png", width = 16.6, height = 6, units = "in", dpi = 300) # width = 5000, height = 1800, units = "px" normally but "px" not accepted in the r_ext container
@@ -677,9 +758,9 @@ for(i0 in window_size){
article = TRUE,
legend.width = 0.2,
legend.name = list("", "OBS", "RANDOM"),
- text.size = 16,
title = paste0("PROPORTION OF INSERTION SITES (WARNING: MAX ~ 100 INTEG PER POSITION, SEE 24.7.2) | WINDOW SIZE: ", i0, " | STEP: ", step, " | GRAPH "),
- title.text.size = 7,
+ text.size = text.size,
+ title.text.size = title.text.size / 2,
return = TRUE
)
@@ -688,15 +769,785 @@ for(i0 in window_size){
png(filename = paste0("plot_", file_name, "_lead_lag_insertion_bin_", i0, ".png"), width = 5000, height = 1800, units = "px", res = 300)
fun_gg_empty_graph(text = "EMPTY .pos FILE: NO PLOT DRAWN")
}
+}
+# insertion freq / genome raw distribution on both sides
-
+png(filename = paste0("plot_", file_name, "_insertion_raw.png"), width = 5000, height = 1800, units = "px", res = 300)
+if(ncol(obs.rd.freq) > 0){
+ tempo <- obs.rd.freq
+ tempo$freq[tempo$orient == "Reverse"] <- tempo$freq[tempo$orient == "Reverse"] * -1
+ fun_gg_scatter(
+ data1 = list(structure.freq, tempo), # res # res[res$KIND == "obs", ]
+ x = list("x", "Position"),
+ y = list("y", "freq"),
+ categ = list("ZONE", "KIND"),
+ geom = list("geom_step", "geom_stick"),
+ geom.stick.base = 0,
+ color = list(c("black", "brown"), fun_gg_palette(n = 2)), # fun_gg_palette(n = 2) # fun_gg_palette(n = 2)[1]
+ legend.width = NULL,
+ title = "RAW",
+ x.lim = c(0, genome_size),
+ x.lab = xlab,
+ x.left.extra.margin = 0,
+ x.right.extra.margin = 0,
+ x.second.tick.nb = 4,
+ y.lab = "Insertion frequency\n<- reverse forward ->",
+ y.second.tick.nb = 4,
+ text.size = text.size,
+ title.text.size = title.text.size
+ )
+}else{
+ fun_gg_empty_graph(text = "EMPTY .freq FILE: NO PLOT DRAWN")
}
+if(tss_path != "NULL"){
+ # selecting tss with essential info (TRUE / FALSE)
+ # ess.tss <- tss[fun_comp_1d(ess$gene, tss$name)$same.elements.pos2, ] # ess.tss will contain all the tss but with the indic of TRUE FALSE for essential
+ ess.tss <- tss # ess.tss will contain all the tss but with the indic of TRUE FALSE for essential
+ names(ess.tss) <- c("gene", "promoterID", "tss.orient", "POS")
+ cat("\n\nNUMBER OF ROWS FOR ess FILE: ", nrow(ess))
+ cat("\n\nNUMBER OF ROWS FOR tss FILE: ", nrow(tss))
+ ess.tss <- merge(ess.tss, ess[fun_comp_1d(ess$gene, tss$name)$same.elements.pos1, ], by = "gene")
+ ess.tss$essential <- as.character(ess.tss$essential)
+ unknown <- tss[ ! tss$name %in% ess$gene, ] # is equivalent to tss[-fun_comp_1d(ess$gene, tss$name)$same.elements.pos2, ]
+ names(unknown) <- c("gene", "promoterID", "tss.orient", "POS")
+ ess.tss <- rbind(ess.tss, data.frame(unknown, essential = NA, gene_ori = NA, gene_left = NA, gene_right = NA))
+
+ ess.tss$tss.orient <- toupper(ess.tss$tss.orient)
+ ess.tss <- ess.tss[order(ess.tss$POS), ]
+ cat("\n\nNUMBER OF ROWS FOR ess.tss FILE AFTER MERGING BETWEEN ess AND tss FILES: ", nrow(ess.tss)) # ok same number of rows after merging
+ cat("\n\ness.tss file head:\n")
+ print(head(ess.tss))
+ cat("\n\nTABLE OF ESSENTIAL CDS IN ess.tss FILE:\n")
+ print(table(ess.tss$essential, useNA = "always")) # 3072 + 265 = 3337 ok
+ ess.tss$essential[is.na(ess.tss$essential)] <- "UNKNOWN"
+ cat("\n\nTABLE OF ESSENTIAL CDS IN ess.tss FILE WITH UNKNOWN ADDED:\n")
+ print(table(ess.tss$essential, useNA = "always"))
+
+ # check coherence between the two files tss and ess
+ if(any((ess.tss$tss.orient == "forward" & ess.tss$gene_ori == "-") | (ess.tss$tss.orient == "reverse" & ess.tss$gene_ori == "+"))){
+ cat("\n\nERROR: FORWARD AND REVERSE GENE POSITION NOT COHERENT BETWEEN TSS AND ESSENTIAL FILES:\n\n")
+ print(ess[(ess.tss$tss.orient == "forward" & ess.tss$gene_ori == "-") | (ess.tss$tss.orient == "reverse" & ess.tss$gene_ori == "+"), ])
+ }
+ cat(paste0("\n\nNUMBER OF GENES USED HERE: ", nrow(ess.tss), " / ", nrow(tss), " TOTAL TSS -> SAVED IN tss.used.txt FILE\n\n"))
+ cat(paste0("\n\nNUMBER OF ESSENTIAL GENES: ", sum(ess.tss$essential == "TRUE"), " / ", nrow(ess.tss), "\n\n"))
+ cat(paste0("\n\nNUMBER OF GENE WITH X PROMOTERS:\n"))
+ print(table(table(ess.tss$gene)))
+
+
+ # barplot of promoter/gene frequency
+ png(filename = paste0("plot_", file_name, "_promoter_per_genes.png"), width = 2500, height = 1800, units = "px", res = 300)
+ barplot(table(table(ess.tss$gene)), xlab = "Number of promoters / Gene", ylab = "Frequency") # OK take the name as x-axis value by default
+ write.table(ess.tss, file = paste0("./all.tss.used.txt"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
+
+ # ess.tss prep for hist and bax plots
+ first <- ess.tss[which.min(ess.tss$POS), ]
+ first$POS <- first$POS + genome_size
+ last <- ess.tss[which.max(ess.tss$POS), ]
+ last$POS <- last$POS - genome_size
+ tempo.ess.tss <- rbind(ess.tss, first, last)
+ # end ess.tss prep for hist and bax plots
+
+
+ # parallel
+ ini.date <- Sys.time()
+ ini.time <- as.numeric(ini.date) # time of process begin, converted into
+ tempo.cat <- paste0("PARALLELIZATION INITIATED AT: ", ini.date)
+ cat(paste0("\n", tempo.cat, "\n"))
+ thread.nb = parallel::detectCores(all.tests = FALSE, logical = TRUE) # detect the number of threads
+ tempo.cat <- paste0("NUMBER OF THREADS USED: ", thread.nb)
+ cat(paste0("\n ", tempo.cat, "\n"))
+ Clust <- parallel::makeCluster(thread.nb, outfile = paste0("./insertion_site_parall_log.txt")) # outfile to print or cat during parallelization (only possible in a file, outfile = "" do not work on windows)
+ tempo.cat <- paste0("SPLIT OF TEST NUMBERS IN PARALLELISATION:")
+ cat(paste0("\n ", tempo.cat, "\n"))
+ cluster.list <- parallel::clusterSplit(Clust, 1:nrow(obs.rd.freq)) # split according to the number of cluster
+ str(cluster.list) # using print(str()) add a NULL below the result
+ cat("\n")
+ print.count <- 1000
+ paral.output.list <- parallel::clusterApply( # paral.output.list is a list made of thread.nb compartments, each made of n / thread.nb (mat theo column number) compartment. Each compartment receive the corresponding results of fun_permut(), i.e., data (permuted mat1.perm), warning message, cor (final correlation) and count (number of permutations)
+ cl = Clust,
+ x = cluster.list,
+ obs.rd.freq = obs.rd.freq,
+ tempo.ess.tss = tempo.ess.tss,
+ thread.nb = thread.nb,
+ print.count = print.count,
+ cute.path = cute,
+ fun = function(
+ x,
+ obs.rd.freq,
+ tempo.ess.tss,
+ thread.nb,
+ print.count,
+ cute.path
+ ){
+ # check again: very important because another R
+ process.id <- Sys.getpid()
+ cat(paste0("\nPROCESS ID ", sprintf("%07d", process.id), " -> TESTS ", x[1], " TO ", x[length(x)]))
+ source(cute.path, local = .GlobalEnv)
+ fun_pack(req.package = "lubridate", load = TRUE) # load = TRUE to be sure that functions are present in the environment. And this prevent to use R.lib.path argument of fun_python_pack()
+ # end check again: very important because another R
+ ini.date <- Sys.time()
+ ini.time <- as.numeric(ini.date) # time of process begin, converted into
+ # new environment
+ env.name <- paste0("env", ini.time)
+ if(exists(env.name, where = -1)){
+ tempo.cat <- paste0("\n\n================\n\nERROR IN ", function.name, ": ENVIRONMENT env.name ALREADY EXISTS. PLEASE RERUN ONCE\n\n============\n\n")
+ stop(tempo.cat, call. = FALSE)
+ }else{
+ assign(env.name, new.env())
+ }
+ # end new environment
+ print.count.loop <- 0
+ res <- data.frame() # this is much longer: res <- data.frame(matrix(nrow = nrow(integ), ncol = ncol(integ) + ncol(tempo.ess.tss) + 2))
+ for(i2 in 1:length(x)){
+ print.count.loop <- print.count.loop + 1
+ dist <- obs.rd.freq$Position[x[i2]] - tempo.ess.tss$POS
+ pos <- which.min(abs(dist))
+ res <- rbind(res, data.frame(tempo.ess.tss[pos, ], obs.rd.freq[x[i2], ], Distance = dist[pos]))
+ if(print.count.loop == print.count){
+ print.count.loop <- 0
+ tempo.time <- as.numeric(Sys.time())
+ tempo.lapse <- round(lubridate::seconds_to_period(tempo.time - ini.time))
+ final.loop <- (tempo.time - ini.time) / i2 * length(x) # number of time that remains
+ final.exp <- as.POSIXct(final.loop, origin = ini.date)
+ cat(paste0("\nLOOP ", format(i2, big.mark=","), " / ", format(length(x), big.mark=","), " | TIME SPENT: ", tempo.lapse, " | EXPECTED END: ", final.exp))
+ }
+ }
+ return(res)
+ }
+ )
+ parallel::stopCluster(Clust)
+ # txt files assembly
+ final <- data.frame()
+ for(i0 in 1:length(cluster.list)){
+ final <- rbind(final, paral.output.list[[i0]])
+ }
+ # inactivated because loop above recover more info: res <- lapply(X = integ.list, FUN = function(X){x <- X - tempo.ess.tss$POS ; pos <- which.min(abs(x)) ; y <- data.frame(tempo.ess.tss[pos, ], D = x[pos]) ; return(y)})
+ # x1 <- pos.list[[i0]] - ess.tss$POS # distance from each insertion to any promoter. This order to have + for insertion after the promoter, and - before the promoter
+ # x2 <- pos.list[[i0]] - (first$POS + genome_size) # this pushes the first promoter at the right of the cut close to insertions at the left of the cut. No need to change the sign because this is for insertions at the left of the promoter, i.e., insert - promoter will be negative
+ # x3 <- pos.list[[i0]] - (last$POS - genome_size) # this pushes the last promoter at the left of the cut close to insertions at the right of the cut. No need to change the sign because this is for insertions at the right of the promoter which will have a negative coordinate, i.e., insert - (-promoter) will be positive
+ # all these can be summaryzed as x1 <- X - c(ess.tss$POS, (first$POS + genome_size), (last$POS - genome_size))
+ # and thus, all this can be simplified by adding two rows to ess.tss : the one with the (first$POS + genome_size) and the one with (last$POS - genome_size)
+ if(nrow(final) != nrow(obs.rd.freq)){
+ cat("\n\nERROR: nrow(final) DIFFERENT FROM nrow(obs.rd.freq)\n\n")
+ }else{
+ names(final)[names(final) == "seq"] <- "KIND"
+ final$KIND[final$KIND == "obs"] <- "OBS"
+ final$KIND[final$KIND == "random"] <- "RANDOM"
+ options(scipen = 1000) # to avoid writing of scientific numbers in tables, see https://stackoverflow.com/questions/3978266/number-format-writing-1e-5-instead-of-0-00001
+ tempo.cat <- paste0("TABLE SAVED IN: ", paste0("./distance.insertion.tss.txt"))
+ cat(paste0("\n ", tempo.cat, "\n"))
+ write.table(final, file = paste0("./distance.insertion.tss.txt"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
+ options(scipen = 0)# integ.list <- c(integ)
+ }
+ head(final)
+ tail(final)
+
+
+ # data prep for histogram plots
+ final$KIND <- factor(final$KIND)
+ m <- aggregate(final$D, list(final$KIND), mean, na.rm = TRUE)$x
+ s <- aggregate(final$D, list(final$KIND), sd, na.rm = TRUE)$x
+ x.norm <- seq(min(final$D, na.rm = TRUE), max(final$D, na.rm = TRUE), 1) #
+ tempo.lines <- data.frame(x.norm = x.norm, y.norm = c(dnorm(x.norm, mean = m[1], sd = s[1]), dnorm(x.norm, mean = m[2], sd = s[2])), KIND = rep(levels(final$KIND), each = length(x.norm)), color = rep(fun_gg_palette(2, "dark"), each = length(x.norm)))
+ # end data prep for histogram plots
+
+
+ # histogram freq
+ png(filename = paste0("hist_", file_name, "_tss_distance_freq.png"), width = 5000, height = 1800, units = "px", res = 300)
+ library(ggplot2)
+ a <- ggplot(data = final, mapping = aes(x = Distance, fill = KIND))
+ b <- geom_histogram( position = "dodge", bins = 30, center = 300, na.rm = TRUE)
+ d <- ggtitle("DISTANCE FREQ")
+ e <- ylab("Number of Distances")
+ f <- theme(text = element_text(size = text.size), plot.title = element_text(hjust = 0, size = title.text.size)) # base_size spécifie la taille des textes
+ g <- scale_y_continuous(expand = c(0, 0), limits = c(0, max(ggplot_build(a + b + d + e + f)$data[[1]]$y, na.rm = TRUE)))
+ h <- scale_discrete_manual(aesthetics = "fill", values = fun_gg_palette(2), guide = guide_legend(title = "Insertion"))
+ print(a + b + d + e + f + g + h)
+
+
+ # histogram density and normal law
+ png(filename = paste0("hist_", file_name, "_tss_distance_freq_Nlaw.png"), width = 5000, height = 1800, units = "px", res = 300)
+ a <- ggplot(data = final, mapping = aes(x = Distance, fill = KIND))
+ b <- geom_histogram(mapping = aes(y = ..density..), position = "dodge", bins = 30, center = 300, na.rm = TRUE)
+ d <- ggtitle("DENSITY AND NORMAL LAWS", )
+ e <- geom_line(data = tempo.lines, aes(x = x.norm, y = y.norm, color = KIND), size = 1)
+ f <- scale_discrete_manual(aesthetics = "color", values = tempo.lines$color)
+ g <- ylab("Density")
+ h <- theme(text = element_text(size = text.size), plot.title = element_text(hjust = 0, size = title.text.size)) # base_size spécifie la taille des textes
+ i <- scale_y_continuous(expand = c(0, 0), limits = c(0, max(0, ggplot_build(a + b + d + e + f + g + h)$data[[1]]$density)))
+ j <- scale_discrete_manual(aesthetics = "fill", values = fun_gg_palette(2), guide = guide_legend(title = "Insertion"))
+ k <- scale_discrete_manual(aesthetics = "color", values = fun_gg_palette(2, "light"), guide = guide_legend(title = "Law"))
+ print(a + b + d + e + f + g + h + i + j + k)
+
+
+
+ # creation of the new column same_orient
+ final <- data.frame(final, same_orient = final$tss.orient == final$orient)
+ final$same_orient[final$same_orient == TRUE] <- "SAME"
+ final$same_orient[final$same_orient == FALSE] <- "OPPOSITE"
+ final$essential[final$essential == FALSE] <- "DISPENSABLE"
+ final$essential[final$essential == TRUE] <- "ESSENTIAL"
+
+ text.size <- 30
+
+ png(filename = paste0("boxplot_", file_name, "_tss.png"), width = 5000, height = 1800, units = "px", res = 300)
+ fun_gg_boxplot(data1 = final, y = "Distance", categ = c("KIND", "essential"), y.lim = c(-1.5e4, 1.5e4), y.tick.nb = 6, dot.categ = "same_orient", dot.color = fun_gg_palette(n = 5, "dark")[if(all(final[ , "same_orient"] == "SAME")){2}else if(all(final[ , "same_orient"] == "OPPOSITE")){5}else{c(5, 2)}], dot.alpha = 0.1, dot.size = 1, legend.width = NULL, y.bottom.extra.margin = 0, title = "", vertical = FALSE, dot.legend.name = "INSERTION / CDS\nORIENTATION", box.legend.name = "GENE", y.top.extra.margin = 0.1, x.lab = "", y.lab = "Distance from TSS (bp)", text.size = text.size, title.text.size = title.text.size, stat.size = annotate.text.size)
+
+ png(filename = paste0("boxplot_", file_name, "_tss_wo_unknown.png"), width = 5000, height = 1800, units = "px", res = 300)
+ fun_gg_boxplot(data1 = final[final$essential != "UNKNOWN", ], y = "Distance", categ = c("KIND", "essential"), y.lim = c(-1.5e4, 1.5e4), y.tick.nb = 6, dot.categ = "same_orient", dot.color = fun_gg_palette(n = 5, "dark")[if(all(final[ , "same_orient"] == "SAME")){2}else if(all(final[ , "same_orient"] == "OPPOSITE")){5}else{c(5, 2)}], dot.alpha = 0.1, dot.size = 1, legend.width = NULL, y.bottom.extra.margin = 0, title = "", vertical = FALSE, dot.legend.name = "INSERTION / CDS\nORIENTATION", box.legend.name = "GENE", y.top.extra.margin = 0.1, x.lab = "", y.lab = "Distance from TSS (bp)", text.size = text.size, title.text.size = title.text.size, stat.size = annotate.text.size)
+
+
+ cat("\n\nTEST BETWEEN OBS AND RANDOM IN ESSENTIAL: \n\n")
+ t.test(x = final[final$essential == "ESSENTIAL" & final$KIND == "OBS", "Distance"], y = final[final$essential == "ESSENTIAL" & final$KIND == "RANDOM", "Distance"], var.equal = FALSE)
+ cat("\n\nTEST BETWEEN ESSENTIAL AND DISPENSABLE IN OBS: \n\n")
+ t.test(x = final[final$essential == "ESSENTIAL" & final$KIND == "OBS", "Distance"], y = final[final$essential == "DISPENSABLE" & final$KIND == "OBS", "Distance"], var.equal = FALSE)
+
+ # parallel
+ for(i0 in c("ESSENTIAL", "DISPENSABLE", "UNKNOWN")){
+ gene.loop <- unique(final$gene[final$essential == i0])
+ ini.date <- Sys.time()
+ ini.time <- as.numeric(ini.date) # time of process begin, converted into
+ tempo.cat <- paste0("PARALLELIZATION INITIATED AT: ", ini.date)
+ cat(paste0("\n", tempo.cat, "\n"))
+ thread.nb = parallel::detectCores(all.tests = FALSE, logical = TRUE) # detect the number of threads
+ tempo.cat <- paste0("NUMBER OF THREADS USED: ", thread.nb)
+ cat(paste0("\n ", tempo.cat, "\n"))
+ Clust <- parallel::makeCluster(thread.nb, outfile = paste0("./", tolower(i0), ".insertion_site_parall_log.txt")) # outfile to print or cat during parallelization (only possible in a file, outfile = "" do not work on windows)
+ tempo.cat <- paste0("SPLIT OF LOOP NUMBERS IN PARALLELISATION:")
+ cat(paste0("\n ", tempo.cat, "\n"))
+ cluster.list <- parallel::clusterSplit(Clust, 1:length(gene.loop)) # split according to the number of cluster
+ str(cluster.list) # using print(str()) add a NULL below the result
+ cat("\n")
+ paral.output.list <- parallel::clusterApply( # paral.output.list is a list made of thread.nb compartments, each made of n / thread.nb (mat theo column number) compartment. Each compartment receive the corresponding results of fun_permut(), i.e., data (permuted mat1.perm), warning message, cor (final correlation) and count (number of permutations)
+ cl = Clust,
+ x = cluster.list,
+ final = final,
+ gene.loop = gene.loop,
+ i0 = i0,
+ thread.nb = thread.nb,
+ print.count = print.count,
+ cute.path = cute,
+ ylim = c(-1.5e4, 1.5e4),
+ text.size = text.size,
+ title.text.size = title.text.size,
+ annotate.text.size = annotate.text.size,
+ fun = function(
+ x,
+ final,
+ gene.loop,
+ i0,
+ thread.nb,
+ print.count,
+ cute.path,
+ ylim,
+ text.size,
+ title.text.size,
+ annotate.text.size
+ ){
+ # check again: very important because another R
+ process.id <- Sys.getpid()
+ cat(paste0("\nPROCESS ID ", sprintf("%07d", process.id), " -> LOOPS ", x[1], " TO ", x[length(x)]))
+ source(cute.path, local = .GlobalEnv)
+ fun_pack(req.package = "lubridate", load = TRUE) # load = TRUE to be sure that functions are present in the environment. And this prevent to use R.lib.path argument of fun_python_pack()
+ # end check again: very important because another R
+ ini.date <- Sys.time()
+ ini.time <- as.numeric(ini.date) # time of process begin, converted into
+ # new environment
+ env.name <- paste0("env", ini.time)
+ if(exists(env.name, where = -1)){
+ tempo.cat <- paste0("\n\n================\n\nERROR IN ", function.name, ": ENVIRONMENT env.name ALREADY EXISTS. PLEASE RERUN ONCE\n\n============\n\n")
+ stop(tempo.cat, call. = FALSE)
+ }else{
+ assign(env.name, new.env())
+ }
+ # end new environment
+ print.count.loop <- 0
+ # png(filename = paste0(process.id, ".up.down.tss.", tolower(i0), ".png"), width = 5000, height = 1800, units = "px", res = 300)
+ fun_open(pdf = TRUE, pdf.path = "working.dir", pdf.name = paste0(process.id, ".up.down.tss.", tolower(i0), ".pdf"), width = 8, height = 5)
+ for(i2 in 1:length(x)){
+ cat(paste0("\nGENE ", gene.loop[x[i2]], " ", i2, " / ", length(x)))
+ tempo <- final$gene == gene.loop[x[i2]] & final$essential == i0
+ tempo1 <- nrow(final[tempo & final$KIND == "OBS", ])
+ tempo2 <- nrow(final[tempo & final$KIND == "RANDOM", ])
+ if(sum(tempo, na.rm = TRUE) > 0){
+ fun_gg_boxplot(data1 = final[tempo, ], y = "Distance", categ = c("KIND", "essential"), dot.categ = "same_orient", dot.color = fun_gg_palette(n = 5, "dark")[if(all(final[tempo, "same_orient"] == "SAME")){2}else if(all(final[tempo, "same_orient"] == "OPPOSITE")){5}else{c(5, 2)}], y.tick.nb = 6, dot.alpha = 0.3, dot.size = 3, legend.width = NULL, y.bottom.extra.margin = 0, y.lim = ylim, title = paste0("GENE: ", gene.loop[x[i2]], " | n = ", format(nrow(final[tempo, ]), big.mark = ","), ifelse(tempo1 > 0 , paste0(" | n.obs = ", tempo1), ""), ifelse(tempo2 > 0 , paste0(" | n.random = ", tempo2), "")), vertical = FALSE, dot.legend.name = "INSERTION / CDS\nORIENTATION", box.legend.name = "GENE", y.top.extra.margin = 0.1, x.lab = "", y.lab = "Distance from TSS (bp)", box.line.size = 0, box.fill = TRUE, box.alpha = 0, text.size = text.size, title.text.size = title.text.size, stat.size = annotate.text.size)
+ }else{
+ fun_gg_empty_graph(text = paste0("GENE: ", gene.loop[x[i2]]))
+ }
+ if(print.count.loop == print.count){
+ print.count.loop <- 0
+ tempo.time <- as.numeric(Sys.time())
+ tempo.lapse <- round(lubridate::seconds_to_period(tempo.time - ini.time))
+ final.loop <- (tempo.time - ini.time) / i2 * length(x) # number of time that remains
+ final.exp <- as.POSIXct(final.loop, origin = ini.date)
+ cat(paste0("\nPROCESS ID ", sprintf("%07d", process.id), " | LOOP ", format(i2, big.mark=","), " / ", format(length(x), big.mark=","), " | TIME SPENT: ", tempo.lapse, " | EXPECTED END: ", final.exp))
+ }
+ }
+ fun_close()
+ return(process.id)
+ }
+ )
+ parallel::stopCluster(Clust)
+ # pdf files assembly
+ tempo.names <- paste0("./", unlist(paral.output.list), ".up.down.tss.", tolower(i0), ".pdf")
+ pdftools::pdf_combine(
+ input = tempo.names,
+ output = paste0("./", tolower(i0), ".joined.pdf")
+ )
+ file.remove(tempo.names)
+ }
+
+
+
+ ################## CDS
+
+
+ head(cds)
+ head(ess)
+ head(final)
+ addmargins(table(final$orient))
+ # selecting cds with essential info (TRUE / FALSE)
+ # ess.cds <- cds[fun_comp_1d(ess$gene, cds$V1)$same.elements.pos2, ] # ess.cds will contain all the cds but with the indic of TRUE FALSE for essential
+ ess.cds <- cds # ess.cds will contain all the cds but with the indic of TRUE FALSE for essential
+ names(ess.cds) <- c("gene", "start", "end", "length", "what", "cds.orient")
+ head(ess.cds) # is equivalent to cds at that stage
+ nrow(ess)
+ nrow(cds)
+ cat(paste0("\n\nNUMBER OF COMMON GENES BETWEEN THE cds GEN FILE AND THE essential GEN FILE: ", length(common.ess.cds), "\n\n"))
+ nrow(ess.cds)
+ ess.cds <- merge(ess.cds, ess[fun_comp_1d(ess$gene, cds$V1)$same.elements.pos1, ], by = "gene")
+ ess.cds$essential <- as.character(ess.cds$essential)
+ unknown <- cds[ ! cds$V1 %in% ess$gene, ] # is equivalent to cds[-fun_comp_1d(ess$gene, cds$name)$same.elements.pos2, ]
+ names(unknown) <- c("gene", "start", "end", "length", "what", "cds.orient")
+ ess.cds <- rbind(ess.cds, data.frame(unknown, essential = NA, gene_ori = NA, gene_left = NA, gene_right = NA))
+
+
+ ess.cds$cds.orient <- toupper(ess.cds$cds.orient)
+ ess.cds <- ess.cds[order(ess.cds$start), ]
+ nrow(ess.cds) # ok same number of rows after merging
+ head(ess.cds)
+ tail(ess.cds)
+ addmargins(table(ess.cds$essential, useNA = "always")) # 4357 ok
+ addmargins(table(ess.cds$gene_ori, useNA = "always")) # 4357 ok
+ ess.cds$essential[is.na(ess.cds$essential)] <- "UNKNOWN"
+ ess.cds$gene_ori[is.na(ess.cds$gene_ori) & ess.cds$cds.orient == "FORWARD"] <- "+"
+ ess.cds$gene_ori[is.na(ess.cds$gene_ori) & ess.cds$cds.orient == "REVERSE"] <- "-"
+ addmargins(table(ess.cds$essential, useNA = "always"))
+ addmargins(table(ess.cds$gene_ori, useNA = "always")) # 4357 ok
+
+
+ # check coherence between the two files cds and ess
+ if(any((ess.cds$cds.orient == "forward" & ess.cds$gene_ori == "-") | (ess.cds$cds.orient == "reverse" & ess.cds$gene_ori == "+"))){
+ cat("\n\nERROR: FORWARD AND REVERSE GENE POSITION NOT COHERENT BETWEEN CDS AND ESSENTIAL FILES:\n\n")
+ print(ess[(ess.cds$cds.orient == "forward" & ess.cds$gene_ori == "-") | (ess.cds$cds.orient == "reverse" & ess.cds$gene_ori == "+"), ])
+ }
+ cat(paste0("\n\nNUMBER OF GENES USED HERE: ", nrow(ess.cds), " / ", nrow(cds), " TOTAL CDS -> SAVED IN cds.used.txt FILE\n\n"))
+ cat(paste0("\n\nNUMBER OF ESSENTIAL GENES: ", sum(ess.cds$essential == "TRUE"), " / ", nrow(ess.cds), "\n\n"))
+ cat(paste0("\n\nWARNING: ", length(ess.cds$gene[duplicated(ess.cds$gene)]), " DUPLICATED GENES\n\n"))
+ cat(paste0("\n\nTHESE DUPLICATED GENES (ALTERNATIVE TRANSCRIPT?) INCLUDE ONE ESSENTIAL GENE:\n"))
+ ess.cds[ess.cds$gene %in% ess.cds$gene[duplicated(ess.cds$gene)], ]
+
+
+ write.table(ess.cds, file = paste0("./cds.used.txt"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
+
+ # to deal with genes cut by the end of line
+ tempo1 <- ess.cds[ess.cds$end - ess.cds$start < 0, ]
+ if(nrow(tempo1) > 0){
+ cat("\n\n2 GENES CREATED FOR EACH GENE CUT BY END OF LINE\n\n")
+ print(tempo1)
+ tempo2 <- data.frame()
+ for(i1 in 1:nrow(tempo1)){
+ tempo3 <- ess.cds[ess.cds$start == tempo1$start[i1] & ess.cds$end == tempo1$end[i1], ]
+ tempo4 <- tempo3
+ tempo3$start <- 0
+ tempo4$end <- genome_size
+ tempo2 <- rbind(tempo2, tempo3, tempo4)
+ }
+ cat("\n\nLINES REPLACED IN THE GENE OBJECT:\n\n")
+ print(tempo2)
+ ess.cds <- rbind(ess.cds[ ! (ess.cds$end - ess.cds$start < 0), ], tempo2)
+ }
+
+ write.table(ess.cds, file = paste0("./cds.used.with.uncut.genes.txt"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
+
+ uq.final <- unique(final)
+ # loop
+ loop.nb <- nrow(uq.final)
+ ini.date <- Sys.time()
+ ini.time <- as.numeric(ini.date) # time of process begin, converted into
+ tempo.cat <- paste0("PARALLELIZATION INITIATED AT: ", ini.date)
+ cat(paste0("\n", tempo.cat, "\n"))
+ thread.nb = parallel::detectCores(all.tests = FALSE, logical = TRUE) # detect the number of threads
+ tempo.cat <- paste0("NUMBER OF THREADS USED: ", thread.nb)
+ cat(paste0("\n ", tempo.cat, "\n"))
+ Clust <- parallel::makeCluster(thread.nb, outfile = paste0("./cds.insertion_site_parall_log.txt")) # outfile to print or cat during parallelization (only possible in a file, outfile = "" do not work on windows)
+ tempo.cat <- paste0("SPLIT OF TEST NUMBERS IN PARALLELISATION:")
+ cat(paste0("\n ", tempo.cat, "\n"))
+ cluster.list <- parallel::clusterSplit(Clust, 1:loop.nb) # split according to the number of cluster
+ str(cluster.list) # using print(str()) add a NULL below the result
+ cat("\n")
+ paral.output.list <- parallel::clusterApply( # paral.output.list is a list made of thread.nb compartments, each made of n / thread.nb (mat theo column number) compartment. Each compartment receive the corresponding results of fun_permut(), i.e., data (permuted mat1.perm), warning message, cor (final correlation) and count (number of permutations)
+ cl = Clust,
+ x = cluster.list,
+ kind.file = final,
+ uq.kind.file = uq.final,
+ ess.cds = ess.cds,
+ thread.nb = thread.nb,
+ print.count = print.count,
+ cute.path = cute,
+ fun = function(
+ x,
+ kind.file,
+ uq.kind.file,
+ ess.cds,
+ thread.nb,
+ print.count,
+ cute.path
+ ){
+ # check again: very important because another R
+ process.id <- Sys.getpid()
+ cat(paste0("\nPROCESS ID ", sprintf("%07d", process.id), " -> TESTS ", x[1], " TO ", x[length(x)]))
+ source(cute.path, local = .GlobalEnv)
+ fun_pack(req.package = "lubridate", load = TRUE) # load = TRUE to be sure that functions are present in the environment. And this prevent to use R.lib.path argument of fun_python_pack()
+ # end check again: very important because another R
+ ini.date <- Sys.time()
+ ini.time <- as.numeric(ini.date) # time of process begin, converted into
+ # new environment
+ env.name <- paste0("env", ini.time)
+ if(exists(env.name, where = -1)){
+ tempo.cat <- paste0("\n\n================\n\nERROR IN ", function.name, ": ENVIRONMENT env.name ALREADY EXISTS. PLEASE RERUN ONCE\n\n============\n\n")
+ stop(tempo.cat, call. = FALSE)
+ }else{
+ assign(env.name, new.env())
+ }
+ # end new environment
+ print.count.loop <- 0
+ inside.gene <- data.frame()
+ inside.gene.unique <- data.frame()
+ outside.gene <- data.frame()
+ outside.gene.unique <- data.frame()
+
+ print.count.loop <- 0
+ for(i3 in 1:length(x)){
+ print.count.loop <- print.count.loop + 1
+ tempo1 <- kind.file[kind.file$POS == uq.kind.file$POS[x[i3]] & kind.file$orient == uq.kind.file$orient[x[i3]] & kind.file$KIND == uq.kind.file$KIND[x[i3]], ] # selection of all the duplicated positions for forward and seq in kind.file (reverse in the next loop if exists)
+ # inside gene
+ if(any(uq.kind.file$POS[x[i3]] >= ess.cds$start & uq.kind.file$POS[x[i3]] <= ess.cds$end)){ # here we do not care about the orientation of the gene
+ tempo2 <- ess.cds[ess.cds$start <= uq.kind.file$POS[x[i3]] & ess.cds$end >= uq.kind.file$POS[x[i3]], ] # selection of the genes with kind.file in it
+ tempo.final <- data.frame()
+ # ess.log <- ess.cds$essential[ess.cds$start <= uq.kind.file$POS[x[i3]] & ess.cds$end >= uq.kind.file$POS[x[i3]]]
+ for(i4 in 1:nrow(tempo2)){
+ tempo.final <- rbind(tempo.final, data.frame(tempo1, tempo2[i4, ], cds.nb = i4))
+ }
+ inside.gene <- rbind(inside.gene, tempo.final)
+ inside.gene.unique <- rbind(inside.gene.unique, unique(tempo.final))
+ if(nrow(unique(tempo.final)) != nrow(tempo2)){
+ print(uq.kind.file[x[i3], ])
+ cat("\n\n")
+ print(tempo.final)
+ cat("\n\n")
+ print(unique(tempo.final))
+ cat("\n\n")
+ print(unique(tempo.final[, names(tempo.final) != "KIND"]))
+ cat("\n\n")
+ print(tempo2)
+ cat("\n\nERROR 1\n\n")
+ }
+ }else{
+ outside.gene <- rbind(outside.gene, tempo1)
+ outside.gene.unique <- rbind(outside.gene.unique, unique(tempo1))
+ }
+ if(print.count.loop == print.count){
+ print.count.loop <- 0
+ tempo.time <- as.numeric(Sys.time())
+ tempo.lapse <- round(lubridate::seconds_to_period(tempo.time - ini.time))
+ final.loop <- (tempo.time - ini.time) / i3 * length(x) # number of time that remains
+ final.exp <- as.POSIXct(final.loop, origin = ini.date)
+ cat(paste0("\nIN PROCESS ", sprintf("%07d", process.id), " | LOOP ", format(i3, big.mark=","), " / ", format(length(x), big.mark=","), " | TIME SPENT: ", tempo.lapse, " | EXPECTED END: ", final.exp))
+ }
+ }
+ return(list(inside.gene, outside.gene, inside.gene.unique, outside.gene.unique))
+ }
+ )
+ parallel::stopCluster(Clust)
+ # txt files assembly
+ tempo.names <- c("inside.gene", "outside.gene", "inside.gene.unique", "outside.gene.unique")
+ for(i1 in 1:length(tempo.names)){
+ assign(tempo.names[i1], data.frame())
+ for(i2 in 1:length(cluster.list)){
+ assign(tempo.names[i1], rbind(get(tempo.names[i1]), paral.output.list[[i2]][[i1]]))
+ }
+ options(scipen = 1000) # to avoid writing of scientific numbers in tables, see https://stackoverflow.com/questions/3978266/number-format-writing-1e-5-instead-of-0-00001
+ write.table(get(tempo.names[i1]), file = paste0("./", tempo.names[i1], ".txt"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
+ options(scipen = 0)
+ }
+
+
+ # integrate the position in proportion
+ cat("\n\nPROP: DISTANCE OF INSERTION INSIDE CDS FROM ATG (FROM 0 ATG TO 1 STOP)\nPROP REVERSE FOR REVERSE GENES BECAUSE THE GENE IS IN THE OTHER ORIENTATION BUT COORDINATES ARE IN FORWARD\n\n")
+ # out.path <- "C:\\Users\\Gael\\Desktop/"
+ file <- c("inside.gene", "inside.gene.unique")
+ for(i0 in 1:length(file)){
+ tempo.name <- file[i0]
+ obs1 <- read.table(paste0("./", tempo.name, ".txt"), header = TRUE, sep = "\t")
+ tempo.cat <- paste0(tempo.name, ": HEAD\n")
+ cat(paste0("\n\n", tempo.cat, "\n\n"))
+ print(head(obs1, 100)[c(1:3, 90:92), ])
+ obs1 <- data.frame(obs1, pos_prop = (obs1$POS - obs1$start) / (obs1$end - obs1$start), same_orient = mapply(obs1$orient, obs1$cds.orient , FUN = identical))
+ tempo.cat <- paste0(tempo.name, ": HEAD BEFORE PROP INVERSION FOR REVERSE GENES\n")
+ cat(paste0("\n\n", tempo.cat, "\n\n"))
+ print(head(obs1, 100)[c(1:3, 90:92), ])
+ tempo.cat <- paste0(tempo.name, ": NUMBER OF INSERTION IN SAME (TRUE) OR OPPOSITE (FALSE) GENE ORIENTATION\n")
+ cat(paste0("\n\n", tempo.cat, "\n\n"))
+ print(addmargins(table(obs1$same_orient, obs1$KIND)))
+ tempo.cat <- paste0(tempo.name, ": NUMBER OF REVERSE GENE ROWS ", sum(obs1$cds.orient == "REVERSE"), " / ", nrow(obs1))
+ cat(paste0("\n\n", tempo.cat, "\n\n"))
+ obs1$POS_prop[obs1$cds.orient == "REVERSE"] <- 1 - obs1$POS_prop[obs1$cds.orient == "REVERSE"] # because the gene is in the other orientation but coordinates are in forward
+ tempo.cat <- paste0(tempo.name, ": HEAD\n")
+ cat(paste0("\n\n", tempo.cat, "\n\n"))
+ print(head(obs1, 100)[c(1:3, 90:92), ])
+ options(scipen = 1000) # to avoid writing of scientific numbers in tables, see https://stackoverflow.com/questions/3978266/number-format-writing-1e-5-instead-of-0-00001
+ write.table(obs1, file = paste0("./", tempo.name, ".pos_prop.txt"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
+ options(scipen = 0)
+ }
+
+
+
+
+
+
+
+ # verifs
+ nrow(inside.gene) # nb of insertion inside genes (1 insertion -> 2 genes impacted -> count for 2)
+ nrow(unique(inside.gene)) == nrow(inside.gene.unique) # verif that files are similars
+ fun_comp_2d(unique(inside.gene), inside.gene.unique)$identical.content # verif that files are similars
+
+ nrow(outside.gene)
+ nrow(unique(outside.gene)) == nrow(outside.gene.unique) # verif that files are similars
+ fun_comp_2d(unique(outside.gene), outside.gene.unique)$identical.content # verif that files are similars
+
+
+ cat(paste0("\n\nCHECK ON THE OBSERVED DATA ONLY:\n\n"))
+ obs <- inside.gene[inside.gene$KIND == "OBS", ]
+ nrow(obs[obs$cds.nb == 1, ]) # nb of insertion that are inside genes
+ nrow(obs[obs$cds.nb == 1, ]) + nrow(outside.gene) # nb of insertion: must be 397,137
+ cat(paste0("\n\nUSE obs[obs$cds.nb == 1, ] AND SAY 'NUMBER OF INSERTION IN AT LEAST ONE GENE'\n\n"))
+
+ table(obs$cds.nb) # nb of insertions in two genes or more
+ table(unique(obs)$cds.nb) # nb of insertions in two genes or more, without insertion position duplicates
+
+
+ # Essential genes insertion
+ ess <- obs[obs$essential.1 == "TRUE", ]
+ ess <- data.frame(ess, gene_orient = paste0(ess$gene, "_", ess$cds.orient))
+ ess.gene.list <- unique(ess[, -c(1:3)]) # list of the impacted essential genes, -c(1:3) to remove info about insertions
+ ess.gene.list <- ess.gene.list[order(ess.gene.list$gene.1), ]
+ ess.gene.list # list of the impacted essential genes: 81 genes impacted
+ cat(paste0("\n\nTHE NUMBER OF ESSENTIAL IMPACTED GENES (DOES NOT INCLUDE THE dnaX DUPLICATED GENE) IS: ", nrow(ess.gene.list), " / 295\n\n"))
+
+ # list of essential genes (including the gene orientation) and number of insertion in it according to the orientation
+ res <- addmargins(table(ess$gene_orient, ess$orient))
+ res # those without full biais might not be essential, like bcsB_REVERSE
+ nrow(res) # number of rows of this table (81 genes + 1 for the sum row)
+
+
+
+
+
+
+
+ res <- read.table("./inside.gene.pos_prop.txt", sep = "\t", stringsAsFactors = FALSE, header = TRUE)
+ # res$same_orient[res$same_orient == TRUE] <- "SAME"
+ # res$same_orient[res$same_orient == "FALSE"] <- "OPPOSITE"
+ # res$essential[res$essential == TRUE] <- "ESSENTIAL"
+ # res$essential[res$essential == "FALSE"] <- "DISPENSABLE"
+ # res <- as.data.frame(res, stringsAsFactors = TRUE)
+ # names(res)[names(res) == "KIND"] <- "KIND"
+ # res$KIND[res$KIND == "obs"] <- "OBS"
+ # res$KIND[res$KIND == "random"] <- "RANDOM"
+ head(res)
+ fun_info(res, 20)
+ addmargins(table(res$essential[res$KIND == "OBS"])) # nb of insertions in genes
+
+
+ res <- res[order(res$gene, res$KIND), ]
+
+ png(filename = paste0("boxplot_", file_name, "_cds.png"), width = 5000, height = 1800, units = "px", res = 300)
+ fun_gg_boxplot(data1 = res, y = "pos_prop", categ = c("KIND", "essential"), dot.categ = "same_orient", dot.color = fun_gg_palette(n = 5, "dark")[if(all(res[ , "same_orient"] == "SAME")){2}else if(all(res[ , "same_orient"] == "OPPOSITE")){5}else{c(5, 2)}], dot.alpha = 0.1, dot.size = 1, legend.width = NULL, y.bottom.extra.margin = 0, y.lim = c(0, 1), title = paste0("n = ", format(nrow(res), big.mark = ","), " | n.obs = ", format(nrow(res[res$KIND == "OBS", ]), big.mark = ","), " | n.random = ", format(nrow(res[res$KIND == "RANDOM", ]), big.mark = ",")), vertical = FALSE, dot.legend.name = "INSERTION / CDS\nORIENTATION", box.legend.name = "GENE", y.top.extra.margin = 0.1, x.lab = "", y.lab = "GENE COORDINATES (PROP)", text.size = text.size, title.text.size = title.text.size, stat.size = annotate.text.size)
+ png(filename = paste0("boxplot_", file_name, "_cds_wo_unknown.png"), width = 5000, height = 1800, units = "px", res = 300)
+ fun_gg_boxplot(data1 = res[res$essential != "UNKNOWN", ], y = "pos_prop", categ = c("KIND", "essential"), dot.categ = "same_orient", dot.color = fun_gg_palette(n = 5, "dark")[if(all(res[ , "same_orient"] == "SAME")){2}else if(all(res[ , "same_orient"] == "OPPOSITE")){5}else{c(5, 2)}], dot.alpha = 0.1, dot.size = 1, legend.width = NULL, y.bottom.extra.margin = 0, y.lim = c(0, 1), title = paste0("n = ", format(nrow(res), big.mark = ","), " | n.obs = ", format(nrow(res[res$KIND == "OBS", ]), big.mark = ","), " | n.random = ", format(nrow(res[res$KIND == "RANDOM", ]), big.mark = ",")), vertical = FALSE, dot.legend.name = "INSERTION / CDS\nORIENTATION", box.legend.name = "GENE", y.top.extra.margin = 0.1, x.lab = "", y.lab = "GENE COORDINATES (PROP)", text.size = text.size, title.text.size = title.text.size, stat.size = annotate.text.size)
+
+
+ cat("\n\nTEST BETWEEN OBS AND RANDOM IN ESSENTIAL: \n\n")
+ t.test(x = res[res$essential == "ESSENTIAL" & res$KIND == "OBS", "pos_prop"], y = res[res$essential == "ESSENTIAL" & res$KIND == "RANDOM", "pos_prop"], var.equal = FALSE)
+ cat("\n\nTEST BETWEEN OBS AND RANDOM IN ESSENTIAL GENES IMPACTED BY OBS INSERTIONS: \n\n")
+ tempo <- unique(res$gene[res$KIND == "OBS" & res$essential == "ESSENTIAL"])
+ t.test(x = res[res$essential == "ESSENTIAL" & res$KIND == "OBS" & res$gene %in% tempo, "pos_prop"], y = res[res$essential == "ESSENTIAL" & res$KIND == "RANDOM" & res$gene %in% tempo, "pos_prop"], var.equal = FALSE)
+ cat("\n\nTEST BETWEEN ESSENTIAL AND DISPENSABLE IN OBS: \n\n")
+ t.test(x = res[res$essential == "ESSENTIAL" & res$KIND == "OBS", "pos_prop"], y = res[res$essential == "DISPENSABLE" & res$KIND == "OBS", "pos_prop"], var.equal = FALSE)
+
+ # png(filename = paste0("insertion_pos_in_ess_cds.png"), width = 5000, height = 1800, units = "px", res = 300)
+ fun_open(pdf = TRUE, pdf.path = "working.dir", pdf.name = "insertion_pos_in_ess_cds.pdf", width = 8, height = 5)
+ gene.loop <- unique(res$gene[res$essential == "ESSENTIAL"])
+ for(i0 in 1:length(gene.loop)){
+ cat(paste0("\nGENE ", gene.loop[i0], " ", i0, " / ", length(gene.loop)))
+ tempo <- res$gene == gene.loop[i0] & res$essential == "ESSENTIAL"
+ tempo1 <- nrow(res[tempo & res$KIND == "OBS", ])
+ tempo2 <- nrow(res[tempo & res$KIND == "RANDOM", ])
+ if(sum(tempo, na.rm = TRUE) > 0){
+ fun_gg_boxplot(data1 = res[tempo, ], y = "pos_prop", categ = c("KIND", "essential"), dot.categ = "same_orient", dot.color = fun_gg_palette(n = 5, "dark")[if(all(res[tempo, "same_orient"] == "SAME")){2}else if(all(res[tempo, "same_orient"] == "OPPOSITE")){5}else{c(5, 2)}], dot.alpha = 0.3, dot.size = 3, legend.width = NULL, y.bottom.extra.margin = 0, y.lim = c(0, 1), title = paste0("GENE: ", gene.loop[i0], " | n = ", format(nrow(res[tempo, ]), big.mark = ","), ifelse(tempo1 > 0 , paste0(" | n.obs = ", tempo1), ""), ifelse(tempo2 > 0 , paste0(" | n.random = ", tempo2), "")), vertical = FALSE, dot.legend.name = "INSERTION / CDS\nORIENTATION", box.legend.name = "GENE", y.top.extra.margin = 0.1, x.lab = "", y.lab = "GENE COORDINATES (PROP)", box.line.size = 0, box.fill = TRUE, box.alpha = 0, text.size = text.size, title.text.size = title.text.size, stat.size = annotate.text.size)
+ }
+ }
+ fun_close()
+
+
+
+
+ files <- c("inside.gene.pos_prop", "outside.gene")
+ site <- c("INSIDE", "OUTSIDE")
+ type <- c("EXPERIMENTAL", "RANDOM")
+ gene2 <- c("ESSENTIAL", "DISPENSABLE")
+ ylim <- c(0, 4e5)
+
+
+ # main
+ # data prep
+ for(i0 in 1:length(files)){
+ assign(files[i0], read.table(paste0("./", files[i0], ".txt"), sep = "\t", stringsAsFactors = FALSE, header = TRUE))
+ assign(files[i0], data.frame(get(files[i0]), site = site[i0], stringsAsFactors = FALSE))
+ assign(files[i0], {x <- get(files[i0]); names(x)[names(x) == "KIND"] <- "type" ; x$type[x$type == "obs"] <- "OBS" ; x$type[x$type == "random"] <- "RANDOM" ; x})
+
+ }
+ inside.gene.pos_prop$same_orient[inside.gene.pos_prop$same_orient == TRUE] <- "SAME"
+ inside.gene.pos_prop$same_orient[inside.gene.pos_prop$same_orient == "FALSE"] <- "OPPOSITE"
+ inside.gene.pos_prop$essential[inside.gene.pos_prop$essential == TRUE] <- "ESSENTIAL"
+ inside.gene.pos_prop$essential[inside.gene.pos_prop$essential == "FALSE"] <- "DISPENSABLE"
+ inside.gene.pos_prop <- data.frame(inside.gene.pos_prop, complete = paste0(inside.gene.pos_prop[, "site"], "_", inside.gene.pos_prop[, "essential"]), stringsAsFactors = FALSE)
+ outside.gene <- data.frame(outside.gene, essential = NA, same_orient = NA, complete = "OUTSIDE", stringsAsFactors = FALSE)
+
+ res <- data.frame(stringsAsFactors = FALSE)
+ col.name <- c("orient", "fork", "site" ,"type", "essential" ,"same_orient", "complete")
+ for(i0 in 1:length(files)){
+ if(nrow(get(files[i0])) > 0){
+ res <- rbind(res, get(files[i0])[, col.name], stringsAsFactors = FALSE)
+ }
+ }
+
+
+
+
+ rd.outside.nb <- sum(res$type == "RANDOM" & res$site == "OUTSIDE")
+ rd.inside.nb <- sum(res$type == "RANDOM" & res$site == "INSIDE")
+
+
+
+
+
+ # tests
+ res <- as.data.frame(lapply(res, FUN = factor))
+ fun_info(res, 20)
+ for(i0 in 1:length(col.name)){
+ tempo <- table(res[col.name[i0]])
+ if(length(tempo) == 2){
+ cat("\n\n\nCONFORMITY CHISQ TEST ON ", col.name[i0], " VARIABLE\n")
+ print(format(addmargins(tempo), big.mark = ","))
+ print(chisq.test(tempo, p = c(0.5, 0.5)))
+ }else if(length(tempo) > 2){
+ cat("\n\n\nHOMOGENEITY CHISQ TEST ON ", col.name[i0], " VARIABLE\n")
+ print(format(addmargins(tempo), big.mark = ","))
+ print(chisq.test(tempo))
+ }else{
+ cat("\n\n\nNO CHISQ TEST ON ", col.name[i0], " VARIABLE, BECAUSE A SINGLE CLASS: \n")
+ print(format(addmargins(tempo), big.mark = ","))
+ }
+ }
+ addmargins(table(res$essential[res$type == "OBS"])) # nb of insertions in genes
+ addmargins(table(res[, c("site", "essential")]))
+ addmargins(table(res[, c("type", "complete")]))
+ # plots insertion count
+ png(filename = paste0("barplot_", file_name, "_all.png"), width = 5000, height = 1800, units = "px", res = 300)
+ library(ggplot2)
+ tempo.gg.name <- "gg.indiv.plot."
+ tempo.gg.count <- 0
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::ggplot(data = res, mapping = aes(x = complete, fill = type))) # fill because this is what is used with geom_bar
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::geom_bar(stat = "count", position = ggplot2::position_dodge(width = NULL), color = "black", width = 0.5))
+ tempo <- ggplot2::ggplot_build(eval(parse(text = paste(paste0(tempo.gg.name, 1:tempo.gg.count), collapse = " + "))))$data[[1]]
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::ggtitle("INSERTION SITE COUNT"))
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::annotate(geom = "text", x = tempo$x, y = tempo$y, label = format(tempo$count, big.mark = ","), size = annotate.text.size, hjust = 0, vjust = 0.5, angle = 90))
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::scale_y_continuous(expand = c(0, 0), oob = scales::rescale_none))
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::theme(text = element_text(size = text.size), plot.title = element_text(hjust = 0, size = title.text.size), axis.line.x = element_line(color="black"), axis.text.x = element_text(angle = 45, hjust = 1), axis.line.y = element_line(color="black"), axis.ticks.x=element_blank(), panel.grid.major.x = element_blank(), panel.grid.major.y = element_line(color ="grey"), panel.grid.minor.x = element_blank(), panel.grid.minor.y = element_blank(), panel.background = element_blank()))
+ print(eval(parse(text = paste(paste0(tempo.gg.name, 1:tempo.gg.count), collapse = " + "))))
+
+ # plots normalized prop inside / outside CDS
+ res2 <- aggregate(res$site, list(site = res$site, type = res$type), length)
+ res2 # count
+ sum.obs <- sum(res2$x[res2$type == "OBS"]) # 398142
+ sum.rd <- sum(res2$x[res2$type == "RANDOM"]) # 399696
+ # normalisation
+ res2$x[res2$type == "OBS" & res2$site == "INSIDE"] <- (res2$x[res2$type == "OBS" & res2$site == "INSIDE"] / sum.obs) / prop_coding_genome # the first division is to have the proportion. The second is to have relative to the proportion of the coding genome
+ res2$x[res2$type == "OBS" & res2$site == "OUTSIDE"] <- (res2$x[res2$type == "OBS" & res2$site == "OUTSIDE"] / sum.obs) / (1 - prop_coding_genome)
+ res2$x[res2$type == "RANDOM" & res2$site == "INSIDE"] <- res2$x[res2$type == "RANDOM" & res2$site == "INSIDE"] / (sum.rd * prop_coding_genome) # equivalent to above
+ res2$x[res2$type == "RANDOM" & res2$site == "OUTSIDE"] <- res2$x[res2$type == "RANDOM" & res2$site == "OUTSIDE"] / (sum.rd * (1 - prop_coding_genome)) # equivalent to above
+ res2$site <- as.character(res2$site)
+ res2$type <- as.character(res2$type)
+ tempo.max <- paste0(as.character(res2[res2$x == max(res2$x), c("site", "type")]), collapse = "_") # name of the max prop
+ res2 # normalization by the proportion of the coding genome (0.88 or 0.12), equivalent to the proba that insertion fall into inside or outside according to the inside and outside avalaible
+ res2$x <- res2$x / max(res2$x) # normalization to max 1
+ res2 # normalization to max 1
+
+
+ png(filename = paste0("barplot_", file_name, "_inside_outside.png"), width = 5000, height = 1800, units = "px", res = 300)
+ tempo.gg.name <- "gg.indiv.plot."
+ tempo.gg.count <- 0
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::ggplot(data = res2, mapping = aes(x = site, y = x, fill = type))) # fill because this is what is used with geom_bar
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::geom_col(position = ggplot2::position_dodge(width = NULL), color = "black", width = 0.5))
+ tempo <- ggplot2::ggplot_build(eval(parse(text = paste(paste0(tempo.gg.name, 1:tempo.gg.count), collapse = " + "))))$data[[1]]
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::ggtitle(paste0("NORMALIZED PROP (INSIDE / OUTSIDE CDS)\nUSING THE THEORETICAL PROP OF THE GENOME: ", paste0(round(c(prop_coding_genome, 1 - prop_coding_genome), 3), collapse = " "), "\nAND USING THE MAX PROP VALUE (", tempo.max, ") -> 1")))
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::annotate(geom = "text", x = tempo$x, y = tempo$y, label = format(round(tempo$y, 2), big.mark = ","), size = annotate.text.size, hjust = 0, vjust = 0.5, angle = 90))
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::scale_y_continuous(expand = c(0, 0), oob = scales::rescale_none, limits = c(0, 1.2)))
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::theme(text = element_text(size = text.size), plot.title = element_text(hjust = 0, size = title.text.size), axis.line.x = element_line(color="black"), axis.text.x = element_text(angle = 45, hjust = 1), axis.line.y = element_line(color="black"), axis.ticks.x=element_blank(), panel.grid.major.x = element_blank(), panel.grid.major.y = element_line(color ="grey"), panel.grid.minor.x = element_blank(), panel.grid.minor.y = element_blank(), panel.background = element_blank()))
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::xlab(""))
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::ylab("Proportion of insertion\nrelative to\ncorresponding available genome"))
+ print(eval(parse(text = paste(paste0(tempo.gg.name, 1:tempo.gg.count), collapse = " + "))))
+
+ # plots normalized prop ess / non ess CDS
+ tempo <- res[res$essential != "UNKNOWN", ]
+ res3 <- aggregate(tempo$site, list(essential = tempo$essential, type = tempo$type), length)
+ res3 # count
+ sum.obs <- sum(res3$x[res3$type == "OBS"])
+ sum.rd <- sum(res3$x[res3$type == "RANDOM"])
+ # normalisation
+ res3$x[res3$type == "OBS" & res3$essential == "ESSENTIAL"] <- res3$x[res3$type == "OBS" & res3$essential == "ESSENTIAL"] / (sum.obs * prop_ess_coding_genome)
+ res3$x[res3$type == "OBS" & res3$essential == "DISPENSABLE"] <- res3$x[res3$type == "OBS" & res3$essential == "DISPENSABLE"] / (sum.obs * (1 - prop_ess_coding_genome))
+ res3$x[res3$type == "RANDOM" & res3$essential == "ESSENTIAL"] <- res3$x[res3$type == "RANDOM" & res3$essential == "ESSENTIAL"] / (sum.rd * prop_ess_coding_genome)
+ res3$x[res3$type == "RANDOM" & res3$essential == "DISPENSABLE"] <- res3$x[res3$type == "RANDOM" & res3$essential == "DISPENSABLE"] / (sum.rd * (1 - prop_ess_coding_genome))
+ res3$essential <- as.character(res3$essential)
+ res3$type <- as.character(res3$type)
+ tempo.max <- paste0(res3[res3$x == max(res3$x), c("essential", "type")], collapse = "_") # name of the max prop
+ res3 # normalization by the proportion of the coding genome (0.88 or 0.12), equivalent to the proba that insertion fall into inside or outside according to the inside and outside avalaible
+ res3$x <- res3$x / max(res3$x) # normalization to max 1
+ res3 # normalization to max 1
+
+ png(filename = paste0("barplot_", file_name, "_ess_uness.png"), width = 5000, height = 1800, units = "px", res = 300)
+ tempo.gg.name <- "gg.indiv.plot."
+ tempo.gg.count <- 0
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::ggplot(data = res3, mapping = aes(x = essential, y = x, fill = type))) # fill because this is what is used with geom_bar
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::geom_col(position = ggplot2::position_dodge(width = NULL), color = "black", width = 0.5))
+ tempo <- ggplot2::ggplot_build(eval(parse(text = paste(paste0(tempo.gg.name, 1:tempo.gg.count), collapse = " + "))))$data[[1]]
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::ggtitle(paste0("NORMALIZED PROP (ESSENTIAL / DISPENSABLE CDS)\nUSING THE THEORETICAL PROP OF THE GENOME: ", paste0(round(c(prop_ess_coding_genome, 1 - prop_ess_coding_genome), 3), collapse = " "), "\nAND USING THE MAX PROP VALUE (", tempo.max, ") -> 1")))
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::annotate(geom = "text", x = tempo$x, y = tempo$y, label = format(round(tempo$y, 2), big.mark = ","), size = annotate.text.size, hjust = 0, vjust = 0.5, angle = 90))
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::scale_y_continuous(expand = c(0, 0), oob = scales::rescale_none, limits = c(0, 1.2)))
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::theme(text = element_text(size = text.size), plot.title = element_text(hjust = 0, size = title.text.size), axis.line.x = element_line(color="black"), axis.text.x = element_text(angle = 45, hjust = 1), axis.line.y = element_line(color="black"), axis.ticks.x=element_blank(), panel.grid.major.x = element_blank(), panel.grid.major.y = element_line(color ="grey"), panel.grid.minor.x = element_blank(), panel.grid.minor.y = element_blank(), panel.background = element_blank()))
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::xlab(""))
+ assign(paste0(tempo.gg.name, tempo.gg.count <- tempo.gg.count + 1), ggplot2::ylab("Proportion of insertion\nrelative to\ncorresponding available genome"))
+ print(eval(parse(text = paste(paste0(tempo.gg.name, 1:tempo.gg.count), collapse = " + "))))
+}
diff --git a/bin/plot_read_length.R b/bin/plot_read_length.R
index bdef8eb63b354a19e63f46b3d9427b338fc3eabd..efb4e4c27fc3aeb9775941be805ce7ca240b48fb 100755
--- a/bin/plot_read_length.R
+++ b/bin/plot_read_length.R
@@ -36,8 +36,8 @@
# R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
- stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+ stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
}
# other initializations
erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
diff --git a/bin/print_report.R b/bin/print_report.R
index 51c74ccf27086998d6ccb6b178e17d904302fba8..69ab147f6f2014c3224b6d9c89f683fa1374efc1 100755
--- a/bin/print_report.R
+++ b/bin/print_report.R
@@ -37,8 +37,8 @@
# R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
- stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+ stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
}
# other initializations
erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
diff --git a/bin/random_insertion.R b/bin/random_insertion.R
index 27d1b3e7bcbb305d8530fcf457ae1825469398a2..b842c4c09e6a742ea57cfd64b0b69992404c6f88 100755
--- a/bin/random_insertion.R
+++ b/bin/random_insertion.R
@@ -36,8 +36,8 @@
# R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
- stop(paste0("\n\n================\n\nERROR IN random_insertion.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+ stop(paste0("\n\n================\n\nERROR IN random_insertion.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
}
# other initializations
erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -297,6 +297,10 @@ if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){# normally n
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
ori_coord <- as.integer(ori_coord)
+ if(any(is.na(ori_coord))){
+ tempo.cat <- paste0("ERROR IN random_insertion.R:\nTHE CONVERSION OF THE ori_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ori_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
ter_coord <- strsplit(ter_coord, split = " ")[[1]]
if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally no NA with is.null()
@@ -304,12 +308,20 @@ if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally n
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
ter_coord <- as.integer(ter_coord)
+ if(any(is.na(ter_coord))){
+ tempo.cat <- paste0("ERROR IN random_insertion.R:\nTHE CONVERSION OF THE ter_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ter_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
if(length(genome_size) != 1 & any(grepl(genome_size, pattern = "\\D"))){# normally no NA with is.null()
tempo.cat <- paste0("ERROR IN random_insertion.R:\nTHE genome_size PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(genome_size, collapse = " "))
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
genome_size <- as.integer(genome_size)
+ if(any(is.na(genome_size))){
+ tempo.cat <- paste0("ERROR IN random_insertion.R:\nTHE CONVERSION OF THE genome_size PARAMETER INTO INTEGER RETURNS NA: \n", paste0(genome_size, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
diff --git a/bin/seq_around_insertion.R b/bin/seq_around_insertion.R
index 0f9721977fff6f8f87fd0d68f177c2a94b59a04a..d65d670367b4239a084ef0043ce3092a93810206 100755
--- a/bin/seq_around_insertion.R
+++ b/bin/seq_around_insertion.R
@@ -36,8 +36,8 @@
# R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
- stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+ stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
}
# other initializations
erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -274,6 +274,10 @@ if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){# normally n
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
ori_coord <- as.integer(ori_coord)
+ if(any(is.na(ori_coord))){
+ tempo.cat <- paste0("ERROR IN seq_around_insertion.R:\nTHE CONVERSION OF THE ori_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ori_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
ter_coord <- strsplit(ter_coord, split = " ")[[1]]
if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally no NA with is.null()
@@ -281,12 +285,20 @@ if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally n
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
ter_coord <- as.integer(ter_coord)
+ if(any(is.na(ter_coord))){
+ tempo.cat <- paste0("ERROR IN seq_around_insertion.R:\nTHE CONVERSION OF THE ter_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ter_coord, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
if(length(insertion_dist) != 1 & any(grepl(insertion_dist, pattern = "\\D"))){# normally no NA with is.null()
tempo.cat <- paste0("ERROR IN seq_around_insertion.R:\nTHE insertion_dist PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(insertion_dist, collapse = " "))
stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
}else{
insertion_dist <- as.integer(insertion_dist)
+ if(any(is.na(insertion_dist))){
+ tempo.cat <- paste0("ERROR IN seq_around_insertion.R:\nTHE CONVERSION OF THE insertion_dist PARAMETER INTO INTEGER RETURNS NA: \n", paste0(insertion_dist, collapse = " "))
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+ }
}
@@ -328,6 +340,7 @@ fun_report(data = paste0("\n\n################################ RUNNING\n\n"), ou
obs <- read.table(pos, stringsAsFactors = TRUE) # does not take the header
+print(head(obs))
################ end Data import
@@ -338,7 +351,10 @@ obs <- read.table(pos, stringsAsFactors = TRUE) # does not take the header
names(obs) <- c("orient", "pos")
# ori and dif
-if( ! any(obs$orient %in% c(0, 16))){cat("\n\nERROR: OTHER THAN 0 OR 16 FOR FLAG\n\n")}
+if( ! any(obs$orient %in% c(0, 16))){
+ tempo.cat <- "ERROR IN seq_around_insertion.R: OTHER THAN 0 OR 16 FOR FLAG"
+ stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+}
ori.center <- mean(ori_coord, na.rm = TRUE)
ter_center <- mean(ter_coord, na.rm = TRUE)
diff --git a/dataset/cds_ORI_CENTERED.txt b/dataset/cds_ORI_CENTERED.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f7f639b1c4d06a16613fc71ec9df869c2b667c2c
--- /dev/null
+++ b/dataset/cds_ORI_CENTERED.txt
@@ -0,0 +1,4357 @@
+thrL 3036809 3036874 66 1 forward
+thrA 3036956 3039418 2463 1 forward
+thrB 3039420 3040352 933 1 forward
+thrC 3040353 3041639 1287 1 forward
+yaaX 3041853 3042149 297 1 forward
+yaaA 3042302 3043078 777 1 reverse
+yaaJ 3043148 3044578 1431 1 reverse
+talB 3044857 3045810 954 1 forward
+mog 3045925 3046512 588 1 forward
+satP 3046547 3047113 567 1 reverse
+yaaW 3047262 3047975 714 1 reverse
+mbiA 3047449 3047934 486 1 forward
+yaaI 3048001 3048405 405 1 reverse
+dnaK 3048782 3050698 1917 1 forward
+dnaJ 3050787 3051917 1131 1 forward
+insL-1 3052064 3053176 1113 1 forward
+mokC 3053370 3053579 210 1 reverse
+hokC 3053370 3053522 153 1 reverse
+nhaA 3054108 3055274 1167 1 forward
+nhaR 3055334 3056239 906 1 forward
+insB-1 3056430 3056933 504 1 reverse
+insA-1 3056852 3057127 276 1 reverse
+rpsT 3057434 3057697 264 1 reverse
+yaaY 3057800 3058018 219 1 forward
+ribF 3058026 3058967 942 1 forward
+ileS 3059010 3061826 2817 1 forward
+lspA 3061826 3062320 495 1 forward
+fkpB 3062445 3062894 450 1 forward
+ispH 3062896 3063846 951 1 forward
+rihC 3063912 3064826 915 1 forward
+dapB 3064993 3065814 822 1 forward
+carA 3066270 3067418 1149 1 forward
+carB 3067436 3070657 3222 1 forward
+caiF 3070919 3071314 396 1 forward
+caiE 3071400 3071990 591 1 reverse
+caiD 3071996 3072781 786 1 reverse
+caiC 3072890 3074443 1554 1 reverse
+caiB 3074517 3075734 1218 1 reverse
+caiA 3075863 3077005 1143 1 reverse
+caiT 3077036 3078550 1515 1 reverse
+fixA 3079022 3079792 771 1 forward
+fixB 3079807 3080748 942 1 forward
+fixC 3080799 3082085 1287 1 forward
+fixX 3082082 3082369 288 1 forward
+yaaU 3082426 3083757 1332 1 forward
+kefF 3083865 3084395 531 1 forward
+kefC 3084388 3086250 1863 1 forward
+folA 3086442 3086921 480 1 forward
+apaH 3086999 3087841 843 1 reverse
+apaG 3087848 3088225 378 1 reverse
+rsmA 3088228 3089049 822 1 reverse
+pdxA 3089046 3090035 990 1 reverse
+surA 3090035 3091321 1287 1 reverse
+lptD 3091374 3093728 2355 1 reverse
+djlA 3093983 3094798 816 1 forward
+yabP 3095093 3095743 651 1 forward
+yabQ 3095740 3095898 159 1 forward
+rluA 3096306 3096965 660 1 reverse
+rapA 3096977 3099883 2907 1 reverse
+polB 3100048 3102399 2352 1 reverse
+araD 3102474 3103169 696 1 reverse
+araA 3103454 3104956 1503 1 reverse
+araB 3104967 3106667 1701 1 reverse
+araC 3107006 3107884 879 1 forward
+yabI 3107970 3108734 765 1 forward
+thiQ 3108848 3109546 699 1 reverse
+thiP 3109530 3111140 1611 1 reverse
+thiB 3111116 3112099 984 1 reverse
+sgrR 3112263 3113918 1656 1 reverse
+sgrT 3114007 3114138 132 1 forward
+setA 3114240 3115418 1179 1 forward
+leuD 3115467 3116072 606 1 reverse
+leuC 3116083 3117483 1401 1 reverse
+leuB 3117486 3118577 1092 1 reverse
+leuA 3118577 3120148 1572 1 reverse
+leuL 3120241 3120327 87 1 reverse
+leuO 3120987 3121931 945 1 forward
+yabR 3122086 3122130 45 1 reverse
+ilvI 3122249 3123973 1725 1 forward
+ilvH 3123976 3124467 492 1 forward
+cra 3124647 3125651 1005 1 forward
+mraZ 3126253 3126711 459 1 forward
+rsmH 3126713 3127654 942 1 forward
+ftsL 3127651 3128016 366 1 forward
+ftsI 3128032 3129798 1767 1 forward
+murE 3129785 3131272 1488 1 forward
+murF 3131269 3132627 1359 1 forward
+mraY 3132621 3133703 1083 1 forward
+murD 3133706 3135022 1317 1 forward
+ftsW 3135022 3136266 1245 1 forward
+murG 3136263 3137330 1068 1 forward
+murC 3137384 3138859 1476 1 forward
+ddlB 3138852 3139772 921 1 forward
+ftsQ 3139774 3140604 831 1 forward
+ftsA 3140601 3141863 1263 1 forward
+ftsZ 3141924 3143075 1152 1 forward
+lpxC 3143176 3144093 918 1 forward
+secM 3144324 3144836 513 1 forward
+secA 3144898 3147603 2706 1 forward
+mutT 3147663 3148052 390 1 forward
+yacG 3148268 3148465 198 1 reverse
+zapD 3148475 3149218 744 1 reverse
+coaE 3149218 3149838 621 1 reverse
+yacM 3149863 3149907 45 1 forward
+guaC 3150063 3151106 1044 1 forward
+hofC 3151141 3152343 1203 1 reverse
+hofB 3152333 3153718 1386 1 reverse
+ppdD 3153728 3154168 441 1 reverse
+nadC 3154371 3155264 894 1 reverse
+ampD 3155352 3155903 552 1 forward
+ampE 3155900 3156754 855 1 forward
+aroP 3156797 3158170 1374 1 reverse
+pdhR 3158711 3159475 765 1 forward
+aceE 3159636 3162299 2664 1 forward
+aceF 3162314 3164206 1893 1 forward
+lpd 3164531 3165955 1425 1 forward
+yacH 3166026 3167879 1854 1 reverse
+acnB 3168234 3170831 2598 1 forward
+yacL 3171007 3171369 363 1 forward
+speD 3171407 3172201 795 1 reverse
+speE 3172217 3173083 867 1 reverse
+yacC 3173189 3173536 348 1 reverse
+cueO 3173702 3175252 1551 1 forward
+gcd 3175454 3177844 2391 1 reverse
+hpt 3178050 3178586 537 1 forward
+can 3178627 3179289 663 1 reverse
+yadG 3179398 3180324 927 1 forward
+yadH 3180321 3181091 771 1 forward
+yadI 3181196 3181636 441 1 forward
+yadE 3181700 3182929 1230 1 forward
+panD 3182933 3183313 381 1 reverse
+rpnC 3183587 3184489 903 1 forward
+panC 3184563 3185414 852 1 reverse
+panB 3185426 3186220 795 1 reverse
+yadC 3186334 3187572 1239 1 reverse
+yadK 3187622 3188218 597 1 reverse
+yadL 3188245 3188850 606 1 reverse
+yadM 3188862 3189431 570 1 reverse
+htrE 3189448 3192045 2598 1 reverse
+yadV 3192080 3192820 741 1 reverse
+yadN 3192918 3193502 585 1 reverse
+folK 3193872 3194351 480 1 reverse
+pcnB 3194348 3195745 1398 1 reverse
+gluQ 3195805 3196731 927 1 reverse
+dksA 3196768 3197223 456 1 reverse
+sfsA 3197401 3198105 705 1 reverse
+thpR 3198120 3198650 531 1 reverse
+hrpB 3198724 3201153 2430 1 forward
+mrcB 3201349 3203883 2535 1 forward
+fhuA 3204103 3206346 2244 1 forward
+fhuC 3206397 3207194 798 1 forward
+fhuD 3207194 3208084 891 1 forward
+fhuB 3208081 3210063 1983 1 forward
+hemL 3210221 3211501 1281 1 reverse
+clcA 3211726 3213147 1422 1 forward
+yadW 3213171 3213236 66 1 forward
+erpA 3213229 3213573 345 1 forward
+yadS 3213620 3214243 624 1 reverse
+btuF 3214281 3215081 801 1 reverse
+mtn 3215074 3215772 699 1 reverse
+dgt 3215856 3217373 1518 1 forward
+degP 3217503 3218927 1425 1 forward
+cdaR 3219082 3220239 1158 1 forward
+yaeH 3220328 3220714 387 1 reverse
+yaeI 3220876 3221688 813 1 reverse
+dapD 3221742 3222566 825 1 reverse
+glnD 3222597 3225269 2673 1 reverse
+map 3225331 3226125 795 1 reverse
+rpsB 3226493 3227218 726 1 forward
+tsf 3227476 3228327 852 1 forward
+pyrH 3228474 3229199 726 1 forward
+frr 3229491 3230048 558 1 forward
+dxr 3230140 3231336 1197 1 forward
+ispU 3231522 3232283 762 1 forward
+cdsA 3232296 3233153 858 1 forward
+rseP 3233165 3234517 1353 1 forward
+bamA 3234547 3236979 2433 1 forward
+skp 3237101 3237586 486 1 forward
+lpxD 3237590 3238615 1026 1 forward
+fabZ 3238720 3239175 456 1 forward
+lpxA 3239179 3239967 789 1 forward
+lpxB 3239967 3241115 1149 1 forward
+rnhB 3241112 3241708 597 1 forward
+dnaE 3241745 3245227 3483 1 forward
+accA 3245240 3246199 960 1 forward
+ldcC 3246298 3248439 2142 1 forward
+yaeR 3248496 3248885 390 1 forward
+tilS 3248950 3250248 1299 1 forward
+rof 3250297 3250551 255 1 reverse
+yaeP 3250544 3250744 201 1 reverse
+yaeQ 3250910 3251455 546 1 forward
+arfB 3251452 3251874 423 1 forward
+nlpE 3251888 3252598 711 1 forward
+yaeF 3252798 3253622 825 1 reverse
+proS 3253676 3255394 1719 1 reverse
+trmO 3255506 3256213 708 1 reverse
+rcsF 3256210 3256614 405 1 reverse
+metQ 3256732 3257547 816 1 reverse
+metI 3257587 3258240 654 1 reverse
+metN 3258233 3259264 1032 1 reverse
+gmhB 3259452 3260027 576 1 forward
+dkgB 3265786 3266589 804 1 forward
+yafC 3266586 3267500 915 1 reverse
+yafD 3267741 3268541 801 1 forward
+yafE 3268545 3269168 624 1 forward
+mltD 3269216 3270574 1359 1 reverse
+gloB 3270646 3271401 756 1 reverse
+yafS 3271435 3272157 723 1 forward
+rnhA 3272154 3272621 468 1 reverse
+dnaQ 3272686 3273417 732 1 forward
+yafT 3273954 3274739 786 1 forward
+ykfM 3274876 3275355 480 1 reverse
+yafU 3275365 3275703 339 1 reverse
+yafF 3275809 3275997 189 1 forward
+yafV 3276038 3276808 771 1 reverse
+ivy 3276962 3277435 474 1 forward
+fadE 3277478 3279922 2445 1 reverse
+lpcA 3280162 3280740 579 1 forward
+yafJ 3280946 3281713 768 1 forward
+yafK 3281684 3282424 741 1 reverse
+yafQ 3282580 3282858 279 1 reverse
+dinJ 3282861 3283121 261 1 reverse
+yafL 3283331 3284080 750 1 forward
+rayT 3284256 3284753 498 1 forward
+lfhA 3284977 3286689 1713 1 reverse
+lafU 3286691 3287446 756 1 forward
+dinB 3287517 3288572 1056 1 forward
+yafN 3288624 3288917 294 1 forward
+yafO 3288920 3289318 399 1 forward
+yafP 3289328 3289780 453 1 forward
+ykfJ 3290086 3290352 267 1 forward
+prfH 3290321 3290821 501 1 forward
+pepD 3290878 3292335 1458 1 reverse
+gpt 3292596 3293054 459 1 forward
+frsA 3293146 3294390 1245 1 forward
+crl 3294448 3295625 402 2 forward
+insB9 3294542 3295045 504 1 reverse
+insA9 3294964 3295239 276 1 reverse
+phoE 3295664 3296719 1056 1 reverse
+proB 3297007 3298110 1104 1 forward
+proA 3298122 3299375 1254 1 forward
+ykfN 3299769 3299831 63 1 reverse
+ykfI 3299947 3300288 342 1 reverse
+yafW 3300309 3300626 318 1 reverse
+ykfH 3300645 3300866 222 1 reverse
+ykfG 3300875 3301351 477 1 reverse
+yafX 3301367 3301825 459 1 reverse
+ykfF 3301923 3302162 240 1 reverse
+ykfB 3302239 3302706 468 1 reverse
+yafY 3302729 3303172 444 1 reverse
+yafZ 3303803 3304624 822 1 reverse
+ykfA 3304716 3305579 864 1 reverse
+perR 3305908 3306801 894 1 reverse
+insN 3306897 3308809 690 2 forward
+insI-1 3307222 3308373 1152 1 forward
+ykfC 3309466 3310611 1146 1 forward
+insH-1 3310720 3311736 1017 1 reverse
+mmuP 3311944 3313347 1404 1 forward
+mmuM 3313334 3314266 933 1 forward
+afuC 3314375 3315421 1047 1 reverse
+afuB 3315433 3315781 349 1 reverse
+insB-2 3315797 3316300 504 1 reverse
+insA-2 3316219 3316494 276 1 reverse
+yagB 3317004 3317354 351 1 reverse
+yagA 3317448 3318602 1155 1 reverse
+yagE 3318897 3319805 909 1 forward
+yagF 3319820 3321787 1968 1 forward
+yagG 3322014 3323396 1383 1 forward
+yagH 3323408 3325018 1611 1 forward
+xynR 3325023 3325781 759 1 reverse
+argF 3325920 3326924 1005 1 reverse
+ykgS 3327129 3327257 129 1 forward
+insB-3 3327268 3327771 504 1 reverse
+insA-3 3327690 3327965 276 1 reverse
+yagJ 3328119 3328850 732 1 forward
+yagK 3328941 3329567 627 1 reverse
+yagL 3329839 3330537 699 1 reverse
+yagM 3330564 3331418 855 1 reverse
+ykgV 3331537 3331761 225 1 reverse
+yagN 3331758 3332198 441 1 reverse
+intF 3332315 3333715 1401 1 reverse
+yagP 3334000 3334410 411 1 reverse
+paoD 3334389 3335345 957 1 reverse
+paoC 3335355 3337553 2199 1 reverse
+paoB 3337550 3338506 957 1 reverse
+paoA 3338503 3339192 690 1 reverse
+yagU 3339610 3340224 615 1 forward
+ykgJ 3340472 3340801 330 1 reverse
+ecpE 3341114 3341824 711 1 reverse
+ecpD 3341793 3343436 1644 1 reverse
+ecpC 3343426 3345951 2526 1 reverse
+ecpB 3345977 3346645 669 1 reverse
+ecpA 3346703 3347290 588 1 reverse
+ecpR 3347365 3347955 591 1 reverse
+ykgL 3348731 3348958 228 1 forward
+ykgO 3348993 3349133 141 1 reverse
+ykgM 3349133 3349396 264 1 reverse
+ykgR 3349760 3349861 102 1 reverse
+ykgP 3350335 3350424 90 1 reverse
+eaeH 3350976 3351863 888 1 forward
+insE-1 3351910 3352209 300 1 forward
+insF-1 3352206 3353072 867 1 forward
+ykgA 3353069 3353755 687 1 reverse
+rclC 3354345 3354938 594 1 reverse
+rclB 3354950 3355186 237 1 reverse
+rclA 3355295 3356620 1326 1 reverse
+rclR 3356846 3357700 855 1 forward
+ykgE 3358227 3358946 720 1 forward
+ykgF 3358957 3360384 1428 1 forward
+ykgG 3360377 3361072 696 1 forward
+ykgH 3361315 3361983 669 1 reverse
+betA 3362196 3363866 1671 1 reverse
+betB 3363880 3365352 1473 1 reverse
+betI 3365366 3365953 588 1 reverse
+betT 3366082 3368115 2034 1 forward
+yahV 3368421 3368495 75 1 forward
+pdeL 3368990 3370078 1089 1 forward
+yahB 3370120 3371052 933 1 reverse
+yahC 3371144 3371641 498 1 reverse
+yahD 3371899 3372504 606 1 forward
+yahE 3372544 3373407 864 1 forward
+yahF 3373397 3374944 1548 1 forward
+yahG 3374944 3376362 1419 1 forward
+yahH 3376412 3376708 297 1 forward
+yahI 3376784 3377734 951 1 forward
+yahJ 3377744 3379126 1383 1 forward
+yahK 3379503 3380552 1050 1 forward
+yahL 3380795 3381610 816 1 forward
+yahM 3382023 3382268 246 1 forward
+yahN 3382285 3382956 672 1 reverse
+yahO 3383103 3383378 276 1 forward
+prpR 3383476 3385062 1587 1 reverse
+prpB 3385301 3386191 891 1 forward
+prpC 3386631 3387800 1170 1 forward
+prpD 3387834 3389285 1452 1 forward
+prpE 3389325 3391211 1887 1 forward
+codB 3391541 3392800 1260 1 forward
+codA 3392790 3394073 1284 1 forward
+cynR 3394410 3395309 900 1 reverse
+cynT 3395418 3396077 660 1 forward
+cynS 3396108 3396578 471 1 forward
+cynX 3396611 3397765 1155 1 forward
+lacA 3397868 3398479 612 1 reverse
+lacY 3398545 3399798 1254 1 reverse
+lacZ 3399850 3402924 3075 1 reverse
+lacI 3403047 3404129 1083 1 reverse
+mhpR 3404206 3405039 834 1 reverse
+mhpA 3405230 3406894 1665 1 forward
+mhpB 3406896 3407840 945 1 forward
+mhpC 3407858 3408724 867 1 forward
+mhpD 3408734 3409543 810 1 forward
+mhpF 3409540 3410490 951 1 forward
+mhpE 3410487 3411500 1014 1 forward
+mhpT 3412078 3413289 1212 1 forward
+yaiL 3413391 3413930 540 1 forward
+frmB 3414154 3414987 834 1 reverse
+frmA 3415081 3416190 1110 1 reverse
+frmR 3416225 3416500 276 1 reverse
+yaiO 3416688 3417461 774 1 reverse
+yaiX 3417463 3419491 699 2 reverse
+insC-1 3417970 3418335 366 1 forward
+insD-1 3418293 3419198 906 1 forward
+yaiP 3419358 3420554 1197 1 reverse
+ykiC 3420579 3420698 120 1 forward
+yaiS 3420678 3421235 558 1 reverse
+tauA 3421851 3422813 963 1 forward
+tauB 3422826 3423593 768 1 forward
+tauC 3423590 3424417 828 1 forward
+tauD 3424414 3425265 852 1 forward
+hemB 3425372 3426346 975 1 reverse
+yaiT 3426870 3431037 2907 2 forward
+insF-2 3428358 3429224 867 1 reverse
+insE-2 3429221 3429520 300 1 reverse
+iprA 3431125 3431748 624 1 forward
+ampH 3431749 3432906 1158 1 reverse
+sbmA 3433258 3434478 1221 1 forward
+yaiW 3434491 3435585 1095 1 forward
+yaiY 3435644 3435952 309 1 reverse
+yaiZ 3436212 3436424 213 1 forward
+ddlA 3436448 3437542 1095 1 reverse
+iraP 3438005 3438265 261 1 forward
+phoA 3438366 3439781 1416 1 forward
+psiF 3439900 3440220 321 1 forward
+dgcC 3440322 3441437 1116 1 forward
+proC 3441454 3442263 810 1 reverse
+yaiI 3442383 3442841 459 1 forward
+aroL 3443024 3443548 525 1 forward
+yaiA 3443598 3443789 192 1 forward
+aroM 3444047 3444724 678 1 forward
+ppnP 3444796 3445080 285 1 forward
+ykiA 3445228 3445569 342 1 forward
+ykiD 3445566 3445649 84 1 forward
+rdgC 3445727 3446638 912 1 reverse
+mak 3446763 3447671 909 1 forward
+araJ 3447916 3449100 1185 1 reverse
+sbcC 3449226 3452372 3147 1 reverse
+sbcD 3452369 3453571 1203 1 reverse
+phoB 3453761 3454450 690 1 forward
+phoR 3454508 3455803 1296 1 forward
+brnQ 3456210 3457529 1320 1 forward
+proY 3457605 3458978 1374 1 forward
+malZ 3459137 3460951 1815 1 forward
+acpH 3460956 3461537 582 1 reverse
+queA 3461630 3462700 1071 1 forward
+tgt 3462756 3463883 1128 1 forward
+yajC 3463906 3464238 333 1 forward
+secD 3464266 3466113 1848 1 forward
+secF 3466124 3467095 972 1 forward
+yajD 3467224 3467571 348 1 forward
+tsx 3467748 3468632 885 1 reverse
+yajI 3468931 3469470 540 1 reverse
+nrdR 3469621 3470070 450 1 forward
+ribD 3470074 3471177 1104 1 forward
+ribE 3471266 3471736 471 1 forward
+nusB 3471756 3472175 420 1 forward
+thiL 3472253 3473230 978 1 forward
+pgpA 3473208 3473726 519 1 forward
+yajO 3473780 3474754 975 1 reverse
+dxs 3474934 3476796 1863 1 reverse
+ispA 3476821 3477720 900 1 reverse
+xseB 3477720 3477962 243 1 reverse
+thiI 3478168 3479616 1449 1 forward
+yajL 3479670 3480260 591 1 reverse
+panE 3480223 3481134 912 1 reverse
+yajQ 3481302 3481793 492 1 forward
+yajR 3481921 3483285 1365 1 reverse
+cyoE 3483434 3484324 891 1 reverse
+cyoD 3484336 3484665 330 1 reverse
+cyoC 3484665 3485279 615 1 reverse
+cyoB 3485269 3487260 1992 1 reverse
+cyoA 3487282 3488229 948 1 reverse
+ampG 3488689 3490164 1476 1 reverse
+yajG 3490208 3490786 579 1 reverse
+bolA 3491091 3491408 318 1 forward
+tig 3491752 3493050 1299 1 forward
+clpP 3493296 3493919 624 1 forward
+clpX 3494045 3495319 1275 1 forward
+lon 3495507 3497861 2355 1 forward
+hupB 3498070 3498342 273 1 forward
+ppiD 3498534 3500405 1872 1 forward
+ybaV 3500556 3500927 372 1 forward
+fadM 3501021 3501419 399 1 forward
+queC 3501471 3502166 696 1 reverse
+ybaE 3502231 3503931 1701 1 reverse
+cof 3504031 3504849 819 1 forward
+decR 3505002 3505460 459 1 forward
+mdlA 3505490 3507262 1773 1 forward
+mdlB 3507255 3509036 1782 1 forward
+glnK 3509217 3509555 339 1 forward
+amtB 3509585 3510871 1287 1 forward
+tesB 3510920 3511780 861 1 reverse
+ybaY 3511998 3512570 573 1 forward
+atl 3512601 3512990 390 1 reverse
+ybaA 3513291 3513644 354 1 forward
+pdeB 3513686 3515236 1551 1 reverse
+ylaC 3515400 3515870 471 1 reverse
+maa 3515986 3516537 552 1 reverse
+hha 3516709 3516927 219 1 reverse
+tomB 3516953 3517327 375 1 reverse
+acrB 3517873 3521022 3150 1 reverse
+acrA 3521045 3522238 1194 1 reverse
+acrR 3522380 3523027 648 1 forward
+mscK 3523155 3526517 3363 1 forward
+ybaM 3526729 3526890 162 1 reverse
+priC 3526904 3527431 528 1 reverse
+ybaN 3527501 3527878 378 1 forward
+apt 3528031 3528582 552 1 forward
+dnaX 3528711 3530642 1932 1 forward
+dnaX 3528711 3530005 1296 2 forward
+ybaB 3530695 3531024 330 1 forward
+recR 3531024 3531629 606 1 forward
+htpG 3531739 3533613 1875 1 forward
+adk 3533794 3534438 645 1 forward
+hemH 3534674 3535636 963 1 forward
+aes 3535633 3536592 960 1 reverse
+gsk 3536744 3538048 1305 1 forward
+ybaL 3538181 3539857 1677 1 reverse
+fsr 3540095 3541315 1221 1 reverse
+ushA 3541533 3543185 1653 1 forward
+ybaK 3543222 3543701 480 1 reverse
+ybaP 3543905 3544699 795 1 reverse
+ybaQ 3544837 3545178 342 1 forward
+copA 3545494 3547998 2505 1 reverse
+copA 3547787 3547998 213 2 reverse
+glsA 3548260 3549192 933 1 forward
+ybaT 3549195 3550487 1293 1 forward
+cueR 3550612 3551019 408 1 forward
+ybbJ 3551020 3551478 459 1 reverse
+qmcA 3551475 3552392 918 1 reverse
+fetA 3552538 3553215 678 1 forward
+fetB 3553202 3553981 780 1 forward
+cnoX 3554044 3554898 855 1 reverse
+ybbO 3554959 3555768 810 1 reverse
+tesA 3555758 3556384 627 1 reverse
+ybbA 3556352 3557038 687 1 forward
+ybbP 3557035 3559449 2415 1 forward
+rhsD 3559880 3564160 4281 1 forward
+ybbC 3564200 3564568 369 1 forward
+ylbH 3564568 3565278 711 1 forward
+ybbD 3565259 3565749 491 1 forward
+ylbI 3566116 3566211 96 1 forward
+ylbG 3566264 3566635 372 1 reverse
+selU 3566751 3567845 1095 1 reverse
+allS 3567914 3568840 927 1 reverse
+allA 3569070 3569552 483 1 forward
+allR 3569630 3570445 816 1 forward
+gcl 3570535 3572316 1782 1 forward
+hyi 3572329 3573105 777 1 forward
+glxR 3573205 3574083 879 1 forward
+ybbW 3574252 3575706 1455 1 forward
+allB 3575766 3577127 1362 1 forward
+ybbY 3577184 3578485 1302 1 forward
+glxK 3578507 3579652 1146 1 forward
+allE 3579880 3580665 786 1 reverse
+allC 3580676 3581911 1236 1 reverse
+allD 3581933 3582982 1050 1 reverse
+fdrA 3583299 3584966 1668 1 forward
+ylbE 3584976 3586235 1260 1 forward
+ylbF 3586246 3587061 816 1 forward
+ybcF 3587058 3587951 894 1 forward
+purK 3588146 3589213 1068 1 reverse
+purE 3589210 3589719 510 1 reverse
+lpxH 3589837 3590559 723 1 reverse
+ppiB 3590562 3591056 495 1 reverse
+cysS 3591230 3592615 1386 1 forward
+ybcI 3592651 3593172 522 1 reverse
+ybcJ 3593280 3593492 213 1 reverse
+folD 3593494 3594360 867 1 reverse
+sfmA 3594831 3595373 543 1 forward
+sfmC 3595593 3596285 693 1 forward
+sfmD 3596316 3598919 2604 1 forward
+sfmH 3598955 3599938 984 1 forward
+sfmF 3599949 3600464 516 1 forward
+fimZ 3600467 3601099 633 1 reverse
+intD 3601434 3602597 1164 1 reverse
+xisD 3602477 3602698 222 1 reverse
+exoD 3602717 3602980 264 1 reverse
+renD 3603303 3604866 306 2 forward
+insE-3 3603461 3603760 300 1 forward
+insF-3 3603757 3604623 867 1 forward
+emrE 3604934 3605266 333 1 forward
+ylcJ 3605314 3605463 150 1 forward
+ybcK 3605521 3607047 1527 1 forward
+ybcL 3607512 3608063 552 1 forward
+ybcM 3608073 3608870 798 1 forward
+ylcH 3608987 3609088 102 1 forward
+ybcN 3609085 3609540 456 1 forward
+ninE 3609540 3609710 171 1 forward
+ybcO 3609703 3609993 291 1 forward
+rusA 3609990 3610352 363 1 forward
+ylcG 3610349 3610489 141 1 forward
+ybcQ 3610575 3610958 384 1 forward
+nmpC 3611148 3613444 1098 2 reverse
+insH-2 3611356 3612372 1017 1 reverse
+essD 3614017 3614232 216 1 forward
+rrrD 3614232 3614729 498 1 forward
+rzpD 3614726 3615187 462 1 forward
+rzoD 3614946 3615128 183 1 forward
+borD 3615219 3615512 294 1 reverse
+ybcV 3615803 3616213 411 1 reverse
+ybcW 3616499 3616705 207 1 forward
+ylcI 3616870 3617064 195 1 reverse
+nohD 3617453 3617998 546 1 forward
+aaaD 3617973 3618281 309 1 forward
+tfaD 3618153 3618716 564 1 forward
+ybcY 3618771 3619425 655 1 reverse
+tfaX 3619494 3619679 186 1 forward
+appY 3620300 3621049 750 1 forward
+ompT 3621299 3622252 954 1 reverse
+envY 3622766 3623527 762 1 reverse
+ybcH 3623710 3624600 891 1 reverse
+nfrA 3624601 3627573 2973 1 reverse
+nfrB 3627560 3629797 2238 1 reverse
+cusS 3629947 3631389 1443 1 reverse
+cusR 3631379 3632062 684 1 reverse
+cusC 3632219 3633592 1374 1 forward
+cusF 3633750 3634082 333 1 forward
+cusB 3634098 3635321 1224 1 forward
+cusA 3635333 3638476 3144 1 forward
+pheP 3638578 3639954 1377 1 forward
+ybdG 3640035 3641282 1248 1 reverse
+nfsB 3641390 3642043 654 1 reverse
+ybdF 3642137 3642505 369 1 reverse
+ybdJ 3642570 3642818 249 1 reverse
+ybdK 3642884 3644002 1119 1 reverse
+hokE 3644455 3644607 153 1 forward
+insL-2 3644684 3645796 1113 1 forward
+entD 3646078 3646698 621 1 reverse
+fepA 3646873 3649113 2241 1 reverse
+fes 3649356 3650558 1203 1 forward
+ybdZ 3650561 3650779 219 1 forward
+entF 3650776 3654657 3882 1 forward
+fepE 3654873 3656006 1134 1 forward
+fepC 3656003 3656818 816 1 reverse
+fepG 3656815 3657807 993 1 reverse
+fepD 3657804 3658808 1005 1 reverse
+entS 3658919 3660169 1251 1 forward
+fepB 3660173 3661129 957 1 reverse
+entC 3661504 3662679 1176 1 forward
+entE 3662689 3664299 1611 1 forward
+entB 3664313 3665170 858 1 forward
+entA 3665170 3665916 747 1 forward
+entH 3665919 3666332 414 1 forward
+cstA 3666513 3668618 2106 1 forward
+ybdD 3668801 3668998 198 1 forward
+hcxA 3669008 3670096 1089 1 reverse
+ybdL 3670205 3671365 1161 1 forward
+ybdM 3671366 3671995 630 1 reverse
+ybdN 3671968 3673188 1221 1 reverse
+ybdO 3673335 3674237 903 1 reverse
+dsbG 3674446 3675192 747 1 reverse
+ahpC 3675564 3676127 564 1 forward
+ahpF 3676372 3677937 1566 1 forward
+uspG 3678058 3678486 429 1 reverse
+ybdR 3678707 3679945 1239 1 forward
+yldA 3679949 3680038 90 1 reverse
+rnk 3680176 3680586 411 1 reverse
+rna 3680816 3681622 807 1 reverse
+citT 3681736 3683199 1464 1 reverse
+citG 3683250 3684128 879 1 reverse
+citX 3684103 3684654 552 1 reverse
+citF 3684658 3686190 1533 1 reverse
+citE 3686201 3687109 909 1 reverse
+citD 3687106 3687402 297 1 reverse
+citC 3687417 3688475 1059 1 reverse
+dpiB 3688854 3690512 1659 1 forward
+dpiA 3690481 3691161 681 1 forward
+dcuC 3691202 3692587 1386 1 reverse
+pagP 3693176 3693736 561 1 forward
+cspE 3693911 3694120 210 1 forward
+crcB 3694174 3694557 384 1 reverse
+ybeM 3694650 3695437 788 1 forward
+tatE 3695566 3695769 204 1 forward
+lipA 3695870 3696835 966 1 reverse
+ybeF 3697044 3697997 954 1 reverse
+lipB 3698256 3698897 642 1 reverse
+ybeD 3698998 3699261 264 1 reverse
+dacA 3699371 3700582 1212 1 reverse
+rlpA 3700721 3701809 1089 1 reverse
+mrdB 3701820 3702932 1113 1 reverse
+mrdA 3702935 3704836 1902 1 reverse
+rlmH 3704867 3705334 468 1 reverse
+rsfS 3705338 3705655 318 1 reverse
+cobC 3705915 3706526 612 1 reverse
+nadD 3706550 3707191 642 1 reverse
+holA 3707193 3708224 1032 1 reverse
+lptE 3708224 3708805 582 1 reverse
+leuS 3708820 3711402 2583 1 reverse
+ybeL 3711637 3712119 483 1 forward
+ybeQ 3712189 3713166 978 1 reverse
+ybeR 3713330 3714037 708 1 forward
+djlB 3714034 3715461 1428 1 forward
+ybeT 3715471 3716025 555 1 reverse
+ybeU 3716127 3716834 708 1 forward
+djlC 3716831 3718282 1452 1 forward
+hscC 3718342 3720012 1671 1 reverse
+rihA 3720096 3721031 936 1 reverse
+gltL 3721149 3721874 726 1 reverse
+gltK 3721874 3722548 675 1 reverse
+gltJ 3722548 3723288 741 1 reverse
+gltI 3723458 3724366 909 1 reverse
+insH-3 3724616 3725632 1017 1 reverse
+lnt 3725962 3727500 1539 1 reverse
+ybeX 3727525 3728403 879 1 reverse
+ybeY 3728493 3728960 468 1 reverse
+ybeZ 3728957 3729997 1041 1 reverse
+miaB 3730150 3731574 1425 1 reverse
+ubiF 3731720 3732895 1176 1 forward
+asnB 3734132 3735796 1665 1 reverse
+umpH 3736193 3736945 753 1 reverse
+nagC 3736993 3738213 1221 1 reverse
+nagA 3738222 3739370 1149 1 reverse
+nagB 3739430 3740230 801 1 reverse
+nagE 3740563 3742509 1947 1 forward
+glnS 3742712 3744376 1665 1 forward
+chiP 3744953 3746359 1407 1 forward
+chiQ 3746409 3746735 327 1 forward
+fur 3746819 3747265 447 1 reverse
+uof 3747258 3747344 87 1 reverse
+fldA 3747554 3748084 531 1 reverse
+ybfE 3748224 3748517 294 1 reverse
+ybfF 3748657 3749421 765 1 reverse
+seqA 3749606 3750151 546 1 forward
+pgm 3750177 3751817 1641 1 forward
+ybfP 3752031 3752525 495 1 forward
+ybfG 3752566 3753216 651 1 reverse
+potE 3753565 3754884 1320 1 reverse
+speF 3754881 3757079 2199 1 reverse
+ybfK 3757202 3757459 258 1 forward
+kdpE 3757675 3758352 678 1 reverse
+kdpD 3758349 3761033 2685 1 reverse
+kdpC 3761026 3761598 573 1 reverse
+kdpB 3761607 3763655 2049 1 reverse
+kdpA 3763678 3765351 1674 1 reverse
+kdpF 3765351 3765440 90 1 reverse
+ybfA 3765753 3765959 207 1 forward
+rhsC 3766202 3770395 4194 1 forward
+ybfB 3770395 3770721 327 1 forward
+ybfO 3770839 3772272 1434 1 forward
+ybfC 3772269 3772838 570 1 forward
+ybfQ 3773064 3773318 255 1 forward
+ybfL 3773519 3774580 1062 1 forward
+ybfD 3774711 3775472 762 1 forward
+ybgA 3775620 3776129 510 1 forward
+phr 3776126 3777544 1419 1 forward
+dtpD 3777694 3779175 1482 1 reverse
+ybgI 3779446 3780189 744 1 forward
+pxpB 3780212 3780868 657 1 forward
+pxpC 3780862 3781794 933 1 forward
+pxpA 3781784 3782518 735 1 forward
+nei 3782554 3783345 792 1 forward
+abrB 3783342 3784388 1047 1 reverse
+ybgO 3784540 3785601 1062 1 reverse
+ybgP 3785598 3786326 729 1 reverse
+ybgQ 3786341 3788788 2448 1 reverse
+ybgD 3788848 3789414 567 1 reverse
+gltA 3789804 3791087 1284 1 reverse
+ybgU 3791293 3791400 108 1 reverse
+sdhC 3791796 3792185 390 1 forward
+sdhD 3792179 3792526 348 1 forward
+sdhA 3792526 3794292 1767 1 forward
+sdhB 3794308 3795024 717 1 forward
+sucA 3795325 3798126 2802 1 forward
+sucB 3798141 3799358 1218 1 forward
+sucC 3799633 3800799 1167 1 forward
+sucD 3800799 3801668 870 1 forward
+mngR 3801772 3802494 723 1 reverse
+mngA 3802603 3804579 1977 1 forward
+mngB 3804597 3807230 2634 1 forward
+cydA 3808077 3809645 1569 1 forward
+cydB 3809661 3810800 1140 1 forward
+cydX 3810815 3810928 114 1 forward
+ybgE 3810928 3811221 294 1 forward
+ybgC 3811371 3811775 405 1 forward
+tolQ 3811772 3812464 693 1 forward
+tolR 3812468 3812896 429 1 forward
+tolA 3812961 3814226 1266 1 forward
+tolB 3814359 3815651 1293 1 forward
+pal 3815686 3816207 522 1 forward
+cpoB 3816217 3817008 792 1 forward
+nadA 3818704 3819747 1044 1 forward
+pnuC 3819785 3820504 720 1 forward
+zitB 3820501 3821442 942 1 reverse
+ybgS 3821556 3821936 381 1 reverse
+aroG 3822252 3823304 1053 1 forward
+gpmA 3823462 3824214 753 1 reverse
+galM 3824416 3825456 1041 1 reverse
+galK 3825450 3826598 1149 1 reverse
+galT 3826602 3827648 1047 1 reverse
+galE 3827658 3828674 1017 1 reverse
+modF 3828935 3830407 1473 1 reverse
+modE 3830475 3831263 789 1 reverse
+acrZ 3831392 3831541 150 1 forward
+modA 3831708 3832481 774 1 forward
+modB 3832481 3833170 690 1 forward
+modC 3833173 3834231 1059 1 forward
+ybhA 3834232 3835050 819 1 reverse
+pgl 3835205 3836200 996 1 forward
+ybhD 3836241 3837194 954 1 reverse
+ybhH 3837378 3838430 1053 1 forward
+ybhI 3838506 3839939 1434 1 forward
+ybhJ 3840122 3842383 2262 1 forward
+ybhC 3842617 3843900 1284 1 reverse
+ybhB 3844052 3844528 477 1 reverse
+bioA 3844587 3845876 1290 1 reverse
+bioB 3845963 3847003 1041 1 forward
+bioF 3847000 3848154 1155 1 forward
+bioC 3848141 3848896 756 1 forward
+bioD 3848889 3849566 678 1 forward
+uvrB 3850145 3852166 2022 1 forward
+ybhK 3852358 3853266 909 1 reverse
+moaA 3853663 3854652 990 1 forward
+moaB 3854674 3855186 513 1 forward
+moaC 3855189 3855674 486 1 forward
+moaD 3855667 3855912 246 1 forward
+moaE 3855914 3856366 453 1 forward
+ybhL 3856503 3857207 705 1 forward
+ybhM 3857412 3858125 714 1 forward
+ybhN 3858161 3859117 957 1 reverse
+clsB 3859117 3860358 1242 1 reverse
+ybhP 3860355 3861116 762 1 reverse
+ybhQ 3861249 3861659 411 1 forward
+ybhR 3861621 3862727 1107 1 reverse
+ybhS 3862738 3863871 1134 1 reverse
+ybhF 3863864 3865600 1737 1 reverse
+ybhG 3865593 3866591 999 1 reverse
+cecR 3866591 3867262 672 1 reverse
+rhlE 3867491 3868855 1365 1 forward
+ybiA 3869087 3869569 483 1 reverse
+dinG 3869689 3871839 2151 1 forward
+ybiB 3871867 3872829 963 1 forward
+hcxB 3872970 3874055 1086 1 forward
+ybiJ 3874284 3874544 261 1 reverse
+ybiI 3874809 3875075 267 1 reverse
+ybiX 3875149 3875826 678 1 reverse
+fiu 3875868 3878150 2283 1 reverse
+mcbA 3878415 3878675 261 1 reverse
+rlmF 3878951 3879877 927 1 forward
+ybiO 3879874 3882099 2226 1 reverse
+glnQ 3882360 3883082 723 1 reverse
+glnP 3883079 3883738 660 1 reverse
+glnH 3883877 3884623 747 1 reverse
+dps 3885027 3885530 504 1 reverse
+rhtA 3885829 3886716 888 1 reverse
+yliM 3886951 3887016 66 1 forward
+ompX 3887069 3887584 516 1 forward
+opgE 3887633 3889216 1584 1 reverse
+mntS 3889488 3889616 129 1 reverse
+mntR 3889802 3890269 468 1 forward
+ybiR 3890266 3891384 1119 1 forward
+ldtB 3891443 3892363 921 1 reverse
+ybiT 3892582 3894174 1593 1 forward
+ybiU 3894415 3895680 1266 1 reverse
+ybiV 3895832 3896647 816 1 reverse
+ybiW 3896793 3899225 2433 1 reverse
+ybiY 3899231 3900130 900 1 reverse
+fsaA 3900261 3900923 663 1 forward
+moeB 3900999 3901748 750 1 reverse
+moeA 3901748 3902983 1236 1 reverse
+iaaA 3903187 3904152 966 1 forward
+gsiA 3904139 3906010 1872 1 forward
+gsiB 3906030 3907568 1539 1 forward
+gsiC 3907586 3908506 921 1 forward
+gsiD 3908509 3909420 912 1 forward
+pdeI 3909598 3911946 2349 1 forward
+dgcI 3911954 3913282 1329 1 forward
+rimO 3913329 3914654 1326 1 reverse
+bssR 3914867 3915250 384 1 forward
+yliI 3915361 3916476 1116 1 forward
+gstB 3916473 3917099 627 1 reverse
+dacC 3917346 3918548 1203 1 forward
+deoR 3918595 3919353 759 1 reverse
+ybjG 3919411 3920007 597 1 reverse
+mdfA 3920292 3921524 1233 1 forward
+ybjH 3921565 3921849 285 1 reverse
+ybjI 3921935 3922750 816 1 reverse
+ybjJ 3922750 3923958 1209 1 reverse
+rcdA 3924042 3924578 537 1 forward
+ybjL 3924753 3926438 1686 1 reverse
+ybjM 3926708 3927085 378 1 forward
+grxA 3927115 3927372 258 1 reverse
+ybjC 3927532 3927819 288 1 forward
+nfsA 3927803 3928525 723 1 forward
+rimK 3928586 3929488 903 1 forward
+ybjN 3929576 3930052 477 1 forward
+potF 3930403 3931515 1113 1 forward
+potG 3931610 3932743 1134 1 forward
+potH 3932753 3933706 954 1 forward
+potI 3933703 3934548 846 1 forward
+ybjO 3934608 3935096 489 1 forward
+rlmC 3935137 3936264 1128 1 forward
+artJ 3936463 3937194 732 1 reverse
+artM 3937485 3938153 669 1 reverse
+artQ 3938153 3938869 717 1 reverse
+artI 3938876 3939607 732 1 reverse
+artP 3939625 3940353 729 1 reverse
+ybjP 3940571 3941086 516 1 reverse
+ybjQ 3941212 3941535 324 1 forward
+amiD 3941532 3942362 831 1 forward
+ybjS 3942359 3943372 1014 1 reverse
+ybjT 3943471 3944901 1431 1 reverse
+ltaE 3944912 3945913 1002 1 reverse
+poxB 3945950 3947668 1719 1 reverse
+hcr 3947801 3948769 969 1 reverse
+hcp 3948781 3950433 1653 1 reverse
+lysO 3950577 3951476 900 1 reverse
+aqpZ 3951971 3952666 696 1 reverse
+ybjD 3953092 3954750 1659 1 forward
+ybjX 3954747 3955739 993 1 reverse
+macA 3955854 3956969 1116 1 forward
+macB 3956966 3958912 1947 1 forward
+cspD 3958985 3959209 225 1 reverse
+clpS 3959532 3959852 321 1 forward
+clpA 3959883 3962159 2277 1 forward
+infA 3962844 3963062 219 1 reverse
+aat 3963347 3964051 705 1 reverse
+cydC 3964093 3965814 1722 1 reverse
+cydD 3965815 3967581 1767 1 reverse
+trxB 3967704 3968669 966 1 reverse
+lrp 3969214 3969708 495 1 forward
+ftsK 3969843 3973832 3990 1 forward
+lolA 3973991 3974602 612 1 forward
+rarA 3974613 3975956 1344 1 forward
+serS 3976047 3977339 1293 1 forward
+dmsA 3977578 3980022 2445 1 forward
+dmsB 3980033 3980650 618 1 forward
+dmsC 3980652 3981515 864 1 forward
+ycaC 3981550 3982176 627 1 reverse
+ycaD 3982490 3983638 1149 1 forward
+ycaM 3983848 3985278 1431 1 forward
+ycaN 3985279 3986187 909 1 reverse
+ycaK 3986287 3986877 591 1 forward
+pflA 3986959 3987699 741 1 reverse
+pflB 3987891 3990173 2283 1 reverse
+focA 3990228 3991085 858 1 reverse
+ycaO 3991491 3993251 1761 1 reverse
+ycaP 3993381 3994073 693 1 forward
+serC 3994272 3995360 1089 1 forward
+aroA 3995431 3996714 1284 1 forward
+ycaL 3996883 3997647 765 1 forward
+cmk 3997820 3998503 684 1 forward
+rpsA 3998614 4000287 1674 1 forward
+ihfB 4000447 4000731 285 1 forward
+ycaI 4000939 4003203 2265 1 forward
+msbA 4003240 4004988 1749 1 forward
+lpxK 4004985 4005971 987 1 forward
+ycaQ 4006008 4007240 1233 1 forward
+ycaR 4007292 4007474 183 1 forward
+kdsB 4007471 4008217 747 1 forward
+ycbJ 4008371 4009264 894 1 forward
+elyC 4009241 4010020 780 1 reverse
+cmoM 4010156 4010941 786 1 forward
+mukF 4010938 4012260 1323 1 forward
+mukE 4012241 4012945 705 1 forward
+mukB 4012945 4017405 4461 1 forward
+ldtD 4017666 4019513 1848 1 forward
+ycbK 4019694 4020242 549 1 forward
+gloC 4020269 4020916 648 1 forward
+aspC 4021138 4022328 1191 1 reverse
+ompF 4022513 4023601 1089 1 reverse
+asnS 4024204 4025604 1401 1 reverse
+pncB 4025773 4026975 1203 1 reverse
+pepN 4027241 4029853 2613 1 forward
+ssuB 4029896 4030663 768 1 reverse
+ssuC 4030660 4031451 792 1 reverse
+ssuD 4031462 4032607 1146 1 reverse
+ssuA 4032604 4033563 960 1 reverse
+ssuE 4033556 4034131 576 1 reverse
+elfA 4034487 4035026 540 1 forward
+elfD 4035109 4035810 702 1 forward
+elfC 4035835 4038435 2601 1 forward
+elfG 4038426 4039496 1071 1 forward
+ycbU 4039508 4040050 543 1 forward
+ycbV 4040058 4040573 516 1 forward
+ycbF 4040566 4041276 711 1 forward
+pyrD 4041387 4042397 1011 1 forward
+zapC 4042571 4043113 543 1 forward
+ycbX 4043110 4044219 1110 1 reverse
+rlmL 4044463 4046571 2109 1 forward
+uup 4046583 4048490 1908 1 forward
+pqiA 4048620 4049873 1254 1 forward
+pqiB 4049878 4051518 1641 1 forward
+pqiC 4051515 4052078 564 1 forward
+rmf 4052334 4052501 168 1 forward
+fabA 4052571 4053089 519 1 reverse
+ycbZ 4053158 4054918 1761 1 reverse
+matP 4055104 4055556 453 1 forward
+ompA 4055632 4056672 1041 1 reverse
+sulA 4057029 4057538 510 1 reverse
+sxy 4057757 4058386 630 1 forward
+yccS 4058349 4060502 2154 1 reverse
+yccF 4060521 4060967 447 1 reverse
+helD 4061090 4063144 2055 1 forward
+mgsA 4063176 4063634 459 1 reverse
+yccT 4063730 4064392 663 1 reverse
+yccU 4064565 4064978 414 1 forward
+hspQ 4065023 4065340 318 1 reverse
+rlmI 4065398 4066588 1191 1 reverse
+yccX 4066683 4066961 279 1 forward
+tusE 4066958 4067287 330 1 reverse
+yccA 4067378 4068037 660 1 reverse
+hyaA 4068758 4069876 1119 1 forward
+hyaB 4069873 4071666 1794 1 forward
+hyaC 4071685 4072392 708 1 forward
+hyaD 4072389 4072976 588 1 forward
+hyaE 4072973 4073371 399 1 forward
+hyaF 4073368 4074225 858 1 forward
+appC 4074359 4075903 1545 1 forward
+appB 4075915 4077051 1137 1 forward
+appX 4077064 4077156 93 1 forward
+appA 4077236 4078534 1299 1 forward
+etk 4078649 4080829 2181 1 reverse
+etp 4080849 4081295 447 1 reverse
+gfcE 4081283 4082422 1140 1 reverse
+gfcD 4082468 4084564 2097 1 reverse
+gfcC 4084564 4085310 747 1 reverse
+gfcB 4085307 4085951 645 1 reverse
+gfcA 4086058 4086363 306 1 reverse
+insA-4 4086452 4086727 276 1 forward
+insB-4 4086646 4087149 504 1 forward
+cspH 4087582 4087794 213 1 reverse
+cspG 4088080 4088292 213 1 forward
+ymcF 4088303 4088491 189 1 forward
+ymcE 4088466 4088696 231 1 forward
+gnsA 4088686 4088859 174 1 forward
+yccM 4088908 4089981 1074 1 reverse
+torS 4090053 4092797 2745 1 reverse
+torT 4092880 4093908 1029 1 forward
+torR 4093881 4094573 693 1 reverse
+torC 4094703 4095875 1173 1 forward
+torA 4095875 4098421 2547 1 forward
+torD 4098418 4099017 600 1 forward
+cbpM 4099169 4099474 306 1 reverse
+cbpA 4099474 4100394 921 1 reverse
+yccE 4100655 4101911 1257 1 forward
+agp 4102204 4103445 1242 1 forward
+yccJ 4103483 4103710 228 1 reverse
+wrbA 4103731 4104327 597 1 reverse
+ymdF 4104700 4104873 174 1 forward
+rutG 4105130 4106458 1329 1 reverse
+rutF 4106479 4106973 495 1 reverse
+rutE 4106984 4107574 591 1 reverse
+rutD 4107584 4108384 801 1 reverse
+rutC 4108392 4108778 387 1 reverse
+rutB 4108790 4109482 693 1 reverse
+rutA 4109482 4110630 1149 1 reverse
+rutR 4110861 4111499 639 1 forward
+putA 4111539 4115501 3963 1 reverse
+ymdG 4115643 4115765 123 1 forward
+putP 4115924 4117432 1509 1 forward
+efeU 4117975 4118804 830 1 forward
+efeO 4118862 4119989 1128 1 forward
+efeB 4119995 4121266 1272 1 forward
+phoH 4121611 4122675 1065 1 forward
+pgaD 4122725 4123138 414 1 reverse
+pgaC 4123140 4124465 1326 1 reverse
+pgaB 4124458 4126476 2019 1 reverse
+pgaA 4126485 4128908 2424 1 reverse
+dgcT 4129495 4130853 1359 1 forward
+insF-4 4130894 4131760 867 1 reverse
+insE-4 4131757 4132056 300 1 reverse
+ymdE 4132163 4132465 303 1 forward
+ycdU 4132462 4133448 987 1 forward
+ghrA 4134505 4135443 939 1 forward
+ycdX 4135498 4136235 738 1 forward
+ycdY 4136259 4136813 555 1 forward
+ycdZ 4136915 4137406 492 1 forward
+csgG 4137470 4138303 834 1 reverse
+csgF 4138330 4138746 417 1 reverse
+csgE 4138771 4139160 390 1 reverse
+csgD 4139165 4139815 651 1 reverse
+csgB 4140570 4141025 456 1 forward
+csgA 4141066 4141521 456 1 forward
+csgC 4141580 4141912 333 1 forward
+ymdA 4142033 4142344 312 1 forward
+ymdB 4142439 4142972 534 1 forward
+clsC 4142974 4144395 1422 1 forward
+opgC 4144403 4145560 1158 1 reverse
+opgG 4145954 4147489 1536 1 forward
+opgH 4147482 4150025 2544 1 forward
+yceK 4150198 4150425 228 1 forward
+msyB 4150426 4150800 375 1 reverse
+mdtG 4150883 4152109 1227 1 reverse
+lpxL 4152281 4153201 921 1 reverse
+yceA 4153426 4154478 1053 1 forward
+yceI 4154520 4155095 576 1 reverse
+yceJ 4155099 4155665 567 1 reverse
+yceO 4155926 4156066 141 1 reverse
+solA 4156087 4157205 1119 1 reverse
+bssS 4157320 4157574 255 1 reverse
+dinI 4157861 4158106 246 1 reverse
+pyrC 4158180 4159226 1047 1 reverse
+yceB 4159332 4159892 561 1 reverse
+grxB 4160026 4160673 648 1 reverse
+mdtH 4160737 4161945 1209 1 reverse
+rimJ 4162181 4162765 585 1 forward
+yceH 4162776 4163423 648 1 forward
+yceM 4163425 4164348 924 1 forward
+murJ 4164458 4165993 1536 1 forward
+flgN 4166033 4166449 417 1 reverse
+flgM 4166454 4166747 294 1 reverse
+flgA 4166823 4167482 660 1 reverse
+flgB 4167637 4168053 417 1 forward
+flgC 4168057 4168461 405 1 forward
+flgD 4168473 4169168 696 1 forward
+flgE 4169193 4170401 1209 1 forward
+flgF 4170421 4171176 756 1 forward
+flgG 4171348 4172130 783 1 forward
+flgH 4172183 4172881 699 1 forward
+flgI 4172893 4173990 1098 1 forward
+flgJ 4173990 4174931 942 1 forward
+flgK 4174997 4176640 1644 1 forward
+flgL 4176652 4177605 954 1 forward
+rne 4177801 4180986 3186 1 reverse
+yceQ 4181121 4181441 321 1 forward
+rluC 4181559 4182518 960 1 forward
+yceF 4182630 4183214 585 1 reverse
+yceD 4183413 4183934 522 1 forward
+rpmF 4183986 4184159 174 1 forward
+plsX 4184240 4185310 1071 1 forward
+fabH 4185378 4186331 954 1 forward
+fabD 4186347 4187276 930 1 forward
+fabG 4187289 4188023 735 1 forward
+acpP 4188234 4188470 237 1 forward
+fabF 4188558 4189799 1242 1 forward
+pabC 4189919 4190728 810 1 forward
+mltG 4190731 4191753 1023 1 forward
+tmk 4191743 4192384 642 1 forward
+holB 4192381 4193385 1005 1 forward
+ycfH 4193396 4194193 798 1 forward
+ptsG 4194488 4195921 1434 1 forward
+fhuE 4195981 4198170 2190 1 reverse
+hinT 4198504 4198863 360 1 forward
+ycfL 4198866 4199243 378 1 forward
+lpoB 4199257 4199898 642 1 forward
+thiK 4199879 4200703 825 1 forward
+nagZ 4200714 4201739 1026 1 forward
+ycfP 4201762 4202304 543 1 forward
+ndh 4202704 4204008 1305 1 forward
+ycfJ 4204218 4204757 540 1 forward
+comR 4204819 4205451 633 1 reverse
+bhsA 4205692 4205949 258 1 forward
+ldtC 4206031 4206993 963 1 reverse
+mfd 4207137 4210583 3447 1 reverse
+ycfT 4210711 4211784 1074 1 reverse
+lolC 4212046 4213245 1200 1 forward
+lolD 4213238 4213939 702 1 forward
+lolE 4213939 4215183 1245 1 forward
+nagK 4215212 4216123 912 1 forward
+cobB 4216139 4216978 840 1 forward
+ycfZ 4217098 4217886 789 1 reverse
+ymfA 4217883 4218344 462 1 reverse
+potD 4218402 4219448 1047 1 reverse
+potC 4219445 4220239 795 1 reverse
+potB 4220236 4221063 828 1 reverse
+potA 4221077 4222213 1137 1 reverse
+pepT 4222463 4223689 1227 1 forward
+roxA 4223738 4224859 1122 1 reverse
+phoQ 4224935 4226395 1461 1 reverse
+phoP 4226395 4227066 672 1 reverse
+purB 4227235 4228605 1371 1 reverse
+hflD 4228609 4229250 642 1 reverse
+mnmA 4229286 4230392 1107 1 reverse
+nudJ 4230446 4230907 462 1 reverse
+rluE 4230917 4231570 654 1 reverse
+icd 4231742 4232992 1251 1 forward
+ymfD 4233486 4234151 666 1 reverse
+ymfE 4234152 4234856 705 1 reverse
+lit 4235314 4236207 894 1 forward
+intE 4236298 4237425 1128 1 reverse
+xisE 4237406 4237651 246 1 reverse
+ymfH 4237688 4237999 312 1 reverse
+ymfI 4238116 4238457 342 1 forward
+ymfJ 4238395 4238703 309 1 reverse
+ymfK 4238878 4239552 675 1 reverse
+ymfT 4239643 4239843 201 1 forward
+ymfL 4239887 4240444 558 1 forward
+ymfM 4240441 4240779 339 1 forward
+ymfN 4240789 4242156 1368 1 forward
+oweE 4240789 4241022 234 1 forward
+aaaE 4241020 4242156 1137 1 forward
+ymfR 4242168 4242350 183 1 forward
+beeE 4242350 4242823 474 1 forward
+jayE 4242750 4243541 792 1 forward
+ymfQ 4243532 4244116 585 1 forward
+ycfK 4244120 4244749 630 1 forward
+tfaP 4244751 4245164 414 1 forward
+tfaE 4245136 4245738 603 1 reverse
+stfE 4245738 4246274 537 1 reverse
+pinE 4246304 4246858 555 1 forward
+mcrA 4246965 4247798 834 1 forward
+icdC 4248032 4248196 165 1 forward
+iraM 4248299 4248622 324 1 reverse
+ymgK 4248879 4248923 45 1 reverse
+ymgL 4249159 4249269 111 1 reverse
+ycgX 4249322 4249726 405 1 reverse
+bluR 4249947 4250678 732 1 reverse
+bluF 4250883 4252094 1212 1 reverse
+ycgZ 4252408 4252644 237 1 forward
+ymgA 4252687 4252959 273 1 forward
+ariR 4252988 4253254 267 1 forward
+ymgC 4253367 4253615 249 1 forward
+pdeG 4253947 4255470 1524 1 forward
+ymgF 4255602 4255820 219 1 forward
+ycgH 4256220 4258867 2648 1 forward
+ymgD 4258924 4259253 330 1 reverse
+ymgG 4259263 4259607 345 1 reverse
+ymgI 4259609 4259782 174 1 reverse
+ymgJ 4259883 4260068 186 1 forward
+ycgI 4260183 4260526 344 1 forward
+minE 4260898 4261164 267 1 reverse
+minD 4261168 4261980 813 1 reverse
+minC 4262004 4262699 696 1 reverse
+ycgJ 4263219 4263587 369 1 forward
+pliG 4263690 4264091 402 1 reverse
+ycgL 4264300 4264626 327 1 forward
+ycgM 4264698 4265357 660 1 forward
+ycgN 4265434 4265895 462 1 forward
+hlyE 4266102 4267013 912 1 reverse
+umuD 4267386 4267805 420 1 forward
+umuC 4267805 4269073 1269 1 forward
+dsbB 4269119 4269649 531 1 reverse
+nhaB 4269795 4271336 1542 1 reverse
+fadR 4271557 4272276 720 1 forward
+ycgB 4272328 4273860 1533 1 reverse
+dadA 4274190 4275488 1299 1 forward
+dadX 4275498 4276568 1071 1 forward
+ymgM 4276879 4277082 204 1 forward
+cvrA 4276954 4278690 1737 1 reverse
+ldcA 4278785 4279699 915 1 reverse
+emtA 4279799 4280410 612 1 forward
+ycgR 4280412 4281146 735 1 reverse
+ymgE 4281347 4281601 255 1 forward
+ycgY 4281779 4282219 441 1 forward
+treA 4282298 4283995 1698 1 reverse
+dhaM 4284315 4285733 1419 1 reverse
+dhaL 4285744 4286376 633 1 reverse
+dhaK 4286387 4287457 1071 1 reverse
+dhaR 4287685 4289604 1920 1 forward
+ycgV 4289704 4292571 2868 1 reverse
+ychF 4293340 4294431 1092 1 reverse
+pth 4294548 4295132 585 1 reverse
+ychH 4295410 4295688 279 1 forward
+dauA 4295743 4297422 1680 1 reverse
+prs 4297547 4298494 948 1 reverse
+ispE 4298645 4299496 852 1 reverse
+lolB 4299496 4300119 624 1 reverse
+hemA 4300333 4301589 1257 1 forward
+prfA 4301631 4302713 1083 1 forward
+prmC 4302713 4303546 834 1 forward
+ychQ 4303543 4303935 393 1 forward
+ychA 4303939 4304748 810 1 forward
+kdsA 4304784 4305638 855 1 forward
+ldrA 4305787 4305894 108 1 reverse
+ldrB 4306322 4306429 108 1 reverse
+ldrC 4306857 4306964 108 1 reverse
+chaA 4307368 4308468 1101 1 reverse
+chaB 4308738 4308968 231 1 forward
+chaC 4309126 4309821 696 1 forward
+ychN 4309865 4310218 354 1 reverse
+ychO 4310403 4311797 1395 1 forward
+narL 4311798 4312448 651 1 reverse
+narX 4312441 4314237 1797 1 reverse
+narK 4314576 4315967 1392 1 forward
+narG 4316483 4320226 3744 1 forward
+narH 4320223 4321761 1539 1 forward
+narJ 4321758 4322468 711 1 forward
+narI 4322468 4323145 678 1 forward
+ychS 4323328 4323603 276 1 forward
+tpr 4323706 4323795 90 1 reverse
+purU 4324401 4325243 843 1 reverse
+ychJ 4325293 4325751 459 1 reverse
+rssA 4325864 4326769 906 1 forward
+rssB 4326861 4327874 1014 1 forward
+galU 4328076 4328984 909 1 forward
+hns 4329128 4329541 414 1 reverse
+tdk 4330146 4330763 618 1 forward
+insZ 4331045 4331941 897 1 reverse
+adhE 4332065 4334740 2676 1 reverse
+ychE 4335217 4335864 648 1 forward
+insH21 4336150 4337166 1017 1 forward
+oppA 4337801 4339432 1632 1 forward
+oppB 4339518 4340438 921 1 forward
+oppC 4340453 4341361 909 1 forward
+oppD 4341373 4342386 1014 1 forward
+oppF 4342383 4343387 1005 1 forward
+yciU 4343440 4343769 330 1 reverse
+clsA 4343804 4345264 1461 1 reverse
+yciY 4345407 4345580 174 1 forward
+kch 4345635 4346888 1254 1 reverse
+yciI 4347188 4347484 297 1 reverse
+tonB 4347708 4348427 720 1 forward
+yciA 4348467 4348865 399 1 reverse
+yciB 4348970 4349509 540 1 reverse
+yciC 4349539 4350282 744 1 reverse
+ompW 4350639 4351277 639 1 forward
+yciE 4351337 4351843 507 1 reverse
+yciF 4351889 4352389 501 1 reverse
+yciG 4352475 4352654 180 1 reverse
+trpA 4353035 4353841 807 1 reverse
+trpB 4353841 4355034 1194 1 reverse
+trpC 4355046 4356407 1362 1 reverse
+trpD 4356408 4358003 1596 1 reverse
+trpE 4358003 4359565 1563 1 reverse
+trpL 4359657 4359701 45 1 reverse
+yciV 4359839 4360720 882 1 forward
+yciO 4360717 4361337 621 1 forward
+yciQ 4361365 4363260 1896 1 forward
+rluB 4363471 4364346 876 1 forward
+btuR 4364386 4364976 591 1 reverse
+yciK 4364973 4365731 759 1 reverse
+sohB 4365951 4367000 1050 1 forward
+yciN 4367036 4367287 252 1 reverse
+topA 4367667 4370264 2598 1 forward
+cysB 4370474 4371448 975 1 forward
+ymiA 4371743 4371907 165 1 forward
+yciX 4371910 4372077 168 1 forward
+ymiC 4372191 4372286 96 1 forward
+acnA 4372450 4375125 2676 1 forward
+ribA 4375189 4375779 591 1 reverse
+pgpB 4375949 4376713 765 1 forward
+lapA 4376862 4377170 309 1 forward
+lapB 4377177 4378346 1170 1 forward
+pyrF 4378540 4379277 738 1 forward
+yciH 4379277 4379603 327 1 forward
+osmB 4379729 4379947 219 1 reverse
+yciT 4380216 4380965 750 1 reverse
+yciZ 4381055 4381228 174 1 reverse
+pdeR 4381376 4383361 1986 1 reverse
+ymiB 4383415 4383519 105 1 forward
+rnb 4383597 4385531 1935 1 reverse
+yciW 4385599 4386726 1128 1 reverse
+fabI 4386870 4387658 789 1 reverse
+ycjD 4388026 4388379 354 1 reverse
+sapF 4388447 4389253 807 1 reverse
+sapD 4389255 4390247 993 1 reverse
+sapC 4390247 4391137 891 1 reverse
+sapB 4391124 4392089 966 1 reverse
+sapA 4392086 4393729 1644 1 reverse
+ymjA 4394042 4394287 246 1 reverse
+puuP 4394421 4395806 1386 1 reverse
+ymjE 4395796 4395960 165 1 reverse
+puuA 4396109 4397527 1419 1 reverse
+puuD 4397739 4398503 765 1 forward
+puuR 4398530 4399087 558 1 forward
+puuC 4399362 4400849 1488 1 forward
+puuB 4400851 4402131 1281 1 forward
+puuE 4402169 4403434 1266 1 forward
+pspF 4403554 4404531 978 1 reverse
+pspA 4404698 4405366 669 1 forward
+pspB 4405420 4405644 225 1 forward
+pspC 4405644 4406003 360 1 forward
+pspD 4406012 4406233 222 1 forward
+pspE 4406308 4406622 315 1 forward
+ycjM 4406835 4408514 1680 1 forward
+ycjN 4408528 4409820 1293 1 forward
+ycjO 4409841 4410722 882 1 forward
+ycjP 4410709 4411551 843 1 forward
+ycjQ 4411582 4412634 1053 1 forward
+ycjR 4412653 4413441 789 1 forward
+ycjS 4413451 4414506 1056 1 forward
+ycjT 4414503 4416770 2268 1 forward
+ycjU 4416767 4417426 660 1 forward
+ycjV 4417440 4418408 969 1 forward
+ymjB 4418408 4418521 114 1 forward
+ompG 4418566 4419471 906 1 forward
+ycjW 4419582 4420580 999 1 reverse
+ycjX 4420736 4422133 1398 1 forward
+ycjF 4422130 4423191 1062 1 forward
+tyrR 4423339 4424880 1542 1 forward
+tpx 4424924 4425430 507 1 reverse
+ycjG 4425549 4426514 966 1 forward
+mpaA 4426489 4427217 729 1 reverse
+ymjC 4427299 4427481 183 1 reverse
+ymjD 4427487 4427552 66 1 reverse
+ycjY 4427552 4428472 921 1 reverse
+pgrR 4428610 4429509 900 1 forward
+mppA 4429846 4431459 1614 1 forward
+ynaI 4431510 4432541 1032 1 reverse
+insH-4 4432695 4433711 1017 1 forward
+ynaJ 4433984 4434241 258 1 forward
+uspE 4434291 4435241 951 1 reverse
+fnr 4435393 4436145 753 1 reverse
+ogt 4436340 4436855 516 1 reverse
+abgT 4436866 4438392 1527 1 reverse
+abgB 4438429 4439874 1446 1 reverse
+abgA 4439874 4441184 1311 1 reverse
+abgR 4441360 4442268 909 1 forward
+smrA 4442598 4443161 564 1 forward
+dgcM 4443182 4444414 1233 1 reverse
+zntB 4444669 4445652 984 1 forward
+ynaL 4445927 4446100 174 1 forward
+dbpA 4446130 4447503 1374 1 forward
+ttcA 4447632 4448567 936 1 reverse
+intR 4448619 4449854 1236 1 reverse
+xisR 4449856 4450071 216 1 reverse
+rcbA 4450150 4450359 210 1 reverse
+ralR 4450352 4450546 195 1 reverse
+recT 4450603 4451412 810 1 reverse
+recE 4451405 4454005 2601 1 reverse
+racC 4454107 4454382 276 1 reverse
+ydaE 4454457 4454627 171 1 reverse
+kilR 4454627 4454848 222 1 reverse
+sieB 4455290 4455778 489 1 forward
+ydaF 4455775 4455930 156 1 reverse
+ydaG 4455941 4456075 135 1 reverse
+racR 4456384 4456860 477 1 reverse
+ydaS 4456984 4457280 297 1 forward
+ydaT 4457303 4457725 423 1 forward
+ydaU 4457738 4458595 858 1 forward
+ydaV 4458602 4459348 747 1 forward
+ydaW 4459371 4459931 561 1 forward
+rzpR 4459964 4460263 300 1 forward
+rzoR 4460019 4460204 186 1 forward
+trkG 4460401 4461858 1458 1 forward
+ynaK 4461996 4462259 264 1 forward
+ydaY 4462240 4462599 360 1 forward
+ynaA 4463073 4464101 1029 1 forward
+lomR 4464008 4465603 399 2 forward
+insH-5 4464365 4465345 981 1 reverse
+stfR 4465668 4469030 3363 1 forward
+tfaR 4469030 4469605 576 1 forward
+pinR 4469703 4470293 591 1 reverse
+ynaE 4470610 4470843 234 1 reverse
+ynaM 4470912 4471025 114 1 reverse
+ttcC 4471577 4471627 51 1 reverse
+uspF 4471804 4472238 435 1 reverse
+ompN 4472379 4473512 1134 1 reverse
+ydbK 4473879 4477403 3525 1 reverse
+ydbJ 4477677 4477943 267 1 forward
+hslJ 4477940 4478362 423 1 reverse
+ldhA 4478473 4479462 990 1 reverse
+ydbH 4479670 4482309 2640 1 forward
+ynbE 4482306 4482491 186 1 forward
+ydbL 4482499 4482825 327 1 forward
+feaR 4482997 4483902 906 1 reverse
+feaB 4484138 4485637 1500 1 forward
+tynA 4485695 4487968 2274 1 reverse
+paaZ 4488216 4490261 2046 1 reverse
+paaA 4490546 4491475 930 1 forward
+paaB 4491487 4491774 288 1 forward
+paaC 4491783 4492529 747 1 forward
+paaD 4492544 4493041 498 1 forward
+paaE 4493049 4494119 1071 1 forward
+paaF 4494116 4494883 768 1 forward
+paaG 4494883 4495671 789 1 forward
+paaH 4495673 4497100 1428 1 forward
+paaI 4497090 4497512 423 1 forward
+paaJ 4497512 4498717 1206 1 forward
+paaK 4498744 4500057 1314 1 forward
+paaX 4500158 4501108 951 1 forward
+paaY 4501090 4501680 591 1 forward
+ynbG 4501784 4501849 66 1 reverse
+ydbA 4502011 4510632 6063 3 forward
+insD-2 4504540 4505445 906 1 reverse
+insC-2 4505403 4505768 366 1 reverse
+insI-2 4505977 4507128 1152 1 forward
+pdxI 4510840 4511700 861 1 forward
+ydbD 4511763 4514069 2307 1 forward
+ynbA 4514240 4514845 606 1 forward
+ynbB 4514845 4515741 897 1 forward
+ynbC 4515757 4517514 1758 1 forward
+ynbD 4517528 4518820 1293 1 forward
+azoR 4518874 4519479 606 1 reverse
+hrpA 4519680 4523582 3903 1 forward
+ydcF 4523854 4524654 801 1 forward
+aldA 4524851 4526290 1440 1 forward
+gapC 4526332 4527332 1001 1 reverse
+cybB 4527521 4528051 531 1 forward
+ydcA 4528296 4528469 174 1 forward
+hokB 4528541 4528690 150 1 reverse
+mokB 4528581 4528748 168 1 reverse
+trg 4529089 4530729 1641 1 forward
+ydcI 4530767 4531690 924 1 reverse
+ydcJ 4531907 4533250 1344 1 forward
+opgD 4533475 4535130 1656 1 forward
+ydcH 4535270 4535494 225 1 forward
+rimL 4535557 4536096 540 1 forward
+ydcK 4536088 4537068 981 1 reverse
+tehA 4537192 4538184 993 1 forward
+tehB 4538181 4538774 594 1 forward
+ydcL 4539076 4539744 669 1 forward
+insQ 4540336 4541484 1149 1 forward
+ydcO 4541524 4542699 1176 1 reverse
+sutR 4542791 4543327 537 1 forward
+rlhA 4543400 4545361 1962 1 forward
+yncJ 4545453 4545683 231 1 reverse
+hicA 4545905 4546081 177 1 forward
+hicB 4546127 4546543 417 1 forward
+ydcR 4546622 4548028 1407 1 forward
+ydcS 4548273 4549418 1146 1 forward
+ydcT 4549436 4550449 1014 1 forward
+ydcU 4550450 4551391 942 1 forward
+ydcV 4551381 4552175 795 1 forward
+patD 4552197 4553621 1425 1 forward
+yncL 4553718 4553813 96 1 reverse
+ortT 4554008 4554181 174 1 forward
+ydcY 4554267 4554500 234 1 forward
+ydcZ 4554501 4554950 450 1 reverse
+mnaT 4554947 4555465 519 1 reverse
+curA 4555646 4556683 1038 1 forward
+mcbR 4556881 4557546 666 1 forward
+yncD 4557582 4559684 2103 1 reverse
+yncE 4559926 4560987 1062 1 forward
+ansP 4561100 4562599 1500 1 reverse
+yncG 4562866 4563483 618 1 forward
+yncH 4563559 4563771 213 1 forward
+rhsE 4564509 4566557 2049 1 forward
+ydcD 4566541 4567023 483 1 forward
+yncO 4566938 4567123 186 1 reverse
+yncI 4567205 4568258 1054 1 forward
+ydcC 4568435 4569571 1137 1 forward
+pptA 4569671 4569904 234 1 forward
+yddH 4569901 4570470 570 1 reverse
+nhoA 4570643 4571488 846 1 forward
+yddE 4571584 4572477 894 1 reverse
+narV 4572556 4573236 681 1 reverse
+narW 4573233 4573928 696 1 reverse
+narY 4573928 4575472 1545 1 reverse
+narZ 4575469 4579209 3741 1 reverse
+narU 4579291 4580679 1389 1 reverse
+yddJ 4581003 4581338 336 1 reverse
+yddK 4581377 4582333 957 1 reverse
+yddL 4582357 4582647 291 1 reverse
+yddG 4582907 4583788 882 1 reverse
+fdnG 4584020 4587067 3048 1 forward
+fdnH 4587080 4587964 885 1 forward
+fdnI 4587957 4588610 654 1 forward
+yddM 4589017 4589301 285 1 reverse
+adhP 4589447 4590457 1011 1 reverse
+maeA 4590591 4592288 1698 1 reverse
+sra 4592445 4592582 138 1 reverse
+bdm 4592684 4592899 216 1 reverse
+osmC 4593244 4593675 432 1 forward
+ddpF 4593731 4594657 927 1 reverse
+ddpD 4594650 4595636 987 1 reverse
+ddpC 4595633 4596529 897 1 reverse
+ddpB 4596526 4597548 1023 1 reverse
+ddpA 4597550 4599100 1551 1 reverse
+ddpX 4599114 4599695 582 1 reverse
+dosP 4599953 4602352 2400 1 reverse
+dosC 4602377 4603759 1383 1 reverse
+yddY 4603797 4603838 42 1 reverse
+yddW 4604123 4605442 1320 1 reverse
+gadC 4605573 4607108 1536 1 reverse
+gadB 4607264 4608664 1401 1 reverse
+pqqL 4609026 4611821 2796 1 reverse
+yddB 4611866 4614238 2373 1 reverse
+yddA 4614276 4615961 1686 1 reverse
+yneP 4616164 4616286 123 1 forward
+ydeM 4616252 4617409 1158 1 reverse
+ydeN 4617461 4619143 1683 1 reverse
+ydeO 4619545 4620306 762 1 reverse
+safA 4620381 4620578 198 1 reverse
+ydeP 4620826 4623105 2280 1 reverse
+ydeQ 4623439 4624353 915 1 reverse
+ydeR 4624412 4624915 504 1 reverse
+ydeS 4624928 4625458 531 1 reverse
+ydeT 4625472 4626620 1149 1 reverse
+yneL 4626953 4627155 203 1 reverse
+hipA 4627473 4628795 1323 1 reverse
+hipB 4628795 4629061 267 1 reverse
+yneO 4629284 4634705 5422 1 reverse
+lsrK 4635236 4636828 1593 1 reverse
+lsrR 4636907 4637860 954 1 reverse
+lsrA 4638109 4639644 1536 1 forward
+lsrC 4639638 4640666 1029 1 forward
+lsrD 4640666 6 993 1 forward
+lsrB 18 1040 1023 1 forward
+lsrF 1067 1942 876 1 forward
+lsrG 1966 2256 291 1 forward
+tam 2313 3071 759 1 forward
+yneE 3075 3989 915 1 reverse
+uxaB 4196 5647 1452 1 reverse
+dgcF 5874 6821 948 1 reverse
+yneG 6933 7292 360 1 reverse
+glsB 7292 8218 927 1 reverse
+sad 8282 9670 1389 1 reverse
+yneJ 9771 10652 882 1 forward
+yneK 10730 11845 1116 1 forward
+ydeA 11995 13185 1191 1 forward
+marC 13210 13875 666 1 reverse
+marR 14087 14521 435 1 forward
+marA 14541 14924 384 1 forward
+marB 14956 15174 219 1 forward
+eamA 15205 16104 900 1 reverse
+ydeE 16299 17486 1188 1 forward
+mgtS 17613 17708 96 1 forward
+dgcZ 17927 18817 891 1 reverse
+ydeI 19072 19464 393 1 reverse
+ydeJ 19740 20258 519 1 forward
+dcp 20302 22347 2046 1 reverse
+ydfG 22484 23230 747 1 forward
+ydfH 23319 24005 687 1 forward
+ydfZ 24182 24385 204 1 forward
+ydfI 24420 25880 1461 1 reverse
+ydfJ 25969 27252 1284 1 reverse
+ynfT 27857 27970 114 1 forward
+ydfK 28039 28272 234 1 forward
+pinQ 28589 29179 591 1 forward
+tfaQ 29277 29852 576 1 reverse
+ydfN 29852 30814 963 1 reverse
+nohA 30765 31334 570 1 reverse
+ynfO 31723 31956 234 1 forward
+ydfO 32014 32424 411 1 forward
+gnsB 32576 32749 174 1 reverse
+ynfN 32921 33076 156 1 reverse
+ynfR 33155 33220 66 1 reverse
+ynfQ 33223 33411 189 1 reverse
+cspI 33422 33634 213 1 reverse
+rzpQ 33997 34494 498 1 reverse
+rzoQ 34047 34301 255 1 reverse
+rrrQ 34491 35024 534 1 reverse
+ydfR 35021 35332 312 1 reverse
+essQ 35337 35552 216 1 reverse
+cspB 36306 36521 216 1 reverse
+cspF 36822 37034 213 1 forward
+ynfS 37089 37178 90 1 forward
+ydfT 37456 38208 753 1 reverse
+ydfU 38222 39271 1050 1 reverse
+rem 39618 39869 252 1 reverse
+hokD 40086 40241 156 1 reverse
+relE 40313 40600 288 1 reverse
+relB 40600 40839 240 1 reverse
+ydfV 40864 41169 306 1 forward
+flxA 41372 41704 333 1 forward
+ydfW 42141 42290 150 1 reverse
+ydfX 42313 42603 291 1 reverse
+dicC 42587 42817 231 1 reverse
+dicA 42901 43308 408 1 forward
+ydfA 43475 43630 156 1 forward
+ydfB 43632 43760 129 1 forward
+ydfC 43790 44008 219 1 forward
+dicB 44576 44764 189 1 forward
+ydfD 44761 44952 192 1 forward
+ydfE 45045 45965 921 1 forward
+insD-7 45848 46504 657 1 forward
+intQ 46479 47675 1197 1 forward
+ynfP 47695 47805 111 1 reverse
+rspB 47863 48882 1020 1 reverse
+rspA 48894 50108 1215 1 reverse
+ynfA 50314 50640 327 1 reverse
+ynfB 50775 51116 342 1 forward
+speG 51151 51711 561 1 forward
+ynfC 51714 52424 711 1 reverse
+ynfD 52532 52837 306 1 forward
+ynfE 53036 55462 2427 1 forward
+ynfF 55523 57946 2424 1 forward
+ynfG 57957 58574 618 1 forward
+ynfH 58576 59430 855 1 forward
+dmsD 59473 60087 615 1 forward
+clcB 60282 61538 1257 1 forward
+ynfK 61491 62186 696 1 reverse
+mlc 62311 63531 1221 1 reverse
+ynfL 63666 64559 894 1 reverse
+ynfM 64666 65919 1254 1 forward
+asr 66343 66651 309 1 forward
+ydgU 66744 66827 84 1 forward
+ydgD 66927 67748 822 1 forward
+mdtI 67787 68116 330 1 reverse
+mdtJ 68103 68468 366 1 reverse
+tqsA 68880 69914 1035 1 forward
+pntB 69939 71327 1389 1 reverse
+pntA 71338 72870 1533 1 reverse
+ydgH 73394 74338 945 1 forward
+ydgI 74524 75906 1383 1 forward
+folM 75943 76665 723 1 forward
+ydgC 76662 76997 336 1 reverse
+rstA 77126 77845 720 1 forward
+rstB 77849 79150 1302 1 forward
+tus 79226 80155 930 1 forward
+fumC 80152 81555 1404 1 reverse
+fumA 81698 83344 1647 1 reverse
+manA 83543 84718 1176 1 forward
+ydgA 84819 86327 1509 1 forward
+uidC 86553 87818 1266 1 reverse
+uidB 87857 89230 1374 1 reverse
+uidA 89227 91038 1812 1 reverse
+uidR 91429 92019 591 1 reverse
+hdhA 92240 93007 768 1 reverse
+malI 93119 94147 1029 1 reverse
+malX 94322 95914 1593 1 forward
+malY 95924 97096 1173 1 forward
+add 97200 98201 1002 1 forward
+ydgJ 98235 99275 1041 1 reverse
+blr 99518 99643 126 1 forward
+cnu 99916 100131 216 1 forward
+ydgK 100217 100657 441 1 forward
+rsxA 100734 101315 582 1 forward
+rsxB 101315 101893 579 1 forward
+rsxC 101886 104108 2223 1 forward
+rsxD 104109 105167 1059 1 forward
+rsxG 105171 105791 621 1 forward
+rsxE 105795 106490 696 1 forward
+nth 106490 107125 636 1 forward
+dtpA 107736 109238 1503 1 forward
+gstA 109344 109949 606 1 forward
+pdxY 109993 110856 864 1 reverse
+tyrS 110915 112189 1275 1 reverse
+pdxH 112318 112974 657 1 reverse
+mliC 113033 113362 330 1 reverse
+anmK 113460 114569 1110 1 reverse
+slyB 114843 115310 468 1 forward
+slyA 115357 115791 435 1 reverse
+ydhI 115992 116228 237 1 forward
+ydhJ 116231 117088 858 1 forward
+ydhK 117088 119100 2013 1 forward
+sodC 119101 119622 522 1 reverse
+ydhF 119703 120599 897 1 reverse
+ydhL 120648 120887 240 1 reverse
+nemR 120990 121589 600 1 forward
+nemA 121626 122723 1098 1 forward
+gloA 122804 123211 408 1 forward
+rnt 123314 123961 648 1 forward
+lhr 124054 128670 4617 1 forward
+grxD 128721 129068 348 1 reverse
+mepH 129402 130217 816 1 forward
+sodB 130345 130926 582 1 forward
+ydhP 131088 132257 1170 1 reverse
+ynhF 132423 132512 90 1 reverse
+purR 132811 133836 1026 1 forward
+ydhB 133833 134765 933 1 reverse
+ydhC 134878 136089 1212 1 forward
+cfa 136380 137528 1149 1 forward
+ribC 137568 138209 642 1 reverse
+mdtK 138424 139797 1374 1 forward
+ydhQ 139838 141094 1257 1 reverse
+ydhR 141667 141972 306 1 forward
+ydhS 142098 143702 1605 1 forward
+ydhT 143714 144526 813 1 reverse
+ydhU 144530 145315 786 1 reverse
+ydhX 145312 145980 669 1 reverse
+ydhW 146044 146691 648 1 reverse
+ydhV 146695 148797 2103 1 reverse
+ydhY 148818 149444 627 1 reverse
+fumD 149899 150108 210 1 reverse
+pykF 150665 152077 1413 1 forward
+lpp 152388 152624 237 1 forward
+ldtE 152688 153692 1005 1 reverse
+sufE 153841 154257 417 1 reverse
+sufS 154270 155490 1221 1 reverse
+sufD 155487 156758 1272 1 reverse
+sufC 156733 157479 747 1 reverse
+sufB 157489 158976 1488 1 reverse
+sufA 158985 159353 369 1 reverse
+ydiH 159901 160089 189 1 reverse
+menI 160189 160599 411 1 reverse
+ydiJ 160596 163652 3057 1 reverse
+ydiK 164041 165153 1113 1 forward
+ydiL 165582 165938 357 1 forward
+ydiM 166038 167252 1215 1 forward
+ydiN 167479 168744 1266 1 forward
+ydiB 168756 169622 867 1 forward
+aroD 169653 170411 759 1 forward
+ydiF 170554 172149 1596 1 forward
+ydiO 172163 173314 1152 1 forward
+ydiP 173357 174268 912 1 reverse
+ydiQ 174584 175348 765 1 forward
+ydiR 175368 176306 939 1 forward
+ydiS 176362 177651 1290 1 forward
+ydiT 177648 177941 294 1 forward
+fadK 177944 179644 1701 1 forward
+ppsA 179701 182079 2379 1 reverse
+ppsR 182412 183245 834 1 forward
+aroH 183402 184448 1047 1 forward
+ydiE 184580 184771 192 1 forward
+ydiU 184775 186211 1437 1 reverse
+ydiV 186274 186987 714 1 reverse
+nlpC 187234 187698 465 1 reverse
+btuD 187776 188525 750 1 reverse
+btuE 188525 189076 552 1 reverse
+btuC 189139 190119 981 1 reverse
+ihfA 190220 190519 300 1 reverse
+pheT 190524 192911 2388 1 reverse
+pheS 192926 193909 984 1 reverse
+pheM 194193 194237 45 1 reverse
+rplT 194360 194716 357 1 reverse
+rpmI 194769 194966 198 1 reverse
+infC 195063 195605 543 1 reverse
+thrS 195609 197537 1929 1 reverse
+arpB 198061 199960 1900 1 forward
+yniD 200132 200239 108 1 forward
+ydiY 200292 201050 759 1 reverse
+pfkB 201337 202266 930 1 forward
+ydiZ 202367 202657 291 1 forward
+yniA 202763 203623 861 1 forward
+yniB 203664 204200 537 1 reverse
+hxpB 204347 205015 669 1 forward
+ydjM 205178 205768 591 1 forward
+tcyP 205901 207292 1392 1 forward
+ydjO 207296 208099 804 1 reverse
+cedA 208388 208630 243 1 reverse
+katE 208834 211095 2262 1 forward
+chbG 211353 212102 750 1 reverse
+chbF 212115 213467 1353 1 reverse
+chbR 213572 214414 843 1 reverse
+chbA 214422 214772 351 1 reverse
+chbC 214823 216181 1359 1 reverse
+chbB 216266 216586 321 1 reverse
+osmE 216885 217223 339 1 reverse
+nadE 217425 218252 828 1 forward
+cho 218482 219369 888 1 forward
+ves 219329 219904 576 1 reverse
+spy 220107 220592 486 1 reverse
+astE 220922 221890 969 1 reverse
+astB 221883 223226 1344 1 reverse
+astD 223223 224701 1479 1 reverse
+astA 224698 225732 1035 1 reverse
+astC 225729 226949 1221 1 reverse
+xthA 227395 228201 807 1 forward
+ydjX 228368 229078 711 1 forward
+ydjY 229083 229760 678 1 forward
+ydjZ 229775 230482 708 1 forward
+ynjA 230482 231030 549 1 forward
+ynjB 231040 232206 1167 1 forward
+ynjC 232179 233714 1536 1 forward
+ynjD 233714 234367 654 1 forward
+ynjE 234434 235741 1308 1 forward
+ynjF 235750 236370 621 1 reverse
+nudG 236457 236864 408 1 forward
+ynjH 236830 237102 273 1 reverse
+gdhA 237338 238681 1344 1 forward
+ynjI 238798 239838 1041 1 reverse
+topB 239966 241927 1962 1 reverse
+selD 241932 242975 1044 1 reverse
+ydjA 243092 243643 552 1 reverse
+sppA 243804 245660 1857 1 forward
+ansA 245827 246843 1017 1 forward
+pncA 246854 247495 642 1 forward
+ydjE 247588 248946 1359 1 reverse
+ydjF 249063 249821 759 1 reverse
+ydjG 249958 250938 981 1 reverse
+ydjH 250948 251895 948 1 reverse
+ydjI 251900 252736 837 1 reverse
+ydjJ 252757 253800 1044 1 reverse
+ydjK 253817 255196 1380 1 reverse
+ydjL 255223 256299 1077 1 reverse
+yeaC 256669 256941 273 1 reverse
+msrB 256983 257396 414 1 reverse
+gapA 257738 258733 996 1 forward
+yeaD 258817 259701 885 1 forward
+yeaE 259749 260603 855 1 reverse
+mipA 260693 261439 747 1 reverse
+yeaG 261875 263809 1935 1 forward
+yeaH 263922 265205 1284 1 forward
+cdgI 265352 266827 1476 1 forward
+dgcJ 267008 268498 1491 1 forward
+yeaK 268541 269044 504 1 forward
+yoaI 269045 269149 105 1 reverse
+yeaL 269319 269765 447 1 forward
+nimR 269722 270543 822 1 reverse
+nimT 270640 271821 1182 1 forward
+yeaO 271876 272223 348 1 forward
+yoaF 272245 272499 255 1 reverse
+dgcP 272682 273707 1026 1 forward
+yoaK 273740 273838 99 1 forward
+yoaJ 273841 273915 75 1 forward
+yeaQ 273974 274222 249 1 reverse
+yoaG 274370 274552 183 1 reverse
+yeaR 274556 274915 360 1 reverse
+leuE 275088 275726 639 1 reverse
+dmlR 275853 276776 924 1 reverse
+dmlA 276879 277964 1086 1 forward
+yeaV 278155 279600 1446 1 forward
+yeaW 279632 280756 1125 1 forward
+yeaX 280812 281777 966 1 forward
+rnd 281831 282958 1128 1 reverse
+fadD 283028 284713 1686 1 reverse
+yeaY 284918 285499 582 1 reverse
+tsaB 285539 286234 696 1 reverse
+yoaA 286292 288202 1911 1 reverse
+yoaB 288334 288678 345 1 forward
+yoaC 289100 289399 300 1 forward
+yoaH 289519 289698 180 1 reverse
+pabB 289772 291133 1362 1 forward
+nudL 291137 291715 579 1 forward
+sdaA 291899 293263 1365 1 forward
+pdeD 293394 294992 1599 1 forward
+yoaE 294996 296552 1557 1 reverse
+yoaL 296540 296749 210 1 reverse
+manX 297015 297986 972 1 forward
+manY 298049 298849 801 1 forward
+manZ 298862 299713 852 1 forward
+yobD 299768 300226 459 1 forward
+mntP 300655 301221 567 1 forward
+rlmA 301218 302027 810 1 reverse
+cspC 302193 302402 210 1 reverse
+yobF 302415 302558 144 1 reverse
+yebO 303228 303515 288 1 reverse
+mgrB 303590 303733 144 1 reverse
+yobH 303892 304131 240 1 forward
+kdgR 304275 305066 792 1 reverse
+yebQ 305243 306616 1374 1 forward
+htpX 306662 307543 882 1 reverse
+prc 307735 309783 2049 1 reverse
+proQ 309803 310501 699 1 reverse
+msrC 310598 311095 498 1 reverse
+yebS 311225 312508 1284 1 forward
+yebT 312477 315110 2634 1 forward
+rsmF 315190 316629 1440 1 forward
+yebV 316747 316983 237 1 forward
+yebW 317088 317279 192 1 forward
+pphA 317280 317936 657 1 reverse
+yebY 318332 318673 342 1 reverse
+yebZ 318686 319558 873 1 reverse
+yobA 319562 319936 375 1 reverse
+holE 320075 320305 231 1 forward
+yobB 320407 321063 657 1 forward
+exoX 321087 321749 663 1 forward
+ptrB 321746 323806 2061 1 reverse
+yebE 324015 324674 660 1 reverse
+yebF 325001 325357 357 1 reverse
+yebG 325424 325714 291 1 reverse
+purT 325848 327026 1179 1 forward
+eda 327082 327723 642 1 reverse
+edd 327760 329571 1812 1 reverse
+zwf 329806 331281 1476 1 reverse
+yebK 331619 332488 870 1 forward
+pykA 332616 334058 1443 1 forward
+lpxM 334189 335160 972 1 reverse
+mepM 335280 336602 1323 1 reverse
+znuA 336618 337550 933 1 reverse
+znuC 337629 338384 756 1 forward
+znuB 338381 339166 786 1 forward
+ruvB 339313 340323 1011 1 reverse
+ruvA 340332 340943 612 1 reverse
+yobI 341082 341147 66 1 reverse
+yebB 341218 341820 603 1 forward
+ruvC 341822 342343 522 1 reverse
+yebC 342378 343118 741 1 reverse
+nudB 343147 343599 453 1 reverse
+aspS 343717 345489 1773 1 reverse
+yecD 345799 346365 567 1 forward
+yecE 346362 347180 819 1 forward
+yecN 347233 347628 396 1 forward
+cmoA 347669 348412 744 1 forward
+cmoB 348409 349380 972 1 forward
+torZ 349545 351974 2430 1 reverse
+torY 351999 353099 1101 1 reverse
+cutC 353487 354233 747 1 reverse
+yecM 354247 354813 567 1 reverse
+argS 355029 356762 1734 1 forward
+yecT 356939 357427 489 1 forward
+flhE 357547 357939 393 1 reverse
+flhA 357939 360017 2079 1 reverse
+flhB 360010 361158 1149 1 reverse
+cheZ 361360 362004 645 1 reverse
+cheY 362015 362404 390 1 reverse
+cheB 362419 363468 1050 1 reverse
+cheR 363471 364331 861 1 reverse
+tap 364350 365951 1602 1 reverse
+tar 365997 367658 1662 1 reverse
+cheW 367803 368306 504 1 reverse
+cheA 368327 370291 1965 1 reverse
+motB 370296 371222 927 1 reverse
+motA 371219 372106 888 1 reverse
+flhC 372233 372811 579 1 reverse
+flhD 372814 373164 351 1 reverse
+insB-5 373485 373988 504 1 reverse
+insA-5 373907 374182 276 1 reverse
+uspC 374720 375148 429 1 forward
+otsA 375155 376579 1425 1 reverse
+otsB 376554 377354 801 1 reverse
+araH 377521 378507 987 1 reverse
+araG 378522 380036 1515 1 reverse
+araF 380106 381095 990 1 reverse
+ftnB 381892 382395 504 1 forward
+yecJ 382474 382725 252 1 reverse
+azuC 382840 382926 87 1 reverse
+yecR 383189 383512 324 1 forward
+ftnA 383683 384180 498 1 forward
+yecH 384218 384457 240 1 reverse
+tyrP 384648 385859 1212 1 forward
+yecA 385921 386586 666 1 reverse
+pgsA 387236 387784 549 1 reverse
+uvrC 387841 389673 1833 1 reverse
+uvrY 389670 390326 657 1 reverse
+yecU 390622 390798 177 1 forward
+yecF 390785 391009 225 1 forward
+sdiA 391077 391799 723 1 reverse
+tcyN 392029 392781 753 1 reverse
+tcyL 392778 393446 669 1 reverse
+dcyD 393461 394447 987 1 reverse
+tcyJ 394552 395352 801 1 reverse
+fliZ 395440 395991 552 1 reverse
+fliA 396037 396756 720 1 reverse
+fliC 397077 398573 1497 1 reverse
+fliD 398839 400245 1407 1 forward
+fliS 400270 400680 411 1 forward
+fliT 400680 401045 366 1 forward
+amyA 401123 402610 1488 1 forward
+yedD 402644 403057 414 1 reverse
+yedE 403244 404449 1206 1 forward
+yedF 404446 404679 234 1 forward
+yedK 404788 405456 669 1 forward
+yedL 405567 406046 480 1 forward
+yedN 406190 407318 1129 1 reverse
+intG 407469 407747 279 1 forward
+fliE 407667 407981 315 1 reverse
+fliF 408196 409854 1659 1 forward
+fliG 409847 410842 996 1 forward
+fliH 410835 411521 687 1 forward
+fliI 411521 412894 1374 1 forward
+fliJ 412913 413356 444 1 forward
+fliK 413353 414480 1128 1 forward
+fliL 414585 415049 465 1 forward
+fliM 415054 416058 1005 1 forward
+fliN 416055 416468 414 1 forward
+fliO 416471 416836 366 1 forward
+fliP 416836 417573 738 1 forward
+fliQ 417583 417852 270 1 forward
+fliR 417860 418645 786 1 forward
+rcsA 418935 419558 624 1 forward
+dsrB 419602 419790 189 1 reverse
+yodD 419953 420180 228 1 forward
+yedP 420478 421293 816 1 forward
+dgcQ 421290 422984 1695 1 reverse
+yodC 423155 423337 183 1 reverse
+yedI 423416 424333 918 1 reverse
+yedA 424506 425426 921 1 forward
+vsr 425415 425885 471 1 reverse
+dcm 425866 427284 1419 1 reverse
+yedJ 427351 428046 696 1 reverse
+yedR 428086 428451 366 1 reverse
+yedS 429018 430210 1193 1 forward
+hchA 430802 431653 852 1 forward
+hprS 431761 433119 1359 1 reverse
+hprR 433119 433790 672 1 reverse
+yedX 433923 434336 414 1 forward
+msrP 434445 435449 1005 1 forward
+msrQ 435450 436085 636 1 forward
+zinT 436342 436992 651 1 forward
+yodB 437335 437865 531 1 forward
+mtfA 438618 439415 798 1 forward
+yeeJ 439905 446981 7077 1 forward
+yeeL 447243 448295 1053 1 reverse
+shiA 448610 449926 1317 1 forward
+amn 450028 451482 1455 1 forward
+yeeN 451825 452541 717 1 forward
+yeeO 453170 454813 1644 1 reverse
+cbl 454931 455881 951 1 reverse
+nac 455983 456900 918 1 reverse
+ldtA 457358 458290 933 1 reverse
+cobT 458355 459434 1080 1 reverse
+cobS 459446 460189 744 1 reverse
+cobU 460186 460731 546 1 reverse
+insH-6 461272 462288 1017 1 reverse
+yoeA 463602 465441 504 2 forward
+insD-3 463919 464824 906 1 reverse
+insC-3 464782 465147 366 1 reverse
+yeeP 465753 466178 426 1 forward
+flu 466506 469625 3120 1 forward
+yeeR 469746 471278 1533 1 forward
+yeeS 471275 471721 447 1 forward
+yeeT 471784 472005 222 1 forward
+cbeA 472079 472447 369 1 forward
+cbtA 472536 472910 375 1 forward
+yeeW 472907 473101 195 1 forward
+yoeF 473542 473898 357 1 forward
+yeeX 473999 474328 330 1 reverse
+yeeA 474500 475558 1059 1 reverse
+sbmC 475756 476229 474 1 reverse
+dacD 476348 477514 1167 1 reverse
+sbcB 477723 479150 1428 1 forward
+yeeD 479193 479420 228 1 reverse
+yeeE 479434 480492 1059 1 reverse
+plaP 480671 482029 1359 1 reverse
+yoeI 482019 482081 63 1 reverse
+yeeY 482296 483225 930 1 reverse
+yeeZ 483271 484095 825 1 reverse
+yoeB 484178 484432 255 1 reverse
+yefM 484429 484680 252 1 reverse
+hisL 484963 485013 51 1 forward
+hisG 485159 486058 900 1 forward
+hisD 486064 487368 1305 1 forward
+hisC 487365 488435 1071 1 forward
+hisB 488435 489502 1068 1 forward
+hisH 489502 490092 591 1 forward
+hisA 490092 490829 738 1 forward
+hisF 490811 491587 777 1 forward
+hisI 491581 492192 612 1 forward
+wzzB 492288 493268 981 1 reverse
+ugd 493414 494580 1167 1 reverse
+gnd 494829 496235 1407 1 reverse
+wbbL 496363 498356 795 2 reverse
+insH-7 496862 497878 1017 1 reverse
+wbbK 498358 499476 1119 1 reverse
+wbbJ 499461 500051 591 1 reverse
+wbbI 500032 501024 993 1 reverse
+wbbH 501027 502193 1167 1 reverse
+glf 502193 503296 1104 1 reverse
+rfbX 503304 504551 1248 1 reverse
+rfbC 504548 505105 558 1 reverse
+rfbA 505105 505986 882 1 reverse
+rfbD 506044 506943 900 1 reverse
+rfbB 506943 508028 1086 1 reverse
+galF 508401 509294 894 1 reverse
+wcaM 509469 510863 1395 1 reverse
+wcaL 510874 512094 1221 1 reverse
+wcaK 512091 513371 1281 1 reverse
+wzxC 513647 515125 1479 1 reverse
+wcaJ 515127 516521 1395 1 reverse
+cpsG 516576 517946 1371 1 reverse
+cpsB 518051 519487 1437 1 reverse
+wcaI 519490 520713 1224 1 reverse
+gmm 520710 521189 480 1 reverse
+fcl 521192 522157 966 1 reverse
+gmd 522160 523281 1122 1 reverse
+wcaF 523307 523855 549 1 reverse
+wcaE 523871 524617 747 1 reverse
+wcaD 524628 525845 1218 1 reverse
+wcaC 525820 527037 1218 1 reverse
+wcaB 527034 527522 489 1 reverse
+wcaA 527525 528364 840 1 reverse
+wzc 528457 530619 2163 1 reverse
+wzb 530622 531065 444 1 reverse
+wza 531071 532210 1140 1 reverse
+yegH 532869 534452 1584 1 forward
+asmA 534726 536579 1854 1 reverse
+dcd 536601 537182 582 1 reverse
+udk 537274 537915 642 1 reverse
+dgcE 538233 541550 3318 1 forward
+alkA 541659 542507 849 1 reverse
+yegD 542641 543993 1353 1 forward
+yegI 544006 545952 1947 1 reverse
+yegJ 546152 546613 462 1 forward
+pphC 546678 547439 762 1 reverse
+yegL 547436 548095 660 1 reverse
+ibsA 548316 548375 60 1 reverse
+ibsB 548648 548704 57 1 reverse
+mdtA 548983 550230 1248 1 forward
+mdtB 550230 553352 3123 1 forward
+mdtC 553353 556430 3078 1 forward
+mdtD 556431 557846 1416 1 forward
+baeS 557843 559246 1404 1 forward
+baeR 559243 559965 723 1 forward
+yegP 560156 560488 333 1 forward
+yegQ 560635 561996 1362 1 forward
+ogrK 562269 562487 219 1 reverse
+yegZ 562569 562787 219 1 reverse
+yegR 562956 563273 318 1 reverse
+yegS 563679 564578 900 1 forward
+gatR 564660 566694 774 2 reverse
+insE-5 565203 565502 300 1 forward
+insF-5 565499 566365 867 1 forward
+gatD 566800 567840 1041 1 reverse
+gatC 567888 569245 1358 1 reverse
+gatB 569249 569533 285 1 reverse
+gatA 569564 570016 453 1 reverse
+gatZ 570026 571288 1263 1 reverse
+gatY 571317 572171 855 1 reverse
+fbaB 572479 573531 1053 1 reverse
+yegT 573788 575065 1278 1 forward
+yegU 575062 576066 1005 1 forward
+yegV 576063 577028 966 1 forward
+yegW 577002 577748 747 1 reverse
+yegX 577800 578618 819 1 reverse
+thiD 578683 579483 801 1 reverse
+thiM 579480 580268 789 1 reverse
+rcnR 580491 580763 273 1 reverse
+rcnA 580884 581708 825 1 forward
+rcnB 581927 582265 339 1 forward
+yehA 582347 583381 1035 1 reverse
+yehB 583397 585877 2481 1 reverse
+yehC 585893 586612 720 1 reverse
+yehD 586647 587189 543 1 reverse
+yehE 587482 587763 282 1 reverse
+mrp 588026 589135 1110 1 reverse
+metG 589267 591300 2034 1 forward
+yehF 591441 592265 825 1 forward
+yehI 595246 598878 3633 1 forward
+yehK 598939 599256 318 1 forward
+yehL 599563 600651 1089 1 forward
+yehM 600662 602941 2280 1 forward
+yehP 602934 604070 1137 1 forward
+yehQ 604067 605911 1845 1 forward
+yehR 606192 606653 462 1 forward
+yehS 606693 607163 471 1 reverse
+btsR 607210 607929 720 1 reverse
+btsS 607926 609611 1686 1 reverse
+mlrA 609833 610564 732 1 forward
+yohO 610624 610731 108 1 forward
+yehW 610712 611443 732 1 reverse
+yehX 611448 612374 927 1 reverse
+yehY 612367 613524 1158 1 reverse
+osmF 613531 614448 918 1 reverse
+bglX 614659 616956 2298 1 reverse
+dld 617152 618867 1716 1 forward
+pbpG 618905 619837 933 1 reverse
+yohC 620011 620598 588 1 reverse
+yohD 620768 621346 579 1 forward
+yohF 621476 622237 762 1 reverse
+mdtQ 622290 623725 1436 1 reverse
+yohP 623949 624032 84 1 forward
+dusC 624405 625352 948 1 reverse
+yohJ 625591 625989 399 1 forward
+yohK 625986 626681 696 1 forward
+cdd 626811 627695 885 1 forward
+sanA 627845 628564 720 1 forward
+yeiS 628567 628806 240 1 forward
+preT 629000 630238 1239 1 forward
+preA 630232 631467 1236 1 forward
+mglC 631710 632720 1011 1 reverse
+mglA 632736 634256 1521 1 reverse
+mglB 634317 635315 999 1 reverse
+galS 635595 636635 1041 1 reverse
+yeiB 636777 637934 1158 1 reverse
+folE 637951 638619 669 1 reverse
+yeiG 638877 639713 837 1 forward
+cirA 639745 641736 1992 1 reverse
+lysP 642030 643499 1470 1 reverse
+yeiE 643704 644585 882 1 reverse
+yeiH 644684 645733 1050 1 forward
+nfo 645807 646664 858 1 forward
+yeiI 646667 647755 1089 1 forward
+nupX 647862 649112 1251 1 reverse
+rihB 649212 650153 942 1 reverse
+yeiL 650322 650981 660 1 forward
+psuT 651052 652302 1251 1 reverse
+psuG 652396 653334 939 1 reverse
+psuK 653322 654263 942 1 reverse
+fruA 654686 656377 1692 1 reverse
+fruK 656394 657332 939 1 reverse
+fruB 657332 658462 1131 1 reverse
+setB 658830 660011 1182 1 forward
+yeiW 660008 660262 255 1 reverse
+yeiP 660417 660989 573 1 forward
+yeiQ 661212 662678 1467 1 forward
+yeiR 662796 663782 987 1 forward
+lpxT 663821 664534 714 1 forward
+mepS 664946 665512 567 1 forward
+pdeN 665693 667249 1557 1 forward
+yejA 667331 669145 1815 1 forward
+yejB 669146 670240 1095 1 forward
+yejE 670240 671265 1026 1 forward
+yejF 671267 672856 1590 1 forward
+yejG 672860 673204 345 1 reverse
+bcr 673537 674727 1191 1 reverse
+rsuA 674755 675450 696 1 reverse
+radD 675599 677359 1761 1 forward
+rplY 677484 677768 285 1 forward
+yejK 677907 678914 1008 1 reverse
+yejL 679096 679323 228 1 forward
+yejM 679343 681103 1761 1 forward
+yejO 681357 685147 2592 2 reverse
+insH-8 684032 685048 1017 1 reverse
+narP 685467 686114 648 1 forward
+ccmH 686325 687377 1053 1 reverse
+ccmG 687374 687931 558 1 reverse
+ccmF 687928 689871 1944 1 reverse
+ccmE 689868 690347 480 1 reverse
+ccmD 690344 690553 210 1 reverse
+ccmC 690550 691287 738 1 reverse
+ccmB 691329 691991 663 1 reverse
+ccmA 691988 692611 624 1 reverse
+napC 692624 693226 603 1 reverse
+napB 693236 693685 450 1 reverse
+napH 693682 694545 864 1 reverse
+napG 694532 695227 696 1 reverse
+napA 695234 697720 2487 1 reverse
+napD 697717 697980 264 1 reverse
+napF 697970 698464 495 1 reverse
+yojO 698573 698737 165 1 forward
+eco 698872 699360 489 1 forward
+mqo 700075 701721 1647 1 reverse
+yojI 701939 703582 1644 1 reverse
+alkB 703658 704308 651 1 reverse
+ada 704308 705372 1065 1 reverse
+ftp 705446 706501 1056 1 reverse
+ompC 706613 707716 1104 1 reverse
+rcsD 708455 711127 2673 1 forward
+rcsB 711144 711794 651 1 forward
+rcsC 711994 714843 2850 1 reverse
+atoS 715010 716836 1827 1 forward
+atoC 716833 718218 1386 1 forward
+atoD 718414 719076 663 1 forward
+atoA 719076 719726 651 1 forward
+atoE 719723 721045 1323 1 forward
+atoB 721076 722260 1185 1 forward
+yfaP 722334 723110 777 1 reverse
+yfaQ 723115 724764 1650 1 reverse
+yfaS 724765 729369 4605 1 reverse
+yfaT 729303 729926 624 1 reverse
+yfaA 729923 731611 1689 1 reverse
+gyrA 731760 734387 2628 1 reverse
+ubiG 734534 735256 723 1 forward
+yfaL 735384 739136 3753 1 reverse
+ypaB 739561 739704 144 1 reverse
+nrdA 739832 742117 2286 1 forward
+nrdB 742351 743481 1131 1 forward
+yfaE 743481 743735 255 1 forward
+inaA 743789 744439 651 1 reverse
+yfaH 744654 744860 207 1 forward
+glpQ 744902 745978 1077 1 reverse
+glpT 745983 747341 1359 1 reverse
+glpA 747614 749242 1629 1 forward
+glpB 749232 750491 1260 1 forward
+glpC 750488 751678 1191 1 forward
+rpnE 751871 752770 900 1 forward
+ypaA 752783 752968 186 1 forward
+yfaU 753009 753812 804 1 reverse
+yfaV 753830 755119 1290 1 reverse
+rhmD 755176 756381 1206 1 reverse
+yfaX 756396 757178 783 1 reverse
+yfaY 757398 758600 1203 1 reverse
+yfaZ 758700 759242 543 1 reverse
+nudI 759521 759946 426 1 forward
+ais 759985 760587 603 1 reverse
+arnB 760877 762034 1158 1 forward
+arnC 762038 763006 969 1 forward
+arnA 763006 764988 1983 1 forward
+arnD 764985 765875 891 1 forward
+arnT 765875 767527 1653 1 forward
+arnE 767524 767859 336 1 forward
+arnF 767859 768245 387 1 forward
+pmrD 768239 768505 267 1 reverse
+menE 768615 769970 1356 1 reverse
+menC 769967 770929 963 1 reverse
+menB 770929 771786 858 1 reverse
+menH 771801 772559 759 1 reverse
+menD 772556 774226 1671 1 reverse
+menF 774315 775610 1296 1 reverse
+elaB 775689 775994 306 1 reverse
+elaA 776049 776510 462 1 reverse
+rbn 776575 777492 918 1 forward
+elaD 777680 778891 1212 1 forward
+yfbK 778962 780689 1728 1 reverse
+yfbL 780827 781798 972 1 forward
+yfbM 781901 782404 504 1 forward
+yfbN 782677 783393 717 1 reverse
+yfbO 783602 784024 423 1 forward
+yfbP 784083 784931 849 1 forward
+nuoN 785015 786472 1458 1 reverse
+nuoM 786479 788008 1530 1 reverse
+nuoL 788172 790013 1842 1 reverse
+nuoK 790010 790312 303 1 reverse
+nuoJ 790309 790863 555 1 reverse
+nuoI 790875 791417 543 1 reverse
+nuoH 791432 792409 978 1 reverse
+nuoG 792406 795132 2727 1 reverse
+nuoF 795185 796522 1338 1 reverse
+nuoE 796519 797019 501 1 reverse
+nuoC 797022 798812 1791 1 reverse
+nuoB 798918 799580 663 1 reverse
+nuoA 799596 800039 444 1 reverse
+lrhA 800670 801608 939 1 reverse
+alaA 802528 803745 1218 1 forward
+yfbR 803829 804428 600 1 forward
+yfbS 804487 806319 1833 1 reverse
+hxpA 806406 807056 651 1 reverse
+yfbU 807067 807561 495 1 reverse
+yfbV 807644 808099 456 1 reverse
+ackA 808437 809639 1203 1 forward
+pta 809714 811858 2145 1 forward
+yfcC 812048 813568 1521 1 forward
+yfcD 813601 814143 543 1 reverse
+yfcE 814201 814755 555 1 reverse
+yfcF 814808 815452 645 1 reverse
+yfcG 815588 816235 648 1 forward
+folX 816292 816654 363 1 forward
+yfcH 816675 817568 894 1 forward
+rpnB 817616 818506 891 1 reverse
+hisP 818703 819476 774 1 reverse
+hisM 819484 820200 717 1 reverse
+hisQ 820197 820883 687 1 reverse
+hisJ 820973 821755 783 1 reverse
+argT 821976 822758 783 1 reverse
+ubiX 823024 823593 570 1 reverse
+purF 823688 825205 1518 1 reverse
+cvpA 825242 825730 489 1 reverse
+dedD 825989 826651 663 1 reverse
+folC 826641 827909 1269 1 reverse
+accD 827979 828893 915 1 reverse
+dedA 829049 829708 660 1 reverse
+truA 829791 830603 813 1 reverse
+usg 830603 831616 1014 1 reverse
+pdxB 831682 832818 1137 1 reverse
+flk 832917 833912 996 1 forward
+yfcJ 833909 835087 1179 1 reverse
+fabB 835352 836572 1221 1 reverse
+mnmC 836731 838737 2007 1 forward
+yfcL 838858 839136 279 1 reverse
+epmC 839170 839718 549 1 reverse
+yfcA 839718 840527 810 1 reverse
+mepA 840527 841351 825 1 reverse
+aroC 841355 842440 1086 1 reverse
+prmB 842475 843407 933 1 reverse
+smrB 843573 844124 552 1 forward
+yfcO 844195 845016 822 1 reverse
+yfcP 845018 845557 540 1 reverse
+yfcQ 845554 846042 489 1 reverse
+yfcR 846039 846551 513 1 reverse
+yfcS 846551 847303 753 1 reverse
+yfcU 847323 849968 2646 1 reverse
+yfcV 850050 850613 564 1 reverse
+sixA 851294 851779 486 1 reverse
+fadJ 851982 854126 2145 1 reverse
+fadI 854126 855436 1311 1 reverse
+yfcZ 855617 855901 285 1 reverse
+fadL 856273 857613 1341 1 forward
+yfdF 857979 859037 1059 1 forward
+mlaA 859219 859974 756 1 reverse
+yfdC 860268 861200 933 1 forward
+intS 861512 862669 1158 1 forward
+yfdG 862822 863184 363 1 forward
+yfdH 863181 864101 921 1 forward
+yfdI 864098 865429 1332 1 forward
+yfdK 866044 866484 441 1 reverse
+yfdL 866511 867029 519 1 reverse
+yfdM 867079 867354 276 1 reverse
+yfdN 867354 867848 495 1 reverse
+yfdO 867845 868213 369 1 reverse
+yfdP 868571 868933 363 1 forward
+yfdQ 868999 869823 825 1 forward
+yfdR 869951 870487 537 1 forward
+yfdS 870478 870840 363 1 forward
+yfdT 870840 871145 306 1 forward
+ypdJ 871061 871201 141 1 forward
+torI 871277 871477 201 1 forward
+dsdC 871661 872596 936 1 reverse
+dsdX 872814 874151 1338 1 forward
+dsdA 874169 875497 1329 1 forward
+emrY 875605 877143 1539 1 reverse
+emrK 877143 878306 1164 1 reverse
+evgA 878722 879336 615 1 forward
+evgS 879341 882934 3594 1 forward
+yfdE 882990 884135 1146 1 reverse
+yfdV 884209 885153 945 1 reverse
+oxc 885223 886917 1695 1 reverse
+frc 886971 888221 1251 1 reverse
+yfdX 888734 889369 636 1 reverse
+ypdI 889665 889940 276 1 forward
+yfdY 890017 890259 243 1 reverse
+lpxP 890612 891532 921 1 forward
+ypdK 891888 891959 72 1 forward
+alaC 892024 893262 1239 1 reverse
+ypdA 893638 895335 1698 1 forward
+ypdB 895350 896084 735 1 forward
+ypdC 896097 896954 858 1 forward
+fryA 896957 899452 2496 1 reverse
+ypdE 899477 900514 1038 1 reverse
+ypdF 900514 901599 1086 1 reverse
+fryC 901614 902861 1248 1 reverse
+fryB 902883 903209 327 1 reverse
+glk 903428 904393 966 1 reverse
+yfeO 904597 905853 1257 1 forward
+ypeC 905968 906294 327 1 forward
+mntH 906435 907673 1239 1 reverse
+nupC 908009 909211 1203 1 forward
+insL-3 909298 910410 1113 1 forward
+pdeA 910610 912799 2190 1 reverse
+yfeC 913434 913778 345 1 forward
+yfeD 913780 914172 393 1 forward
+gltX 914224 915639 1416 1 reverse
+xapR 916560 917444 885 1 reverse
+xapB 917696 918952 1257 1 reverse
+xapA 919012 919845 834 1 reverse
+yfeN 920094 920858 765 1 forward
+yfeR 920897 921823 927 1 reverse
+yfeH 921913 922911 999 1 forward
+ypeB 922908 923126 219 1 reverse
+ligA 923128 925143 2016 1 reverse
+zipA 925214 926200 987 1 reverse
+cysZ 926430 927191 762 1 forward
+cysK 927376 928347 972 1 forward
+ptsH 928731 928988 258 1 forward
+ptsI 929033 930760 1728 1 forward
+crr 930801 931310 510 1 forward
+pdxK 931353 932204 852 1 reverse
+yfeK 932309 932683 375 1 forward
+yfeS 932716 933450 735 1 forward
+cysM 933639 934550 912 1 reverse
+cysA 934684 935781 1098 1 reverse
+cysW 935771 936646 876 1 reverse
+cysU 936646 937479 834 1 reverse
+cysP 937479 938495 1017 1 reverse
+ucpA 938799 939590 792 1 reverse
+murR 939719 940576 858 1 reverse
+murQ 940740 941636 897 1 forward
+murP 941640 943064 1425 1 forward
+yfeW 943069 944373 1305 1 forward
+yfeX 944613 945512 900 1 reverse
+yfeY 945608 946183 576 1 reverse
+yfeZ 946244 946693 450 1 reverse
+ypeA 946680 947105 426 1 reverse
+amiA 947319 948188 870 1 forward
+hemF 948192 949091 900 1 forward
+eutR 949097 950149 1053 1 reverse
+eutK 950195 950695 501 1 reverse
+eutL 950708 951367 660 1 reverse
+eutC 951377 952264 888 1 reverse
+eutB 952285 953646 1362 1 reverse
+intZ 953825 955033 1209 1 forward
+yffL 955224 955865 642 1 forward
+yffM 956335 956580 246 1 forward
+yffN 956592 956960 369 1 forward
+yffO 957078 957494 417 1 forward
+yffP 957491 958084 594 1 forward
+yffQ 958559 958936 378 1 forward
+yffR 958947 959339 393 1 forward
+yffS 959490 960299 810 1 forward
+eutA 960448 961851 1404 1 reverse
+eutH 961848 963074 1227 1 reverse
+eutG 963291 964478 1188 1 reverse
+eutJ 964468 965304 837 1 reverse
+eutE 965315 966718 1404 1 reverse
+eutN 966730 967017 288 1 reverse
+eutM 967124 967417 294 1 reverse
+eutD 967456 968472 1017 1 reverse
+eutT 968469 969272 804 1 reverse
+eutQ 969269 969970 702 1 reverse
+eutP 969945 970424 480 1 reverse
+eutS 970437 970772 336 1 reverse
+maeB 971065 973344 2280 1 reverse
+talA 973633 974583 951 1 forward
+tktB 974603 976606 2004 1 forward
+ypfG 976701 977744 1044 1 reverse
+nudK 977870 978445 576 1 reverse
+aegA 978513 980492 1980 1 reverse
+narQ 980698 982398 1701 1 forward
+acrD 982562 985675 3114 1 forward
+ypfM 985774 985833 60 1 reverse
+yffB 986214 986570 357 1 forward
+dapE 986574 987701 1128 1 forward
+ypfN 987729 987929 201 1 forward
+ypfH 988039 988737 699 1 reverse
+tmcA 988811 990826 2016 1 reverse
+ypfJ 990841 991704 864 1 reverse
+purC 991872 992585 714 1 reverse
+bamC 992798 993832 1035 1 reverse
+dapA 993849 994727 879 1 reverse
+gcvR 994873 995445 573 1 forward
+bcp 995445 995915 471 1 forward
+hyfA 996168 996785 618 1 forward
+hyfB 996785 998803 2019 1 forward
+hyfC 998814 999761 948 1 forward
+hyfD 999778 1001217 1440 1 forward
+hyfE 1001229 1001879 651 1 forward
+hyfF 1001884 1003464 1581 1 forward
+hyfG 1003454 1005121 1668 1 forward
+hyfH 1005131 1005676 546 1 forward
+hyfI 1005673 1006431 759 1 forward
+hyfJ 1006424 1006837 414 1 forward
+hyfR 1006867 1008879 2013 1 forward
+focB 1008901 1009749 849 1 forward
+yfgO 1009787 1010848 1062 1 reverse
+bepA 1011061 1012524 1464 1 forward
+yfgD 1012545 1012904 360 1 forward
+hda 1013042 1013743 702 1 reverse
+uraA 1013838 1015127 1290 1 reverse
+upp 1015213 1015839 627 1 reverse
+purM 1016164 1017201 1038 1 forward
+purN 1017201 1017839 639 1 forward
+ppk 1018011 1020077 2067 1 forward
+ppx 1020082 1021623 1542 1 forward
+pdeF 1021662 1023905 2244 1 reverse
+yfgG 1024257 1024448 192 1 forward
+yfgH 1024759 1025277 519 1 forward
+yfgI 1025293 1025832 540 1 forward
+guaA 1025925 1027502 1578 1 reverse
+guaB 1027571 1029037 1467 1 reverse
+xseA 1029199 1030569 1371 1 forward
+yfgJ 1030566 1030781 216 1 reverse
+der 1030851 1032323 1473 1 reverse
+bamB 1032441 1033619 1179 1 reverse
+yfgM 1033630 1034250 621 1 reverse
+hisS 1034268 1035542 1275 1 reverse
+ispG 1035653 1036771 1119 1 reverse
+rodZ 1036798 1037811 1014 1 reverse
+rlmN 1038096 1039250 1155 1 reverse
+ndk 1039400 1039831 432 1 reverse
+pbpC 1039980 1042292 2313 1 reverse
+yfhM 1042293 1047254 4962 1 reverse
+sseA 1047461 1048306 846 1 forward
+sseB 1049124 1049900 777 1 reverse
+pepB 1050042 1051325 1284 1 reverse
+iscX 1051503 1051703 201 1 reverse
+fdx 1051715 1052050 336 1 reverse
+hscA 1052052 1053902 1851 1 reverse
+hscB 1053919 1054434 516 1 reverse
+iscA 1054530 1054853 324 1 reverse
+iscU 1054870 1055256 387 1 reverse
+iscS 1055284 1056498 1215 1 reverse
+iscR 1056610 1057098 489 1 reverse
+trmJ 1057550 1058290 741 1 reverse
+suhB 1058409 1059212 804 1 forward
+yfhR 1059357 1060211 855 1 forward
+csiE 1060402 1061682 1281 1 forward
+hcaT 1061674 1062813 1140 1 reverse
+hcaR 1062973 1063863 891 1 reverse
+iroK 1062973 1063038 66 1 reverse
+hcaE 1063999 1065360 1362 1 forward
+hcaF 1065357 1065875 519 1 forward
+hcaC 1065875 1066195 321 1 forward
+hcaB 1066192 1067004 813 1 forward
+hcaD 1067014 1068216 1203 1 forward
+yphA 1068313 1068735 423 1 forward
+yphB 1068783 1069655 873 1 reverse
+yphC 1069667 1070728 1062 1 reverse
+yphD 1070794 1071792 999 1 reverse
+yphE 1071817 1073328 1512 1 reverse
+yphF 1073351 1074334 984 1 reverse
+yphG 1074431 1077712 3282 1 reverse
+yphH 1077830 1079023 1194 1 forward
+glyA 1079221 1080474 1254 1 reverse
+hmp 1080802 1081992 1191 1 forward
+glnB 1082037 1082375 339 1 reverse
+glrR 1082436 1083770 1335 1 reverse
+qseG 1083760 1084473 714 1 reverse
+glrK 1084638 1086065 1428 1 reverse
+purL 1086623 1090510 3888 1 reverse
+mltF 1090768 1092324 1557 1 forward
+tadA 1092321 1092824 504 1 reverse
+pgpC 1092882 1093517 636 1 reverse
+yfhH 1093726 1094574 849 1 forward
+yfhL 1094630 1094890 261 1 forward
+shoB 1095084 1095164 81 1 reverse
+acpS 1095585 1095965 381 1 reverse
+pdxJ 1095965 1096696 732 1 reverse
+recO 1096708 1097436 729 1 reverse
+era 1097448 1098353 906 1 reverse
+rnc 1098350 1099030 681 1 reverse
+lepB 1099302 1100276 975 1 reverse
+lepA 1100292 1102091 1800 1 reverse
+rseC 1102289 1102768 480 1 reverse
+rseB 1102765 1103721 957 1 reverse
+rseA 1103721 1104371 651 1 reverse
+rpoE 1104404 1104979 576 1 reverse
+rseD 1104976 1105131 156 1 reverse
+nadB 1105387 1107009 1623 1 forward
+yfiC 1106994 1107731 738 1 reverse
+srmB 1107863 1109197 1335 1 forward
+yfiE 1109406 1110287 882 1 reverse
+eamB 1110390 1110977 588 1 forward
+grcA 1111033 1111416 384 1 reverse
+ung 1111721 1112410 690 1 forward
+yfiF 1112458 1113495 1038 1 reverse
+trxC 1113702 1114121 420 1 forward
+yfiP 1114190 1114888 699 1 forward
+patZ 1114920 1117580 2661 1 forward
+pssA 1117694 1119049 1356 1 forward
+yfiM 1119095 1119418 324 1 forward
+kgtP 1119415 1120713 1299 1 reverse
+clpB 1126567 1129140 2574 1 reverse
+pgeF 1129270 1130001 732 1 reverse
+rluD 1129998 1130978 981 1 reverse
+bamD 1131113 1131850 738 1 forward
+raiA 1132121 1132462 342 1 forward
+pheL 1132566 1132613 48 1 forward
+pheA 1132712 1133872 1161 1 forward
+tyrA 1133915 1135036 1122 1 reverse
+aroF 1135047 1136117 1071 1 reverse
+yfiL 1136327 1136692 366 1 forward
+yfiR 1136842 1137360 519 1 forward
+dgcN 1137350 1138576 1227 1 forward
+yfiB 1138592 1139074 483 1 forward
+rplS 1139150 1139497 348 1 reverse
+trmD 1139539 1140306 768 1 reverse
+rimM 1140337 1140885 549 1 reverse
+rpsP 1140904 1141152 249 1 reverse
+ffh 1141401 1142762 1362 1 reverse
+ypjD 1142929 1143720 792 1 forward
+yfjD 1143741 1145027 1287 1 forward
+grpE 1145082 1145675 594 1 reverse
+nadK 1145798 1146676 879 1 forward
+recN 1146762 1148423 1662 1 forward
+bamE 1148572 1148913 342 1 forward
+yfjF 1148975 1149265 291 1 reverse
+ratA 1149255 1149731 477 1 reverse
+smpB 1149863 1150345 483 1 forward
+intA 1151126 1152367 1242 1 forward
+yfjH 1152611 1153567 957 1 reverse
+alpA 1153611 1153823 213 1 forward
+yfjI 1153952 1155361 1410 1 forward
+yfjJ 1155514 1156140 627 1 forward
+abpB 1156318 1158507 2190 1 reverse
+abpA 1158504 1160120 1617 1 reverse
+yfjM 1160480 1160743 264 1 reverse
+rnlA 1160885 1161958 1074 1 forward
+rnlB 1161951 1162322 372 1 forward
+yfjP 1162677 1163540 864 1 forward
+yfjQ 1163632 1164453 822 1 forward
+yfjR 1164670 1165371 702 1 forward
+ypjK 1165412 1165648 237 1 forward
+yfjS 1165648 1166091 444 1 forward
+yfjT 1166115 1166582 468 1 forward
+yfjU 1166807 1167121 315 1 reverse
+yfjV 1167134 1168149 1016 1 reverse
+yfjW 1168285 1169988 1704 1 forward
+ypjI 1170512 1170783 272 1 forward
+yfjX 1170886 1171344 459 1 forward
+yfjY 1171353 1171835 483 1 forward
+ypjJ 1171844 1172044 201 1 forward
+yfjZ 1172082 1172399 318 1 forward
+ypjF 1172420 1172749 330 1 forward
+ypjA 1173113 1177693 4581 1 reverse
+pinH 1178032 1178271 240 1 reverse
+ypjB 1178605 1179396 792 1 reverse
+ypjC 1179496 1179978 483 1 reverse
+ygaQ 1181364 1183616 2253 1 forward
+csiD 1183952 1184929 978 1 forward
+lhgO 1184949 1186217 1269 1 forward
+gabD 1186240 1187688 1449 1 forward
+gabT 1187702 1188982 1281 1 forward
+gabP 1189220 1190620 1401 1 forward
+csiR 1190641 1191303 663 1 forward
+kbp 1191304 1191753 450 1 reverse
+yqaE 1191837 1191995 159 1 reverse
+ygaV 1192178 1192477 300 1 forward
+ygaP 1192487 1193011 525 1 forward
+stpA 1193058 1193462 405 1 reverse
+alaE 1194131 1194580 450 1 forward
+ygaC 1194617 1194961 345 1 reverse
+ygaM 1195113 1195442 330 1 forward
+nrdH 1195690 1195935 246 1 forward
+nrdI 1195932 1196342 411 1 forward
+nrdE 1196315 1198459 2145 1 forward
+nrdF 1198469 1199428 960 1 forward
+proV 1199782 1200984 1203 1 forward
+proW 1200977 1202041 1065 1 forward
+proX 1202099 1203091 993 1 forward
+ygaY 1203283 1204460 1178 1 forward
+ygaZ 1204584 1205321 738 1 forward
+ygaH 1205311 1205646 336 1 forward
+mprA 1205737 1206267 531 1 forward
+emrA 1206394 1207566 1173 1 forward
+emrB 1207583 1209121 1539 1 forward
+luxS 1209185 1209700 516 1 reverse
+gshA 1209850 1211406 1557 1 reverse
+yqaA 1211479 1211907 429 1 reverse
+yqaB 1211904 1212470 567 1 reverse
+csrA 1213928 1214113 186 1 reverse
+alaS 1214348 1216978 2631 1 reverse
+recX 1217106 1217606 501 1 reverse
+recA 1217675 1218736 1062 1 reverse
+pncC 1218816 1219313 498 1 reverse
+mltB 1219458 1220543 1086 1 reverse
+srlA 1220799 1221362 564 1 forward
+srlE 1221359 1222318 960 1 forward
+srlB 1222329 1222700 372 1 forward
+srlD 1222704 1223483 780 1 forward
+gutM 1223588 1223947 360 1 forward
+srlR 1224014 1224787 774 1 forward
+gutQ 1224780 1225745 966 1 forward
+norR 1225742 1227256 1515 1 reverse
+norV 1227443 1228882 1440 1 forward
+norW 1228879 1230012 1134 1 forward
+hypF 1230140 1232392 2253 1 reverse
+hydN 1232545 1233072 528 1 reverse
+ascG 1233221 1234231 1011 1 reverse
+ascF 1234491 1235948 1458 1 forward
+ascB 1235957 1237381 1425 1 forward
+hycI 1237540 1238010 471 1 reverse
+hycH 1238003 1238413 411 1 reverse
+hycG 1238410 1239177 768 1 reverse
+hycF 1239177 1239719 543 1 reverse
+hycE 1239729 1241438 1710 1 reverse
+hycD 1241456 1242379 924 1 reverse
+hycC 1242382 1244208 1827 1 reverse
+hycB 1244205 1244816 612 1 reverse
+hycA 1244941 1245402 462 1 reverse
+hypA 1245614 1245964 351 1 forward
+hypB 1245968 1246840 873 1 forward
+hypC 1246831 1247103 273 1 forward
+hypD 1247103 1248224 1122 1 forward
+hypE 1248221 1249231 1011 1 forward
+fhlA 1249305 1251383 2079 1 forward
+ygbA 1251420 1251773 354 1 reverse
+mutS 1252060 1254621 2562 1 forward
+pphB 1254727 1255383 657 1 forward
+ygbI 1255434 1256201 768 1 reverse
+ygbJ 1256397 1257305 909 1 forward
+ygbK 1257302 1258468 1167 1 forward
+ygbL 1258560 1259198 639 1 forward
+ygbM 1259203 1259979 777 1 forward
+ygbN 1260068 1261432 1365 1 forward
+rpoS 1261526 1262518 993 1 reverse
+nlpD 1262581 1263720 1140 1 reverse
+pcm 1263860 1264486 627 1 reverse
+umpG 1264480 1265241 762 1 reverse
+truD 1265222 1266271 1050 1 reverse
+ispF 1266268 1266747 480 1 reverse
+ispD 1266747 1267457 711 1 reverse
+ftsB 1267476 1267787 312 1 reverse
+ygbE 1267981 1268304 324 1 reverse
+cysC 1268354 1268959 606 1 reverse
+cysN 1268959 1270386 1428 1 reverse
+cysD 1270388 1271296 909 1 reverse
+iap 1271548 1272585 1038 1 forward
+cas2 1273536 1273820 285 1 reverse
+cas1 1273822 1274739 918 1 reverse
+casE 1274755 1275354 600 1 reverse
+casD 1275341 1276015 675 1 reverse
+casC 1276018 1277109 1092 1 reverse
+casB 1277122 1277604 483 1 reverse
+casA 1277597 1279105 1509 1 reverse
+cas3 1279520 1282186 2667 1 reverse
+cysH 1282545 1283279 735 1 reverse
+cysI 1283354 1285066 1713 1 reverse
+cysJ 1285066 1286865 1800 1 reverse
+queD 1287181 1287546 366 1 forward
+ygcN 1287624 1288895 1272 1 forward
+ygcO 1288886 1289146 261 1 forward
+ygcP 1289163 1289738 576 1 forward
+ygcQ 1289886 1290746 861 1 reverse
+ygcR 1290743 1291522 780 1 reverse
+ygcS 1291500 1292837 1338 1 reverse
+ygcU 1292931 1294385 1455 1 reverse
+ygcW 1294455 1295240 786 1 reverse
+yqcE 1295559 1296836 1278 1 forward
+ygcE 1296863 1298341 1479 1 forward
+queE 1299714 1300385 672 1 reverse
+yqcG 1300524 1300664 141 1 forward
+ygcG 1300678 1301550 873 1 forward
+eno 1301610 1302908 1299 1 reverse
+pyrG 1302996 1304633 1638 1 reverse
+mazG 1304861 1305652 792 1 reverse
+mazF 1305723 1306058 336 1 reverse
+mazE 1306058 1306306 249 1 reverse
+relA 1306384 1308618 2235 1 reverse
+rlmD 1308666 1309967 1302 1 reverse
+barA 1310024 1312780 2757 1 forward
+gudD 1313012 1314352 1341 1 reverse
+gudX 1314373 1315713 1341 1 reverse
+gudP 1315715 1317067 1353 1 reverse
+yqcA 1317502 1317951 450 1 reverse
+truC 1317969 1318751 783 1 reverse
+yqcC 1318751 1319080 330 1 reverse
+syd 1319702 1320247 546 1 reverse
+queF 1320315 1321163 849 1 forward
+ppnN 1321275 1322639 1365 1 forward
+sdaC 1323196 1324485 1290 1 forward
+sdaB 1324543 1325910 1368 1 forward
+ygdG 1326022 1326777 756 1 forward
+fucO 1326832 1327980 1149 1 reverse
+fucA 1328008 1328655 648 1 reverse
+fucP 1329202 1330518 1317 1 forward
+fucI 1330551 1332326 1776 1 forward
+fucK 1332435 1333853 1419 1 forward
+fucU 1333855 1334277 423 1 forward
+fucR 1334335 1335066 732 1 forward
+rlmM 1335110 1336210 1101 1 reverse
+ygdD 1336203 1336598 396 1 reverse
+gcvA 1336617 1337534 918 1 reverse
+ygdI 1337885 1338112 228 1 reverse
+csdA 1338304 1339509 1206 1 forward
+csdE 1339509 1339952 444 1 forward
+tcdA 1340003 1340809 807 1 reverse
+mltA 1341048 1342145 1098 1 reverse
+amiC 1342724 1343977 1254 1 reverse
+argA 1344209 1345540 1332 1 forward
+recD 1345602 1347428 1827 1 reverse
+recB 1347428 1350970 3543 1 reverse
+ptrA 1350963 1353851 2889 1 reverse
+recC 1354027 1357395 3369 1 reverse
+ppdC 1357408 1357731 324 1 reverse
+ygdB 1357716 1358123 408 1 reverse
+ppdB 1358120 1358683 564 1 reverse
+ppdA 1358674 1359144 471 1 reverse
+thyA 1359328 1360122 795 1 reverse
+lgt 1360129 1361004 876 1 reverse
+ptsP 1361155 1363401 2247 1 reverse
+rppH 1363414 1363944 531 1 reverse
+ygdT 1364297 1364443 147 1 reverse
+mutH 1364629 1365318 690 1 forward
+ygdQ 1365387 1366100 714 1 forward
+ygdR 1366238 1366456 219 1 forward
+tas 1366564 1367604 1041 1 forward
+lplT 1367636 1368829 1194 1 reverse
+aas 1368822 1370981 2160 1 reverse
+galR 1371566 1372597 1032 1 forward
+lysA 1372604 1373866 1263 1 reverse
+lysR 1373988 1374923 936 1 forward
+ygeA 1374910 1375602 693 1 reverse
+araE 1375731 1377149 1419 1 reverse
+kduD 1377464 1378225 762 1 reverse
+kduI 1378255 1379091 837 1 reverse
+yqeF 1379378 1380559 1182 1 reverse
+yqeG 1380814 1382043 1230 1 forward
+yqeH 1382503 1383135 633 1 forward
+yqeI 1383469 1384278 810 1 forward
+yqeJ 1384271 1384753 483 1 forward
+yqeL 1384786 1384866 81 1 reverse
+yqeK 1384902 1385327 426 1 reverse
+ygeF 1385521 1386010 490 1 forward
+ygeG 1386235 1386726 492 1 forward
+ygeH 1387061 1388437 1377 1 forward
+ygeI 1388605 1388823 219 1 forward
+pbl 1388906 1389408 503 1 forward
+ygeK 1389427 1389870 444 1 reverse
+ygeL 1389904 1390059 156 1 reverse
+ygeN 1390281 1390987 707 1 reverse
+ygeO 1390929 1391327 399 1 reverse
+insD-4 1391339 1392244 906 1 reverse
+insC-4 1392202 1392567 366 1 reverse
+ygeP 1392656 1392955 300 1 reverse
+ygeQ 1393001 1393795 795 1 reverse
+ygeR 1394103 1394858 756 1 reverse
+xdhA 1395312 1397570 2259 1 forward
+xdhB 1397581 1398459 879 1 forward
+xdhC 1398456 1398935 480 1 forward
+ygeV 1398975 1400753 1779 1 reverse
+ygeW 1401229 1402419 1191 1 forward
+ygeX 1402477 1403673 1197 1 forward
+ygeY 1403731 1404942 1212 1 forward
+hyuA 1404995 1406380 1386 1 forward
+yqeA 1406428 1407360 933 1 forward
+yqeB 1407581 1409206 1626 1 reverse
+yqeC 1409254 1410024 771 1 reverse
+mocA 1410127 1410705 579 1 forward
+ygfK 1411027 1414125 3099 1 forward
+ssnA 1414128 1415456 1329 1 forward
+ygfM 1415507 1416286 780 1 forward
+xdhD 1416283 1419153 2871 1 forward
+xanQ 1419318 1420718 1401 1 forward
+guaD 1420733 1422052 1320 1 forward
+ghxQ 1422088 1423455 1368 1 forward
+ygfS 1423491 1423979 489 1 reverse
+ygfT 1423979 1425898 1920 1 reverse
+uacT 1426334 1427782 1449 1 forward
+yqfG 1427784 1427909 126 1 forward
+yqfH 1427906 1427977 72 1 reverse
+idi 1428032 1428580 549 1 forward
+lysS 1428624 1430141 1518 1 reverse
+prfB 1430151 1431249 1098 2 reverse
+recJ 1431340 1433073 1734 1 reverse
+dsbC 1433079 1433789 711 1 reverse
+xerD 1433814 1434710 897 1 reverse
+fldB 1434822 1435343 522 1 forward
+ygfX 1435383 1435790 408 1 reverse
+sdhE 1435771 1436037 267 1 reverse
+ygfZ 1436280 1437260 981 1 forward
+yqfA 1437456 1438115 660 1 reverse
+yqfB 1438279 1438590 312 1 reverse
+bglA 1438629 1440068 1440 1 forward
+ygfF 1440125 1440868 744 1 reverse
+gcvP 1441135 1444008 2874 1 reverse
+gcvH 1444127 1444516 390 1 reverse
+gcvT 1444540 1445634 1095 1 reverse
+yqfI 1445925 1446008 84 1 forward
+ubiI 1446082 1447284 1203 1 reverse
+ubiH 1447307 1448485 1179 1 reverse
+pepP 1448482 1449807 1326 1 reverse
+ygfB 1449833 1450411 579 1 reverse
+zapA 1450579 1450908 330 1 forward
+fau 1451208 1451756 549 1 forward
+ibsC 1451857 1451916 60 1 reverse
+serA 1452145 1453377 1233 1 reverse
+rpiA 1453633 1454292 660 1 reverse
+yqfE 1454348 1454578 231 1 reverse
+argP 1454720 1455613 894 1 forward
+scpA 1455817 1457961 2145 1 forward
+argK 1457954 1458949 996 1 forward
+scpB 1458960 1459745 786 1 forward
+scpC 1459769 1461247 1479 1 forward
+ygfI 1461244 1462140 897 1 reverse
+yggE 1462307 1463047 741 1 reverse
+argO 1463140 1463775 636 1 reverse
+mscS 1463914 1464774 861 1 reverse
+fbaA 1465132 1466211 1080 1 reverse
+pgk 1466426 1467589 1164 1 reverse
+epd 1467639 1468658 1020 1 reverse
+yggC 1468943 1469656 714 1 reverse
+fumE 1469653 1470162 510 1 reverse
+yggF 1470184 1471149 966 1 reverse
+yggP 1471146 1472423 1278 1 reverse
+cmtA 1472438 1473826 1389 1 reverse
+cmtB 1473854 1474297 444 1 reverse
+tktA 1474611 1476602 1992 1 reverse
+loiP 1476880 1477638 759 1 forward
+speB 1477844 1478764 921 1 reverse
+speA 1478902 1480878 1977 1 reverse
+yqgB 1480887 1481018 132 1 reverse
+yqgC 1481154 1481369 216 1 forward
+yqgD 1481366 1481617 252 1 reverse
+metK 1481673 1482827 1155 1 forward
+galP 1483251 1484645 1395 1 forward
+yggI 1484722 1485219 498 1 forward
+endA 1485314 1486021 708 1 forward
+rsmE 1486101 1486832 732 1 forward
+gshB 1486845 1487795 951 1 forward
+yqgE 1487904 1488467 564 1 forward
+yqgF 1488467 1488883 417 1 forward
+yggR 1489067 1490047 981 1 reverse
+yggS 1490065 1490769 705 1 forward
+yggT 1490787 1491353 567 1 forward
+yggU 1491350 1491640 291 1 forward
+rdgB 1491648 1492241 594 1 forward
+yggW 1492234 1493370 1137 1 forward
+yggM 1493525 1494532 1008 1 reverse
+ansB 1494649 1495695 1047 1 reverse
+yggN 1495871 1496590 720 1 reverse
+yggL 1496774 1497100 327 1 reverse
+trmI 1497100 1497819 720 1 reverse
+mutY 1497980 1499032 1053 1 forward
+yggX 1499060 1499335 276 1 forward
+mltC 1499400 1500479 1080 1 forward
+nupG 1500681 1501937 1257 1 forward
+speC 1501987 1504122 2136 1 reverse
+yqgA 1504520 1505227 708 1 forward
+yghD 1505557 1506093 537 1 reverse
+yghE 1506095 1506955 861 1 reverse
+yghF 1507021 1507887 867 1 reverse
+yghG 1508034 1508444 411 1 reverse
+pppA 1508510 1509319 810 1 reverse
+yghJ 1509517 1514079 4563 1 reverse
+glcA 1514564 1516246 1683 1 reverse
+glcB 1516601 1518772 2172 1 reverse
+glcG 1518794 1519198 405 1 reverse
+glcF 1519203 1520426 1224 1 reverse
+glcE 1520437 1521489 1053 1 reverse
+glcD 1521489 1522988 1500 1 reverse
+glcC 1523239 1524003 765 1 forward
+yghO 1524010 1525182 1173 1 reverse
+insH-9 1525145 1526161 1017 1 forward
+yghQ 1526308 1527375 1068 1 reverse
+yghR 1527421 1528179 759 1 reverse
+yghS 1528211 1528924 714 1 reverse
+yghT 1529098 1529790 693 1 forward
+pitB 1529839 1531338 1500 1 reverse
+gss 1531630 1533489 1860 1 reverse
+yghU 1533694 1534560 867 1 forward
+hybG 1534683 1534931 249 1 reverse
+hybF 1534944 1535285 342 1 reverse
+hybE 1535278 1535766 489 1 reverse
+hybD 1535759 1536253 495 1 reverse
+hybC 1536253 1537956 1704 1 reverse
+hybB 1537953 1539131 1179 1 reverse
+hybA 1539121 1540107 987 1 reverse
+hybO 1540110 1541228 1119 1 reverse
+yghW 1541417 1541704 288 1 reverse
+yghX 1541823 1542658 836 1 reverse
+yqhI 1542564 1542707 144 1 reverse
+gpr 1542864 1543904 1041 1 forward
+yqhA 1543944 1544438 495 1 reverse
+yghA 1544629 1545513 885 1 forward
+exbD 1545785 1546210 426 1 reverse
+exbB 1546217 1546951 735 1 reverse
+metC 1547203 1548390 1188 1 forward
+yghB 1548530 1549189 660 1 forward
+yqhC 1549229 1550185 957 1 reverse
+yqhD 1550322 1551485 1164 1 forward
+dkgA 1551590 1552417 828 1 forward
+yqhG 1552617 1553543 927 1 forward
+yqhH 1553594 1553851 258 1 forward
+ygiQ 1553894 1556113 2220 1 reverse
+ftsP 1556224 1557636 1413 1 reverse
+plsC 1557711 1558448 738 1 reverse
+parC 1558682 1560940 2259 1 reverse
+ygiS 1561078 1562685 1608 1 reverse
+mqsA 1562818 1563213 396 1 reverse
+mqsR 1563215 1563511 297 1 reverse
+ygiV 1563716 1564198 483 1 reverse
+ygiW 1564251 1564643 393 1 reverse
+qseB 1564795 1565454 660 1 forward
+qseC 1565451 1566800 1350 1 forward
+ygiZ 1566846 1567178 333 1 reverse
+mdaB 1567497 1568078 582 1 forward
+ygiN 1568109 1568423 315 1 forward
+parE 1568471 1570363 1893 1 reverse
+yqiA 1570392 1570973 582 1 reverse
+cpdA 1570973 1571800 828 1 reverse
+yqiB 1571825 1572247 423 1 reverse
+nudF 1572248 1572877 630 1 reverse
+tolC 1573082 1574563 1482 1 forward
+ygiA 1574563 1574823 261 1 forward
+ygiB 1574711 1575382 672 1 forward
+ygiC 1575388 1576548 1161 1 forward
+ygiD 1576586 1577401 816 1 reverse
+zupT 1577517 1578290 774 1 forward
+yqiD 1578348 1578518 171 1 reverse
+ribB 1578780 1579433 654 1 reverse
+ubiK 1579807 1580097 291 1 forward
+ygiL 1580381 1580932 552 1 forward
+yqiG 1580992 1584832 2505 2 forward
+insC-5 1581154 1581519 366 1 forward
+insD-5 1581477 1582382 906 1 forward
+yqiH 1584848 1585597 750 1 forward
+yqiI 1585599 1586663 1065 1 forward
+glgS 1586706 1586906 201 1 reverse
+yqiJ 1587175 1587804 630 1 forward
+yqiK 1587831 1589492 1662 1 forward
+ibsD 1589733 1589792 60 1 forward
+ibsE 1590108 1590167 60 1 forward
+rfaE 1590287 1591720 1434 1 reverse
+glnE 1591768 1594608 2841 1 reverse
+ygiF 1594631 1595932 1302 1 reverse
+ygiM 1596174 1596794 621 1 forward
+cca 1596858 1598096 1239 1 forward
+bacA 1598277 1599098 822 1 reverse
+folB 1599188 1599556 369 1 reverse
+plsY 1599661 1600278 618 1 forward
+ttdR 1600291 1601223 933 1 reverse
+ttdA 1601430 1602341 912 1 forward
+ttdB 1602338 1602943 606 1 forward
+ttdT 1602991 1604454 1464 1 forward
+tsaD 1604497 1605510 1014 1 reverse
+rpsU 1605748 1605963 216 1 forward
+dnaG 1606074 1607819 1746 1 forward
+rpoD 1608014 1609855 1842 1 forward
+mug 1609934 1610440 507 1 reverse
+nfeF 1610694 1611458 765 1 reverse
+nfeR 1611746 1612369 624 1 forward
+aer 1612523 1614043 1521 1 reverse
+patA 1614461 1615840 1380 1 forward
+ygjH 1615882 1616214 333 1 reverse
+ebgR 1616433 1617416 984 1 forward
+ebgA 1617600 1620692 3093 1 forward
+ebgC 1620689 1621138 450 1 forward
+ygjI 1621201 1622634 1434 1 forward
+ygjJ 1622768 1623838 1071 1 forward
+ygjK 1623855 1626206 2352 1 forward
+fadH 1626632 1628650 2019 1 forward
+higA 1628695 1629111 417 1 reverse
+higB 1629108 1629422 315 1 reverse
+rlmG 1629706 1630842 1137 1 reverse
+ygjP 1630927 1631430 504 1 forward
+ygjQ 1631507 1632199 693 1 forward
+ygjR 1632278 1633264 987 1 forward
+alx 1633547 1634512 966 1 forward
+sstT 1634911 1636155 1245 1 forward
+ygjV 1636160 1636711 552 1 reverse
+uxaA 1636794 1638281 1488 1 reverse
+uxaC 1638296 1639708 1413 1 reverse
+exuT 1640191 1641489 1299 1 forward
+exuR 1641619 1642395 777 1 forward
+yqjA 1642740 1643402 663 1 forward
+mzrA 1643406 1643789 384 1 forward
+yqjC 1643936 1644304 369 1 forward
+yqjD 1644342 1644647 306 1 forward
+yqjE 1644650 1645054 405 1 forward
+yqjK 1645044 1645343 300 1 forward
+yqjF 1645529 1645921 393 1 forward
+yqjG 1645991 1646977 987 1 forward
+yhaH 1647271 1647636 366 1 forward
+yhaI 1647878 1648234 357 1 forward
+yhaJ 1648285 1649181 897 1 reverse
+yhaK 1649286 1649987 702 1 forward
+yhaL 1650010 1650174 165 1 forward
+cyuA 1650308 1651618 1311 1 reverse
+cyuP 1651646 1652977 1332 1 reverse
+tdcG 1653252 1654616 1365 1 reverse
+tdcF 1654688 1655077 390 1 reverse
+tdcE 1655091 1657385 2295 1 reverse
+tdcD 1657419 1658627 1209 1 reverse
+tdcC 1658653 1659984 1332 1 reverse
+tdcB 1660006 1660995 990 1 reverse
+tdcA 1661094 1662032 939 1 reverse
+tdcR 1662347 1662565 219 1 forward
+yhaB 1662821 1663360 540 1 forward
+yhaC 1663382 1664569 1188 1 forward
+garK 1665592 1666737 1146 1 reverse
+garR 1666834 1667718 885 1 reverse
+garL 1667754 1668524 771 1 reverse
+garP 1668540 1669874 1335 1 reverse
+garD 1670249 1671820 1572 1 forward
+prlF 1671969 1672304 336 1 forward
+yhaV 1672304 1672768 465 1 forward
+agaR 1672823 1673632 810 1 reverse
+kbaZ 1673881 1675161 1281 1 forward
+agaV 1675184 1675657 474 1 forward
+agaW 1675668 1676069 402 1 forward
+agaA 1676089 1676592 504 1 forward
+agaS 1676943 1678097 1155 1 forward
+kbaY 1678110 1678970 861 1 forward
+agaB 1679137 1679613 477 1 forward
+agaC 1679652 1680455 804 1 forward
+agaD 1680445 1681236 792 1 forward
+agaI 1681237 1681992 756 1 forward
+yraH 1682393 1682977 585 1 forward
+yraI 1683057 1683752 696 1 forward
+yraJ 1683781 1686297 2517 1 forward
+yraK 1686308 1687399 1092 1 forward
+rsmI 1687442 1688302 861 1 reverse
+lpoA 1688367 1690403 2037 1 forward
+yraN 1690361 1690756 396 1 forward
+diaA 1690776 1691366 591 1 forward
+yraP 1691376 1691951 576 1 forward
+yraQ 1692065 1693105 1041 1 reverse
+yraR 1693178 1693813 636 1 reverse
+yhbO 1693941 1694459 519 1 forward
+yhbP 1694439 1694882 444 1 reverse
+yhbQ 1694933 1695235 303 1 forward
+yhbS 1695222 1695725 504 1 reverse
+yhbT 1695719 1696243 525 1 reverse
+yhbU 1696452 1697447 996 1 forward
+yhbV 1697456 1698334 879 1 forward
+yhbW 1698415 1699422 1008 1 forward
+mtr 1699540 1700784 1245 1 reverse
+deaD 1700938 1702827 1890 1 reverse
+yrbN 1702820 1702900 81 1 reverse
+nlpI 1703007 1703891 885 1 reverse
+pnp 1704000 1706135 2136 1 reverse
+rpsO 1706382 1706651 270 1 reverse
+truB 1706800 1707744 945 1 reverse
+rbfA 1707744 1708145 402 1 reverse
+infB 1708309 1710981 2673 1 reverse
+nusA 1711006 1712493 1488 1 reverse
+rimP 1712521 1712973 453 1 reverse
+argG 1713604 1714947 1344 1 forward
+yhbX 1714955 1716580 1626 1 reverse
+secG 1717140 1717472 333 1 reverse
+glmM 1717700 1719037 1338 1 reverse
+folP 1719030 1719878 849 1 reverse
+ftsH 1719968 1721902 1935 1 reverse
+rlmE 1722002 1722631 630 1 reverse
+yhbY 1722757 1723050 294 1 forward
+greA 1723206 1723682 477 1 reverse
+dacB 1723930 1725363 1434 1 forward
+obgE 1725549 1726721 1173 1 reverse
+yhbE 1726737 1727702 966 1 reverse
+rpmA 1727829 1728086 258 1 reverse
+rplU 1728107 1728418 312 1 reverse
+ispB 1728677 1729648 972 1 forward
+sfsB 1729876 1730154 279 1 forward
+murA 1730202 1731461 1260 1 reverse
+ibaG 1731516 1731770 255 1 reverse
+mlaB 1731930 1732223 294 1 reverse
+mlaC 1732223 1732858 636 1 reverse
+mlaD 1732877 1733428 552 1 reverse
+mlaE 1733433 1734215 783 1 reverse
+mlaF 1734223 1735032 810 1 reverse
+yrbG 1735242 1736219 978 1 forward
+kdsD 1736233 1737219 987 1 forward
+kdsC 1737240 1737806 567 1 forward
+lptC 1737803 1738378 576 1 forward
+lptA 1738347 1738904 558 1 forward
+lptB 1738911 1739636 726 1 forward
+rpoN 1739684 1741117 1434 1 forward
+hpf 1741140 1741427 288 1 forward
+ptsN 1741545 1742036 492 1 forward
+rapZ 1742082 1742936 855 1 forward
+npr 1742933 1743205 273 1 forward
+yrbL 1743419 1744051 633 1 forward
+mtgA 1744048 1744776 729 1 reverse
+elbB 1744773 1745426 654 1 reverse
+arcB 1745656 1747992 2337 1 reverse
+yhcC 1748088 1749017 930 1 reverse
+gltB 1749692 1754152 4461 1 forward
+gltD 1754165 1755583 1419 1 forward
+gltF 1756143 1756907 765 1 forward
+yhcA 1757079 1757753 675 1 forward
+yhcD 1757774 1760155 2382 1 forward
+yhcE 1760152 1761896 546 2 forward
+insH-10 1760669 1761685 1017 1 reverse
+yhcF 1761893 1762609 717 1 forward
+yhcG 1762794 1763921 1128 1 forward
+yhcH 1763981 1764445 465 1 reverse
+nanK 1764442 1765317 876 1 reverse
+nanE 1765314 1766003 690 1 reverse
+nanT 1766051 1767541 1491 1 reverse
+nanA 1767650 1768543 894 1 reverse
+nanR 1768665 1769456 792 1 reverse
+dcuD 1769836 1771203 1368 1 forward
+sspB 1771246 1771743 498 1 reverse
+sspA 1771749 1772387 639 1 reverse
+rpsI 1772782 1773174 393 1 reverse
+rplM 1773190 1773618 429 1 reverse
+zapE 1773837 1774964 1128 1 reverse
+yhcB 1775158 1775556 399 1 forward
+degQ 1775710 1777077 1368 1 forward
+degS 1777167 1778234 1068 1 forward
+mdh 1778297 1779235 939 1 reverse
+argR 1779670 1780140 471 1 forward
+yhcN 1780505 1780768 264 1 forward
+yhcO 1780824 1781096 273 1 reverse
+aaeB 1781188 1783155 1968 1 reverse
+aaeA 1783161 1784093 933 1 reverse
+aaeX 1784101 1784304 204 1 reverse
+aaeR 1784487 1785416 930 1 forward
+tldD 1785550 1786995 1446 1 reverse
+yhdP 1787425 1791225 3801 1 reverse
+rng 1791293 1792762 1470 1 reverse
+yhdE 1792752 1793345 594 1 reverse
+mreD 1793354 1793842 489 1 reverse
+mreC 1793842 1794945 1104 1 reverse
+mreB 1795011 1796054 1044 1 reverse
+csrD 1796359 1798299 1941 1 reverse
+yhdH 1798451 1799425 975 1 forward
+accB 1800403 1800873 471 1 forward
+accC 1800884 1802233 1350 1 forward
+yhdT 1802342 1802584 243 1 forward
+panF 1802574 1804025 1452 1 forward
+prmA 1804037 1804918 882 1 forward
+dusB 1805247 1806212 966 1 forward
+fis 1806238 1806534 297 1 forward
+yhdJ 1806620 1807504 885 1 forward
+yhdU 1807588 1807767 180 1 forward
+envR 1807770 1808432 663 1 reverse
+acrE 1808831 1809988 1158 1 forward
+acrF 1810000 1813104 3105 1 forward
+yhdV 1813357 1813578 222 1 forward
+yhdW 1814009 1815033 1025 1 forward
+yhdX 1815101 1816282 1182 1 forward
+yhdY 1816292 1817395 1104 1 forward
+yhdZ 1817403 1818161 759 1 forward
+yrdA 1824203 1824757 555 1 forward
+yrdB 1824733 1824990 258 1 reverse
+aroE 1824987 1825805 819 1 reverse
+tsaC 1825810 1826382 573 1 reverse
+yrdD 1826387 1826929 543 1 reverse
+smg 1826958 1827431 474 1 reverse
+smf 1827403 1828527 1125 1 reverse
+def 1828657 1829166 510 1 forward
+fmt 1829181 1830128 948 1 forward
+rsmB 1830174 1831463 1290 1 forward
+trkA 1831485 1832861 1377 1 forward
+mscL 1832991 1833401 411 1 forward
+arfA 1833398 1833616 219 1 reverse
+zntR 1833672 1834097 426 1 reverse
+yhdN 1834108 1834476 369 1 reverse
+rplQ 1834583 1834966 384 1 reverse
+rpoA 1835007 1835996 990 1 reverse
+rpsD 1836022 1836642 621 1 reverse
+rpsK 1836676 1837065 390 1 reverse
+rpsM 1837082 1837438 357 1 reverse
+rpmJ 1837585 1837701 117 1 reverse
+secY 1837733 1839064 1332 1 reverse
+rplO 1839072 1839506 435 1 reverse
+rpmD 1839510 1839689 180 1 reverse
+rpsE 1839693 1840196 504 1 reverse
+rplR 1840211 1840564 354 1 reverse
+rplF 1840574 1841107 534 1 reverse
+rpsH 1841120 1841512 393 1 reverse
+rpsN 1841546 1841851 306 1 reverse
+rplE 1841866 1842405 540 1 reverse
+rplX 1842420 1842734 315 1 reverse
+rplN 1842745 1843116 372 1 reverse
+rpsQ 1843281 1843535 255 1 reverse
+rpmC 1843535 1843726 192 1 reverse
+rplP 1843726 1844136 411 1 reverse
+rpsC 1844149 1844850 702 1 reverse
+rplV 1844868 1845200 333 1 reverse
+rpsS 1845215 1845493 279 1 reverse
+rplB 1845510 1846331 822 1 reverse
+rplW 1846349 1846651 303 1 reverse
+rplD 1846648 1847253 606 1 reverse
+rplC 1847264 1847893 630 1 reverse
+rpsJ 1847926 1848237 312 1 reverse
+gspB 1848475 1848894 420 1 reverse
+gspA 1848896 1850365 1470 1 reverse
+gspC 1850545 1851360 816 1 forward
+gspD 1851344 1853296 1953 1 forward
+gspE 1853306 1854787 1482 1 forward
+gspF 1854784 1855980 1197 1 forward
+gspG 1855990 1856427 438 1 forward
+gspH 1856435 1856944 510 1 forward
+gspI 1856941 1857318 378 1 forward
+gspJ 1857311 1857898 588 1 forward
+gspK 1857891 1858874 984 1 forward
+gspL 1858889 1860052 1164 1 forward
+gspM 1860049 1860510 462 1 forward
+gspO 1860510 1861187 678 1 forward
+bfr 1861216 1861692 477 1 reverse
+bfd 1861764 1861958 195 1 reverse
+chiA 1862127 1864820 2694 1 reverse
+tufA 1865112 1866296 1185 1 reverse
+fusA 1866367 1868481 2115 1 reverse
+rpsG 1868509 1869048 540 1 reverse
+rpsL 1869145 1869519 375 1 reverse
+tusB 1869645 1869932 288 1 reverse
+tusC 1869940 1870299 360 1 reverse
+tusD 1870299 1870685 387 1 reverse
+yheO 1870685 1871407 723 1 reverse
+fkpA 1871574 1872386 813 1 reverse
+slyX 1872607 1872825 219 1 forward
+slyD 1872874 1873464 591 1 reverse
+yheV 1873559 1873759 201 1 reverse
+kefB 1873769 1875574 1806 1 reverse
+kefG 1875574 1876128 555 1 reverse
+yheS 1876256 1878169 1914 1 forward
+yheT 1878169 1879191 1023 1 forward
+yheU 1879185 1879403 219 1 forward
+prkB 1879457 1880326 870 1 forward
+yhfA 1880381 1880785 405 1 reverse
+crp 1881087 1881719 633 1 forward
+yhfK 1881758 1883860 2103 1 forward
+argD 1883927 1885147 1221 1 reverse
+pabA 1885233 1885796 564 1 reverse
+fic 1885828 1886430 603 1 reverse
+yhfG 1886420 1886587 168 1 reverse
+ppiA 1886692 1887264 573 1 reverse
+tsgA 1887535 1888716 1182 1 forward
+nirB 1888978 1891521 2544 1 forward
+nirD 1891518 1891844 327 1 forward
+nirC 1891970 1892776 807 1 forward
+cysG 1892795 1894168 1374 1 forward
+yhfL 1894415 1894582 168 1 forward
+frlA 1894877 1896214 1338 1 forward
+frlB 1896235 1897257 1023 1 forward
+frlC 1897307 1898137 831 1 forward
+frlD 1898134 1898919 786 1 forward
+frlR 1899019 1899750 732 1 forward
+yhfS 1899902 1900987 1086 1 reverse
+yhfT 1900999 1902303 1305 1 reverse
+yhfU 1902315 1902668 354 1 reverse
+php 1902679 1903557 879 1 reverse
+yhfW 1903554 1904780 1227 1 reverse
+yhfX 1904780 1905943 1164 1 reverse
+yhfY 1906027 1906389 363 1 reverse
+yhfZ 1906406 1907311 906 1 reverse
+trpS 1907601 1908605 1005 1 reverse
+gph 1908598 1909356 759 1 reverse
+rpe 1909349 1910026 678 1 reverse
+dam 1910044 1910880 837 1 reverse
+damX 1910987 1912273 1287 1 reverse
+aroB 1912365 1913453 1089 1 reverse
+aroK 1913510 1914031 522 1 reverse
+hofQ 1914432 1915670 1239 1 reverse
+hofP 1915582 1915986 405 1 reverse
+hofO 1915976 1916416 441 1 reverse
+hofN 1916400 1916939 540 1 reverse
+hofM 1916939 1917718 780 1 reverse
+mrcA 1917838 1920390 2553 1 forward
+nudE 1920556 1921116 561 1 reverse
+igaA 1921436 1923571 2136 1 forward
+yrfG 1923636 1924304 669 1 forward
+hslR 1924315 1924716 402 1 forward
+hslO 1924741 1925619 879 1 forward
+yhgE 1925682 1927406 1725 1 reverse
+pck 1927785 1929407 1623 1 forward
+envZ 1929483 1930835 1353 1 reverse
+ompR 1930832 1931551 720 1 reverse
+greB 1931779 1932255 477 1 forward
+yhgF 1932352 1934673 2322 1 forward
+feoA 1935130 1935357 228 1 forward
+feoB 1935374 1937695 2322 1 forward
+feoC 1937695 1937931 237 1 forward
+rpnA 1938134 1939012 879 1 forward
+bioH 1939041 1939811 771 1 reverse
+yhgH 1939849 1940532 684 1 forward
+nfuA 1940591 1941166 576 1 forward
+gntT 1941526 1942842 1317 1 forward
+malQ 1942953 1945037 2085 1 reverse
+malP 1945047 1947440 2394 1 reverse
+malT 1948052 1950757 2706 1 forward
+rtcA 1950800 1951816 1017 1 reverse
+rtcB 1951820 1953046 1227 1 reverse
+rtcR 1953235 1954833 1599 1 forward
+glpR 1954815 1955572 758 1 reverse
+glpG 1955589 1956419 831 1 reverse
+glpE 1956464 1956790 327 1 reverse
+glpD 1956980 1958485 1506 1 forward
+yzgL 1958691 1958972 282 1 reverse
+glgP 1959101 1961548 2448 1 reverse
+glgA 1961567 1963000 1434 1 reverse
+glgC 1963000 1964295 1296 1 reverse
+glgX 1964313 1966286 1974 1 reverse
+glgB 1966283 1968469 2187 1 reverse
+asd 1968742 1969845 1104 1 reverse
+yhgN 1970038 1970631 594 1 forward
+gntU 1970688 1972028 1341 1 reverse
+gntK 1972032 1972559 528 1 reverse
+gntR 1972698 1973693 996 1 reverse
+yhhW 1973917 1974612 696 1 reverse
+yhhX 1974735 1975772 1038 1 reverse
+yhhY 1976105 1976593 489 1 forward
+yhhZ 1976830 1978008 1179 1 forward
+yrhA 1978005 1979276 495 2 forward
+insA-6 1978450 1978725 276 1 forward
+insB-6 1978644 1979147 504 1 forward
+yrhD 1979371 1979526 156 1 forward
+yrhB 1979726 1980010 285 1 forward
+ggt 1980048 1981790 1743 1 reverse
+yhhA 1981910 1982350 441 1 forward
+ugpQ 1982337 1983080 744 1 reverse
+ugpC 1983077 1984147 1071 1 reverse
+ugpE 1984149 1984994 846 1 reverse
+ugpA 1984991 1985878 888 1 reverse
+ugpB 1985976 1987292 1317 1 reverse
+livF 1987691 1988404 714 1 reverse
+livG 1988406 1989173 768 1 reverse
+livM 1989170 1990447 1278 1 reverse
+livH 1990444 1991370 927 1 reverse
+livK 1991418 1992527 1110 1 reverse
+panZ 1992951 1993334 384 1 forward
+livJ 1993522 1994625 1104 1 reverse
+rpoH 1994896 1995750 855 1 reverse
+ftsX 1995995 1997053 1059 1 reverse
+ftsE 1997046 1997714 669 1 reverse
+ftsY 1997717 1999210 1494 1 reverse
+rsmD 1999360 1999956 597 1 forward
+yhhL 1999946 2000215 270 1 forward
+yhhM 2000218 2000577 360 1 reverse
+yhhN 2000718 2001344 627 1 forward
+zntA 2001418 2003616 2199 1 forward
+tusA 2003718 2003963 246 1 reverse
+yhhQ 2004184 2004849 666 1 forward
+dcrB 2004922 2005479 558 1 forward
+yhhS 2005483 2006700 1218 1 reverse
+yhhT 2006832 2007881 1050 1 forward
+acpT 2007936 2008523 588 1 forward
+nikA 2008634 2010208 1575 1 forward
+nikB 2010208 2011152 945 1 forward
+nikC 2011149 2011982 834 1 forward
+nikD 2011982 2012746 765 1 forward
+nikE 2012743 2013549 807 1 forward
+nikR 2013555 2013956 402 1 forward
+rhsB 2014159 2018394 4236 1 forward
+yhhH 2018366 2018749 384 1 forward
+yhhI 2019345 2020481 1137 1 forward
+yhhJ 2020646 2021770 1125 1 reverse
+rbbA 2021770 2024505 2736 1 reverse
+yhiI 2024502 2025569 1068 1 reverse
+yhiJ 2025935 2027557 1623 1 reverse
+yhiL 2027819 2029425 1607 1 reverse
+yhiM 2029808 2030860 1053 1 forward
+yhiN 2031175 2032377 1203 1 reverse
+pitA 2032609 2034108 1500 1 forward
+uspB 2034352 2034687 336 1 reverse
+uspA 2035078 2035512 435 1 forward
+dtpB 2035829 2037298 1470 1 forward
+rsmJ 2037347 2038099 753 1 reverse
+prlC 2038107 2040149 2043 1 reverse
+rlmJ 2040352 2041194 843 1 forward
+gor 2041266 2042618 1353 1 forward
+dinQ 2042672 2042755 84 1 reverse
+arsR 2043495 2043848 354 1 forward
+arsB 2043902 2045191 1290 1 forward
+arsC 2045204 2045629 426 1 forward
+yhiS 2046258 2048680 1224 2 forward
+insH-11 2047149 2048165 1017 1 reverse
+slp 2048928 2049494 567 1 forward
+dctR 2049650 2050180 531 1 forward
+yhiD 2050222 2050869 648 1 reverse
+hdeB 2050933 2051259 327 1 reverse
+hdeA 2051375 2051707 333 1 reverse
+hdeD 2051962 2052534 573 1 forward
+gadE 2053333 2053860 528 1 forward
+mdtE 2054199 2055356 1158 1 forward
+mdtF 2055381 2058494 3114 1 forward
+gadW 2058857 2059585 729 1 reverse
+gadX 2059953 2060777 825 1 reverse
+gadA 2061147 2062547 1401 1 reverse
+ccp 2062758 2064155 1398 1 reverse
+treF 2064559 2066208 1650 1 forward
+yhjB 2066259 2066861 603 1 reverse
+yhjC 2067381 2068280 900 1 forward
+yhjD 2068329 2069342 1014 1 forward
+yhjE 2069753 2071075 1323 1 forward
+yhjG 2071257 2073317 2061 1 reverse
+pdeH 2073387 2074154 768 1 reverse
+kdgK 2074386 2075315 930 1 forward
+yhjJ 2075411 2076907 1497 1 reverse
+dctA 2077128 2078414 1287 1 reverse
+pdeK 2078597 2080585 1989 1 reverse
+bcsC 2080667 2084140 3474 1 reverse
+bcsZ 2084122 2085228 1107 1 reverse
+bcsB 2085235 2087574 2340 1 reverse
+bcsA 2087585 2090203 2619 1 reverse
+bcsQ 2090200 2090952 753 1 reverse
+yhjR 2090964 2091152 189 1 reverse
+bcsE 2091425 2092996 1572 1 forward
+bcsF 2092993 2093184 192 1 forward
+bcsG 2093181 2094860 1680 1 forward
+ldrD 2094947 2095054 108 1 reverse
+yhjV 2095530 2096801 1272 1 forward
+dppF 2096831 2097835 1005 1 reverse
+dppD 2097832 2098815 984 1 reverse
+dppC 2098826 2099728 903 1 reverse
+dppB 2099738 2100757 1020 1 reverse
+dppA 2101065 2102672 1608 1 reverse
+eptB 2103751 2105442 1692 1 reverse
+yhjX 2105766 2106974 1209 1 reverse
+yhjY 2107203 2107901 699 1 reverse
+tag 2108059 2108622 564 1 forward
+yiaC 2108619 2109059 441 1 forward
+bisC 2109028 2111361 2334 1 reverse
+yiaD 2111514 2112173 660 1 forward
+ghrB 2112277 2113251 975 1 forward
+yiaF 2113301 2114011 711 1 reverse
+yiaG 2114445 2114735 291 1 forward
+cspA 2115016 2115228 213 1 forward
+hokA 2115415 2115567 153 1 reverse
+insJ 2115647 2116168 522 1 forward
+insK 2116165 2117016 852 1 forward
+glyS 2117295 2119364 2070 1 reverse
+glyQ 2119374 2120285 912 1 reverse
+ysaB 2120380 2120679 300 1 reverse
+wecH 2120854 2121849 996 1 forward
+yiaA 2121891 2122328 438 1 reverse
+yiaB 2122374 2122715 342 1 reverse
+xylB 2122884 2124338 1455 1 reverse
+xylA 2124410 2125732 1323 1 reverse
+xylF 2126098 2127090 993 1 forward
+xylG 2127168 2128709 1542 1 forward
+xylH 2128687 2129868 1182 1 forward
+xylR 2129946 2131124 1179 1 forward
+bax 2131320 2132144 825 1 reverse
+malS 2132464 2134494 2031 1 forward
+avtA 2134672 2135925 1254 1 forward
+ysaA 2136076 2136549 474 1 reverse
+yiaJ 2136651 2137499 849 1 reverse
+yiaK 2137700 2138698 999 1 forward
+yiaL 2138710 2139177 468 1 forward
+yiaM 2139295 2139768 474 1 forward
+yiaN 2139771 2141048 1278 1 forward
+yiaO 2141061 2142047 987 1 forward
+lyxK 2142051 2143547 1497 1 forward
+sgbH 2143544 2144206 663 1 forward
+sgbU 2144199 2145059 861 1 forward
+sgbE 2145053 2145748 696 1 forward
+yiaT 2146095 2146835 741 1 reverse
+yiaU 2146959 2147933 975 1 forward
+yiaV 2147930 2149066 1137 1 reverse
+yiaW 2149072 2149395 324 1 reverse
+aldB 2149940 2151478 1539 1 reverse
+yiaY 2151643 2152794 1152 1 reverse
+selB 2152984 2154828 1845 1 reverse
+selA 2154825 2156216 1392 1 reverse
+yibF 2156314 2156922 609 1 reverse
+rhsA 2157150 2161283 4134 1 forward
+yibA 2161304 2162146 843 1 forward
+yibJ 2162188 2162889 702 1 forward
+yibG 2163144 2163605 462 1 forward
+yibS 2163606 2163857 252 1 forward
+yibV 2164312 2164647 336 1 forward
+yibH 2165210 2166346 1137 1 reverse
+yibI 2166349 2166711 363 1 reverse
+mtlA 2167248 2169161 1914 1 forward
+mtlD 2169391 2170539 1149 1 forward
+mtlR 2170539 2171126 588 1 forward
+yibT 2171138 2171347 210 1 reverse
+yibL 2171632 2171994 363 1 forward
+lldP 2172366 2174021 1656 1 forward
+lldR 2174021 2174797 777 1 forward
+lldD 2174794 2175984 1191 1 forward
+trmL 2176182 2176655 474 1 forward
+cysE 2176708 2177529 822 1 reverse
+gpsA 2177609 2178628 1020 1 reverse
+secB 2178628 2179095 468 1 reverse
+grxC 2179158 2179409 252 1 reverse
+yibN 2179551 2179982 432 1 reverse
+gpmM 2180227 2181771 1545 1 forward
+envC 2181805 2183064 1260 1 forward
+yibQ 2183068 2184027 960 1 forward
+waaH 2184014 2185048 1035 1 reverse
+tdh 2185287 2186312 1026 1 reverse
+kbl 2186322 2187518 1197 1 reverse
+htrL 2187793 2188650 858 1 reverse
+rfaD 2188954 2189886 933 1 forward
+waaF 2189896 2190942 1047 1 forward
+waaC 2190946 2191905 960 1 forward
+waaL 2191915 2193174 1260 1 forward
+waaU 2193206 2194279 1074 1 reverse
+waaZ 2194312 2195163 852 1 reverse
+waaY 2195234 2195932 699 1 reverse
+waaJ 2195950 2196966 1017 1 reverse
+waaO 2197006 2198025 1020 1 reverse
+waaB 2198025 2199104 1080 1 reverse
+waaS 2199148 2200083 936 1 reverse
+waaP 2200120 2200917 798 1 reverse
+waaG 2200910 2202034 1125 1 reverse
+waaQ 2202031 2203065 1035 1 reverse
+waaA 2203507 2204784 1278 1 forward
+coaD 2204792 2205271 480 1 forward
+mutM 2205310 2206119 810 1 reverse
+rpmG 2206217 2206384 168 1 reverse
+rpmB 2206405 2206641 237 1 reverse
+yicR 2206858 2207526 669 1 reverse
+dfp 2207698 2208918 1221 1 forward
+dut 2208899 2209354 456 1 forward
+slmA 2209461 2210057 597 1 forward
+pyrE 2210094 2210735 642 1 reverse
+rph 2210830 2211516 687 1 reverse
+yicC 2211643 2212506 864 1 forward
+dinD 2212727 2213551 825 1 forward
+yicG 2213841 2214458 618 1 forward
+ligB 2214455 2216137 1683 1 reverse
+gmk 2216395 2217018 624 1 forward
+rpoZ 2217073 2217348 276 1 forward
+spoT 2217367 2219475 2109 1 forward
+trmH 2219482 2220171 690 1 forward
+recG 2220177 2222258 2082 1 forward
+gltS 2222427 2223632 1206 1 reverse
+xanP 2223912 2225303 1392 1 forward
+yicH 2225424 2227133 1710 1 forward
+yicI 2227186 2229504 2319 1 reverse
+yicJ 2229514 2230896 1383 1 reverse
+setC 2231920 2233104 1185 1 forward
+yicL 2233215 2234138 924 1 forward
+nlpA 2234142 2234960 819 1 reverse
+yicS 2235182 2235475 294 1 forward
+nepI 2235516 2236706 1191 1 reverse
+yicN 2236917 2237369 453 1 reverse
+adeQ 2237422 2238756 1335 1 reverse
+adeD 2238931 2240697 1767 1 forward
+uhpT 2240743 2242134 1392 1 reverse
+uhpC 2242272 2243591 1320 1 reverse
+uhpB 2243601 2245103 1503 1 reverse
+uhpA 2245103 2245693 591 1 reverse
+ilvN 2245769 2246059 291 1 reverse
+ilvB 2246063 2247751 1689 1 reverse
+ivbL 2247857 2247955 99 1 reverse
+tisB 2248520 2248609 90 1 forward
+emrD 2248889 2250073 1185 1 forward
+yidF 2250081 2250578 498 1 reverse
+yidG 2250575 2250937 363 1 reverse
+yidH 2250927 2251274 348 1 reverse
+yidI 2251382 2251831 450 1 forward
+yidJ 2251878 2253371 1494 1 reverse
+yidK 2253368 2255083 1716 1 reverse
+yidL 2255250 2256143 894 1 forward
+glvG 2256316 2256954 639 1 reverse
+glvB 2256954 2257439 486 1 reverse
+glvC 2257464 2258570 1107 1 reverse
+yidP 2258866 2259582 717 1 forward
+yidE 2259579 2261240 1662 1 reverse
+ibpB 2261436 2261864 429 1 reverse
+ibpA 2261976 2262389 414 1 reverse
+yidQ 2262695 2263027 333 1 forward
+yidR 2263029 2264276 1248 1 reverse
+cbrA 2264344 2265408 1065 1 forward
+dgoT 2265405 2266697 1293 1 reverse
+dgoD 2266817 2267965 1149 1 reverse
+dgoA 2267962 2268579 618 1 reverse
+dgoK 2268563 2269441 879 1 reverse
+dgoR 2269438 2270127 690 1 reverse
+yidX 2270405 2271061 657 1 forward
+yidA 2271107 2271919 813 1 reverse
+yidB 2272034 2272432 399 1 reverse
+gyrB 2272672 2275086 2415 1 reverse
+recF 2275115 2276188 1074 1 reverse
+dnaN 2276188 2277288 1101 1 reverse
+dnaA 2277293 2278696 1404 1 reverse
+ysdD 2278993 2279073 81 1 forward
+rpmH 2279303 2279443 141 1 forward
+rnpA 2279460 2279819 360 1 forward
+yidD 2279783 2280040 258 1 forward
+yidC 2280043 2281689 1647 1 forward
+mnmE 2281795 2283159 1365 1 forward
+tnaC 2283402 2283476 75 1 forward
+tnaA 2283697 2285112 1416 1 forward
+tnaB 2285203 2286450 1248 1 forward
+mdtL 2286582 2287757 1176 1 forward
+yidZ 2287732 2288691 960 1 forward
+yieE 2288848 2289597 750 1 forward
+yieF 2289619 2290185 567 1 forward
+adeP 2290239 2291576 1338 1 reverse
+yieH 2291741 2292406 666 1 forward
+cbrB 2292473 2292940 468 1 forward
+cbrC 2292989 2293576 588 1 forward
+yieK 2293638 2294360 723 1 reverse
+yieL 2294375 2295544 1170 1 reverse
+bglH 2295571 2297187 1617 1 reverse
+bglB 2297256 2298668 1413 1 reverse
+bglF 2298687 2300564 1878 1 reverse
+bglG 2300698 2301534 837 1 reverse
+phoU 2301820 2302545 726 1 reverse
+pstB 2302560 2303333 774 1 reverse
+pstA 2303516 2304406 891 1 reverse
+pstC 2304406 2305365 960 1 reverse
+pstS 2305452 2306492 1041 1 reverse
+glmS 2306806 2308635 1830 1 reverse
+glmU 2308797 2310167 1371 1 reverse
+atpC 2310520 2310939 420 1 reverse
+atpD 2310960 2312342 1383 1 reverse
+atpG 2312369 2313232 864 1 reverse
+atpA 2313283 2314824 1542 1 reverse
+atpH 2314837 2315370 534 1 reverse
+atpF 2315385 2315855 471 1 reverse
+atpE 2315917 2316156 240 1 reverse
+atpB 2316203 2317018 816 1 reverse
+atpI 2317027 2317407 381 1 reverse
+rsmG 2318024 2318647 624 1 reverse
+mnmG 2318711 2320600 1890 1 reverse
+mioC 2320979 2321422 444 1 reverse
+asnC 2321512 2321970 459 1 reverse
+asnA 2322122 2323114 993 1 forward
+viaA 2323119 2324570 1452 1 reverse
+ravA 2324564 2326060 1497 1 reverse
+kup 2326283 2328151 1869 1 forward
+rbsD 2328318 2328737 420 1 forward
+rbsA 2328745 2330250 1506 1 forward
+rbsC 2330255 2331220 966 1 forward
+rbsB 2331245 2332135 891 1 forward
+rbsK 2332261 2333190 930 1 forward
+rbsR 2333194 2334186 993 1 forward
+hsrA 2334152 2335579 1428 1 reverse
+yieP 2335602 2336294 693 1 reverse
+hdfR 2342095 2342934 840 1 reverse
+maoP 2343053 2343391 339 1 forward
+yifB 2343416 2344936 1521 1 reverse
+ilvL 2345289 2345387 99 1 forward
+ilvX 2345474 2345524 51 1 forward
+ilvG 2345527 2347171 1645 1 forward
+ilvM 2347168 2347431 264 1 forward
+ilvE 2347451 2348380 930 1 forward
+ilvD 2348445 2350295 1851 1 forward
+ilvA 2350298 2351842 1545 1 forward
+ilvY 2351894 2352787 894 1 reverse
+ilvC 2352937 2354412 1476 1 forward
+ppiC 2354499 2354780 282 1 reverse
+yifN 2354979 2355427 449 1 reverse
+rep 2355644 2357665 2022 1 forward
+gpp 2357712 2359196 1485 1 reverse
+rhlB 2359332 2360597 1266 1 reverse
+trxA 2360728 2361057 330 1 forward
+rhoL 2361198 2361299 102 1 forward
+rho 2361384 2362643 1260 1 forward
+rfe 2362883 2363986 1104 1 forward
+wzzE 2363998 2365044 1047 1 forward
+wecB 2365100 2366230 1131 1 forward
+wecC 2366227 2367489 1263 1 forward
+rffG 2367489 2368556 1068 1 forward
+rffH 2368575 2369456 882 1 forward
+rffC 2369434 2370108 675 1 forward
+wecE 2370113 2371243 1131 1 forward
+wzxE 2371245 2372495 1251 1 forward
+rffT 2372492 2373571 1080 1 forward
+wzyE 2373568 2374920 1353 1 forward
+rffM 2374923 2375663 741 1 forward
+yifK 2375854 2377239 1386 1 forward
+aslB 2377925 2379160 1236 1 forward
+aslA 2379319 2380974 1656 1 reverse
+hemY 2381653 2382849 1197 1 reverse
+hemX 2382852 2384033 1182 1 reverse
+hemD 2384055 2384795 741 1 reverse
+hemC 2384792 2385733 942 1 reverse
+cyaA 2386120 2388666 2547 1 forward
+cyaY 2388706 2389026 321 1 reverse
+yzcX 2388817 2389302 486 1 forward
+yifL 2389489 2389692 204 1 forward
+dapF 2389729 2390553 825 1 forward
+yigA 2390550 2391257 708 1 forward
+xerC 2391254 2392150 897 1 forward
+yigB 2392150 2392866 717 1 forward
+uvrD 2392950 2395112 2163 1 forward
+yigE 2395259 2396023 765 1 reverse
+corA 2396393 2397343 951 1 forward
+yigF 2397386 2397766 381 1 reverse
+yigG 2397780 2398160 381 1 reverse
+rarD 2398255 2399145 891 1 reverse
+yigI 2399197 2399664 468 1 reverse
+pldA 2399829 2400698 870 1 forward
+recQ 2400831 2402660 1830 1 forward
+rhtC 2402724 2403344 621 1 forward
+rhtB 2403406 2404026 621 1 reverse
+pldB 2404137 2405159 1023 1 forward
+yigL 2405167 2405967 801 1 forward
+bioP 2406043 2406942 900 1 forward
+metR 2406830 2407783 954 1 reverse
+metE 2408020 2410281 2262 1 forward
+ysgA 2410321 2411136 816 1 reverse
+udp 2411398 2412159 762 1 forward
+rmuC 2412300 2413727 1428 1 forward
+ubiE 2413822 2414577 756 1 forward
+ubiJ 2414591 2415196 606 1 forward
+ubiB 2415193 2416833 1641 1 forward
+tatA 2416912 2417181 270 1 forward
+tatB 2417185 2417700 516 1 forward
+tatC 2417703 2418479 777 1 forward
+tatD 2418521 2419303 783 1 forward
+rfaH 2419300 2419788 489 1 reverse
+ubiD 2419955 2421448 1494 1 forward
+fre 2421494 2422195 702 1 forward
+fadA 2422576 2423739 1164 1 reverse
+fadB 2423749 2425938 2190 1 reverse
+pepQ 2426128 2427459 1332 1 forward
+yigZ 2427459 2428073 615 1 forward
+trkH 2428112 2429563 1452 1 forward
+hemG 2429575 2430120 546 1 forward
+mobB 2435873 2436400 528 1 reverse
+mobA 2436382 2436966 585 1 reverse
+yihD 2437036 2437305 270 1 forward
+srkA 2437382 2438368 987 1 forward
+dsbA 2438385 2439011 627 1 forward
+yihF 2439166 2440596 1431 1 forward
+yihG 2440637 2441569 933 1 reverse
+polA 2441933 2444719 2787 1 forward
+yihA 2445100 2445732 633 1 reverse
+yihI 2446314 2446823 510 1 forward
+hemN 2447012 2448385 1374 1 forward
+yshB 2448614 2448724 111 1 reverse
+glnG 2448836 2450245 1410 1 reverse
+glnL 2450257 2451306 1050 1 reverse
+glnA 2451592 2453001 1410 1 reverse
+bipA 2453374 2455197 1824 1 forward
+yihL 2455414 2456124 711 1 forward
+yihM 2456132 2457112 981 1 forward
+yihN 2457214 2458479 1266 1 forward
+ompL 2458570 2459262 693 1 reverse
+yihO 2459330 2460733 1404 1 reverse
+yihP 2460776 2462161 1386 1 reverse
+yihQ 2462207 2464243 2037 1 reverse
+yihR 2464442 2465368 927 1 reverse
+yihS 2465482 2466723 1242 1 reverse
+yihT 2466740 2467618 879 1 reverse
+yihU 2467642 2468538 897 1 reverse
+yihV 2468706 2469602 897 1 forward
+yihW 2469636 2470421 786 1 forward
+yihX 2470520 2471119 600 1 forward
+yihY 2471113 2471985 873 1 forward
+dtd 2471982 2472419 438 1 forward
+yiiD 2472416 2473405 990 1 forward
+yiiE 2474258 2474476 219 1 forward
+yiiF 2474718 2474936 219 1 forward
+fdhE 2475266 2476195 930 1 reverse
+fdoI 2476192 2476827 636 1 reverse
+fdoH 2476824 2477726 903 1 reverse
+fdoG 2477739 2480789 3051 1 reverse
+fdhD 2480983 2481816 834 1 forward
+yiiG 2481969 2483024 1056 1 forward
+frvR 2483074 2484822 1749 1 reverse
+frvX 2484822 2485892 1071 1 reverse
+frvB 2485882 2487333 1452 1 reverse
+frvA 2487344 2487790 447 1 reverse
+rhaM 2488091 2488405 315 1 reverse
+rhaD 2488415 2489239 825 1 reverse
+rhaA 2489690 2490949 1260 1 reverse
+rhaB 2490946 2492415 1470 1 reverse
+rhaS 2492703 2493539 837 1 forward
+rhaR 2493613 2494461 849 1 forward
+rhaT 2494458 2495492 1035 1 reverse
+sodA 2495777 2496397 621 1 forward
+kdgT 2496657 2497640 984 1 forward
+yiiM 2497789 2498463 675 1 forward
+cpxA 2498569 2499942 1374 1 reverse
+cpxR 2499939 2500637 699 1 reverse
+cpxP 2500787 2501287 501 1 forward
+fieF 2501436 2502338 903 1 forward
+pfkA 2502519 2503481 963 1 forward
+sbp 2503801 2504790 990 1 forward
+cdh 2504897 2505652 756 1 forward
+tpiA 2505707 2506474 768 1 reverse
+yiiQ 2506582 2507181 600 1 reverse
+yiiR 2507282 2507722 441 1 forward
+yiiS 2507934 2508233 300 1 forward
+uspD 2508260 2508688 429 1 forward
+fpr 2508693 2509439 747 1 reverse
+glpX 2509536 2510546 1011 1 reverse
+glpK 2510681 2512189 1509 1 reverse
+glpF 2512212 2513057 846 1 reverse
+zapB 2513482 2513727 246 1 forward
+rraA 2513812 2514297 486 1 reverse
+menA 2514390 2515316 927 1 reverse
+hslU 2515383 2516714 1332 1 reverse
+hslV 2516724 2517254 531 1 reverse
+ftsN 2517347 2518306 960 1 reverse
+cytR 2518398 2519423 1026 1 reverse
+priA 2519579 2521777 2199 1 reverse
+rpmE 2521980 2522192 213 1 forward
+yiiX 2522253 2522861 609 1 reverse
+metJ 2523045 2523362 318 1 reverse
+metB 2523639 2524799 1161 1 forward
+metL 2524802 2527234 2433 1 forward
+metF 2527583 2528473 891 1 forward
+katG 2528802 2530982 2181 1 forward
+yijE 2531075 2531980 906 1 forward
+yijF 2532007 2532624 618 1 reverse
+gldA 2532899 2534002 1104 1 reverse
+fsaB 2534013 2534675 663 1 reverse
+ptsA 2534687 2537188 2502 1 reverse
+frwC 2537497 2538576 1080 1 forward
+frwB 2538591 2538911 321 1 forward
+pflD 2538962 2541259 2298 1 forward
+pflC 2541225 2542103 879 1 forward
+frwD 2542105 2542446 342 1 forward
+yijO 2542433 2543284 852 1 reverse
+eptC 2543499 2545232 1734 1 reverse
+ppc 2545414 2548065 2652 1 reverse
+argE 2548663 2549814 1152 1 reverse
+argC 2549968 2550972 1005 1 forward
+argB 2550980 2551756 777 1 forward
+argH 2551817 2553190 1374 1 forward
+oxyR 2553457 2554374 918 1 forward
+sthA 2554357 2555757 1401 1 reverse
+fabR 2556034 2556738 705 1 forward
+yijD 2556738 2557097 360 1 forward
+trmA 2557137 2558237 1101 1 reverse
+btuB 2558606 2560450 1845 1 forward
+murI 2560395 2561252 858 1 forward
+murB 2567024 2568052 1029 1 forward
+birA 2568049 2569014 966 1 forward
+coaA 2569043 2569993 951 1 reverse
+tufB 2570911 2572095 1185 1 forward
+secE 2572325 2572708 384 1 forward
+nusG 2572710 2573255 546 1 forward
+rplK 2573414 2573842 429 1 forward
+rplA 2573846 2574550 705 1 forward
+rplJ 2574963 2575460 498 1 forward
+rplL 2575527 2575892 366 1 forward
+rpoB 2576212 2580240 4029 1 forward
+rpoC 2580317 2584540 4224 1 forward
+yjaZ 2584753 2585292 540 1 forward
+thiH 2585702 2586835 1134 1 reverse
+thiG 2586832 2587602 771 1 reverse
+thiS 2587604 2587804 201 1 reverse
+thiF 2587788 2588543 756 1 reverse
+thiE 2588536 2589171 636 1 reverse
+thiC 2589171 2591066 1896 1 reverse
+rsd 2591299 2591775 477 1 reverse
+nudC 2591870 2592643 774 1 forward
+hemE 2592683 2593747 1065 1 forward
+nfi 2593757 2594428 672 1 forward
+yjaG 2594471 2595061 591 1 forward
+hupA 2595248 2595520 273 1 forward
+yjaH 2595533 2596228 696 1 forward
+zraP 2596230 2596655 426 1 reverse
+zraS 2596893 2598290 1398 1 forward
+zraR 2598287 2599612 1326 1 forward
+purD 2599609 2600898 1290 1 reverse
+purH 2600910 2602499 1590 1 reverse
+yjaA 2608201 2608584 384 1 forward
+yjaB 2608647 2609090 444 1 reverse
+metA 2609247 2610176 930 1 forward
+aceB 2610445 2612046 1602 1 forward
+aceA 2612076 2613380 1305 1 forward
+aceK 2613563 2615299 1737 1 forward
+arpA 2615268 2617454 2187 1 reverse
+iclR 2617771 2618595 825 1 reverse
+metH 2618795 2622478 3684 1 forward
+yjbB 2622698 2624329 1632 1 forward
+pepE 2624420 2625109 690 1 reverse
+rluF 2625321 2626193 873 1 forward
+yjbD 2626326 2626598 273 1 reverse
+lysC 2626851 2628200 1350 1 reverse
+pgi 2628725 2630374 1650 1 forward
+yjbE 2630873 2631115 243 1 forward
+yjbF 2631229 2631867 639 1 forward
+yjbG 2631864 2632601 738 1 forward
+yjbH 2632601 2634697 2097 1 forward
+yjbT 2634744 2635022 279 1 reverse
+psiE 2635292 2635702 411 1 forward
+xylE 2635746 2637221 1476 1 reverse
+malG 2637593 2638483 891 1 reverse
+malF 2638498 2640042 1545 1 reverse
+malE 2640196 2641386 1191 1 reverse
+malK 2641751 2642866 1116 1 forward
+lamB 2642938 2644278 1341 1 forward
+malM 2644521 2645441 921 1 forward
+yjbI 2645670 2647250 1581 1 forward
+ubiC 2647473 2647970 498 1 forward
+ubiA 2647983 2648855 873 1 forward
+plsB 2649010 2651433 2424 1 reverse
+dgkA 2651604 2651972 369 1 forward
+lexA 2652082 2652690 609 1 forward
+dinF 2652709 2654088 1380 1 forward
+yjbJ 2654204 2654413 210 1 forward
+zur 2654455 2654970 516 1 reverse
+yjbL 2655288 2655542 255 1 forward
+yjbM 2655566 2656273 708 1 forward
+dusA 2656636 2657673 1038 1 forward
+pspG 2657807 2658049 243 1 forward
+qorA 2658215 2659198 984 1 reverse
+dnaB 2659281 2660696 1416 1 forward
+alr 2660749 2661828 1080 1 forward
+tyrB 2662081 2663274 1194 1 forward
+yjbS 2663776 2663979 204 1 reverse
+aphA 2664381 2665094 714 1 forward
+yjbQ 2665205 2665621 417 1 forward
+yjbR 2665625 2665981 357 1 forward
+uvrA 2666016 2668838 2823 1 reverse
+ssb 2669092 2669628 537 1 forward
+yjcB 2669727 2670008 282 1 reverse
+pdeC 2670438 2672024 1587 1 forward
+soxS 2672027 2672350 324 1 reverse
+soxR 2672436 2672900 465 1 forward
+ghxP 2673446 2674795 1350 1 forward
+yjcE 2674947 2676596 1650 1 forward
+yjcF 2676750 2678042 1293 1 reverse
+actP 2678220 2679869 1650 1 reverse
+yjcH 2679866 2680180 315 1 reverse
+acs 2680380 2682338 1959 1 reverse
+nrfA 2682731 2684167 1437 1 forward
+nrfB 2684212 2684778 567 1 forward
+nrfC 2684775 2685446 672 1 forward
+nrfD 2685443 2686399 957 1 forward
+nrfE 2686479 2688137 1659 1 forward
+nrfF 2688130 2688513 384 1 forward
+nrfG 2688510 2689106 597 1 forward
+gltP 2689448 2690761 1314 1 forward
+yjcO 2691403 2692092 690 1 reverse
+fdhF 2692186 2694333 2148 1 reverse
+mdtP 2694531 2695997 1467 1 reverse
+mdtO 2695994 2698045 2052 1 reverse
+mdtN 2698045 2699076 1032 1 reverse
+ytcA 2699095 2699370 276 1 reverse
+yjcS 2699579 2701564 1986 1 reverse
+alsK 2701837 2702766 930 1 reverse
+alsE 2702750 2703445 696 1 reverse
+alsC 2703456 2704436 981 1 reverse
+alsA 2704415 2705947 1533 1 reverse
+alsB 2706074 2707009 936 1 reverse
+alsR 2707068 2707958 891 1 reverse
+rpiB 2708317 2708766 450 1 forward
+yjdP 2708835 2709164 330 1 forward
+phnP 2709311 2710069 759 1 reverse
+phnO 2710071 2710505 435 1 reverse
+phnN 2710492 2711049 558 1 reverse
+phnM 2711049 2712185 1137 1 reverse
+phnL 2712182 2712862 681 1 reverse
+phnK 2712973 2713731 759 1 reverse
+phnJ 2713728 2714573 846 1 reverse
+phnI 2714566 2715630 1065 1 reverse
+phnH 2715630 2716214 585 1 reverse
+phnG 2716211 2716663 453 1 reverse
+phnF 2716664 2717389 726 1 reverse
+phnE 2717410 2718248 839 1 reverse
+phnD 2718303 2719319 1017 1 reverse
+phnC 2719344 2720132 789 1 reverse
+yjdN 2720265 2720708 444 1 reverse
+yjdM 2721366 2721701 336 1 reverse
+crfC 2722102 2724330 2229 1 forward
+yjcZ 2724327 2725205 879 1 forward
+proP 2725469 2726971 1503 1 forward
+pmrR 2727083 2727172 90 1 forward
+basS 2727148 2728239 1092 1 reverse
+basR 2728249 2728917 669 1 reverse
+eptA 2728914 2730557 1644 1 reverse
+adiC 2730661 2731998 1338 1 reverse
+adiY 2732135 2732896 762 1 reverse
+adiA 2733221 2735488 2268 1 reverse
+melR 2735687 2736595 909 1 reverse
+melA 2736878 2738233 1356 1 forward
+melB 2738336 2739757 1422 1 forward
+yjdF 2739896 2740525 630 1 reverse
+fumB 2740647 2742293 1647 1 reverse
+dcuB 2742371 2743711 1341 1 reverse
+dcuR 2744282 2745001 720 1 reverse
+dcuS 2744998 2746629 1632 1 reverse
+yjdI 2746810 2747040 231 1 forward
+yjdJ 2747052 2747324 273 1 forward
+ghoS 2747551 2747847 297 1 forward
+ghoT 2747875 2748048 174 1 forward
+lysU 2748167 2749684 1518 1 reverse
+dtpC 2749921 2751378 1458 1 reverse
+cadA 2751437 2753584 2148 1 reverse
+cadB 2753664 2754998 1335 1 reverse
+cadC 2755363 2756901 1539 1 reverse
+yjdC 2757700 2758275 576 1 reverse
+dsbD 2758312 2760009 1698 1 reverse
+cutA 2759985 2760323 339 1 reverse
+dcuA 2760439 2761740 1302 1 reverse
+aspA 2761858 2763294 1437 1 reverse
+fxsA 2763631 2764107 477 1 forward
+yjeH 2764123 2765379 1257 1 reverse
+groS 2765655 2765948 294 1 forward
+groL 2765992 2767638 1647 1 forward
+yjeI 2767776 2768129 354 1 forward
+yjeJ 2768332 2769201 870 1 reverse
+epmB 2769596 2770624 1029 1 reverse
+efp 2770666 2771232 567 1 forward
+ecnA 2771284 2771409 126 1 forward
+ecnB 2771520 2771666 147 1 forward
+gdx 2771842 2772159 318 1 forward
+blc 2772156 2772689 534 1 reverse
+ampC 2772778 2773911 1134 1 reverse
+frdD 2773974 2774333 360 1 reverse
+frdC 2774344 2774739 396 1 reverse
+frdB 2774750 2775484 735 1 reverse
+frdA 2775477 2777285 1809 1 reverse
+epmA 2777610 2778587 978 1 forward
+yjeM 2778806 2780308 1503 1 forward
+yjeN 2780360 2780674 315 1 forward
+yjeO 2780671 2780985 315 1 forward
+mscM 2781014 2784337 3324 1 reverse
+psd 2784359 2785327 969 1 reverse
+rsgA 2785424 2786476 1053 1 reverse
+orn 2786571 2787116 546 1 forward
+yjeV 2787859 2787912 54 1 forward
+queG 2787895 2789034 1140 1 reverse
+nnr 2789033 2790580 1548 1 forward
+tsaE 2790552 2791013 462 1 forward
+amiB 2791032 2792369 1338 1 forward
+mutL 2792379 2794226 1848 1 forward
+miaA 2794219 2795169 951 1 forward
+hfq 2795255 2795563 309 1 forward
+hflX 2795639 2796919 1281 1 forward
+hflK 2797005 2798264 1260 1 forward
+hflC 2798267 2799271 1005 1 forward
+yjeT 2799353 2799550 198 1 forward
+purA 2799654 2800952 1299 1 forward
+nsrR 2801157 2801582 426 1 forward
+rnr 2801621 2804062 2442 1 forward
+rlmB 2804242 2804973 732 1 forward
+yjfI 2805100 2805501 402 1 forward
+yjfJ 2805520 2806218 699 1 forward
+yjfK 2806269 2806928 660 1 forward
+yjfL 2806946 2807344 399 1 forward
+yjfM 2807354 2807992 639 1 forward
+yjfC 2807995 2809158 1164 1 forward
+aidB 2809242 2810867 1626 1 forward
+yjfN 2810984 2811259 276 1 reverse
+bsmA 2811408 2811737 330 1 reverse
+yjfP 2811919 2812668 750 1 forward
+ulaR 2812665 2813420 756 1 reverse
+ulaG 2813528 2814592 1065 1 reverse
+ulaA 2814947 2816344 1398 1 forward
+ulaB 2816360 2816665 306 1 forward
+ulaC 2816675 2817139 465 1 forward
+ulaD 2817153 2817803 651 1 forward
+ulaE 2817813 2818667 855 1 forward
+ulaF 2818667 2819353 687 1 forward
+yjfY 2819483 2819758 276 1 reverse
+rpsF 2820085 2820480 396 1 forward
+priB 2820487 2820801 315 1 forward
+rpsR 2820806 2821033 228 1 forward
+rplI 2821075 2821524 450 1 forward
+yjfZ 2821595 2822389 795 1 reverse
+ytfA 2822661 2823062 402 1 forward
+ytfB 2823046 2823684 639 1 reverse
+fklB 2823902 2824522 621 1 forward
+cycA 2824831 2826243 1413 1 forward
+ytfE 2826288 2826950 663 1 reverse
+ytfF 2827058 2828023 966 1 reverse
+qorB 2828131 2828991 861 1 reverse
+ytfH 2829080 2829460 381 1 forward
+cpdB 2829589 2831532 1944 1 reverse
+cysQ 2831722 2832462 741 1 forward
+ytfI 2832674 2833612 939 1 forward
+ytfJ 2833675 2834229 555 1 reverse
+ytfK 2834554 2834760 207 1 forward
+ytfL 2834839 2836182 1344 1 reverse
+msrA 2836505 2837143 639 1 reverse
+tamA 2837349 2839082 1734 1 forward
+tamB 2839079 2842858 3780 1 forward
+ytfP 2842861 2843202 342 1 forward
+yzfA 2842943 2843212 270 1 reverse
+chpS 2843414 2843665 252 1 forward
+chpB 2843659 2844009 351 1 forward
+ppa 2844089 2844619 531 1 reverse
+ytfQ 2844929 2845885 957 1 forward
+ytfR 2846025 2847527 1503 1 forward
+ytfT 2847538 2848563 1026 1 forward
+yjfF 2848550 2849545 996 1 forward
+fbp 2849578 2850576 999 1 reverse
+mpl 2850752 2852125 1374 1 forward
+yjgA 2852281 2852832 552 1 reverse
+pmbA 2852926 2854278 1353 1 forward
+nrdG 2854867 2855331 465 1 reverse
+nrdD 2855489 2857627 2139 1 reverse
+treC 2858021 2859676 1656 1 reverse
+treB 2859726 2861147 1422 1 reverse
+treR 2861266 2862213 948 1 reverse
+mgtL 2862398 2862451 54 1 forward
+mgtA 2862592 2865288 2697 1 forward
+ridA 2865494 2865880 387 1 reverse
+pyrI 2865953 2866414 462 1 reverse
+pyrB 2866427 2867362 936 1 reverse
+pyrL 2867366 2867500 135 1 reverse
+yjgH 2867781 2868176 396 1 reverse
+bdcA 2868307 2869020 714 1 reverse
+bdcR 2869091 2869684 594 1 forward
+tabA 2869829 2870281 453 1 forward
+yjgL 2870404 2872218 1815 1 forward
+argI 2872274 2873278 1005 1 reverse
+rraB 2873440 2873856 417 1 forward
+yjgM 2874001 2874504 504 1 reverse
+yjgN 2874697 2875893 1197 1 forward
+valS 2875949 2878804 2856 1 reverse
+holC 2878804 2879247 444 1 reverse
+pepA 2879407 2880918 1512 1 reverse
+lptF 2881185 2882285 1101 1 forward
+lptG 2882285 2883367 1083 1 forward
+yjgR 2883528 2885030 1503 1 reverse
+idnR 2885108 2886106 999 1 reverse
+idnT 2886173 2887492 1320 1 reverse
+idnO 2887554 2888318 765 1 reverse
+idnD 2888342 2889373 1032 1 reverse
+idnK 2889590 2890153 564 1 forward
+ahr 2890157 2891176 1020 1 reverse
+intB 2891717 2892907 1191 1 forward
+insC-6 2893239 2893604 366 1 forward
+insD-6 2893562 2894467 906 1 forward
+yjgX 2894560 2895758 1199 1 reverse
+yjgZ 2896227 2896556 330 1 forward
+insG 2897070 2898398 1329 1 reverse
+yjhB 2899025 2900242 1218 1 forward
+yjhC 2900254 2901372 1119 1 forward
+ythA 2901415 2901540 126 1 forward
+yjhD 2901593 2901823 231 1 reverse
+yjhE 2901828 2902076 249 1 forward
+insO 2902164 2904760 1041 3 forward
+insI-3 2902433 2903584 1152 1 reverse
+yjhV 2904771 2905100 330 1 forward
+fecE 2905657 2906424 768 1 reverse
+fecD 2906425 2907381 957 1 reverse
+fecC 2907378 2908376 999 1 reverse
+fecB 2908373 2909275 903 1 reverse
+fecA 2909320 2911644 2325 1 reverse
+fecR 2911731 2912684 954 1 reverse
+fecI 2912681 2913202 522 1 reverse
+insA-7 2913494 2913769 276 1 forward
+yjhU 2914305 2915291 987 1 reverse
+yjhF 2915638 2916987 1350 1 reverse
+yjhG 2917094 2919061 1968 1 reverse
+yjhH 2919072 2919977 906 1 reverse
+yjhI 2919982 2920770 789 1 reverse
+sgcR 2921073 2921855 783 1 reverse
+sgcE 2921872 2922504 633 1 reverse
+sgcA 2922516 2922947 432 1 reverse
+sgcQ 2923078 2923884 807 1 reverse
+sgcC 2923897 2925210 1314 1 reverse
+sgcB 2925222 2925500 279 1 reverse
+sgcX 2925497 2926618 1122 1 reverse
+yjhP 2927404 2928150 747 1 reverse
+yjhQ 2928206 2928751 546 1 reverse
+topAI 2928763 2929020 258 1 reverse
+yjhZ 2929397 2929642 246 1 reverse
+yjhR 2929982 2930998 1017 1 forward
+nanS 2931581 2932561 981 1 reverse
+nanM 2932626 2933732 1107 1 reverse
+nanC 2933752 2934468 717 1 reverse
+fimB 2935924 2936526 603 1 forward
+fimE 2937004 2937600 597 1 forward
+fimA 2938082 2938630 549 1 forward
+fimI 2938695 2939234 540 1 forward
+fimC 2939271 2939996 726 1 forward
+fimD 2940063 2942699 2637 1 forward
+fimF 2942709 2943239 531 1 forward
+fimG 2943252 2943755 504 1 forward
+fimH 2943775 2944677 903 1 forward
+gntP 2944920 2946263 1344 1 reverse
+uxuA 2946603 2947787 1185 1 forward
+uxuB 2947868 2949328 1461 1 forward
+uxuR 2949543 2950316 774 1 forward
+yjiC 2950457 2951287 831 1 reverse
+ytiC 2951541 2951642 102 1 forward
+ytiD 2951621 2951764 144 1 forward
+idlP 2951880 2951963 84 1 forward
+iraD 2951960 2952352 393 1 forward
+hypT 2952345 2953256 912 1 reverse
+iadA 2953321 2954493 1173 1 reverse
+yjiG 2954506 2954967 462 1 reverse
+yjiH 2954964 2955647 684 1 reverse
+kptA 2955897 2956451 555 1 forward
+yjiJ 2956464 2957642 1179 1 reverse
+yjiK 2957710 2958570 861 1 reverse
+ytiA 2958635 2958892 258 1 reverse
+yjiL 2958889 2959656 768 1 reverse
+yjiM 2959666 2960817 1152 1 reverse
+yjiN 2960933 2962213 1281 1 reverse
+mdtM 2962254 2963486 1233 1 reverse
+rpnD 2963965 2964885 921 1 forward
+yjiR 2965129 2966541 1413 1 reverse
+yjiS 2966718 2966882 165 1 forward
+yjiT 2967381 2968898 1518 1 forward
+yjiV 2969102 2971822 2721 1 forward
+mcrC 2971879 2972925 1047 1 reverse
+mcrB 2972925 2974304 1380 1 reverse
+symE 2974466 2974807 342 1 reverse
+hsdS 2975035 2976429 1395 1 reverse
+hsdM 2976426 2978015 1590 1 reverse
+hsdR 2978216 2981728 3513 1 reverse
+mrr 2981916 2982830 915 1 forward
+yjiA 2982876 2983832 957 1 reverse
+yjiX 2983843 2984046 204 1 reverse
+btsT 2984096 2986246 2151 1 reverse
+tsr 2986624 2988279 1656 1 forward
+lgoT 2988328 2989689 1362 1 reverse
+lgoR 2989904 2990818 915 1 reverse
+lgoD 2990957 2991979 1023 1 forward
+opgB 2992117 2994408 2292 1 reverse
+yjjA 2994662 2995156 495 1 reverse
+dnaC 2995205 2995942 738 1 reverse
+dnaT 2995945 2996484 540 1 reverse
+yjjB 2996591 2997064 474 1 reverse
+yjjP 2997055 2997825 771 1 reverse
+yjjQ 2998444 2999169 726 1 forward
+bglJ 2999127 2999804 678 1 forward
+fhuF 2999842 3000630 789 1 reverse
+yjjZ 3000771 3001007 237 1 forward
+rsmC 3001636 3002667 1032 1 reverse
+holD 3002770 3003183 414 1 forward
+rimI 3003152 3003598 447 1 forward
+yjjG 3003613 3004290 678 1 forward
+prfC 3004381 3005970 1590 1 forward
+osmY 3006363 3006968 606 1 forward
+ytjA 3007095 3007256 162 1 forward
+yjjU 3007378 3008451 1074 1 forward
+yjjV 3008448 3009227 780 1 forward
+yjjW 3009647 3010510 864 1 reverse
+yjjI 3010482 3012032 1551 1 reverse
+deoC 3012290 3013069 780 1 forward
+deoA 3013196 3014518 1323 1 forward
+deoB 3014570 3015793 1224 1 forward
+deoD 3015850 3016569 720 1 forward
+yjjJ 3016736 3018067 1332 1 forward
+lplA 3018068 3019084 1017 1 reverse
+ytjB 3019112 3019756 645 1 reverse
+serB 3019862 3020830 969 1 forward
+radA 3020879 3022261 1383 1 forward
+nadR 3022282 3023514 1233 1 forward
+ettA 3023822 3025489 1668 1 reverse
+slt 3025700 3027637 1938 1 forward
+trpR 3027727 3028053 327 1 forward
+yjjX 3028200 3028712 513 1 reverse
+ytjC 3028764 3029411 648 1 forward
+rob 3029408 3030277 870 1 reverse
+creA 3030488 3030961 474 1 forward
+creB 3030974 3031663 690 1 forward
+creC 3031663 3033087 1425 1 forward
+creD 3033145 3034497 1353 1 forward
+arcA 3034557 3035273 717 1 reverse
+yjjY 3035369 3035509 141 1 forward
+yjtD 3035909 3036595 687 1 forward
diff --git a/dataset/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/Essential_genes_MG1655.tsv b/dataset/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/Essential_genes_MG1655.tsv
new file mode 100644
index 0000000000000000000000000000000000000000..07dbde5d0179c794608da13e273e88624f229f4c
--- /dev/null
+++ b/dataset/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/Essential_genes_MG1655.tsv
@@ -0,0 +1,4214 @@
+gene essential gene_ori gene_left gene_right
+cdsA TRUE + 195677 196534
+rplC TRUE - 3450319 3450948
+lpxC TRUE + 106557 107474
+rplS TRUE - 2742205 2742552
+lspA TRUE + 25207 25701
+tmk TRUE + 1154347 1154988
+rpsB TRUE + 189874 190599
+lptE TRUE - 670828 671409
+rplD TRUE - 3449703 3450308
+rpsP TRUE - 2743959 2744207
+ibaG FALSE - 3334571 3334825
+rplV TRUE - 3447923 3448255
+ftsZ TRUE + 105305 106456
+rpsN TRUE - 3444601 3444906
+serV FALSE - 2816575 2816667
+infA TRUE - 925448 925666
+ssb TRUE + 4272148 4272684
+accA TRUE + 208621 209580
+msbA TRUE + 965844 967592
+gltX TRUE - 2517279 2518694
+rplK FALSE + 4176470 4176898
+aspS TRUE - 1946774 1948546
+ftsA TRUE + 103982 105244
+rpsH TRUE - 3444175 3444567
+rpsS TRUE - 3448270 3448548
+rplF TRUE - 3443629 3444162
+priB FALSE + 4423543 4423857
+rffT TRUE + 3976624 3977976
+pheM FALSE - 1797250 1797294
+rrlH FALSE + 225759 228662
+lptB TRUE + 3341966 3342691
+def TRUE + 3431712 3432221
+glyQ TRUE - 3722430 3723341
+rpsF FALSE + 4423141 4423536
+accC TRUE + 3403939 3405288
+dnaC TRUE - 4598261 4598998
+rpmB TRUE - 3809461 3809697
+glyS TRUE - 3720351 3722420
+serS TRUE + 938651 939943
+murA TRUE - 3333257 3334516
+ftsW TRUE + 98403 99647
+rpsJ TRUE - 3450981 3451292
+rpsK TRUE - 3439731 3440120
+secY TRUE - 3440788 3442119
+lolC TRUE + 1174650 1175849
+gmk TRUE + 3819451 3820074
+infC TRUE - 1798120 1798662
+lolE TRUE + 1176543 1177787
+lptA TRUE + 3341402 3341959
+ypaB FALSE - 2342616 2342759
+rplJ TRUE + 4178019 4178516
+leuU FALSE - 3320094 3320180
+rpsE TRUE - 3442748 3443251
+accD TRUE - 2431034 2431948
+lpxA TRUE + 202560 203348
+lpxD TRUE + 200971 201996
+fabG TRUE + 1149893 1150627
+rpmA TRUE - 3330884 3331141
+dnaN TRUE - 3879244 3880344
+tyrS TRUE - 1713972 1715246
+rplX TRUE - 3445475 3445789
+rpsL TRUE - 3472200 3472574
+gyrA TRUE - 2334815 2337442
+kdsC FALSE + 3340295 3340861
+rpsQ FALSE - 3446336 3446590
+ddlB FALSE + 102233 103153
+yejL FALSE + 2282151 2282378
+murI TRUE + 4163451 4164308
+ispU TRUE + 194903 195664
+ftsH TRUE - 3323023 3324957
+skp FALSE + 200482 200967
+murF TRUE + 94650 96008
+fusA TRUE - 3469422 3471536
+glnU FALSE - 696088 696162
+lpxB TRUE + 203348 204496
+rpsG TRUE - 3471564 3472103
+thrS TRUE - 1798666 1800594
+trpS TRUE - 3510656 3511660
+trmD TRUE - 2742594 2743361
+hisS TRUE - 2637323 2638597
+mraY TRUE + 96002 97084
+rpoA TRUE - 3438062 3439051
+alaS TRUE - 2817403 2820033
+dnaG TRUE + 3209129 3210874
+rplB TRUE - 3448565 3449386
+rimM FALSE - 2743392 2743940
+ftsQ TRUE + 103155 103985
+argS TRUE + 1958086 1959819
+leuS TRUE - 671424 674006
+rpsO FALSE - 3309437 3309706
+orn TRUE + 4389627 4390172
+lptC TRUE + 3340858 3341433
+ileS TRUE + 22391 25207
+metG TRUE + 2192322 2194355
+secG FALSE - 3320195 3320527
+dnaT FALSE - 4599001 4599540
+waaA TRUE + 3806563 3807840
+zipA TRUE - 2528269 2529255
+lptD TRUE - 54755 57109
+murE TRUE + 93166 94653
+tsf TRUE + 190857 191708
+rplQ TRUE - 3437638 3438021
+rimP FALSE - 3315576 3316028
+rsmH FALSE + 90094 91035
+rplN TRUE - 3445800 3446171
+murG TRUE + 99644 100711
+yidC TRUE + 3883099 3884745
+lolB TRUE - 1262100 1262723
+csrA TRUE - 2816983 2817168
+rpsM FALSE - 3440137 3440493
+lptG TRUE + 4485341 4486423
+cysS TRUE + 553834 555219
+prs TRUE - 1260151 1261098
+glnS TRUE + 705316 706980
+adk TRUE + 496399 497043
+dnaB TRUE + 4262337 4263752
+murB TRUE + 4170080 4171108
+ftsI TRUE + 91413 93179
+lolD TRUE + 1175842 1176543
+dxs TRUE - 437539 439401
+gyrB TRUE - 3875728 3878142
+holB TRUE + 1154985 1155989
+prfB TRUE - 3033206 3034304
+murD TRUE + 97087 98403
+pheS TRUE - 1795983 1796966
+rpsU TRUE + 3208803 3209018
+murC TRUE + 100765 102240
+ispH TRUE + 26277 27227
+lgt TRUE - 2963184 2964059
+rplR TRUE - 3443266 3443619
+asnS TRUE - 986808 988208
+proM FALSE + 3980758 3980834
+ftsB TRUE - 2870531 2870842
+fabI TRUE - 1348275 1349063
+valS TRUE - 4479005 4481860
+ribF TRUE + 21407 22348
+fabZ TRUE + 202101 202556
+kdsB TRUE + 970075 970821
+rplI FALSE + 4424131 4424580
+ftsL TRUE + 91032 91397
+rpsC TRUE - 3447204 3447905
+rplY FALSE + 2280539 2280823
+hemA TRUE + 1262937 1264193
+dnaX TRUE + 491316 493247
+ftsY TRUE - 3600773 3602266
+rfaD FALSE + 3792010 3792942
+rnpB FALSE - 3268238 3268614
+infB TRUE - 3311364 3314036
+nusG TRUE + 4175766 4176311
+ispE TRUE - 1261249 1262100
+rsfS FALSE - 667942 668259
+rpmE FALSE + 4125036 4125248
+rplA FALSE + 4176902 4177606
+ubiB TRUE + 4018249 4019889
+lpxH TRUE - 552441 553163
+holA TRUE - 669797 670828
+proS TRUE - 217057 218775
+secM TRUE + 107705 108217
+rpsA TRUE + 961218 962891
+dnaK FALSE + 12163 14079
+yejM TRUE + 2282398 2284158
+acpP TRUE + 1150838 1151074
+serT FALSE - 1030848 1030935
+pheT TRUE - 1793581 1795968
+yrfF TRUE + 3524491 3526626
+plsC TRUE - 3160766 3161503
+dnaA TRUE - 3880349 3881752
+prfA TRUE + 1264235 1265317
+era TRUE - 2700503 2701408
+ffs FALSE + 475672 475785
+nadD TRUE - 669154 669795
+dicA TRUE + 1645958 1646365
+folA TRUE + 49823 50302
+pnp FALSE - 3307055 3309190
+metK TRUE + 3084728 3085882
+rpoC TRUE + 4183373 4187596
+dfp TRUE + 3810754 3811974
+waaF FALSE + 3792952 3793998
+acpS TRUE - 2698640 2699020
+rfaE FALSE - 3193342 3194775
+accB TRUE + 3403458 3403928
+eno TRUE - 2904665 2905963
+fkpB FALSE + 25826 26275
+frr TRUE + 192872 193429
+thyA FALSE - 2962383 2963177
+secE TRUE + 4175381 4175764
+pyrH TRUE + 191855 192580
+kdsD FALSE + 3339288 3340274
+rpsT FALSE - 20815 21078
+nrdA TRUE + 2342887 2345172
+lpxK TRUE + 967589 968575
+mnmA FALSE - 1191890 1192996
+cydA TRUE + 770681 772249
+cydB FALSE + 772265 773404
+secA TRUE + 108279 110984
+rpoZ FALSE + 3820129 3820404
+ffh TRUE - 2744456 2745817
+fabD TRUE + 1148951 1149880
+mukE TRUE + 974872 975549
+bamA TRUE + 197928 200360
+ubiE FALSE + 4016878 4017633
+rpoD TRUE + 3211069 3212910
+fabB TRUE - 2438407 2439627
+yihA TRUE - 4048156 4048752
+nadK TRUE + 2748853 2749731
+thrU FALSE + 4173411 4173486
+rlmE FALSE - 3325057 3325686
+yfaZ FALSE - 2361755 2362297
+parC TRUE - 3161737 3163995
+obgE TRUE - 3328604 3329776
+mreB TRUE - 3398066 3399109
+leuW FALSE - 696186 696270
+parE TRUE - 3171526 3173418
+rpmC TRUE - 3446590 3446781
+der TRUE - 2633906 2635378
+tsaD TRUE - 3207552 3208565
+yceD FALSE + 1146017 1146538
+nusB FALSE + 434361 434780
+rplM TRUE - 3376245 3376673
+rpsD TRUE - 3439077 3439697
+lptF TRUE + 4484241 4485341
+nusA TRUE - 3314061 3315548
+lpcA FALSE + 243543 244121
+ribE TRUE + 433871 434341
+mreD TRUE - 3396409 3396897
+tsaB TRUE - 1888596 1889291
+glmU TRUE - 3911853 3913223
+rplO TRUE - 3442127 3442561
+rpoE TRUE - 2707459 2708034
+hemH TRUE + 497279 498241
+rnpA TRUE + 3882516 3882875
+pyrG TRUE - 2906051 2907688
+glmM TRUE - 3320755 3322092
+rpoB TRUE + 4179268 4183296
+mreC TRUE - 3396897 3398000
+hemE FALSE + 4195739 4196803
+valZ FALSE + 780291 780366
+hda FALSE - 2616097 2616798
+prmC TRUE + 1265317 1266150
+guaA FALSE - 2628980 2630557
+hflD FALSE - 1191213 1191854
+racR TRUE - 1417789 1418265
+dnaE TRUE + 205126 208608
+lnt TRUE - 688566 690104
+lepB TRUE - 2702357 2703331
+flgC FALSE + 1130661 1131065
+rpmI FALSE - 1797826 1798023
+rplE TRUE - 3444921 3445460
+rne TRUE - 1140405 1143590
+mukB TRUE + 975549 980009
+ybeY FALSE - 691097 691564
+ribA TRUE - 1336594 1337184
+pdxJ FALSE - 2699020 2699751
+lepA FALSE - 2703347 2705146
+lpd FALSE + 127912 129336
+plsB TRUE - 4252066 4254489
+yrdA FALSE + 3427258 3427812
+rseP TRUE + 196546 197898
+rnc FALSE - 2701405 2702085
+mqsA TRUE - 3165873 3166268
+rlmH FALSE - 667471 667938
+cydC TRUE - 926697 928418
+suhB TRUE + 2661464 2662267
+fabA TRUE - 1015175 1015693
+yqiA FALSE - 3173447 3174028
+ispB TRUE + 3331732 3332703
+acnB FALSE + 131615 134212
+ispA TRUE - 439426 440325
+ubiG FALSE + 2337589 2338311
+fmt TRUE + 3432236 3433183
+leuZ FALSE - 1989839 1989925
+ygfB FALSE - 3052888 3053466
+ispG TRUE - 2638708 2639826
+yheO FALSE - 3473740 3474462
+pgsA TRUE - 1990293 1990841
+hemC TRUE - 3987848 3988789
+bamB FALSE - 2635496 2636674
+kdsA TRUE + 1267388 1268242
+tusD FALSE - 3473354 3473740
+lpxL FALSE - 1114885 1115805
+rnt FALSE + 1726371 1727018
+rluD FALSE - 2733053 2734033
+ispD TRUE - 2869802 2870512
+tsaE TRUE + 4393608 4394069
+cmk FALSE + 960424 961107
+folE FALSE - 2241006 2241674
+ratA FALSE - 2752310 2752786
+iscU FALSE - 2657925 2658311
+tsaC TRUE - 3428865 3429437
+bamD TRUE + 2734168 2734905
+aceF FALSE + 125695 127587
+purB TRUE - 1189839 1191209
+yqgF TRUE + 3091522 3091938
+mtn FALSE - 178455 179153
+nrdR FALSE + 432226 432675
+ybeD FALSE - 661602 661865
+bluR FALSE - 1212551 1213282
+ribC TRUE - 1740625 1741266
+ubiD TRUE + 4023011 4024504
+ppa TRUE - 4447145 4447675
+waaQ FALSE - 3805087 3806121
+waaC FALSE + 3794002 3794961
+mukF TRUE + 973542 974864
+atpC FALSE - 3913576 3913995
+waaP FALSE - 3803176 3803973
+gmhB FALSE + 222833 223408
+ribD TRUE + 432679 433782
+pstB FALSE - 3905616 3906389
+hipB FALSE - 1590200 1590466
+ackA FALSE + 2411492 2412694
+ssrA FALSE + 2753615 2753977
+lapB FALSE + 1338582 1339751
+nanE FALSE - 3368369 3369058
+waaG FALSE - 3803966 3805090
+hscA FALSE - 2655107 2656957
+rnhB FALSE + 204493 205089
+icd FALSE + 1194346 1195596
+spoT TRUE + 3820423 3822531
+ykgE FALSE + 320832 321551
+fdx FALSE - 2654770 2655105
+pepP FALSE - 3051537 3052862
+iscR FALSE - 2659665 2660153
+ynfL FALSE - 1666723 1667616
+lapA FALSE + 1338267 1338575
+priA FALSE - 4122635 4124833
+rsgA FALSE - 4388480 4389532
+yfaE FALSE + 2346536 2346790
+nrdB TRUE + 2345406 2346536
+dcd FALSE - 2139658 2140239
+guaB FALSE - 2630626 2632092
+yhbE FALSE - 3329792 3330757
+iscA FALSE - 2657585 2657908
+mdfA FALSE + 882896 884128
+yfgM FALSE - 2636685 2637305
+lipA FALSE - 658474 659439
+aceE FALSE + 123017 125680
+iscS FALSE - 2658339 2659553
+tpx FALSE - 1386329 1386835
+atpG FALSE - 3915425 3916288
+crp FALSE + 3484142 3484774
+gapA FALSE + 1860795 1861790
+sroG FALSE - 3182592 3182740
+pdxH FALSE - 1715375 1716031
+yqgE FALSE + 3090959 3091522
+atpD FALSE - 3914016 3915398
+atpH FALSE - 3917893 3918426
+topA TRUE + 1329072 1331669
+ptsN FALSE + 3344600 3345091
+pta FALSE + 2412769 2414913
+dam FALSE - 3513099 3513935
+cydD FALSE - 928419 930185
+atpI FALSE - 3920083 3920463
+ptsI FALSE + 2532088 2533815
+ubiX FALSE - 2426079 2426648
+trkA FALSE + 3434540 3435916
+ybeZ FALSE - 691561 692640
+rnhA FALSE - 235535 236002
+sapC FALSE - 1351652 1352542
+atpF FALSE - 3918441 3918911
+pcnB FALSE - 157729 159126
+pgk TRUE - 3069481 3070644
+tilS TRUE + 212331 213629
+atpA FALSE - 3916339 3917880
+pfkA FALSE + 4105575 4106537
+pdhR FALSE + 122092 122856
+dxr TRUE + 193521 194717
+acrB FALSE - 480478 483627
+mrdA TRUE - 665539 667440
+hemD TRUE - 3987111 3987851
+atpB FALSE - 3919259 3920074
+galU FALSE + 1290680 1291588
+folP FALSE - 3322085 3322933
+groL TRUE + 4369048 4370694
+lysS FALSE - 3031679 3033196
+hemB TRUE - 387977 388951
+recA FALSE - 2820730 2821791
+yjhP FALSE - 4530460 4531206
+map TRUE - 188712 189506
+hslV FALSE - 4119780 4120310
+fabH FALSE + 1147982 1148935
+ispF TRUE - 2869323 2869802
+pssA TRUE + 2720749 2722104
+ihfA FALSE - 1793277 1793576
+acrA FALSE - 483650 484843
+mrdB TRUE - 664424 665536
+tusA FALSE - 3606774 3607019
+arcA FALSE - 4637613 4638329
+rodZ FALSE - 2639853 2640866
+flhD FALSE - 1975871 1976221
+mobA FALSE - 4039438 4040022
+can TRUE - 142008 142670
+tolC FALSE + 3176137 3177618
+tusC FALSE - 3472995 3473354
+nuoA FALSE - 2402651 2403094
+nadE TRUE + 1820482 1821309
+pstA FALSE - 3906572 3907462
+stfE FALSE - 1208342 1208878
+tpiA FALSE - 4108763 4109530
+sapF FALSE - 1349852 1350658
+sxy FALSE + 1020361 1020990
+fixX FALSE + 45463 45750
+fur FALSE - 709423 709869
+yijE FALSE + 4134131 4135036
+nuoK FALSE - 2393065 2393367
+rimI FALSE + 4606208 4606654
+nuoJ FALSE - 2393364 2393918
+glnD FALSE - 185978 188650
+ubiH FALSE - 3050362 3051540
+ydcA FALSE + 1489701 1489874
+sapD FALSE - 1350660 1351652
+tktA FALSE - 3077666 3079657
+nuoM FALSE - 2389534 2391063
+sspA FALSE - 3374804 3375442
+ytfP FALSE + 4445917 4446258
+rppH FALSE - 2966469 2966999
+nuoI FALSE - 2393930 2394472
+epmA FALSE + 4380666 4381643
+purA FALSE + 4402710 4404008
+aroK FALSE - 3516565 3517086
+hemL TRUE - 173602 174882
+hpf FALSE + 3344195 3344482
+yjiX FALSE - 4586899 4587102
+dapA TRUE - 2596904 2597782
+xerC FALSE + 3994310 3995206
+nuoC FALSE - 2400077 2401867
+rfaH FALSE - 4022356 4022844
+holC FALSE - 4481860 4482303
+rsxE FALSE + 1708852 1709547
+putP FALSE + 1078528 1080036
+nuoN FALSE - 2388070 2389527
+cyaA FALSE + 3989176 3991722
+argR FALSE + 3382725 3383195
+yhcB FALSE + 3378213 3378611
+metZ FALSE + 2945409 2945485
+potB FALSE - 1182840 1183667
+crr FALSE + 2533856 2534365
+rttR FALSE - 1286289 1286459
+nuoH FALSE - 2394487 2395464
+nuoE FALSE - 2399574 2400074
+nuoL FALSE - 2391227 2393068
+cyaY FALSE - 3991762 3992082
+clpX FALSE + 456650 457924
+folC TRUE - 2429696 2430964
+seqA FALSE + 712210 712755
+yafQ FALSE - 245961 246239
+secD TRUE + 426871 428718
+lipB FALSE - 660860 661501
+nlpI FALSE - 3306062 3306946
+polA TRUE + 4044989 4047775
+rseA FALSE - 2706776 2707426
+nuoF FALSE - 2398240 2399577
+pstS FALSE - 3908508 3909548
+rnr FALSE + 4404677 4407118
+hscB FALSE - 2656974 2657489
+pitA FALSE + 3635665 3637164
+secB FALSE - 3781684 3782151
+cysZ FALSE + 2529485 2530246
+sapA FALSE - 1353491 1355134
+nuoB FALSE - 2401973 2402635
+aroB FALSE - 3515420 3516508
+cyoC FALSE - 447270 447884
+rsmA FALSE - 51609 52430
+sucB FALSE + 760745 761962
+pepA FALSE - 4482463 4483974
+ribB TRUE - 3181835 3182488
+treB FALSE - 4462782 4464203
+nuoG FALSE - 2395461 2398187
+sucA FALSE + 757929 760730
+yjbE FALSE + 4233929 4234171
+ndh FALSE + 1165308 1166612
+tusB FALSE - 3472700 3472987
+damX FALSE - 3514042 3515328
+yddM FALSE - 1550422 1550784
+asmA FALSE - 2137783 2139636
+ompR FALSE - 3533887 3534606
+rusA FALSE + 572594 572956
+rsmB FALSE + 3433229 3434518
+ruvA FALSE - 1943389 1944000
+prfC FALSE + 4607437 4609026
+clpP FALSE + 455901 456524
+phoU FALSE - 3904876 3905601
+mnmE FALSE + 3884851 3886215
+arsR FALSE + 3646551 3646904
+zapB FALSE + 4116538 4116783
+feoA FALSE + 3538185 3538412
+yceQ TRUE + 1143725 1144045
+folB FALSE - 3202243 3202611
+yihD FALSE + 4040092 4040361
+ogrK FALSE - 2165326 2165544
+ruvB FALSE - 1942370 1943380
+mtgA FALSE - 3347103 3347831
+ubiA TRUE + 4251039 4251911
+ftsK TRUE + 932447 936436
+ybcF FALSE + 549662 550555
+ychA FALSE + 1266543 1267352
+bfd FALSE - 3464819 3465013
+lysW FALSE + 780066 780141
+fre FALSE + 4024550 4025251
+ygdB FALSE - 2960771 2961178
+ycaK FALSE + 948891 949481
+tfaX FALSE + 582098 582283
+sapB FALSE - 1352529 1353494
+dnaQ FALSE + 236067 236798
+yjdC FALSE - 4360756 4361331
+metV FALSE + 2945629 2945705
+degS TRUE + 3380222 3381289
+metJ FALSE - 4126101 4126418
+yraN FALSE + 3293416 3293811
+ybcO FALSE + 572307 572597
+slyX FALSE + 3475662 3475880
+ghoT FALSE + 4350931 4351104
+sspB FALSE - 3374301 3374798
+apaG FALSE - 51229 51606
+lpxM FALSE - 1937246 1938217
+sixA FALSE - 2454349 2454834
+glpD FALSE + 3560036 3561541
+upp FALSE - 2618268 2618894
+srmB FALSE + 2710918 2712252
+sthA FALSE - 4157413 4158813
+G0-10702 FALSE + 3352086 3352191
+nrfF FALSE + 4291186 4291569
+gltK FALSE - 684478 685152
+pgm FALSE + 712781 714421
+prmB FALSE - 2445530 2446462
+fldA TRUE - 710158 710688
+yadK FALSE - 151003 151599
+pstC FALSE - 3907462 3908421
+dapF FALSE + 3992785 3993609
+ynfB FALSE + 1653832 1654173
+truA FALSE - 2432846 2433658
+rnlB FALSE + 2765006 2765377
+treC FALSE - 4461077 4462732
+yjdI FALSE + 4349866 4350096
+gshB FALSE + 3089900 3090850
+deaD FALSE - 3303993 3305882
+yjaG FALSE + 4197527 4198117
+hha FALSE - 479314 479532
+mtlR FALSE + 3773595 3774182
+zur FALSE - 4257511 4258026
+yafP FALSE + 252709 253161
+trkH FALSE + 4031168 4032619
+yjhD FALSE - 4504649 4504879
+ygeF FALSE + 2988576 2989022
+gpp FALSE - 3960768 3962252
+mlaD FALSE - 3335932 3336483
+tolR FALSE + 775072 775500
+minD TRUE - 1223772 1224584
+rpoN FALSE + 3342739 3344172
+glyY FALSE + 4390606 4390681
+yifE FALSE + 3946109 3946447
+yecM FALSE - 1957304 1957870
+ubiC FALSE + 4250529 4251026
+tatB FALSE + 4020241 4020756
+yfdK FALSE - 2469099 2469539
+yahM FALSE + 344628 344873
+sdhE FALSE - 3038826 3039092
+tdh FALSE - 3788343 3789368
+yjbF FALSE + 4234285 4234923
+tolA FALSE + 775565 776830
+C0343 FALSE + 1407387 1407461
+cysG FALSE + 3495850 3497223
+zwf FALSE - 1932863 1934338
+gcvB FALSE + 2940718 2940922
+coaD TRUE + 3807848 3808327
+mdh FALSE - 3381352 3382290
+hrpA FALSE + 1481142 1484987
+serA FALSE - 3055200 3056432
+kbl FALSE - 3789378 3790574
+yhdN FALSE - 3437163 3437531
+ubiF FALSE + 694324 695499
+psd TRUE - 4387415 4388383
+ychF FALSE - 1255944 1257035
+tadA TRUE - 2695376 2695879
+yhdH FALSE + 3401506 3402480
+sdhC FALSE + 754400 754789
+ttdR FALSE - 3203346 3204278
+fbaA TRUE - 3068187 3069266
+yjbT FALSE - 4237800 4238078
+yffB FALSE + 2589269 2589625
+glnA FALSE - 4054648 4056057
+hns FALSE - 1291732 1292145
+yieE FALSE + 3891892 3892653
+yghR FALSE - 3130476 3131234
+yicN FALSE - 3839973 3840425
+smtA FALSE + 972760 973545
+rapZ FALSE + 3345137 3345991
+glxK FALSE + 541112 542257
+eamA FALSE - 1618262 1619161
+hdhA FALSE - 1695297 1696064
+yidZ FALSE + 3890788 3891747
+waaO FALSE - 3800062 3801081
+oppC FALSE + 1301858 1302766
+tgt FALSE + 425361 426488
+cca TRUE + 3199913 3201151
+trxB FALSE - 930308 931273
+gltA FALSE - 752408 753691
+mprA FALSE + 2808792 2809322
+dapE FALSE + 2589629 2590756
+pepD FALSE - 254259 255716
+ycdY FALSE + 1098863 1099417
+yhbQ FALSE + 3297988 3298290
+rluB FALSE + 1324876 1325751
+racC FALSE - 1415512 1415787
+ppdC FALSE - 2960463 2960786
+ftsX TRUE - 3599051 3600109
+yqiJ FALSE + 3190230 3190859
+recB FALSE - 2950483 2954025
+waaB FALSE - 3801081 3802190
+yohC FALSE - 2223066 2223653
+yafD FALSE + 231122 231922
+rsd FALSE - 4194355 4194831
+minC FALSE - 1224608 1225303
+rssB FALSE + 1289465 1290478
+pykF FALSE + 1753722 1755134
+ydiR FALSE + 1778425 1779363
+ybcN FALSE + 571689 572144
+frlR FALSE + 3502074 3502805
+sdhB FALSE + 756912 757628
+coaA TRUE - 4172099 4173049
+ugd FALSE - 2096471 2097637
+lgoR FALSE - 4592960 4593874
+rob FALSE - 4632464 4633333
+yebB FALSE + 1944275 1944877
+yiaW FALSE - 3752128 3752451
+yadV FALSE - 155461 156201
+selC FALSE + 3834245 3834339
+gcvR FALSE + 2597928 2598500
+yeiW FALSE - 2263063 2263317
+nfsA FALSE + 890407 891129
+setB FALSE + 2261885 2263066
+ydgK FALSE + 1703274 1703714
+ymfJ FALSE - 1200999 1201307
+potC FALSE - 1182049 1182843
+dusB FALSE + 3408302 3409267
+rpoH FALSE - 3597952 3598806
+yaiE FALSE + 407401 407685
+nsrR FALSE + 4404213 4404638
+xisE FALSE - 1200010 1200255
+yqjF FALSE + 3248584 3248976
+tolQ FALSE + 774376 775068
+tatC FALSE + 4020759 4021535
+ghxP FALSE + 4276502 4277851
+envC FALSE + 3784861 3786120
+cybB FALSE + 1488926 1489456
+manX FALSE + 1900072 1901043
+ydjY FALSE + 1832140 1832817
+yidD FALSE + 3882839 3883096
+holD FALSE + 4605826 4606239
+rpe FALSE - 3512404 3513081
+wzzB FALSE - 2095345 2096325
+ileY FALSE - 2783784 2783859
+leuE FALSE - 1878145 1878783
+psrO FALSE + 3309247 3309420
+ytfG FALSE - 4431187 4432047
+typA FALSE + 4056430 4058253
+caiE FALSE - 34781 35371
+tolB FALSE + 776963 778255
+tdcA FALSE - 3264149 3265087
+fadM FALSE + 463626 464024
+truB FALSE - 3309855 3310799
+mzrA FALSE + 3246461 3246844
+epmB FALSE - 4372652 4373680
+ybeX FALSE - 690129 691007
+trmA FALSE - 4160193 4161293
+yhaL FALSE + 3253065 3253229
+miaA FALSE + 4397275 4398225
+marA FALSE + 1617598 1617981
+yajD FALSE + 429829 430176
+hslO FALSE + 3527796 3528674
+yfjY FALSE + 2774408 2774890
+pgi FALSE + 4231781 4233430
+potA FALSE - 1183681 1184817
+yefM TRUE - 2087486 2087737
+rhaR FALSE + 4096669 4097517
+pmrD FALSE - 2371294 2371560
+rnb FALSE - 1345002 1346936
+idi FALSE + 3031087 3031635
+yhiJ FALSE - 3628991 3630613
+lon FALSE + 458112 460466
+ccmE FALSE - 2292923 2293402
+yffS FALSE + 2562515 2563354
+sseB FALSE - 2652179 2652955
+fryB FALSE - 2505938 2506264
+yccE FALSE + 1063259 1064515
+ruvC FALSE - 1944879 1945400
+dapD FALSE - 185123 185947
+moaC FALSE + 817793 818278
+yfiN FALSE + 2740405 2741631
+ygaZ FALSE + 2807639 2808376
+ydfV FALSE + 1643921 1644226
+yfgI FALSE + 2628348 2628887
+ghoS FALSE + 4350607 4350903
+yqjA FALSE + 3245795 3246457
+rdoA FALSE + 4040438 4041424
+ompC FALSE - 2309668 2310771
+cra FALSE + 88028 89032
+sodA FALSE + 4098833 4099453
+manA FALSE + 1686600 1687775
+yfaT FALSE - 2332358 2332981
+zapD FALSE - 111856 112599
+emrK FALSE - 2480198 2481361
+yqiC FALSE + 3182862 3183152
+modE FALSE - 793079 793867
+narV FALSE - 1533961 1534641
+yebZ FALSE - 1921743 1922615
+selD FALSE - 1844989 1846032
+hpt FALSE + 141431 141967
+ytfK FALSE + 4437610 4437816
+mioC FALSE - 3924035 3924478
+ivy FALSE + 240343 240816
+usg FALSE - 2433658 2434671
+yneH FALSE - 1610349 1611275
+fsaA FALSE + 862865 863527
+rsmD FALSE + 3602416 3603012
+gadA FALSE - 3664203 3665603
+nudB FALSE - 1946204 1946656
+fliQ FALSE + 2020640 2020909
+rsxA FALSE + 1703791 1704372
+cyoB FALSE - 447874 449865
+chbR FALSE - 1816629 1817471
+yrfG FALSE + 3526691 3527359
+ybjD FALSE + 915696 917354
+clsA FALSE - 1305209 1306669
+menA FALSE - 4117446 4118372
+baeS FALSE + 2160900 2162303
+ydeR FALSE - 1585817 1586320
+ppiC FALSE - 3957555 3957836
+diaA FALSE + 3293831 3294421
+gspK FALSE + 3460946 3461929
+stpA FALSE - 2796113 2796517
+yciU FALSE - 1304845 1305174
+secF TRUE + 428729 429700
+gspG FALSE + 3459045 3459482
+recC FALSE - 2957082 2960450
+ptsG FALSE + 1157092 1158525
+glnL FALSE - 4053313 4054362
+rhtB FALSE - 4006462 4007082
+xerD FALSE - 3036869 3037765
+tyrR FALSE + 1384744 1386285
+cbrB FALSE + 3895529 3895996
+nirD FALSE + 3494573 3494899
+grpE TRUE - 2748137 2748730
+frlC FALSE + 3500362 3501192
+ftsE TRUE - 3600102 3600770
+surA FALSE - 53416 54702
+fbp FALSE - 4452634 4453632
+ihfB FALSE + 963051 963335
+ftnA FALSE + 1986740 1987237
+yfcR FALSE - 2449094 2449606
+hofO FALSE - 3519031 3519471
+ypfH FALSE - 2591094 2591792
+yohH FALSE - 2226571 2226708
+hemN FALSE + 4050068 4051441
+ybcI FALSE - 555255 555776
+serC FALSE + 956876 957964
+hicA FALSE + 1507310 1507486
+yfjR FALSE + 2767725 2768426
+aroC FALSE - 2444410 2445495
+ygiB FALSE + 3177862 3178437
+mgtL FALSE + 4465454 4465507
+yifK FALSE + 3978910 3980295
+yadN FALSE - 156299 156883
+srlR FALSE + 2827069 2827842
+yfeX FALSE - 2547668 2548567
+mlaE FALSE - 3336488 3337270
+leuO FALSE + 84368 85312
+ygcP FALSE + 2892218 2892793
+yfdH FALSE + 2466236 2467156
+glpF FALSE - 4115268 4116113
+ndk FALSE - 2642455 2642886
+ydhX FALSE - 1748369 1749088
+ycgL FALSE + 1226904 1227230
+ypjM_2 FALSE - 2770858 2771058
+lysA FALSE - 2975659 2976921
+potD FALSE - 1181006 1182052
+yedI FALSE - 2026473 2027390
+cmoB FALSE + 1951466 1952437
+yciF FALSE - 1313294 1313794
+yqeG FALSE + 2983869 2985098
+mppA FALSE + 1391251 1392864
+yzfA FALSE - 4445999 4446268
+yafX FALSE - 263972 264430
+ydaF FALSE - 1417180 1417335
+yhaK FALSE + 3252341 3253042
+dksA FALSE - 160149 160604
+ytfB FALSE - 4426102 4426740
+cyoA FALSE - 449887 450834
+yddL FALSE - 1543762 1544052
+rng FALSE - 3394348 3395817
+yfiE FALSE - 2712461 2713342
+asd TRUE - 3571798 3572901
+ompA FALSE - 1018236 1019276
+cpxP FALSE + 4103843 4104343
+hslR FALSE + 3527370 3527771
+agaI FALSE + 3284292 3285047
+yeaW FALSE + 1882689 1883813
+yffR FALSE + 2562002 2562394
+yihM FALSE + 4059188 4060168
+ychJ FALSE - 1287897 1288355
+sgcA FALSE - 4525572 4526003
+yciK FALSE - 1326378 1327136
+hflX FALSE + 4398695 4399975
+paaZ FALSE - 1449621 1451666
+rlmM FALSE - 2938165 2939265
+ymjA FALSE - 1355447 1355692
+ubiI FALSE - 3049137 3050339
+tauC FALSE + 386195 387022
+dcuD FALSE + 3372891 3374258
+kbaY FALSE + 3281165 3282025
+dhaM FALSE - 1246919 1248337
+appX FALSE + 1039668 1039760
+moeA FALSE - 864352 865587
+ydjF FALSE - 1852120 1852878
+yagM FALSE - 293169 294023
+rdgB FALSE + 3094703 3095296
+yfiM FALSE + 2722201 2722473
+phnF FALSE - 4319720 4320445
+wecF FALSE + 3975548 3976627
+feaR FALSE - 1444402 1445307
+ycgI FALSE + 1222918 1223130
+ryfA FALSE + 2651877 2652180
+ydcO FALSE - 1502929 1504104
+fliT FALSE + 2003737 2004102
+fcl FALSE - 2124249 2125214
+mocA FALSE + 3013182 3013760
+dppB FALSE - 3702794 3703813
+glnG FALSE - 4051892 4053301
+ygaH FALSE + 2808366 2808701
+rcnA FALSE + 2183939 2184763
+ivbL FALSE - 3850913 3851011
+speD FALSE - 134788 135582
+yjiG FALSE - 4557562 4558023
+ydhP FALSE - 1734145 1735314
+paaY FALSE + 1462495 1463085
+xapA FALSE - 2522067 2522900
+melR FALSE - 4338743 4339651
+ycgN FALSE + 1228053 1228499
+truD FALSE - 2868277 2869326
+yhfL FALSE + 3497470 3497637
+garP FALSE - 3271595 3272929
+yggC FALSE - 3071998 3072711
+rhtC FALSE + 4005780 4006400
+sfmA FALSE + 557435 557977
+epd FALSE - 3070694 3071713
+priC FALSE - 489509 490036
+mglB FALSE - 2237372 2238370
+yddJ FALSE - 1542408 1542743
+sdhA FALSE + 755130 756896
+yeaR FALSE - 1877613 1877972
+yegX FALSE - 2180855 2181673
+yhaM FALSE - 3253363 3254673
+yidP FALSE + 3861922 3862638
+htpX FALSE - 1909719 1910600
+yieP FALSE - 3938658 3939350
+dgoK FALSE - 3871619 3872497
+yagA FALSE - 280053 281207
+ybdD FALSE + 631405 631602
+lysY FALSE + 780370 780445
+rssA FALSE + 1288429 1289373
+bglB FALSE - 3900312 3901724
+yeaM FALSE - 1872779 1873600
+yjiA FALSE - 4585932 4586888
+asnA FALSE + 3925178 3926170
+yjhR FALSE + 4533038 4534054
+yihW FALSE + 4072692 4073477
+adiY FALSE - 4335191 4335952
+macA FALSE + 918458 919573
+dsbA FALSE + 4041441 4042067
+yjfY FALSE - 4422539 4422814
+selA FALSE - 3757881 3759272
+crl FALSE + 257829 258230
+ebgR FALSE + 3219488 3220471
+uspC FALSE + 1977777 1978205
+gluQ FALSE - 159186 160112
+yehK FALSE + 2201994 2202311
+yegS FALSE + 2166736 2167635
+yciQ FALSE + 1322770 1324665
+ybdJ FALSE - 605174 605422
+yneE FALSE - 1606132 1607046
+dtpA FALSE + 1710793 1712295
+ymgD FALSE - 1221528 1221857
+ybiA FALSE - 831691 832173
+yedP FALSE + 2023535 2024350
+yihP FALSE - 4063832 4065238
+mrp FALSE - 2191081 2192190
+yhhN FALSE + 3603774 3604400
+ygaV FALSE + 2795233 2795532
+yfaH FALSE + 2347709 2347915
+tesA FALSE - 518363 518989
+sufE FALSE - 1756898 1757314
+zapE FALSE - 3376892 3378019
+trpC FALSE - 1316451 1317809
+sanA FALSE + 2230900 2231619
+ybjN FALSE + 892180 892656
+ycfZ FALSE - 1179702 1180490
+fimB FALSE + 4538980 4539582
+yqeA FALSE + 3009483 3010415
+nlpC FALSE - 1790291 1790755
+yfdQ FALSE + 2472054 2472878
+yaiO FALSE - 379293 380066
+flgI FALSE + 1135497 1136594
+nanS FALSE - 4534637 4535617
+speB FALSE - 3080899 3081819
+yejE FALSE + 2273295 2274320
+purN FALSE + 2620256 2620894
+yidA FALSE - 3874163 3874975
+gntR FALSE - 3575754 3576749
+ydiO FALSE + 1775220 1776371
+inaA FALSE - 2346844 2347494
+yjfJ FALSE + 4408576 4409274
+yiaD FALSE + 3714570 3715229
+ycaQ FALSE + 968612 969844
+yraP FALSE + 3294431 3295006
+rayT FALSE + 247637 248134
+ynfE FALSE + 1656093 1658519
+pagP FALSE + 655780 656340
+dtpC FALSE - 4352977 4354434
+kdpE FALSE - 720279 720956
+envZ FALSE - 3532538 3533890
+hemX FALSE - 3985908 3987089
+murJ TRUE + 1127062 1128597
+wbbH FALSE - 2104084 2105250
+xylG FALSE + 3730224 3731765
+phoB FALSE + 416366 417055
+mdtM FALSE - 4565310 4566542
+apaH FALSE - 50380 51222
+tsgA FALSE + 3490590 3491771
+fliZ FALSE - 1998497 1999048
+metR FALSE - 4009886 4010839
+fliM FALSE + 2018111 2019115
+nfi FALSE + 4196813 4197484
+yhfT FALSE - 3504054 3505358
+yghT FALSE + 3132153 3132845
+fadR FALSE + 1234161 1234880
+ydeS FALSE - 1586333 1586863
+dapB FALSE + 28374 29195
+rhsC FALSE + 728806 732999
+ypdF FALSE - 2503569 2504654
+ymfH FALSE - 1200292 1200603
+gspH FALSE + 3459490 3459999
+eutS FALSE - 2573492 2573827
+dsbG FALSE - 637050 637796
+rspA FALSE - 1651951 1653165
+fimZ FALSE - 563071 563703
+glmS TRUE - 3909862 3911691
+pcm FALSE - 2866915 2867541
+yebK FALSE + 1934676 1935545
+garR FALSE - 3269889 3270779
+yqeB FALSE - 3010636 3012261
+bssS FALSE - 1119924 1120178
+araF FALSE - 1983163 1984152
+cptA FALSE - 3038438 3038845
+ddpF FALSE - 1555136 1556062
+fdoH FALSE - 4079880 4080782
+ttdT FALSE + 3206046 3207509
+prlC FALSE - 3641163 3643205
+speA FALSE - 3081957 3083933
+yfjP FALSE + 2765732 2766595
+ulaC FALSE + 4419731 4420195
+smrB FALSE + 2446628 2447179
+yagN FALSE - 294363 294803
+aroH FALSE + 1786459 1787505
+ulaE FALSE + 4420869 4421723
+yecA FALSE - 1988978 1989643
+fdrA FALSE + 545904 547571
+hofB FALSE - 115714 117099
+yqeI FALSE + 2986524 2987333
+ybhA FALSE - 796836 797654
+yfeK FALSE + 2535364 2535738
+eutM FALSE - 2570179 2570472
+metN FALSE - 221614 222645
+metF FALSE + 4130639 4131529
+mlaF FALSE - 3337278 3338087
+ulaR FALSE - 4415721 4416476
+nanR FALSE - 3371720 3372511
+ppk FALSE + 2621066 2623132
+wcaE FALSE - 2126928 2127674
+yhfZ FALSE - 3509461 3510366
+yjiR FALSE - 4568185 4569597
+yjgA FALSE - 4455337 4455888
+mltA FALSE - 2944103 2945200
+yecR FALSE + 1986246 1986569
+lrhA FALSE - 2403725 2404663
+dtpD FALSE - 740298 741779
+appC FALSE + 1036963 1038507
+rluA FALSE - 59687 60346
+ynaJ FALSE + 1395389 1395646
+cyoD FALSE - 446941 447270
+gpsA TRUE - 3780665 3781684
+fliC FALSE - 2000134 2001630
+luxS FALSE - 2812240 2812755
+yfcD FALSE - 2416656 2417198
+yjiN FALSE - 4563989 4565269
+yiiX FALSE - 4125309 4125917
+yihT FALSE - 4069796 4070674
+yifL FALSE + 3992545 3992748
+ydiB FALSE + 1771813 1772679
+yagH FALSE + 286013 287623
+fucR FALSE + 2937390 2938121
+ygeY FALSE + 3006786 3007997
+gcvA FALSE - 2939672 2940589
+fruA FALSE - 2257741 2259432
+paoC FALSE - 297960 300158
+dtpB FALSE + 3638885 3640354
+torR FALSE - 1056485 1057177
+rbsB FALSE + 3934301 3935191
+yjfI FALSE + 4408156 4408557
+patA FALSE + 3217516 3218895
+ilvI FALSE + 85630 87354
+nrdI FALSE + 2798987 2799397
+yieK FALSE - 3896694 3897416
+ydfN FALSE - 1632909 1633871
+gspF FALSE + 3457839 3459035
+ynfH FALSE + 1661633 1662487
+ccmF FALSE - 2290983 2292926
+yibN FALSE - 3782607 3783038
+rsxG FALSE + 1708228 1708848
+bglF FALSE - 3901743 3903620
+araH FALSE - 1980578 1981567
+eutP FALSE - 2573000 2573479
+phnG FALSE - 4319267 4319719
+treA FALSE - 1244902 1246599
+rpiA FALSE - 3056688 3057347
+dgoA FALSE - 3871018 3871635
+wecC FALSE + 3969283 3970545
+viaA FALSE - 3926175 3927626
+lsrC FALSE + 1601043 1602071
+argE FALSE - 4151719 4152870
+sgbH FALSE + 3746600 3747262
+murR FALSE - 2542774 2543631
+ybfF FALSE - 711261 712025
+thrB FALSE + 2801 3733
+plsX FALSE + 1146844 1147914
+hisD FALSE + 2089121 2090425
+cysI FALSE - 2886409 2888121
+wcaF FALSE - 2126364 2126912
+lexA TRUE + 4255138 4255746
+ytjB FALSE - 4622168 4622812
+ydjI FALSE - 1854957 1855793
+citT FALSE - 644340 645803
+rho TRUE + 3964440 3965699
+pepB FALSE - 2653097 2654380
+kdgR FALSE - 1907332 1908123
+lsrG FALSE + 1605023 1605313
+yehT FALSE - 2210265 2210984
+dnaJ FALSE + 14168 15298
+yceH FALSE + 1125380 1126027
+yjbQ FALSE + 4268261 4268677
+hemG TRUE + 4032631 4033176
+yhbX FALSE - 3318010 3319635
+glyA FALSE - 2682276 2683529
+pgaA FALSE - 1089089 1091512
+yhbW FALSE + 3301470 3302477
+yeaE FALSE - 1862806 1863660
+yhhA FALSE + 3584966 3585406
+ycjV FALSE + 1378845 1379813
+yphC FALSE - 2672722 2673783
+hsdM FALSE - 4579482 4581071
+appY FALSE + 582904 583653
+mutS FALSE + 2855115 2857676
+moeB FALSE - 863603 864352
+fliS FALSE + 2003327 2003737
+selB FALSE - 3756040 3757884
+hlyE FALSE - 1228706 1229617
+fliG FALSE + 2012904 2013899
+fhuE FALSE - 1158585 1160774
+ligB FALSE - 3817511 3819193
+yjjG FALSE + 4606669 4607346
+rbn FALSE + 2379630 2380547
+puuR FALSE + 1359935 1360492
+yhcH FALSE - 3367036 3367500
+grxC FALSE - 3782214 3782465
+yacL FALSE + 134388 134750
+ydjG FALSE - 1853015 1853995
+yiiR FALSE + 4110338 4110778
+pyrE FALSE - 3813150 3813791
+ymfR FALSE + 1204772 1204954
+aspC FALSE - 983742 984932
+abpA FALSE - 2761559 2763175
+ybiV FALSE - 858436 859251
+ybjH FALSE - 884169 884453
+ybjG FALSE - 882015 882611
+yfcZ FALSE - 2458672 2458956
+ygdT FALSE - 2967352 2967498
+ytfJ FALSE - 4436731 4437285
+rihB FALSE - 2252267 2253208
+wcaM FALSE - 2112526 2113920
+elyC FALSE - 971845 972624
+deoA FALSE + 4616252 4617574
+rhlB FALSE - 3962388 3963653
+yfeR FALSE - 2523952 2524878
+dppF FALSE - 3699887 3700891
+dsdA FALSE + 2477224 2478552
+ymfQ FALSE + 1206136 1206720
+yggW FALSE + 3095289 3096425
+ves FALSE - 1822386 1822961
+yhjX FALSE - 3708822 3710030
+paaD FALSE + 1453949 1454446
+yejA FALSE + 2270386 2272200
+hydN FALSE - 2835600 2836127
+yicC FALSE + 3814699 3815562
+mlaC FALSE - 3335278 3335913
+ytfL FALSE - 4437895 4439238
+bdcA FALSE - 4471363 4472076
+yfdO FALSE - 2470900 2471268
+nanM FALSE - 4535682 4536788
+ybfD FALSE + 737315 738076
+yqfE FALSE - 3057403 3057633
+aslB FALSE + 3980981 3982216
+yhdX FALSE + 3418156 3419337
+ybfP FALSE + 714635 715129
+gspO FALSE + 3463565 3464242
+betI FALSE - 327971 328558
+pck FALSE + 3530840 3532462
+yicH FALSE + 3828480 3830189
+frwC FALSE + 4140553 4141632
+nfuA FALSE + 3543646 3544221
+arnF FALSE + 2370914 2371300
+blc FALSE - 4375212 4375745
+ybfE FALSE - 710828 711121
+yfaU FALSE - 2356064 2356867
+yqcG FALSE + 2903579 2903719
+lsrD FALSE + 1602071 1603063
+ompT FALSE - 583903 584856
+glyU FALSE - 2997006 2997079
+phnL FALSE - 4315238 4315918
+narP FALSE + 2288522 2289169
+nanK FALSE - 3367497 3368372
+mtlD FALSE + 3772447 3773595
+pyrC FALSE - 1120784 1121830
+yggN FALSE - 3098926 3099645
+fliO FALSE + 2019528 2019893
+ycbZ FALSE - 1015762 1017522
+agaV FALSE + 3278239 3278712
+ugpB FALSE - 3589032 3590348
+yobB FALSE + 1923464 1924120
+yeeZ FALSE - 2086328 2087152
+ppiA FALSE - 3489747 3490319
+cmoA FALSE + 1950726 1951469
+tig FALSE + 454357 455655
+eutH FALSE - 2564903 2566129
+phr FALSE + 738730 740148
+adeD FALSE + 3841987 3843753
+yiiG FALSE + 4085025 4086080
+yniC FALSE + 1807404 1808072
+ydcY FALSE + 1515672 1515905
+mnmC FALSE + 2439786 2441792
+rutA FALSE - 1072086 1073234
+gfcB FALSE - 1047911 1048555
+pgpA FALSE + 435813 436331
+gshA FALSE - 2812905 2814461
+lacI FALSE - 365652 366734
+gstB FALSE - 879077 879703
+ppdA FALSE - 2961729 2962199
+gspM FALSE + 3463104 3463565
+casD FALSE - 2878396 2879070
+hyfD FALSE + 2602833 2604272
+focB FALSE + 2611956 2612804
+ydjJ FALSE - 1855814 1856857
+dmlR FALSE - 1878910 1879833
+erpA TRUE + 176610 176954
+aroP FALSE - 120178 121551
+yccS FALSE - 1020953 1023106
+sdhD FALSE + 754783 755130
+glpR FALSE - 3557870 3558628
+yohK FALSE + 2229041 2229736
+hypB FALSE + 2849023 2849895
+yccA FALSE - 1029982 1030641
+ykfM FALSE - 238257 238736
+ykfI FALSE - 262552 262893
+fliP FALSE + 2019893 2020630
+ycfK FALSE + 1206724 1207353
+yhgF FALSE + 3535407 3537728
+fepA FALSE - 609477 611717
+rutR FALSE + 1073465 1074103
+frsA FALSE + 256527 257771
+wbbJ FALSE - 2102518 2103108
+nudL FALSE + 1894194 1894772
+cysU FALSE - 2539701 2540534
+degP FALSE + 180884 182308
+ydfJ FALSE - 1629026 1630309
+yfjW FALSE + 2771340 2773043
+ydbD FALSE + 1473168 1475474
+ypdA FALSE + 2496693 2498390
+malE FALSE - 4243252 4244442
+yeaK FALSE + 1871598 1872101
+ppdB FALSE - 2961175 2961738
+ecpA FALSE - 309308 309895
+ycjO FALSE + 1371246 1372127
+ybjL FALSE - 887357 889042
+ycfH FALSE + 1156000 1156797
+yfeC FALSE + 2516489 2516833
+ygiS FALSE - 3164133 3165740
+yfbS FALSE - 2407542 2409374
+fecC FALSE - 4510434 4511432
+srlA FALSE + 2823854 2824417
+paaG FALSE + 1456288 1457076
+yajC FALSE + 426511 426843
+pspF FALSE - 1364959 1365936
+ydiV FALSE - 1789331 1790044
+lacY FALSE - 361150 362403
+yjdP FALSE + 4311891 4312220
+mglC FALSE - 2234765 2235775
+rsmJ FALSE - 3640403 3641155
+radD FALSE + 2278654 2280414
+ycbU FALSE + 1002112 1002654
+yebC FALSE - 1945435 1946175
+csrD FALSE - 3399414 3401354
+exuR FALSE + 3244674 3245450
+gltS FALSE - 3825483 3826688
+ybhG FALSE - 828197 829195
+puuA FALSE - 1357514 1358932
+xylA FALSE - 3727466 3728788
+cysA FALSE - 2537739 2538836
+rlmN FALSE - 2641151 2642305
+rluC FALSE + 1144163 1145122
+manZ FALSE + 1901919 1902770
+ydiP FALSE - 1776414 1777325
+ybjP FALSE - 903175 903690
+yciT FALSE - 1341621 1342370
+ydcV FALSE + 1512786 1513580
+rlmL FALSE + 1007067 1009175
+allB FALSE + 538371 539732
+ilvE FALSE + 3950507 3951436
+ydhC FALSE + 1737935 1739146
+hspQ FALSE - 1027627 1027944
+yjfZ FALSE - 4424651 4425445
+glnP FALSE - 845683 846342
+yoaA FALSE - 1889349 1891259
+yabP FALSE + 58474 59124
+dinJ FALSE - 246242 246502
+rrrQ FALSE - 1637548 1638081
+moaB FALSE + 817278 817790
+mrcA FALSE + 3520893 3523445
+yaaU FALSE + 45807 47138
+purK FALSE - 550750 551817
+fldB FALSE + 3037877 3038398
+thiL TRUE + 434858 435835
+ravA FALSE - 3927620 3929116
+bdm FALSE - 1554089 1554304
+artQ FALSE - 900757 901473
+msrA FALSE - 4439561 4440199
+yjgM FALSE - 4477057 4477560
+yqeC FALSE - 3012309 3013079
+rsuA FALSE - 2277810 2278505
+mtr FALSE - 3302595 3303839
+ydcJ FALSE + 1493312 1494655
+yliF FALSE + 874558 875886
+fadJ FALSE - 2455037 2457181
+cvpA FALSE - 2428297 2428785
+trg FALSE + 1490494 1492134
+yadD FALSE + 146968 147870
+queA FALSE + 424235 425305
+gutM FALSE + 2826643 2827002
+entC FALSE + 624108 625283
+kup FALSE + 3929339 3931207
+lpoA FALSE + 3291422 3293458
+cpxR FALSE - 4102995 4103693
+mcrC FALSE - 4574935 4575981
+ygeO FALSE - 2993984 2994409
+alaE FALSE + 2797186 2797635
+trpB FALSE - 1315246 1316439
+aroG FALSE + 784856 785908
+ssrS FALSE + 3054005 3054187
+ybcJ FALSE - 555884 556096
+glgP FALSE - 3562157 3564604
+glcE FALSE - 3123492 3124544
+yobA FALSE - 1922619 1922993
+ygdD FALSE - 2939258 2939653
+lsrR FALSE - 1598312 1599265
+glpK FALSE - 4113737 4115245
+bisC FALSE - 3712084 3714417
+amiC FALSE - 2945779 2947032
+cpdA FALSE - 3174028 3174855
+pgl FALSE + 797809 798804
+yccT FALSE - 1026334 1026996
+yfiR FALSE + 2739897 2740415
+btuD FALSE - 1790833 1791582
+gldA FALSE - 4135955 4137058
+yqjI FALSE + 3214801 3215424
+ycgG FALSE + 1216551 1218074
+yaiA FALSE + 406203 406394
+ybhI FALSE + 801110 802543
+ygeV FALSE - 3002030 3003808
+htpG FALSE + 494344 496218
+narU FALSE - 1540696 1542084
+yidX FALSE + 3873461 3874117
+yjbS FALSE - 4266832 4267035
+frmA FALSE - 377686 378795
+yqgA FALSE + 3107575 3108282
+yqhD FALSE + 3153377 3154540
+yliI FALSE + 877965 879080
+dusA FALSE + 4259692 4260729
+glvG FALSE - 3859372 3860010
+osmF FALSE - 2216586 2217503
+ymbA FALSE + 1014134 1014682
+moaE FALSE + 818518 818970
+cspD FALSE - 921589 921813
+ylbF FALSE + 548850 549665
+ycaP FALSE + 955985 956677
+fadK FALSE + 1781001 1782701
+clsB FALSE - 821721 822962
+recF FALSE - 3878171 3879244
+mfd FALSE - 1169741 1173187
+wecB FALSE + 3968156 3969286
+ygaX FALSE + 2806338 2806604
+yggP FALSE - 3074201 3075478
+moaA FALSE + 816267 817256
+ydhS FALSE + 1745155 1746759
+iraM FALSE - 1210903 1211226
+ymfN FALSE + 1203393 1204760
+alsK TRUE - 4304893 4305822
+gpt FALSE + 255977 256435
+ybbP FALSE + 519640 522054
+yigA FALSE + 3993606 3994313
+ycgR FALSE - 1243016 1243750
+fdoG FALSE - 4080795 4083845
+yeaI FALSE + 1868409 1869884
+lsrA FALSE + 1599514 1601049
+ybgP FALSE - 748202 748930
+frc FALSE - 2490026 2491276
+phoH FALSE + 1084215 1085279
+yggD FALSE - 3072708 3073217
+ybjX FALSE - 917351 918307
+ygbI FALSE - 2858489 2859286
+yceJ FALSE - 1117703 1118269
+ydcP FALSE + 1504805 1506766
+fepB FALSE - 622777 623733
+tynA FALSE - 1447100 1449373
+hyaF FALSE + 1035972 1036829
+yhjY FALSE - 3710259 3710957
+pncC FALSE - 2821871 2822368
+gspL FALSE + 3461944 3463107
+ygeX FALSE + 3005532 3006728
+wzzE FALSE + 3967054 3968100
+csdA FALSE + 2941359 2942564
+waaJ FALSE - 3799006 3800022
+ghxQ FALSE + 3025143 3026510
+yjgN FALSE + 4477753 4478949
+glnB FALSE - 2685092 2685430
+hycD FALSE - 2844511 2845434
+appA FALSE + 1039840 1041138
+yraJ FALSE + 3286836 3289352
+fabF FALSE + 1151162 1152403
+pheA FALSE + 2735767 2736927
+iraP FALSE + 400610 400870
+yfcP FALSE - 2448073 2448612
+degQ FALSE + 3378765 3380132
+nrdD FALSE - 4458545 4460683
+uspB FALSE - 3637408 3637743
+sfmC FALSE + 558197 558889
+fliN FALSE + 2019112 2019525
+nikC FALSE + 3614205 3615038
+pncA FALSE + 1849911 1850552
+ybhS FALSE - 825342 826475
+rhsB FALSE + 3617215 3621450
+yhbO FALSE + 3296996 3297514
+waaH FALSE - 3787070 3788104
+yjiY FALSE - 4587152 4589302
+ulaD FALSE + 4420209 4420859
+yjhX FALSE - 4531819 4532076
+livM FALSE - 3592226 3593503
+yeeW FALSE + 2075964 2076158
+barA FALSE + 2913079 2915835
+yjiJ FALSE - 4559520 4560698
+deoD FALSE + 4618906 4619625
+ycdZ FALSE + 1099519 1100010
+rsxD FALSE + 1707166 1708224
+ampG FALSE - 451294 452769
+yhaH FALSE + 3250326 3250691
+wrbA FALSE - 1066335 1066931
+cheZ FALSE - 1964417 1965061
+paoA FALSE - 301108 301797
+yaaJ FALSE - 6529 7959
+rrrD FALSE + 576836 577333
+yggF FALSE - 3073239 3074204
+flxA FALSE + 1644429 1644761
+trpE FALSE - 1319408 1320970
+cspI FALSE - 1636479 1636691
+folX FALSE + 2419347 2419709
+ydiN FALSE + 1770536 1771801
+araD FALSE - 65855 66550
+ymfO FALSE + 1204954 1205427
+bolA FALSE + 453696 454013
+cutC FALSE - 1956544 1957290
+thiP FALSE - 72911 74521
+malK FALSE + 4244807 4245922
+dbpA FALSE + 1407535 1408908
+btuE FALSE - 1791582 1792133
+malT FALSE + 3551107 3553812
+yfbP FALSE + 2387138 2387986
+menC FALSE - 2373022 2373984
+chbC FALSE - 1817880 1819238
+yjdJ FALSE + 4350108 4350380
+yfaP FALSE - 2325389 2326165
+nupX FALSE - 2250917 2252167
+prpC FALSE + 349236 350405
+yicS FALSE + 3838238 3838531
+ybhL FALSE + 819107 819811
+eamB FALSE + 2713445 2714032
+ghrB FALSE + 3715333 3716307
+ybgJ FALSE + 742816 743472
+nemR FALSE + 1724047 1724646
+yhcF FALSE + 3364948 3365664
+yagP FALSE - 296605 297015
+ahpF FALSE + 638976 640541
+yghJ FALSE - 3112572 3117134
+yggS FALSE + 3093120 3093824
+betA FALSE - 324801 326471
+cyoE FALSE - 446039 446929
+dsbB FALSE - 1231723 1232253
+sbmC FALSE - 2078813 2079286
+torS FALSE - 1052657 1055401
+aroE FALSE - 3428042 3428860
+tnaB TRUE + 3888259 3889506
+ypdC FALSE + 2499152 2500009
+ybfC FALSE + 734873 735442
+gspB FALSE - 3451530 3451949
+creB FALSE + 4634030 4634719
+araJ FALSE - 410521 411705
+mtlA FALSE + 3770304 3772217
+bglJ FALSE + 4602183 4602860
+bamE FALSE + 2751627 2751968
+sohB FALSE + 1327356 1328405
+aroA FALSE + 958035 959318
+oppF FALSE + 1303788 1304792
+ytjC FALSE + 4631820 4632467
+yfbV FALSE - 2410699 2411154
+artJ FALSE - 899067 899798
+yjdM FALSE - 4324422 4324757
+rsmE FALSE + 3089156 3089887
+arpA FALSE - 4218324 4220510
+umuD FALSE + 1229990 1230409
+ycjS FALSE + 1374856 1375911
+yjjA FALSE - 4597718 4598212
+gatR_2 FALSE - 2169419 2169757
+clcB FALSE + 1663339 1664595
+yebV FALSE + 1919804 1920040
+adiA FALSE - 4336277 4338544
+rimO FALSE - 875933 877258
+modB FALSE + 795085 795774
+nagA FALSE - 700826 701974
+uvrA FALSE - 4269072 4271894
+ybjS FALSE - 904963 905976
+hyfJ FALSE + 2609479 2609892
+dgkA FALSE + 4254660 4255028
+purU FALSE - 1287005 1287847
+argF FALSE - 288525 289529
+yhjV FALSE + 3698586 3699857
+psiE FALSE + 4238348 4238758
+ilvM FALSE + 3950224 3950487
+tsr FALSE + 4589680 4591335
+clpA FALSE + 922487 924763
+aroD FALSE + 1772710 1773468
+yfiP FALSE + 2717245 2717943
+ydgI FALSE + 1677581 1678963
+yhjH FALSE - 3676443 3677210
+yeiH FALSE + 2247739 2248788
+idnT FALSE - 4489229 4490548
+yeaH FALSE + 1866979 1868262
+ybcK FALSE + 568125 569651
+znuC FALSE + 1940686 1941441
+yjhH FALSE - 4522128 4523033
+caiT FALSE - 40417 41931
+hepA FALSE - 60358 63264
+ycjF FALSE + 1383535 1384596
+yidB FALSE - 3875090 3875488
+dusC FALSE - 2227460 2228407
+hcr FALSE - 910405 911373
+lysR FALSE + 2977043 2977978
+rtcA FALSE - 3553855 3554871
+purD FALSE - 4202665 4203954
+lpxT FALSE + 2266876 2267589
+dcuS FALSE - 4348054 4349685
+srlB FALSE + 2825384 2825755
+mdtG FALSE - 1113487 1114713
+yafY FALSE - 265334 265777
+nupC FALSE + 2511064 2512266
+paaE FALSE + 1454454 1455524
+elfA FALSE + 997091 997630
+yigM FALSE + 4009099 4009998
+ylcI FALSE - 579474 579668
+yebT FALSE + 1915534 1918167
+cynT FALSE + 358023 358682
+narH FALSE + 1282827 1284365
+norW FALSE + 2831934 2833067
+pgrR FALSE + 1390015 1390914
+rlmG FALSE - 3232761 3233897
+fhuB FALSE + 171462 173444
+trmL FALSE + 3779238 3779711
+ycfL FALSE + 1161470 1161847
+yebO FALSE - 1906285 1906572
+nudG FALSE + 1839514 1839921
+dcuB FALSE - 4345427 4346767
+pepT FALSE + 1185067 1186293
+yrhB FALSE + 3582782 3583066
+manY FALSE + 1901106 1901906
+yhjA FALSE - 3665814 3667211
+scpB FALSE + 3062015 3062800
+ulaA FALSE + 4418003 4419400
+ydiF FALSE + 1773611 1775206
+pncB FALSE - 988377 989579
+ygfI FALSE - 3064299 3065195
+soxS FALSE - 4275083 4275406
+tmcA FALSE - 2591866 2593881
+hcp FALSE - 911385 913037
+paoD FALSE - 296994 297950
+msrB FALSE - 1860040 1860453
+agaA FALSE + 3279144 3279647
+yqfA FALSE - 3040511 3041170
+yqgB FALSE - 3083942 3084073
+yajR FALSE - 444526 445890
+hybA FALSE - 3142176 3143162
+nudJ FALSE - 1193050 1193511
+yheU FALSE + 3482240 3482458
+rlmI FALSE - 1028002 1029192
+torY FALSE - 1955056 1956156
+pldA FALSE + 4002885 4003754
+rarA FALSE + 937217 938560
+yncG FALSE + 1524271 1524888
+eutQ FALSE - 2572324 2573025
+kefB FALSE - 3476824 3478629
+yheT FALSE + 3481224 3482246
+opgB FALSE - 4595173 4597464
+yeiE FALSE - 2246759 2247640
+pppA FALSE - 3111565 3112374
+metE FALSE + 4011076 4013337
+wzxE FALSE + 3974301 3975551
+yihX FALSE + 4073576 4074175
+nadC FALSE - 117752 118645
+yceA FALSE + 1116030 1117082
+yeaP FALSE + 1875739 1876764
+ccmG FALSE - 2290429 2290986
+gcvT FALSE - 3047595 3048689
+malF FALSE - 4241554 4243098
+thiD FALSE - 2181738 2182538
+mdtK FALSE + 1741481 1742854
+gutQ FALSE + 2827835 2828800
+uxaB FALSE - 1607253 1608704
+purT FALSE + 1928905 1930083
+flgN FALSE - 1128637 1129053
+ttdA FALSE + 3204485 3205396
+nfsB FALSE - 603994 604647
+aaeR FALSE + 3387542 3388471
+kgtP FALSE - 2722470 2723768
+ynjD FALSE + 1836771 1837424
+mpaA FALSE - 1387894 1388622
+hisA FALSE + 2093149 2093886
+agaR FALSE - 3275878 3276687
+yafN TRUE + 252005 252298
+eutA FALSE - 2563503 2564906
+cysN FALSE - 2872014 2873441
+abgA FALSE - 1401279 1402589
+yeaX FALSE + 1883869 1884834
+yqgD FALSE - 3084421 3084672
+ypfJ FALSE - 2593896 2594759
+symE FALSE - 4577522 4577863
+tdcF TRUE - 3257743 3258132
+ccmA FALSE - 2295043 2295666
+rnd FALSE - 1884888 1886015
+radA FALSE + 4623935 4625317
+proW FALSE + 2804032 2805096
+mnaT FALSE - 1516352 1516870
+yghF FALSE - 3110076 3110942
+psuK FALSE - 2256377 2257318
+grxD FALSE - 1731778 1732125
+pdxA FALSE - 52427 53416
+creA FALSE + 4633544 4634017
+yfdE FALSE - 2486045 2487190
+ydfT FALSE - 1640513 1641265
+paaJ FALSE + 1458917 1460122
+yicL FALSE + 3836271 3837194
+fdoI FALSE - 4079248 4079883
+fixC FALSE + 44180 45466
+corA FALSE + 3999449 4000399
+frdB FALSE - 4377806 4378540
+metQ FALSE - 220113 220928
+hypF FALSE - 2833195 2835447
+yhbV TRUE + 3300511 3301389
+ydjN FALSE + 1808958 1810349
+yfjU FALSE - 2769862 2770176
+leuD FALSE - 78848 79453
+ilvB FALSE - 3849119 3850807
+sutR FALSE + 1504196 1504732
+rimK FALSE + 891190 892092
+yhjC FALSE + 3670365 3671336
+nrdG FALSE - 4457923 4458387
+cynS FALSE + 358713 359183
+higB FALSE - 3232163 3232477
+bglA FALSE + 3041684 3043123
+rpiR FALSE - 4310124 4311014
+ymdA FALSE + 1104637 1104948
+argD FALSE - 3486982 3488202
+leuB FALSE - 80867 81958
+cusB FALSE + 596702 597925
+hypT FALSE - 4555401 4556312
+yafV FALSE - 239419 240189
+rutF FALSE - 1069083 1069577
+uspE FALSE - 1395696 1396646
+clsC FALSE + 1105578 1106999
+sdaA FALSE + 1894956 1896320
+xseA FALSE + 2632254 2633624
+uxuR FALSE + 4552599 4553372
+roxA FALSE - 1186342 1187463
+hycI FALSE - 2840595 2841065
+yciH FALSE + 1340682 1341008
+ychN FALSE - 1272469 1272822
+rhsA FALSE + 3760206 3764339
+napF FALSE - 2301025 2301519
+yeeS FALSE + 2074332 2074778
+yraH FALSE + 3285448 3286032
+gltB FALSE + 3352654 3357207
+yieL FALSE - 3897431 3898627
+appB FALSE + 1038519 1039655
+hisG FALSE + 2088216 2089115
+fdnG FALSE + 1545425 1548472
+tktB FALSE + 2577658 2579661
+ycjT FALSE + 1375908 1378175
+yjbJ FALSE + 4257260 4257469
+ycgY FALSE + 1244383 1244823
+frdA FALSE - 4378533 4380341
+galK FALSE - 788054 789202
+glcA FALSE - 3117619 3119301
+ygiM FALSE + 3199229 3199849
+galM FALSE - 787020 788060
+yhjD FALSE + 3671385 3672398
+yiaM FALSE + 3742351 3742824
+ldtD FALSE + 980270 982117
+ansB FALSE - 3097704 3098750
+tyrA FALSE - 2736970 2738091
+rlmC FALSE + 897741 898868
+tdcE FALSE - 3258146 3260440
+yfiB FALSE + 2741647 2742129
+hsrA FALSE - 3937208 3938635
+eutJ FALSE - 2567523 2568359
+glcB FALSE - 3119656 3121827
+yegK FALSE - 2149735 2150496
+yehU FALSE - 2210981 2212666
+rmf FALSE + 1014938 1015105
+rbsR FALSE + 3936250 3937242
+yhbS FALSE - 3298277 3298780
+hisB FALSE + 2091492 2092559
+umpH FALSE - 698797 699549
+fhuA FALSE + 167484 169727
+sroH FALSE - 4188350 4188510
+yceK FALSE + 1112802 1113029
+proC FALSE - 404059 404868
+ugpC FALSE - 3586133 3587203
+yccX FALSE + 1029287 1029565
+ycaD FALSE + 945094 946242
+sgbE FALSE + 3748109 3748804
+acpH FALSE - 423561 424142
+yneG FALSE - 1609990 1610349
+ydcS FALSE + 1509678 1510823
+btuR FALSE - 1325791 1326381
+dsdX FALSE + 2475869 2477206
+garK FALSE - 3268647 3269873
+mak FALSE + 409368 410276
+yecN FALSE + 1950290 1950685
+ampE FALSE + 119281 120135
+purR FALSE + 1735868 1736893
+wcaJ FALSE - 2118184 2119578
+purH FALSE - 4203966 4205555
+satP FALSE - 9928 10494
+ygcO FALSE + 2891941 2892201
+ascB FALSE + 2839012 2840436
+dkgB FALSE + 229167 229970
+yneM FALSE + 1620670 1620765
+norV FALSE + 2830498 2831937
+mutL FALSE + 4395435 4397282
+allR FALSE + 532235 533050
+gadC FALSE - 1566978 1568513
+serB FALSE + 4622918 4623886
+copA FALSE - 508099 510603
+ydjO FALSE - 1810353 1811168
+ypfG FALSE - 2579756 2580799
+phnO FALSE - 4313127 4313561
+yajG FALSE - 452813 453391
+yhfK FALSE + 3484813 3486915
+paaC FALSE + 1453188 1453934
+hyfG FALSE + 2606509 2608176
+ydeK FALSE - 1592133 1596110
+yehI FALSE + 2198301 2201933
+yiiQ FALSE - 4109638 4110237
+fimG FALSE + 4546308 4546811
+uxaC FALSE - 3241351 3242763
+pepN FALSE + 989845 992457
+ynjF FALSE - 1838807 1839427
+yhjG FALSE - 3674313 3676388
+yegD FALSE + 2145698 2147050
+tas FALSE + 2969619 2970659
+treR FALSE - 4464322 4465269
+alsC FALSE - 4306512 4307492
+gspE FALSE + 3456361 3457842
+mnmG FALSE - 3921767 3923656
+dmsC FALSE + 943256 944119
+uvrC FALSE - 1990898 1992730
+recR FALSE + 493629 494234
+fliA FALSE - 1999094 1999813
+ybhM FALSE + 820016 820729
+ybgI FALSE + 742050 742793
+tbpA FALSE - 74497 75480
+ybhC FALSE - 805221 806504
+yeaG FALSE + 1864932 1866866
+ybiH FALSE - 829195 829866
+apt FALSE + 490636 491187
+ddpA FALSE - 1558955 1560505
+nudC FALSE + 4194926 4195699
+mltF FALSE + 2693823 2695379
+nikA FALSE + 3611690 3613264
+ybdM FALSE - 633970 634599
+G0-10704 FALSE + 3999214 3999357
+gcvP FALSE - 3044190 3047063
+aidB FALSE + 4412298 4413923
+ylbH FALSE + 527173 527883
+galT FALSE - 789206 790252
+pgaD FALSE - 1085329 1085742
+ycjU FALSE + 1378172 1378831
+yceB FALSE - 1121936 1122496
+menH FALSE - 2374856 2375614
+yneL FALSE - 1588381 1588560
+rsmI TRUE - 3290497 3291357
+yehA FALSE - 2185402 2186436
+aldB FALSE - 3752996 3754534
+yijO FALSE - 4145489 4146340
+yahN FALSE - 344890 345561
+ilvD FALSE + 3951501 3953351
+argO FALSE - 3066195 3066830
+mdtF FALSE + 3658437 3661550
+galE FALSE - 790262 791278
+yejB FALSE + 2272201 2273295
+ydhF FALSE - 1722760 1723656
+ydiY FALSE - 1803349 1804107
+grxA FALSE - 889719 889976
+greB FALSE + 3534834 3535310
+abgT FALSE - 1398271 1399797
+ppdD FALSE - 117109 117549
+yoaE FALSE - 1898053 1899609
+ygcG FALSE + 2903733 2904605
+pbpG FALSE - 2221960 2222892
+yiiD FALSE + 4075472 4076461
+ydgJ FALSE - 1701292 1702332
+btuC FALSE - 1792196 1793176
+ygcE FALSE + 2899918 2901396
+hyaE FALSE + 1035577 1035975
+flhC FALSE - 1975290 1975868
+bioF FALSE + 809604 810758
+exuT FALSE + 3243246 3244544
+uidR FALSE - 1694486 1695076
+ygeQ FALSE - 2996056 2996850
+gntT FALSE + 3544581 3545897
+phnI FALSE - 4317622 4318686
+ybgO FALSE - 747144 748205
+insK FALSE + 3719177 3720072
+arcZ FALSE + 3348599 3348719
+yeaY FALSE - 1887975 1888556
+basS FALSE - 4330204 4331295
+caiD FALSE - 35377 36162
+arsC FALSE + 3648260 3648685
+hicB FALSE + 1507511 1507948
+ydjM FALSE + 1808235 1808825
+yddA FALSE - 1575681 1577366
+arnD FALSE + 2368040 2368930
+dhaR FALSE + 1250289 1252208
+folM FALSE + 1679000 1679722
+epmC FALSE - 2442225 2442773
+mltG FALSE + 1153335 1154357
+ycfP FALSE + 1164366 1164908
+intQ FALSE + 1649536 1650732
+bglG FALSE - 3903754 3904590
+pliG FALSE - 1226294 1226695
+rarD FALSE - 4001311 4002201
+mcrA FALSE + 1209569 1210402
+napG FALSE - 2297587 2298282
+atoD FALSE + 2321469 2322131
+grxB FALSE - 1122630 1123277
+uup FALSE + 1009187 1011094
+etp FALSE - 1043453 1043899
+yfcA FALSE - 2442773 2443582
+yaiW FALSE + 397096 398190
+djlC FALSE + 679435 680886
+nhaB FALSE - 1232399 1233940
+yafE FALSE + 231926 232549
+atoA FALSE + 2322131 2322781
+yihI FALSE + 4049370 4049879
+citF FALSE - 647262 648794
+yeeP FALSE + 2068810 2069235
+yqcC FALSE - 2921806 2922135
+argC FALSE + 4153024 4154028
+emrY FALSE - 2478660 2480198
+exbD FALSE - 3148840 3149265
+yfeH FALSE + 2524968 2525966
+exbB FALSE - 3149272 3150006
+ybjQ FALSE + 903816 904139
+yciE FALSE - 1312742 1313248
+yjdN FALSE - 4323321 4323764
+nadR FALSE + 4625338 4626570
+ybaL FALSE - 500786 502462
+yaeR FALSE + 211877 212266
+yraK FALSE + 3289363 3290454
+glgS FALSE - 3189761 3189961
+yeeO FALSE - 2056227 2057870
+yeeJ FALSE + 2042935 2050038
+queE FALSE - 2902769 2903440
+ygjI FALSE + 3224256 3225689
+ynjA FALSE + 1833539 1834087
+fucI FALSE + 2933606 2935381
+dmlA FALSE + 1879936 1881021
+yhhQ TRUE + 3607240 3607905
+yfaL FALSE - 2338439 2342191
+tamA FALSE + 4440405 4442138
+hyi FALSE + 534934 535710
+kduD FALSE - 2980519 2981280
+efp FALSE + 4373722 4374288
+tpke11 FALSE + 14080 14168
+yfcQ FALSE - 2448609 2449097
+yfeZ FALSE - 2549299 2549748
+lpoB FALSE + 1161861 1162502
+xapR FALSE - 2519615 2520499
+yjjU FALSE + 4610434 4611507
+ldcA FALSE - 1241389 1242303
+rcsF FALSE - 219591 219995
+adrA FALSE + 402927 404042
+ydaV FALSE + 1420007 1420753
+wzxC FALSE - 2116704 2118182
+cmtA FALSE - 3075493 3076881
+sbcD FALSE - 414974 416176
+prkB FALSE + 3482512 3483381
+ymgA FALSE + 1215291 1215563
+ydgD FALSE + 1669984 1670805
+lpp FALSE + 1755445 1755681
+allA FALSE + 531675 532157
+iap FALSE + 2874603 2875640
+arfB FALSE + 214833 215255
+xapB FALSE - 2520751 2522007
+yebG FALSE - 1928481 1928771
+gntU FALSE - 3573744 3575084
+yhhS FALSE - 3608539 3609756
+psuT FALSE - 2254107 2255357
+nrfG FALSE + 4291566 4292162
+yciV FALSE + 1321244 1322125
+yahD FALSE + 334504 335109
+dkgA FALSE + 3154645 3155472
+yfjX FALSE + 2773941 2774399
+pal FALSE + 778290 778811
+gatR_1 FALSE - 2167717 2168163
+zinT FALSE + 2039399 2040049
+ygeA FALSE - 2977965 2978657
+lhgO FALSE + 2788004 2789272
+xylF FALSE + 3729154 3730146
+argT FALSE - 2425031 2425813
+cysK FALSE + 2530431 2531402
+uspG FALSE - 640662 641090
+nrfE FALSE + 4289535 4291193
+ycjM FALSE + 1368240 1369919
+waaY FALSE - 3798290 3798988
+avtA FALSE + 3737728 3738981
+yfeN FALSE + 2523149 2523913
+aroM FALSE + 406652 407329
+yegW FALSE - 2180057 2180803
+ycjR FALSE + 1374058 1374846
+mrcB FALSE + 164730 167264
+yjiC FALSE - 4553513 4554343
+glgC FALSE - 3566056 3567351
+nupG FALSE + 3103736 3104992
+ydeA FALSE + 1615052 1616242
+dgt FALSE + 179237 180754
+sgcC FALSE - 4526953 4528266
+eutC FALSE - 2554432 2555319
+prpR FALSE - 346081 347667
+htrE FALSE - 152829 155426
+feoB FALSE + 3538429 3540750
+yfbK FALSE - 2382017 2383744
+ybdR FALSE + 641311 642549
+dctA FALSE - 3680184 3681470
+carB FALSE + 30817 34038
+yfeD FALSE + 2516835 2517227
+ppsA FALSE - 1782758 1785136
+perR FALSE - 268513 269406
+yggT FALSE + 3093842 3094408
+ydbL FALSE + 1443904 1444230
+ninE FALSE + 572144 572314
+yqgC FALSE + 3084209 3084424
+yihS FALSE - 4068538 4069779
+abgR FALSE + 1402765 1403673
+fucO FALSE - 2929887 2931035
+bcsG FALSE + 3696237 3697916
+sfsB FALSE + 3332931 3333209
+oxc FALSE - 2488278 2489972
+hdeB FALSE - 3653989 3654315
+glpC FALSE + 2353543 2354733
+yagF FALSE + 282425 284392
+malZ FALSE + 421742 423556
+pheP FALSE + 601182 602558
+ssuD FALSE - 994066 995211
+yhjK FALSE - 3681653 3683602
+gabD FALSE + 2789295 2790743
+glcD FALSE - 3124544 3126043
+ygdR FALSE + 2969293 2969511
+ynbA FALSE + 1475645 1476250
+zntR FALSE - 3436727 3437152
+cobU FALSE - 2063243 2063788
+csiR FALSE + 2793696 2794358
+trpA FALSE - 1314440 1315246
+tdcD FALSE - 3260474 3261694
+mazF FALSE - 2908778 2909113
+galR FALSE + 2974621 2975652
+ssuA FALSE - 995208 996167
+yfaY FALSE - 2360453 2361655
+ynfG FALSE + 1661014 1661631
+napH FALSE - 2296737 2297600
+ahpC FALSE + 638168 638731
+acrD FALSE + 2585617 2588730
+ycgX FALSE - 1211926 1212330
+yigZ FALSE + 4030515 4031129
+arsB FALSE + 3646958 3648247
+yqjG FALSE + 3249046 3250032
+clpB FALSE - 2729622 2732195
+pdxB FALSE - 2434737 2435873
+ymdB FALSE + 1105043 1105576
+ygcR FALSE - 2893798 2894577
+yeaV FALSE + 1881212 1882657
+yjaZ FALSE + 4187809 4188348
+pflB FALSE - 950495 952777
+ahr FALSE - 4493213 4494232
+ugpA FALSE - 3588047 3588934
+mscK FALSE + 485760 489122
+dinG FALSE + 832293 834443
+qmcA FALSE - 514080 514997
+intF FALSE - 294920 296320
+bcsQ FALSE - 3693256 3693984
+rstB FALSE + 1680906 1682207
+yigI FALSE - 4002253 4002720
+ypeA FALSE - 2549735 2550160
+fecD FALSE - 4509481 4510437
+ygjH FALSE - 3218937 3219269
+chpB FALSE + 4446715 4447065
+mgsA FALSE - 1025780 1026238
+yrbG FALSE + 3338297 3339274
+prmA FALSE + 3407092 3407973
+ymfM FALSE + 1203045 1203383
+queD FALSE + 2890236 2890601
+glpB FALSE + 2352287 2353546
+ydhB FALSE - 1736890 1737822
+yfdC FALSE + 2463323 2464255
+paaX FALSE + 1461563 1462513
+yafU FALSE - 238746 239084
+agp FALSE + 1064808 1066049
+thiM FALSE - 2182535 2183323
+ybaS FALSE + 510865 511797
+rnk FALSE - 642780 643190
+opgG FALSE + 1108558 1110093
+ppx FALSE + 2623137 2624678
+ykgM FALSE - 311738 312001
+yjeM FALSE + 4381862 4383364
+dld FALSE + 2220207 2221922
+purM FALSE + 2619219 2620256
+astA FALSE - 1827755 1828789
+idnO FALSE - 4490610 4491374
+cadC FALSE - 4358419 4359957
+yqiH FALSE + 3187903 3188652
+ycdT FALSE + 1092099 1093457
+ybhR FALSE - 824225 825331
+rsmF FALSE + 1918247 1919686
+alsB FALSE - 4309130 4310065
+frlA FALSE + 3497932 3499269
+malQ FALSE - 3546008 3548092
+recO FALSE - 2699763 2700491
+argG FALSE + 3316659 3318002
+yoaB FALSE + 1891391 1891735
+yddE FALSE - 1532989 1533882
+pflA FALSE - 949563 950303
+cheR FALSE - 1966528 1967388
+yahK FALSE + 342108 343157
+arnE FALSE + 2370579 2370914
+abrB FALSE - 745946 746992
+ompN FALSE - 1433784 1434917
+yffM FALSE + 2559390 2559635
+cdd FALSE + 2229866 2230750
+yodB FALSE + 2040392 2040922
+ucpA FALSE - 2541854 2542645
+livF FALSE - 3590747 3591460
+mqo FALSE - 2303130 2304776
+preA FALSE + 2233287 2234522
+hsdR FALSE - 4581272 4584838
+yibQ FALSE + 3786124 3787083
+rtn FALSE + 2268748 2270304
+fdhF FALSE - 4295242 4297389
+yfbM FALSE + 2384956 2385459
+malI FALSE - 1696176 1697204
+nepI FALSE - 3838572 3839762
+ydhW FALSE - 1749101 1749748
+ydiJ FALSE - 1763653 1766709
+livK FALSE - 3594474 3595583
+hofN FALSE - 3519455 3519994
+soxR FALSE + 4275492 4275956
+thrC FALSE + 3734 5020
+nirB FALSE + 3492033 3494576
+gstA FALSE + 1712401 1713006
+mdtB FALSE + 2153287 2156409
+ydaM FALSE - 1404587 1405819
+pyrB FALSE - 4469483 4470418
+sufD FALSE - 1758544 1759815
+ybiU FALSE - 857019 858284
+ydfD FALSE + 1647818 1648009
+yfjJ FALSE + 2758569 2759195
+yniA FALSE + 1805820 1806680
+yfgF FALSE - 2624717 2626960
+yrdB FALSE - 3427788 3428045
+ydeP FALSE - 1582231 1584510
+yegR FALSE - 2166013 2166330
+kefG FALSE - 3478629 3479183
+fkpA FALSE - 3474629 3475441
+panD FALSE - 146314 146694
+ydbH FALSE + 1441075 1443714
+galS FALSE - 2238650 2239690
+yedE FALSE + 2006301 2007506
+yibF FALSE - 3759370 3759978
+abpB FALSE - 2759373 2761562
+csgF FALSE - 1100934 1101350
+dinF FALSE + 4255765 4257144
+yegQ FALSE + 2163692 2165053
+pepQ FALSE + 4029184 4030515
+yadC FALSE - 149715 150953
+thiE FALSE - 4191592 4192227
+hycE FALSE - 2842784 2844493
+yfeO FALSE + 2507652 2508908
+narQ FALSE + 2583753 2585453
+moaD FALSE + 818271 818516
+fryC FALSE - 2504669 2505916
+yjhC FALSE + 4503310 4504428
+tauD FALSE + 387019 387870
+sufB FALSE - 1760546 1762033
+yfdN FALSE - 2470409 2470903
+ygiF FALSE - 3197686 3198987
+puuP FALSE - 1355826 1357211
+yedY FALSE + 2037502 2038506
+mepH FALSE + 1732459 1733274
+ybcH FALSE - 586314 587204
+slyD FALSE - 3475929 3476519
+gltL FALSE - 683753 684478
+ilvC FALSE + 3955993 3957468
+ygjK FALSE + 3226910 3229261
+yfaA FALSE - 2332978 2334666
+gfcD FALSE - 1045072 1047168
+yphA FALSE + 2671296 2671790
+ybaT FALSE + 511800 513092
+fumB FALSE - 4343703 4345349
+ydcK FALSE - 1497493 1498473
+fdhE FALSE - 4078322 4079251
+rbsK FALSE + 3935317 3936246
+yjiM FALSE - 4562722 4563873
+nrdF FALSE + 2801524 2802483
+frlB FALSE + 3499290 3500312
+uidB FALSE - 1690914 1692287
+yecC FALSE - 1995086 1995838
+ddpC FALSE - 1557038 1557934
+bioH FALSE - 3542096 3542866
+rlmF FALSE + 841555 842481
+hflK FALSE + 4400061 4401320
+yafK FALSE - 245065 245805
+hyaD FALSE + 1034993 1035580
+ssuB FALSE - 992500 993267
+dmsD FALSE + 1662530 1663144
+nrdH FALSE + 2798745 2798990
+ansP FALSE - 1522505 1524004
+ydiU FALSE - 1787832 1789268
+zraR FALSE + 4201343 4202668
+proK FALSE - 3706639 3706715
+pspG FALSE + 4260863 4261105
+ypjM_3 FALSE - 2770189 2770707
+ynjC FALSE + 1835281 1836771
+ygeR FALSE - 2997158 2997913
+fsr FALSE - 502700 503920
+uvrB FALSE + 812749 814770
+gcvH FALSE - 3047182 3047571
+uhpT FALSE - 3843799 3845190
+hcaT FALSE - 2664729 2665868
+gspD FALSE + 3454399 3456351
+lsrK FALSE - 1596641 1598233
+citE FALSE - 648805 649713
+sad FALSE - 1611339 1612727
+insO-2 FALSE + 4506981 4507577
+yneJ FALSE + 1612828 1613709
+argA FALSE + 2947264 2948595
+yqcE FALSE + 2898614 2899891
+yfiF FALSE - 2715513 2716550
+ydhK FALSE + 1720145 1722157
+mlrA FALSE + 2212888 2213619
+idnD FALSE - 4491398 4492429
+yggU FALSE + 3094405 3094695
+ybhN FALSE - 820765 821721
+ybgF FALSE + 778821 779612
+rseC FALSE - 2705344 2705823
+yjjV FALSE + 4611504 4612283
+bfr FALSE - 3464271 3464747
+ygiV FALSE - 3166771 3167253
+ypeC FALSE + 2509023 2509349
+panZ FALSE + 3596007 3596390
+murP FALSE + 2544695 2546119
+ygjJ FALSE + 3225823 3226893
+nmpC FALSE - 574981 576048
+mhpR FALSE - 366811 367644
+glpQ FALSE - 2347957 2349033
+fecE FALSE - 4508713 4509480
+yggL FALSE - 3099829 3100155
+fucU FALSE + 2936910 2937332
+thiK FALSE + 1162483 1163307
+acrR FALSE + 484985 485632
+yiaJ FALSE - 3739707 3740555
+caiC FALSE - 36271 37824
+yjfF FALSE + 4451606 4452601
+afuC FALSE - 276980 278026
+ycfJ FALSE + 1166822 1167361
+fetB FALSE + 515807 516586
+slyB FALSE + 1717900 1718367
+yagU FALSE + 302215 302829
+ymgF FALSE + 1218206 1218424
+trmH FALSE + 3822538 3823227
+yjjW FALSE - 4612703 4613566
+rbsA FALSE + 3931801 3933306
+tehA FALSE + 1498597 1499589
+entD TRUE - 608682 609302
+pitB FALSE - 3132894 3134393
+cpsG FALSE - 2119633 2121003
+rhaD FALSE - 4091471 4092295
+yhgE FALSE - 3528737 3530461
+yjiH FALSE - 4558020 4558703
+ascF FALSE + 2837546 2839003
+cirA FALSE - 2242800 2244791
+fsaB FALSE - 4137069 4137731
+ybjC FALSE + 890136 890423
+rpiB FALSE + 4311373 4311822
+thiF FALSE - 4190844 4191599
+aer FALSE - 3215578 3217098
+fimH FALSE + 4546831 4547733
+preT FALSE + 2232055 2233293
+ycfT FALSE - 1173315 1174388
+anmK FALSE - 1716517 1717626
+ychO FALSE + 1273148 1274401
+pgpB FALSE + 1337354 1338118
+oxyR FALSE + 4156513 4157430
+fpr FALSE - 4111749 4112495
+talA FALSE + 2576688 2577638
+yghS FALSE - 3131266 3131979
+yphG FALSE - 2677486 2680767
+csiE FALSE + 2663457 2664737
+yhbT FALSE - 3298774 3299298
+fdhD FALSE + 4084039 4084872
+flk FALSE + 2435972 2436967
+fhuC FALSE + 169778 170575
+ypdI FALSE + 2492720 2492995
+malY FALSE + 1698981 1700153
+ycaC FALSE - 944154 944780
+bcp FALSE + 2598500 2598970
+narG FALSE + 1279087 1282830
+ssnA FALSE + 3017183 3018511
+melA FALSE + 4339934 4341289
+yhcO FALSE - 3383879 3384151
+clcA FALSE + 175107 176528
+ygcU FALSE - 2895986 2897440
+btuB FALSE + 4161662 4163506
+yeaO FALSE + 1874933 1875280
+ydiT FALSE + 1780705 1780998
+tyrP FALSE + 1987705 1988916
+intZ FALSE + 2556793 2558088
+pka FALSE + 2717975 2720635
+araC FALSE + 70387 71265
+ygcQ FALSE - 2892941 2893801
+ptsA FALSE - 4137743 4140244
+yadG FALSE + 142779 143705
+btuF FALSE - 177662 178462
+ompX FALSE + 849673 850188
+oppA FALSE + 1299206 1300837
+lyxK FALSE + 3745107 3746603
+dctR FALSE + 3652706 3653236
+yidE FALSE - 3862635 3864296
+puuE FALSE + 1363574 1364839
+yehM FALSE + 2203717 2205996
+ycjX FALSE + 1382141 1383538
+hyaA FALSE + 1031362 1032480
+tauB FALSE + 385431 386198
+yegE FALSE + 2141290 2144607
+gatD FALSE - 2169857 2170897
+yedW FALSE - 2036176 2036847
+isrC FALSE + 2069341 2069535
+ybiJ FALSE - 836888 837148
+ynfF FALSE + 1658580 1661003
+ypjA FALSE - 2776168 2780748
+ansA FALSE + 1848884 1849900
+edd FALSE - 1930817 1932628
+casB FALSE - 2880177 2880659
+hcaR FALSE - 2666028 2666918
+yfjD FALSE + 2746796 2748082
+cysW FALSE - 2538826 2539701
+eutG FALSE - 2566346 2567533
+cbl FALSE - 2057988 2058938
+yphF FALSE - 2676406 2677389
+yiiM FALSE + 4100845 4101519
+ytfF FALSE - 4430114 4431088
+yjbB FALSE + 4225754 4227385
+yhdY FALSE + 3419347 3420450
+fdnI FALSE + 1549362 1550015
+yacH FALSE - 129407 131260
+fecB FALSE - 4511429 4512331
+csgD FALSE - 1101769 1102419
+yjhF FALSE - 4518694 4520043
+ypdB FALSE + 2498405 2499139
+yfbT FALSE - 2409461 2410111
+recT FALSE - 1412008 1412817
+astC FALSE - 1828786 1830006
+hofC FALSE - 114522 115724
+ynjH FALSE - 1839887 1840159
+mltB FALSE - 2822513 2823598
+ycgB FALSE - 1234932 1236464
+glpT FALSE - 2349038 2350396
+fliI FALSE + 2014578 2015951
+wza FALSE - 2134128 2135267
+argI FALSE - 4475330 4476334
+ylaC FALSE - 478005 478475
+yhaV FALSE + 3275359 3275823
+ynfD FALSE + 1655589 1655894
+prpD FALSE + 350439 351890
+hslJ FALSE - 1439345 1439767
+dedD FALSE - 2429044 2429706
+csgC FALSE + 1104184 1104516
+hemY FALSE - 3984709 3985905
+rspB FALSE - 1650920 1651939
+sgcX FALSE - 4528553 4529674
+pgaB FALSE - 1087062 1089080
+yhhJ FALSE - 3623702 3624826
+pabC FALSE + 1152523 1153332
+ppc FALSE - 4148470 4151121
+leuA FALSE - 81958 83529
+phoR FALSE + 417113 418408
+mdtJ FALSE - 1671160 1671525
+chaA FALSE - 1269972 1271072
+xylH FALSE + 3731743 3732924
+deoB FALSE + 4617626 4618849
+glrK FALSE - 2687693 2689120
+yqfB FALSE - 3041334 3041645
+opgC FALSE - 1107007 1108164
+mhpB FALSE + 369501 370445
+G0-10706 FALSE - 4439248 4439353
+pphA FALSE - 1920337 1920993
+yehL FALSE + 2202618 2203706
+yaiF FALSE - 381728 382114
+gntP FALSE - 4547976 4549319
+bcsB TRUE - 3688291 3690630
+ydeT FALSE - 1586877 1588025
+ybiT FALSE + 855186 856778
+glmZ FALSE + 3984455 3984626
+cbtA FALSE + 2075593 2075967
+sroC FALSE - 685904 686066
+yjhV FALSE + 4507743 4508156
+ynfK FALSE - 1664548 1665243
+pyrF FALSE + 1339945 1340682
+nagC FALSE - 699597 700817
+cysH FALSE - 2885600 2886334
+ttdB FALSE + 3205393 3205998
+udp FALSE + 4014454 4015215
+ypjM_1 FALSE - 2770998 2771180
+lgoD FALSE + 4594013 4595035
+pspA FALSE + 1366103 1366771
+aceB FALSE + 4213501 4215102
+rhsD FALSE + 522485 526765
+fliH FALSE + 2013892 2014578
+alaA FALSE + 2405583 2406800
+gspA FALSE - 3451951 3453420
+yadH FALSE + 143702 144472
+yhjR FALSE - 3694020 3694208
+ymcE FALSE + 1051070 1051300
+nhaR FALSE + 18715 19620
+panC FALSE - 147944 148795
+pntA FALSE - 1674395 1675927
+ibpA FALSE - 3865032 3865445
+fadI FALSE - 2457181 2458491
+entH FALSE + 628523 628936
+citG FALSE - 645854 646732
+folK TRUE - 157253 157732
+dcuR FALSE - 4347338 4348057
+tsx FALSE - 430353 431237
+xylR FALSE + 3733002 3734180
+wzb FALSE - 2133679 2134122
+rlmJ FALSE + 3643408 3644250
+hybC FALSE - 3139308 3141011
+hcaB FALSE + 2669247 2670059
+yicI FALSE - 3830242 3832560
+yafS FALSE + 234816 235538
+yhfS FALSE - 3502957 3504042
+ecpR FALSE - 309970 310560
+cysM FALSE - 2536694 2537605
+fadA FALSE - 4025632 4026795
+fryA FALSE - 2500012 2502507
+katG FALSE + 4131858 4134038
+ptrB FALSE - 1924803 1926863
+entF FALSE + 613380 617261
+lysU FALSE - 4351223 4352740
+trmJ FALSE - 2660605 2661345
+yeeD FALSE - 2082250 2082477
+ghrA FALSE + 1097109 1098047
+ybjE FALSE - 913181 914080
+osmE FALSE - 1819942 1820280
+csgB FALSE + 1103174 1103629
+katE FALSE + 1811891 1814152
+xylE FALSE - 4238802 4240277
+livH FALSE - 3593500 3594426
+yfaX FALSE - 2359451 2360233
+htrL FALSE - 3790849 3791706
+ydbK FALSE - 1435284 1438808
+yfhR FALSE + 2662385 2663266
+yohF FALSE - 2224531 2225292
+yjeH FALSE - 4367179 4368435
+gor FALSE + 3644322 3645674
+yhdP FALSE - 3390480 3394280
+potG FALSE + 894214 895347
+hchA FALSE + 2033859 2034710
+yhgA FALSE + 3541189 3542067
+phnH FALSE - 4318686 4319270
+setA FALSE + 77621 78799
+yaiU FALSE + 392239 393642
+fadL FALSE + 2459322 2460668
+carA FALSE + 29651 30799
+syd FALSE - 2922757 2923302
+yjaH FALSE + 4198589 4199284
+opgH FALSE + 1110086 1112629
+ydiK FALSE + 1767098 1768210
+putA FALSE - 1074143 1078105
+ydeM FALSE - 1577657 1578814
+trmO FALSE - 218887 219594
+phnJ FALSE - 4316784 4317629
+recX FALSE - 2820161 2820661
+exoX FALSE + 1924144 1924806
+shiA FALSE + 2051667 2052983
+yahG FALSE + 337549 338967
+tfaE FALSE - 1207740 1208342
+gadE FALSE + 3656389 3656916
+ybbY FALSE + 539789 541090
+patD FALSE + 1513602 1515026
+fixA FALSE + 42403 43173
+menE FALSE - 2371670 2373025
+zupT FALSE + 3180572 3181345
+yihQ FALSE - 4065263 4067299
+motA FALSE - 1974276 1975163
+motB FALSE - 1973353 1974279
+idnR FALSE - 4488164 4489162
+grcA FALSE - 2714088 2714471
+pabB FALSE + 1892829 1894190
+intS FALSE + 2464567 2465724
+flgF FALSE + 1133025 1133780
+flgD FALSE + 1131077 1131772
+menB FALSE - 2373984 2374841
+narI FALSE + 1285072 1285749
+yigB FALSE + 3995206 3995922
+yjbH FALSE + 4235657 4237753
+ydfG FALSE + 1625541 1626287
+add FALSE + 1700257 1701258
+hdeD FALSE + 3655018 3655590
+uxaA FALSE - 3239849 3241336
+lhr FALSE + 1727111 1731727
+rpoS FALSE - 2864581 2865573
+htgA FALSE + 10830 11315
+livG FALSE - 3591462 3592229
+hokB FALSE - 1489946 1490095
+dmsB FALSE + 942637 943254
+yjcS FALSE - 4302635 4304620
+ygbL FALSE + 2861615 2862253
+yjiQ FALSE + 4567381 4567941
+pgpC FALSE - 2695937 2696572
+araB FALSE - 68348 70048
+nikB FALSE + 3613264 3614208
+cobS FALSE - 2062503 2063246
+ygiA FALSE + 3177618 3177878
+uhpC FALSE - 3845328 3846647
+ydeE FALSE + 1619356 1620543
+pdxY FALSE - 1713050 1713913
+cysE FALSE - 3779764 3780585
+tcdA FALSE - 2943058 2943864
+yafO FALSE + 252301 252699
+tdcB FALSE - 3263061 3264050
+yfcH FALSE + 2419730 2420623
+mobB FALSE - 4038929 4039456
+abgB FALSE - 1399834 1401279
+dacA FALSE - 661975 663186
+yhcC FALSE - 3351143 3352072
+ybgA FALSE + 738224 738733
+scpC FALSE + 3062824 3064302
+thiC FALSE - 4192227 4194122
+recQ FALSE + 4003887 4005716
+hslU FALSE - 4118439 4119770
+ybaY FALSE + 474603 475175
+hisI FALSE + 2094638 2095249
+ltaE FALSE - 907516 908517
+rep FALSE + 3958700 3960721
+yaeF FALSE - 216179 217003
+ddpB FALSE - 1557931 1558953
+fliK FALSE + 2016410 2017537
+sgcQ FALSE - 4526134 4526940
+gsiC FALSE + 870190 871110
+yeiR FALSE + 2265851 2266837
+talB FALSE + 8238 9191
+glk FALSE - 2506483 2507448
+deoC FALSE + 4615346 4616125
+malP FALSE - 3548102 3550495
+ynjE FALSE + 1837491 1838798
+caiB FALSE - 37898 39115
+ulaG FALSE - 4416584 4417648
+ydgA FALSE + 1687876 1689384
+pgaC FALSE - 1085744 1087069
+yfaQ FALSE - 2326170 2327819
+hsdS FALSE - 4578091 4579485
+pspE FALSE + 1367713 1368027
+rcsD FALSE + 2311510 2314182
+dcm FALSE - 2028923 2030341
+purC FALSE - 2594927 2595640
+yjfM FALSE + 4410410 4411048
+fixB FALSE + 43188 44129
+narZ FALSE - 1536874 1540614
+glrR FALSE - 2685491 2686825
+yiaV FALSE - 3750986 3752122
+mpl FALSE + 4453808 4455181
+fklB FALSE + 4426958 4427578
+proA FALSE + 260727 261980
+flu FALSE + 2069563 2072682
+sodC FALSE - 1722158 1722679
+yqcA FALSE - 2920557 2921006
+ybiY FALSE - 861835 862761
+yfcS FALSE - 2449606 2450358
+yggI FALSE + 3087777 3088274
+ydaN FALSE + 1406074 1407057
+yhdT FALSE + 3405397 3405639
+yegL FALSE - 2150493 2151152
+rdgC FALSE - 408332 409243
+ybiR FALSE + 852870 853988
+xdhC FALSE + 3001511 3001990
+ygbM FALSE + 2862258 2863034
+yahF FALSE + 336002 337549
+maeA FALSE - 1551996 1553693
+sstT FALSE + 3237966 3239210
+yzcX FALSE + 3991873 3992358
+fucK FALSE + 2935460 2936908
+yhjB FALSE - 3669315 3669917
+agaS FALSE + 3279998 3281152
+ybhF FALSE - 826468 828204
+sgrR FALSE - 75644 77299
+paaH FALSE + 1457078 1458505
+yhhX FALSE - 3577791 3578828
+yfdT FALSE + 2473895 2474200
+ysgA FALSE - 4013377 4014192
+msyB FALSE - 1113030 1113404
+speC FALSE - 3105042 3107177
+cusR FALSE - 593983 594666
+tesB FALSE - 473525 474385
+yfaW FALSE - 2358231 2359448
+intA FALSE + 2754181 2755422
+dacD FALSE - 2079405 2080571
+sucD FALSE + 763403 764272
+xthA FALSE + 1830452 1831258
+agaB FALSE + 3282192 3282668
+yddW FALSE - 1565528 1566847
+ybhP FALSE - 822959 823720
+dgoD FALSE - 3869873 3871021
+pflD FALSE + 4142018 4144315
+yqiB FALSE - 3174880 3175302
+ydhJ FALSE + 1719288 1720145
+waaL FALSE + 3794971 3796230
+ybbW FALSE + 536857 538311
+yiaN FALSE + 3742827 3744104
+marR FALSE + 1617144 1617578
+lpxP FALSE + 2493667 2494587
+fecA FALSE - 4512376 4514700
+yneF FALSE - 1608931 1609878
+trxA FALSE + 3963784 3964113
+glvB FALSE - 3860010 3860495
+dppD FALSE - 3700888 3701871
+trxC FALSE + 2716757 2717176
+ygjV FALSE - 3239215 3239766
+yehB FALSE - 2186452 2188932
+dmsA FALSE + 940182 942626
+frmB FALSE - 376759 377592
+yhiM FALSE + 3632864 3633916
+nudF FALSE - 3175303 3175932
+dgoT FALSE - 3868461 3869753
+tamB FALSE + 4442135 4445914
+yjeF FALSE + 4392089 4393636
+nfrB FALSE - 590164 592401
+yjdF FALSE - 4342952 4343581
+sucC FALSE + 762237 763403
+dgoR FALSE - 3872494 3873183
+yieH FALSE + 3894797 3895462
+ogt FALSE - 1397745 1398260
+thiI FALSE + 440773 442221
+yfiH FALSE - 2732325 2733056
+yhjJ FALSE - 3678467 3679963
+wcaD FALSE - 2127685 2128902
+fumA FALSE - 1684755 1686401
+ydcF FALSE + 1485259 1486059
+ycgV FALSE - 1252308 1255175
+yffQ FALSE + 2561599 2561991
+rutB FALSE - 1071394 1072086
+iaaA FALSE + 865791 866756
+yegH FALSE + 2135926 2137509
+fhlA FALSE + 2852360 2854438
+mdtE FALSE + 3657255 3658412
+yidJ FALSE - 3854934 3856427
+ybaE FALSE - 464836 466536
+zitB FALSE - 783105 784046
+malM FALSE + 4247577 4248497
+lysC FALSE - 4229907 4231256
+rclR FALSE + 319451 320305
+dps FALSE - 847631 848134
+yhhZ FALSE + 3579886 3581064
+atoS FALSE + 2318065 2319891
+bglH FALSE - 3898627 3900243
+nadB FALSE + 2708442 2710064
+hipA FALSE - 1588878 1590200
+sufS FALSE - 1757327 1758547
+ttcA FALSE - 1409037 1409972
+hupA FALSE + 4198304 4198576
+fecI FALSE - 4515737 4516258
+gdhA FALSE + 1840395 1841738
+glmY FALSE - 2689179 2689362
+thiG FALSE - 4189888 4190658
+yjhG FALSE - 4520150 4522117
+chiP FALSE + 707557 708963
+ycaI FALSE + 963543 965807
+yedA FALSE + 2027563 2028483
+ycgM FALSE + 1227302 1227961
+cobT FALSE - 2061412 2062491
+yraQ FALSE - 3295120 3296160
+livJ FALSE - 3596578 3597681
+yagB FALSE - 279609 279959
+trkG FALSE + 1421806 1423263
+ccmB FALSE - 2294384 2295046
+puuC FALSE + 1360767 1362254
+rtcR FALSE + 3556290 3557888
+yhhY FALSE + 3579161 3579649
+ykfF FALSE - 264528 264767
+narY FALSE - 1535333 1536877
+dauA FALSE - 1258347 1260026
+asnC FALSE - 3924568 3925026
+kptA FALSE + 4558953 4559507
+mepA FALSE - 2443582 2444406
+pykA FALSE + 1935673 1937115
+gltP FALSE + 4292504 4293817
+yheV FALSE - 3476614 3476814
+gss FALSE - 3134685 3136544
+cpsB FALSE - 2121108 2122544
+hyfA FALSE + 2599223 2599840
+ampD FALSE + 118733 119284
+adiC FALSE - 4333717 4335054
+actP FALSE - 4281276 4282925
+sppA FALSE + 1846861 1848717
+ybiW FALSE - 859397 861829
+ygaY FALSE + 2806634 2807515
+mcbR FALSE + 1518286 1518951
+amyA FALSE + 2004180 2005667
+hyfF FALSE + 2604939 2606519
+gfcE FALSE - 1043887 1045026
+ydjK FALSE - 1856874 1858253
+yaaA FALSE - 5683 6459
+recE FALSE - 1412810 1415410
+marB FALSE + 1618013 1618231
+yfaV FALSE - 2356885 2358174
+yjeJ FALSE - 4371388 4372257
+ygdG FALSE + 2928987 2929832
+otsA FALSE - 1978212 1979636
+ygdH FALSE + 2924330 2925694
+nlpA FALSE - 3837198 3838016
+hybB FALSE - 3141008 3142186
+yjhQ FALSE - 4531262 4531807
+insH-5 FALSE - 1425770 1426750
+adhE FALSE - 1294669 1297344
+ycjP FALSE + 1372114 1372956
+yagE FALSE + 281502 282410
+panF FALSE + 3405629 3407080
+ppsR FALSE + 1785469 1786302
+ydcM FALSE + 1501681 1502889
+lacZ FALSE - 362455 365529
+yehQ FALSE + 2207122 2208966
+ydcR FALSE + 1508027 1509433
+casA FALSE - 2880652 2882160
+uhpA FALSE - 3848159 3848749
+tar FALSE - 1969054 1970715
+eutE FALSE - 2568370 2569773
+recN FALSE + 2749817 2751478
+yebY FALSE - 1921389 1921730
+astB FALSE - 1824940 1826283
+agaD FALSE + 3283500 3284291
+frvB FALSE - 4088938 4090389
+nudE FALSE - 3523611 3524171
+gsiA FALSE + 866776 868614
+mutM FALSE - 3808366 3809175
+nanC FALSE - 4536808 4537524
+sseA FALSE + 2650516 2651361
+ypfN FALSE + 2590784 2590984
+endA FALSE + 3088369 3089076
+yfbL FALSE + 2383882 2384853
+yhcD FALSE + 3360829 3363210
+yegU FALSE + 2178117 2179121
+gspJ FALSE + 3460366 3460953
+entB FALSE + 626917 627774
+phoA FALSE + 400971 402386
+ynbC FALSE + 1477162 1478919
+bcsA FALSE - 3690641 3693259
+flgG FALSE + 1133952 1134734
+ptrA FALSE - 2954018 2956906
+elfC FALSE + 998439 1001039
+ydhV FALSE - 1749752 1751854
+mscS FALSE - 3066969 3067829
+speF FALSE - 717485 719683
+menD FALSE - 2375611 2377281
+cueO FALSE + 137083 138633
+yphB FALSE - 2671838 2672710
+ydbC FALSE + 1472245 1473105
+sbcB FALSE + 2080780 2082207
+aceA FALSE + 4215132 4216436
+ecnA FALSE + 4374340 4374465
+yhfX FALSE - 3507835 3508998
+aas FALSE - 2971877 2974036
+crfC FALSE + 4325158 4327386
+yciB FALSE - 1310375 1310914
+gmr FALSE - 1342781 1344766
+kdpD FALSE - 720953 723637
+yeiP FALSE + 2263472 2264044
+mglA FALSE - 2235791 2237311
+rlpA FALSE - 663325 664413
+fepG FALSE - 619419 620411
+isrB FALSE - 1985863 1986022
+ydhR FALSE + 1744724 1745029
+yeiQ FALSE + 2264267 2265733
+mdtH FALSE - 1123341 1124549
+hflC FALSE + 4401323 4402327
+malS FALSE + 3735520 3737550
+yaiX FALSE - 380068 380283
+ybcY FALSE - 581375 581959
+cheA FALSE - 1971384 1973348
+glcG FALSE - 3121849 3122253
+yqiK FALSE + 3190886 3192547
+yaiL FALSE + 375996 376535
+yihG FALSE - 4043693 4044625
+glnK FALSE + 471822 472160
+yrdD FALSE - 3429442 3429984
+argH FALSE + 4154873 4156246
+yjbI FALSE + 4248978 4250306
+trpD FALSE - 1317813 1319408
+guaD FALSE + 3023788 3025107
+mtfA FALSE + 2041675 2042472
+baeR FALSE + 2162300 2163022
+yejO FALSE - 2284412 2286922
+glnE FALSE - 3194823 3197663
+srlE FALSE + 2824414 2825373
+bepA FALSE + 2614116 2615579
+glxR FALSE + 535810 536688
+hrpB FALSE + 162105 164534
+insH-6 FALSE - 2064329 2065345
+arnT FALSE + 2368930 2370582
+yadS FALSE - 177001 177624
+dosP FALSE - 1561358 1563757
+fnr FALSE - 1396798 1397550
+ybbJ FALSE - 513625 514083
+eutR FALSE - 2552152 2553204
+yecE FALSE + 1949419 1950237
+cadA FALSE - 4354493 4356640
+nac FALSE - 2059040 2059957
+ydhT FALSE - 1746771 1747583
+lysP FALSE - 2245085 2246554
+dedA FALSE - 2432104 2432763
+yebS FALSE + 1914282 1915565
+mqsR FALSE - 3166270 3166566
+hyfB FALSE + 2599840 2601858
+rcsC FALSE - 2315049 2317850
+yjjQ FALSE + 4601500 4602225
+yqeF FALSE - 2982433 2983614
+umpG FALSE - 2867535 2868296
+ilvY FALSE - 3954950 3955843
+rsxC FALSE + 1704943 1707165
+znuA FALSE - 1939675 1940607
+yjiK FALSE - 4560766 4561734
+yfeA FALSE - 2513665 2515854
+yecS FALSE - 1995835 1996503
+yhaJ FALSE - 3251340 3252236
+bdcR FALSE + 4472147 4472740
+gudX FALSE - 2917428 2918768
+wcaK FALSE - 2115148 2116428
+tus FALSE + 1682283 1683212
+astE FALSE - 1823979 1824947
+smrA FALSE + 1404003 1404566
+yffL FALSE + 2558279 2558920
+dacB FALSE + 3326985 3328418
+artP FALSE - 902229 902957
+narJ FALSE + 1284362 1285072
+yebE FALSE - 1927072 1927731
+wecE FALSE + 3973169 3974299
+yoeI FALSE - 2085076 2085138
+yaeI FALSE - 184257 185069
+rhaS FALSE + 4095759 4096595
+yfhM FALSE - 2645348 2650309
+yhiL FALSE - 3631243 3632481
+gltI FALSE - 686062 686970
+eutN FALSE - 2569785 2570072
+ykgO FALSE - 311598 311738
+codA FALSE + 355395 356678
+mdtL FALSE + 3889638 3890813
+yedR FALSE - 2031143 2031508
+hisF FALSE + 2093868 2094644
+yfaD FALSE + 2354926 2355825
+mazE TRUE - 2909113 2909361
+potE FALSE - 716169 717488
+uvrY FALSE - 1992727 1993383
+ygfT FALSE - 3027034 3028953
+arnB FALSE + 2363932 2365089
+yhhT FALSE + 3609888 3610937
+fruK FALSE - 2259449 2260387
+panE FALSE - 442828 443739
+yqjK FALSE + 3248099 3248398
+fadD FALSE - 1886085 1887770
+aegA FALSE - 2581568 2583547
+norR FALSE - 2828797 2830311
+fadE FALSE - 240859 243303
+ycjY FALSE - 1388957 1389889
+allS FALSE - 530519 531445
+flgK FALSE + 1137601 1139244
+fhuD FALSE + 170575 171465
+proY FALSE + 420210 421583
+yciO FALSE + 1322122 1322742
+ymfL FALSE + 1202479 1203048
+ymfP FALSE + 1205483 1206145
+rihC FALSE + 27293 28207
+hyfH FALSE + 2608186 2608731
+ycaO FALSE - 954095 955855
+frvX FALSE - 4087878 4088948
+yciW FALSE - 1347004 1348131
+galP FALSE + 3086306 3087700
+hcaC FALSE + 2668930 2669250
+apbE FALSE - 2308501 2309556
+yecD FALSE + 1948856 1949422
+mdtA FALSE + 2152040 2153287
+fiu FALSE - 838472 840754
+kdpB FALSE - 724211 726259
+rsmC FALSE - 4604692 4605723
+aldA FALSE + 1486256 1487695
+rcsA FALSE + 2021992 2022615
+gltD FALSE + 3357220 3358638
+hyuA FALSE + 3008050 3009435
+ygfK FALSE + 3014082 3017180
+potF FALSE + 893007 894119
+sfmD FALSE + 558920 561523
+mdlA FALSE + 468095 469867
+yegV FALSE + 2179118 2180083
+intD FALSE - 564038 565201
+ldcC FALSE + 209679 211820
+melB FALSE + 4341392 4342813
+ccmH FALSE - 2289380 2290432
+ygeH FALSE + 2990116 2991492
+yphE FALSE - 2674872 2676383
+yiaY FALSE - 3754699 3755850
+aaeA FALSE - 3386216 3387148
+hycB FALSE - 2847260 2847871
+qseC FALSE + 3168506 3169855
+rnlA FALSE + 2763940 2765013
+lsrB FALSE + 1603075 1604097
+phnK FALSE - 4316029 4316787
+casC FALSE - 2879073 2880164
+ridA FALSE - 4468550 4468936
+yajQ FALSE + 443907 444398
+hcaF FALSE + 2668412 2668930
+crcB FALSE - 656778 657161
+hybD FALSE - 3138814 3139308
+aaeB FALSE - 3384243 3386210
+zntA FALSE + 3604474 3606672
+yaiP FALSE - 381963 383159
+yfdR FALSE + 2473006 2473542
+potH FALSE + 895357 896310
+ybdN FALSE - 634572 635792
+yjfP FALSE + 4414975 4415724
+glpG FALSE - 3558645 3559475
+tldD FALSE - 3388605 3390050
+asnB FALSE - 696736 698400
+ydjE FALSE - 1850645 1852003
+yjhI FALSE - 4523038 4523826
+ybeU FALSE + 678731 679438
+mdtQ FALSE - 2225345 2226433
+yihU FALSE - 4070698 4071594
+citC FALSE - 650021 651079
+fliE FALSE - 2010724 2011038
+ybjT FALSE - 906075 907505
+ebgA FALSE + 3220655 3223747
+ygiD FALSE - 3179641 3180456
+smf FALSE - 3430458 3431582
+nanT FALSE - 3369106 3370596
+ykfA FALSE - 267321 268184
+uvrD FALSE + 3996006 3998168
+hisP FALSE - 2421758 2422531
+miaB FALSE - 692754 694178
+yidR FALSE - 3866085 3867332
+citX FALSE - 646707 647258
+aroL FALSE + 405629 406153
+gudD FALSE - 2916067 2917407
+yedQ FALSE - 2024347 2026041
+ydcU FALSE + 1511855 1512796
+amtB FALSE + 472190 473476
+macB FALSE + 919570 921516
+kch FALSE - 1307040 1308293
+tqsA FALSE + 1671937 1672971
+sodB FALSE + 1733402 1733983
+afuB FALSE - 278038 278400
+mscM FALSE - 4384070 4387393
+yfhH FALSE + 2696781 2697629
+chbF FALSE - 1815172 1816524
+yadE FALSE + 145081 146310
+yicJ FALSE - 3832570 3833952
+opgD FALSE + 1494880 1496535
+rtcB FALSE - 3554875 3556101
+yagG TRUE + 284619 286001
+yiaK FALSE + 3740756 3741754
+entE FALSE + 625293 626903
+rutC FALSE - 1070996 1071382
+allC FALSE - 543281 544516
+rmuC FALSE + 4015356 4016783
+tdcC FALSE - 3261708 3263039
+wcaI FALSE - 2122547 2123770
+cpdB FALSE - 4432645 4434588
+fliD FALSE + 2001896 2003302
+artI FALSE - 901480 902211
+yehR FALSE + 2209247 2209708
+rraB FALSE + 4476496 4476912
+dcp FALSE - 1623359 1625404
+bcsC FALSE - 3683723 3687196
+lamB FALSE + 4245994 4247334
+ygjR FALSE + 3235315 3236319
+ycjG FALSE + 1386954 1387919
+gabT FALSE + 2790757 2792037
+bioB FALSE + 808567 809607
+eutT FALSE - 2571524 2572327
+hybO FALSE - 3143165 3144283
+dcrB FALSE + 3607978 3608535
+phnP FALSE - 4312367 4313125
+ybdK FALSE - 605488 606606
+tap FALSE - 1967407 1969008
+ydcT FALSE + 1510841 1511854
+yhfA FALSE - 3483436 3483840
+yafZ FALSE - 266408 267229
+ycaN FALSE - 947883 948791
+yiaG FALSE + 3717501 3717791
+rlmB FALSE + 4407298 4408029
+alaC FALSE - 2495079 2496317
+cstA FALSE + 629117 631222
+glgA FALSE - 3564623 3566056
+uacT FALSE + 3029389 3030837
+yedF FALSE + 2007503 2007736
+ldtC FALSE - 1168635 1169597
+yceI FALSE - 1117124 1117699
+yiaO FALSE + 3744117 3745103
+ykfG FALSE - 263480 263956
+ytfE FALSE - 4429344 4430006
+paoB FALSE - 300155 301111
+ydcI FALSE - 1492172 1493095
+emrD FALSE + 3851945 3853129
+proB FALSE + 259612 260715
+mipA FALSE - 1863750 1864496
+yafW FALSE - 262914 263231
+alx FALSE + 3236602 3237567
+ycbX FALSE - 1005714 1006823
+torA FALSE + 1058479 1061025
+raiA FALSE + 2735176 2735517
+narX FALSE - 1275045 1276841
+mhpD FALSE + 371339 372148
+gcl FALSE + 533140 534921
+yjcZ FALSE + 4327383 4328261
+dpiB FALSE + 651458 653116
+flgL FALSE + 1139256 1140209
+allE FALSE - 542485 543270
+rbbA FALSE - 3624826 3627561
+ddpD FALSE - 1556055 1557041
+paaF FALSE + 1455521 1456288
+yliE FALSE + 872202 874550
+yiiS FALSE + 4110990 4111289
+yghB FALSE + 3151585 3152244
+aqpZ FALSE - 914575 915270
+rsxB FALSE + 1704372 1704950
+lldP FALSE + 3775422 3777077
+yjjJ FALSE + 4619792 4621123
+elbB FALSE - 3347828 3348481
+ygbJ FALSE + 2859452 2860360
+nadA FALSE + 781308 782351
+bcr FALSE - 2276592 2277782
+fadH FALSE + 3229687 3231705
+yciN FALSE - 1328441 1328692
+ytfQ FALSE + 4447985 4448941
+rutG FALSE - 1067734 1069062
+creC FALSE + 4634719 4636143
+yiaT FALSE - 3749151 3749891
+metH FALSE + 4221851 4225534
+yghO FALSE - 3127065 3128237
+rlmD FALSE - 2911721 2913022
+rph FALSE - 3813886 3814572
+kduI FALSE - 2981310 2982146
+acrF FALSE + 3413055 3416159
+yccM FALSE - 1051512 1052585
+yihR FALSE - 4067498 4068424
+sufC FALSE - 1759790 1760536
+mdtN FALSE - 4301101 4302132
+yigL FALSE + 4008223 4009023
+ybcQ FALSE + 573179 573562
+phnM FALSE - 4314105 4315241
+yajO FALSE - 436385 437359
+mgtA FALSE + 4465648 4468344
+modA FALSE + 794312 795085
+napA FALSE - 2298289 2300775
+nrfC FALSE + 4287831 4288502
+azoR FALSE - 1480279 1480884
+ybgL FALSE + 744388 745122
+eutD FALSE - 2570511 2571527
+argP FALSE + 3057775 3058668
+nth FALSE + 1709547 1710182
+hyfR FALSE + 2609922 2611934
+rhtA FALSE - 848433 849320
+dhaK FALSE - 1248991 1250061
+yfjZ FALSE + 2775137 2775454
+mlaA FALSE - 2462274 2463029
+yjfN FALSE - 4414040 4414315
+fbaB FALSE - 2175534 2176586
+yfjS FALSE + 2768703 2769146
+yafL FALSE + 246712 247461
+proP FALSE + 4328525 4330027
+ygbA FALSE - 2854475 2854828
+gfcC FALSE - 1047168 1047914
+atoC FALSE + 2319888 2321273
+ydjA FALSE - 1846149 1846700
+lldR FALSE + 3777077 3777853
+intE FALSE - 1198902 1200029
+ilvN FALSE - 3848825 3849115
+chaC FALSE + 1271709 1272425
+ydeQ FALSE - 1584844 1585758
+slt FALSE + 4628756 4630693
+yncE FALSE + 1521331 1522392
+alsA FALSE - 4307471 4309003
+amn FALSE + 2053085 2054539
+tnaA FALSE + 3886753 3888168
+leuC FALSE - 79464 80864
+cusA FALSE + 597937 601080
+yjhU FALSE - 4517361 4518347
+pflC FALSE + 4144281 4145159
+entS FALSE + 621523 622773
+ybbN FALSE - 516649 517503
+yafJ FALSE + 244327 245094
+yebQ FALSE + 1908300 1909673
+yihO FALSE - 4062386 4063789
+tyrB FALSE + 4265137 4266330
+ynjI FALSE - 1841855 1842895
+ydiS FALSE + 1779419 1780708
+mutT FALSE + 111044 111433
+yajI FALSE - 431536 432075
+ybfA FALSE + 728357 728563
+ypjD FALSE + 2745909 2746775
+adeP FALSE - 3893295 3894632
+bcsZ FALSE - 3687178 3688284
+cvrA FALSE - 1239558 1241294
+mrr FALSE + 4584972 4585886
+etk FALSE - 1041253 1043433
+cycA FALSE + 4427887 4429299
+betT FALSE + 328687 330720
+ggt FALSE - 3583104 3584846
+ybiO FALSE - 842478 844703
+osmC FALSE + 1554649 1555080
+uspA FALSE + 3638134 3638568
+yicR FALSE - 3809914 3810582
+chiA FALSE - 3465182 3467875
+yohJ FALSE + 2228646 2229044
+tonB FALSE + 1309113 1309832
+ybeF FALSE - 659648 660601
+yoeF FALSE + 2076599 2076955
+rffG FALSE + 3970545 3971612
+hybE FALSE - 3138333 3138821
+acpT FALSE + 3610992 3611579
+hdfR FALSE - 3945151 3945990
+mdtC FALSE + 2156410 2159487
+treF FALSE + 3667615 3669264
+yebF FALSE - 1928058 1928414
+znuB FALSE + 1941438 1942223
+hycG FALSE - 2841465 2842232
+dppA FALSE - 3704121 3705728
+fliF FALSE + 2011253 2012911
+pepE FALSE - 4227476 4228165
+djlB FALSE + 676638 678065
+fimD FALSE + 4543119 4545755
+xanP FALSE + 3826968 3828359
+bhsA FALSE + 1168296 1168553
+trmI FALSE - 3100155 3100874
+yraI FALSE + 3286112 3286807
+prpB FALSE + 347906 348796
+yfcG FALSE + 2418643 2419290
+opgE FALSE - 850237 851820
+insO-1 FALSE + 271054 271479
+hypE FALSE + 2851318 2852286
+garD FALSE + 3273304 3274875
+yjjP FALSE - 4600111 4600881
+yfjQ FALSE + 2766687 2767508
+dsbD FALSE - 4361368 4363065
+glgB FALSE - 3569339 3571525
+yjcC FALSE + 4273494 4275080
+yagI FALSE - 287628 288386
+yjeT FALSE + 4402409 4402606
+yoaD FALSE + 1896451 1898049
+yffP FALSE + 2560546 2561139
+ydeI FALSE - 1622129 1622521
+ygfF FALSE - 3043180 3043923
+rhaB FALSE - 4094002 4095471
+cheB FALSE - 1965476 1966525
+ygiW FALSE - 3167306 3167698
+yeaN FALSE + 1873697 1874878
+iraD FALSE + 4555016 4555408
+tatE FALSE + 658170 658373
+mazG FALSE - 2907916 2908707
+ybaK FALSE - 505827 506306
+ugpE FALSE - 3587205 3588050
+araG FALSE - 1981579 1983093
+yidF FALSE - 3853137 3853634
+cbrA FALSE + 3867400 3868464
+fumC FALSE - 1683209 1684612
+ygbN FALSE + 2863123 2864487
+marC FALSE - 1616267 1616932
+yedL FALSE + 2008624 2009103
+yfcE FALSE - 2417256 2417810
+mdlB FALSE + 469860 471641
+metC FALSE + 3150258 3151445
+yfcT FALSE - 2450378 2451274
+cutA FALSE - 4363041 4363379
+ycjD FALSE - 1349431 1349784
+birA TRUE + 4171105 4172070
+yniB FALSE - 1806721 1807257
+brnQ FALSE + 418815 420134
+psuG FALSE - 2255451 2256389
+menF FALSE - 2377370 2378665
+cpxA FALSE - 4101625 4102998
+fepC FALSE - 618607 619422
+uxuB FALSE + 4550924 4552384
+envY FALSE - 585370 586131
+scpA FALSE + 3058872 3061016
+cspA FALSE + 3718072 3718284
+zapC FALSE + 1005175 1005717
+kdgT FALSE + 4099713 4100696
+nrdE FALSE + 2799370 2801514
+ybgS FALSE - 784160 784540
+aspA FALSE - 4364914 4366350
+rfe FALSE + 3965939 3967042
+rutE FALSE - 1069588 1070178
+yfhG FALSE - 2686815 2687528
+envR FALSE - 3410825 3411487
+cysQ FALSE + 4434778 4435518
+yicG FALSE + 3816897 3817514
+cdaR FALSE + 182463 183620
+glpA FALSE + 2350669 2352297
+yhjE FALSE + 3672809 3674131
+gspC FALSE + 3453600 3454415
+ynfM FALSE + 1667723 1668976
+ybaP FALSE - 506510 507304
+gadW FALSE - 3661913 3662641
+ybhK FALSE - 814962 815870
+yrbL FALSE + 3346474 3347106
+flhB FALSE - 1963067 1964215
+xylB FALSE - 3725940 3727394
+rstA FALSE + 1680174 1680902
+yegT FALSE + 2176843 2178120
+yceF FALSE - 1145234 1145818
+cas2 FALSE - 2876591 2876875
+yehW FALSE - 2213767 2214498
+rluF FALSE + 4228377 4229249
+rhaM FALSE - 4091147 4091461
+murQ FALSE + 2543795 2544691
+ybhD FALSE - 798845 799861
+yraR FALSE - 3296233 3296868
+yahA FALSE + 331595 332683
+ydiM FALSE + 1769095 1770309
+ybdH FALSE - 631612 632700
+purL FALSE - 2689678 2693565
+purF FALSE - 2426743 2428260
+hisM FALSE - 2422539 2423255
+gabP FALSE + 2792275 2793675
+bax FALSE - 3734376 3735200
+yiaF FALSE - 3716357 3717067
+ybgQ FALSE - 748945 751392
+topB FALSE - 1843023 1844984
+csgA FALSE + 1103670 1104125
+pldB FALSE + 4007193 4008215
+yaaW FALSE - 10643 11356
+glnH FALSE - 846481 847227
+ydfH FALSE + 1626376 1627062
+eutB FALSE - 2555340 2556701
+yjcF FALSE - 4279806 4281098
+thrA FALSE + 337 2799
+aslA FALSE - 3982375 3984030
+nfo FALSE + 2248862 2249719
+ompL FALSE - 4061626 4062318
+pqiA FALSE + 1011224 1012477
+cusC FALSE + 594823 596196
+rbsD FALSE + 3931374 3931793
+yhdZ FALSE + 3420458 3421216
+ldhA FALSE - 1439878 1440867
+lplT FALSE - 2970691 2971884
+glnQ FALSE - 844964 845686
+hyaB FALSE + 1032477 1034270
+rhlE FALSE + 830095 831459
+bacA FALSE - 3201332 3202153
+acs FALSE - 4283436 4285394
+hemF FALSE + 2551247 2552146
+yqiI FALSE + 3188654 3189718
+xdhA FALSE + 2998367 3000625
+ada FALSE - 2307363 2308427
+yihN FALSE + 4060270 4061535
+yagJ FALSE + 290724 291455
+ynfA FALSE - 1653371 1653697
+umuC FALSE + 1230409 1231677
+csgG FALSE - 1100074 1100907
+wcaL FALSE - 2113931 2115151
+yacG FALSE - 111649 111846
+eptC FALSE - 4146555 4148288
+mhpF FALSE + 372145 373095
+dgcZ FALSE - 1620984 1621874
+ycaM FALSE + 946452 947882
+pbpC FALSE - 2643035 2645347
+oppB FALSE + 1300923 1301843
+pqiB FALSE + 1012482 1014122
+bioA FALSE - 807191 808480
+rihA FALSE - 682700 683635
+tauA FALSE + 384456 385418
+yhfW FALSE - 3506609 3507835
+yiaA FALSE - 3724947 3725384
+aat FALSE - 925951 926655
+gpmA FALSE - 786066 786818
+aes FALSE - 498238 499197
+kdpA FALSE - 726282 727955
+hycF FALSE - 2842232 2842774
+hokE FALSE + 607059 607211
+gph FALSE - 3511653 3512411
+sgcB FALSE - 4528278 4528556
+acnA FALSE + 1333855 1336530
+dinI FALSE - 1120465 1120710
+ilvH FALSE + 87357 87848
+yifB FALSE - 3946472 3948022
+fxsA FALSE + 4366687 4367163
+ybcL FALSE + 570116 570667
+coaE TRUE - 112599 113219
+alr FALSE + 4263805 4264884
+ydhQ FALSE - 1742895 1744151
+tehB FALSE + 1499586 1500179
+yjgL FALSE + 4473460 4475274
+arcB FALSE - 3348711 3351047
+yjbG FALSE + 4234920 4235657
+nfrA FALSE - 587205 590177
+mug FALSE - 3212989 3213495
+yfcU FALSE - 2451287 2453023
+gntX FALSE + 3542904 3543587
+paaK FALSE + 1460149 1461462
+nhaA FALSE + 17489 18655
+yeiB FALSE - 2239832 2240989
+cbpA FALSE - 1062078 1062998
+ydeU FALSE - 1590689 1592089
+ybbB FALSE - 529356 530450
+yfgG FALSE + 2627312 2627503
+mhpE FALSE + 373092 374105
+yjiS FALSE + 4569774 4569938
+ygbK FALSE + 2860357 2861523
+ybiB FALSE + 834471 835433
+bglX FALSE - 2217714 2220011
+ydfE FALSE + 1648102 1649022
+metA FALSE + 4212303 4213232
+hybF FALSE - 3137999 3138340
+fucP FALSE + 2932257 2933573
+ybhH FALSE + 799982 801034
+yeeR FALSE + 2072803 2074335
+fadB FALSE - 4026805 4028994
+mngB FALSE + 767201 769834
+cusS FALSE - 592551 593993
+poxB FALSE - 908554 910272
+yjjB FALSE - 4599647 4599973
+yeiG FALSE + 2241932 2242768
+mdaB FALSE + 3170552 3171133
+ycdX FALSE + 1098102 1098839
+ushA FALSE + 504138 505790
+yhcA FALSE + 3360134 3360808
+frdD FALSE - 4377030 4377389
+yfjT FALSE + 2769170 2769637
+yidK FALSE - 3856424 3858139
+ytfR FALSE + 4449081 4450583
+yiaL FALSE + 3741766 3742233
+rclA FALSE - 317900 319225
+astD FALSE - 1826280 1827758
+yjjI FALSE - 4613538 4615088
+ryeA FALSE + 1921090 1921338
+ybgK FALSE + 743466 744398
+artM FALSE - 900089 900757
+yibH FALSE - 3768266 3769402
+maeB FALSE - 2574120 2576399
+yahB FALSE - 332725 333657
+flgA FALSE - 1129427 1130086
+acrE FALSE + 3411886 3413043
+amiD FALSE + 904136 904966
+plaP FALSE - 2083728 2085086
+setC FALSE + 3834976 3836160
+nrfD FALSE + 4288499 4289455
+yfdG FALSE + 2465877 2466239
+hyfC FALSE + 2601869 2602816
+ettA FALSE - 4626878 4628545
+slmA FALSE + 3812517 3813113
+mdtO FALSE - 4299050 4301101
+nhoA FALSE + 1532048 1532893
+yphH FALSE + 2680885 2682078
+rffH FALSE + 3971631 3972512
+dacC FALSE + 879950 881152
+nanA FALSE - 3370705 3371598
+yehE FALSE - 2190537 2190818
+hisL FALSE + 2088020 2088070
+glgX FALSE - 3567369 3569342
+ynfC FALSE - 1654771 1655481
+yeaJ FALSE + 1870065 1871555
+yahI FALSE + 339389 340339
+ykgN FALSE - 279248 279586
+qor FALSE - 4261271 4262254
+cysJ FALSE - 2888121 2889920
+mhpA FALSE + 367835 369499
+rcsB FALSE + 2314199 2314849
+fes FALSE + 612038 613162
+feaB FALSE + 1445543 1447042
+ugpQ FALSE - 3585393 3586136
+mmuM FALSE + 275939 276871
+glcF FALSE - 3122258 3123481
+yeiI FALSE + 2249722 2250810
+eptA FALSE - 4331970 4333613
+cof FALSE + 466636 467454
+ryjB FALSE + 4526000 4526089
+yoeA FALSE + 2066659 2067051
+cdh FALSE + 4107953 4108708
+rcnB FALSE + 2184982 2185320
+yijF FALSE - 4135063 4135680
+yihF FALSE + 4042222 4043652
+ligA TRUE - 2526183 2528198
+rna FALSE - 643420 644226
+rffC FALSE + 3972619 3973164
+phnE_1 FALSE - 4320684 4321304
+yahJ FALSE + 340349 341731
+polB FALSE - 63429 65780
+ydfU FALSE - 1641279 1642328
+xdhD FALSE + 3019338 3022208
+yjjX FALSE - 4631256 4631768
+yheS FALSE + 3479311 3481224
+yehS FALSE - 2209748 2210218
+ycjN FALSE + 1369933 1371225
+gsk FALSE + 499349 500653
+nemA FALSE + 1724683 1725780
+cho FALSE + 1821539 1822426
+ynaI FALSE - 1392915 1393946
+truC FALSE - 2921024 2921806
+ydbJ FALSE + 1439082 1439348
+eco FALSE + 2301927 2302415
+ulaF FALSE + 4421723 4422409
+insG FALSE - 4500126 4501454
+ymfD FALSE - 1196090 1196755
+amiB FALSE + 4394088 4395425
+nlpD FALSE - 2865636 2866775
+ldtE FALSE - 1755745 1756749
+G0-10701 FALSE + 3065209 3065366
+yecT FALSE + 1959996 1960484
+gsiD FALSE + 871113 872024
+ftnB FALSE + 1984949 1985452
+malX FALSE + 1697379 1698971
+ygfM FALSE + 3018562 3019341
+yejF FALSE + 2274322 2275911
+phoP FALSE - 1188999 1189670
+kdgK FALSE + 3677442 3678371
+gudP FALSE - 2918770 2920122
+pmbA FALSE + 4455982 4457334
+sgbU FALSE + 3747255 3748115
+yggE FALSE - 3065362 3066102
+atoB FALSE + 2324131 2325315
+hisC FALSE + 2090422 2091492
+ykgF FALSE + 321562 322989
+nrfA FALSE + 4285787 4287223
+ldtA FALSE - 2060415 2061347
+ddpX FALSE - 1560519 1561100
+sbp FALSE + 4106857 4107846
+fetA FALSE + 515143 515820
+rluE FALSE - 1193521 1194174
+mntR FALSE + 852406 852873
+yehX FALSE - 2214503 2215429
+solA FALSE - 1118691 1119809
+nirC FALSE + 3495025 3495831
+elfD FALSE + 997713 998414
+uidA FALSE - 1692284 1694095
+ygcW FALSE - 2897510 2898295
+uidC FALSE - 1689610 1690875
+adeQ FALSE - 3840478 3841812
+zraP FALSE - 4199286 4199711
+hycC FALSE - 2845437 2847263
+torZ FALSE - 1952602 1955031
+yhhW FALSE - 3576973 3577668
+dinB FALSE + 250898 251953
+cfa FALSE + 1739437 1740585
+allD FALSE - 544538 545587
+rclC FALSE - 316950 317543
+yaaI FALSE - 11382 11786
+yihL FALSE + 4058470 4059180
+ymdF FALSE + 1067304 1067477
+yggR FALSE - 3092122 3093102
+cynR FALSE - 357015 357914
+ycjW FALSE - 1380987 1381985
+yghZ FALSE + 3145919 3146959
+gltF FALSE + 3359198 3359962
+efeB FALSE + 1082599 1083870
+eda FALSE - 1930139 1930780
+fau FALSE + 3054263 3054811
+yjcE FALSE + 4278003 4279652
+sdiA FALSE - 1994134 1994856
+phoQ FALSE - 1187539 1188999
+srlD FALSE + 2825759 2826538
+puuB FALSE + 1362256 1363536
+yeeA FALSE - 2077557 2078615
+mepM FALSE - 1938337 1939659
+glpE FALSE - 3559520 3559846
+yhdJ FALSE + 3409675 3410559
+mutH FALSE + 2967684 2968373
+ydhU FALSE - 1747587 1748372
+yiiE FALSE + 4077314 4077532
+hyfE FALSE + 2604284 2604934
+kdpC FALSE - 723630 724202
+yhbU FALSE + 3299507 3300502
+yfcJ FALSE - 2436964 2438142
+lldD FALSE + 3777850 3779040
+ypdE FALSE - 2502532 2503569
+ymiA FALSE + 1333184 1333312
+sfsA FALSE - 160782 161486
+cas3 FALSE - 2882575 2885241
+pphB FALSE + 2857782 2858438
+dcyD FALSE - 1996518 1997504
+mliC FALSE - 1716090 1716419
+paaA FALSE + 1451951 1452880
+yjgW FALSE + 4497622 4497957
+creD FALSE + 4636201 4637553
+frvR FALSE - 4086130 4087878
+ratB FALSE - 2752030 2752320
+yaiT FALSE + 389475 390935
+elfG FALSE + 1001030 1002100
+ykgH FALSE - 323920 324588
+psiF FALSE + 402505 402825
+paaI FALSE + 1458495 1458917
+arnC FALSE + 2365093 2366061
+yqjH FALSE - 3213749 3214513
+ldtB FALSE - 854047 854967
+udk FALSE - 2140331 2140972
+yqeH FALSE + 2985558 2986190
+phnD FALSE - 4321359 4322375
+nagE FALSE + 703167 705113
+basR FALSE - 4331305 4331973
+uhpB FALSE - 3846657 3848159
+yedJ FALSE - 2030408 2031103
+hofQ FALSE - 3517487 3518725
+yciA FALSE - 1309872 1310270
+ypjK FALSE + 2768467 2768703
+ygdQ FALSE + 2968442 2969155
+gadX FALSE - 3663009 3663833
+fliR FALSE + 2020917 2021702
+nudK FALSE - 2580925 2581500
+yzgL FALSE - 3561747 3562028
+fieF FALSE + 4104492 4105394
+yghQ FALSE - 3129363 3130430
+gnd FALSE - 2097886 2099292
+lplA FALSE - 4621124 4622140
+hybG FALSE - 3137738 3137986
+yhgN FALSE + 3573094 3573687
+ytfT FALSE + 4450597 4451619
+pyrI FALSE - 4469009 4469470
+iadA FALSE - 4556377 4557549
+rffM FALSE + 3977979 3978719
+maa FALSE - 478591 479142
+yedK FALSE + 2007845 2008513
+modC FALSE + 795777 796835
+ygfZ FALSE + 3039335 3040315
+fdnH FALSE + 1548485 1549369
+yihV FALSE + 4071762 4072658
+ygaP FALSE + 2795542 2796066
+yjbD FALSE - 4229382 4229654
+helD FALSE + 1023694 1025748
+bioC FALSE + 810745 811500
+recD FALSE - 2948657 2950483
+insA-7 FALSE + 4516550 4516825
+yffO FALSE + 2560133 2560549
+bcsE FALSE + 3694481 3696052
+yehP FALSE + 2205989 2207125
+rfbB FALSE - 2110000 2111085
+gsiB FALSE + 868634 870172
+gcd FALSE - 138835 141225
+ybjJ FALSE - 885354 886562
+ydjX FALSE + 1831425 1832135
+stfR FALSE + 1427073 1430435
+djlA FALSE + 57364 58179
+ampH FALSE - 394354 395511
+cysB FALSE + 1331879 1332853
+nikR FALSE + 3616611 3617012
+gpmM FALSE + 3783283 3784827
+yfcO FALSE - 2447250 2448071
+malG FALSE - 4240649 4241539
+tfaD FALSE + 580757 581320
+ykfC FALSE + 272071 273216
+ybbO FALSE - 517564 518373
+ilvA FALSE + 3953354 3954898
+ybeT FALSE - 678075 678629
+ydhY FALSE - 1751875 1752501
+nagK FALSE + 1177816 1178727
+fepD FALSE - 620408 621412
+ypjF FALSE + 2775475 2775804
+mngA FALSE + 765207 767183
+yncD FALSE - 1518987 1521089
+gloA FALSE + 1725861 1726268
+queG FALSE - 4390951 4392090
+renD FALSE + 567285 567470
+sbcC FALSE - 411831 414977
+gmd FALSE - 2125217 2126338
+fliY FALSE - 1997609 1998409
+atoE FALSE + 2322778 2324100
+ydaY FALSE + 1423645 1424004
+flgE FALSE + 1131797 1133005
+yfhL FALSE + 2697685 2697945
+ydeN FALSE - 1578866 1580548
+yciI FALSE - 1308593 1308889
+hcaE FALSE + 2667054 2668415
+ymfK TRUE - 1201482 1202156
+ymfI FALSE + 1200720 1201061
+ynjB FALSE + 1834097 1835263
+ftsP FALSE - 3159279 3160691
+ssuE FALSE - 996160 996735
+ylaB FALSE - 476291 477841
+cytR FALSE - 4121454 4122479
+elaA FALSE - 2379104 2379565
+lrp FALSE + 931818 932312
+ascG FALSE - 2836276 2837286
+ydeO FALSE - 1580950 1581711
+hyaC FALSE + 1034289 1034996
+yqaB FALSE - 2814959 2815525
+yjhB FALSE + 4502081 4503298
+menI FALSE - 1763246 1763656
+flhE FALSE - 1960604 1960996
+yejK FALSE - 2280962 2281969
+nei FALSE + 745158 745949
+focA FALSE - 952832 953689
+speG FALSE + 1654208 1654768
+xdhB FALSE + 3000636 3001514
+uxuA FALSE + 4549659 4550843
+ompW FALSE + 1312044 1312682
+ppiD FALSE + 461139 463010
+yihY FALSE + 4074169 4075041
+tag FALSE + 3711115 3711678
+glpX FALSE - 4112592 4113602
+yciZ FALSE - 1342460 1342633
+smg FALSE - 3430013 3430486
+dcuC FALSE - 653806 655191
+aceK FALSE + 4216619 4218355
+ycjQ FALSE + 1372987 1374039
+fepE FALSE + 617477 618610
+ydaW FALSE + 1420776 1421336
+rhaA FALSE - 4092746 4094005
+bsmA FALSE - 4414464 4414793
+yaeQ FALSE + 214291 214836
+mhpC FALSE + 370463 371329
+ssuC FALSE - 993264 994055
+queF FALSE + 2923370 2924218
+pabA FALSE - 3488288 3488851
+yccU FALSE + 1027169 1027582
+ygiN FALSE + 3171164 3171478
+ydgH FALSE + 1676451 1677395
+mutY FALSE + 3101035 3102087
+dosC FALSE - 1563782 1565164
+pdxK FALSE - 2534408 2535259
+prlF FALSE + 3275024 3275359
+emrE FALSE + 567538 567870
+yfcL FALSE - 2441913 2442191
+ybaV FALSE + 463161 463532
+yibL FALSE + 3774688 3775050
+vsr FALSE - 2028472 2028942
+yfeW FALSE + 2546124 2547428
+argK FALSE + 3061009 3062004
+ybaN FALSE + 490106 490483
+cas1 FALSE - 2876877 2877794
+holE FALSE + 1923132 1923362
+aphA FALSE + 4267437 4268150
+narK FALSE + 1277180 1278571
+sfmH FALSE + 561565 562542
+caiA FALSE - 39244 40386
+ygaU FALSE - 2794359 2794808
+sgcE FALSE - 4524928 4525560
+yfiL FALSE + 2739382 2739747
+ydjL FALSE - 1858280 1859356
+araA FALSE - 66835 68337
+recJ FALSE - 3034395 3036128
+gfcA FALSE - 1048662 1048967
+fliJ FALSE + 2015970 2016413
+arnA FALSE + 2366061 2368043
+hscC FALSE - 680946 682616
+ykgJ FALSE - 303077 303406
+ybdF FALSE - 604741 605109
+ompG FALSE + 1379971 1380876
+eptB FALSE - 3706807 3708498
+C0293 FALSE + 1195937 1196009
+napC FALSE - 2295679 2296281
+yfiC FALSE - 2710049 2710786
+yjfK FALSE + 4409325 4409984
+oppD FALSE + 1302778 1303791
+yhaC FALSE + 3266437 3267624
+mdtP FALSE - 4297587 4299053
+ygiQ FALSE - 3156949 3159168
+yegI FALSE - 2147063 2149009
+sulA FALSE - 1019633 1020142
+yedD FALSE - 2005701 2006114
+eutL FALSE - 2553763 2554422
+panB FALSE - 148807 149601
+rutD FALSE - 1070188 1070988
+phoE FALSE - 258269 259324
+mdtD FALSE + 2159488 2160903
+cbpM FALSE - 1061773 1062078
+ykgA FALSE - 315674 316360
+flgJ FALSE + 1136594 1137535
+cobB FALSE + 1178743 1179582
+yjcO FALSE - 4294459 4295148
+pfkB FALSE + 1804394 1805323
+yddH FALSE - 1531306 1531875
+comR FALSE - 1167423 1168055
+uraA FALSE - 2616893 2618182
+yfjH FALSE - 2755666 2756622
+gatY FALSE - 2174372 2175226
+hcaD FALSE + 2670069 2671271
+yneK FALSE + 1613787 1614902
+ydfO FALSE + 1635071 1635481
+evgS FALSE + 2482396 2485989
+yagK FALSE - 291546 292172
+slp FALSE + 3651984 3652550
+uspF FALSE - 1433209 1433643
+gloB FALSE - 234027 234782
+mcbA FALSE - 841019 841279
+zraS FALSE + 4199949 4201346
+yhhM FALSE - 3603274 3603633
+yjgR FALSE - 4486584 4488086
+yfdS FALSE + 2473533 2473895
+intB FALSE + 4494773 4495963
+ebgC FALSE + 3223744 3224193
+ygfS FALSE - 3026546 3027034
+npr FALSE + 3345988 3346260
+yhcG FALSE + 3365849 3366976
+ybdL FALSE + 632809 633969
+lgoT FALSE - 4591384 4592745
+argB FALSE + 4154039 4154812
+codB FALSE + 354146 355405
+sdaC FALSE + 2926251 2927540
+ybhJ FALSE + 802726 804987
+sufA FALSE - 1762042 1762410
+ampC FALSE - 4375834 4376967
+dadA FALSE + 1236794 1238092
+rfbD FALSE - 2109101 2110000
+ung FALSE + 2714776 2715465
+dinD FALSE + 3815783 3816607
+casE FALSE - 2877810 2878409
+purE FALSE - 551814 552323
+hypD FALSE + 2850158 2851279
+efeO FALSE + 1081466 1082593
+yghD FALSE - 3108612 3109148
+frdC FALSE - 4377400 4377795
+yecJ FALSE - 1985531 1985782
+tam FALSE + 1605370 1606128
+ybiC FALSE + 835574 836659
+yghA FALSE + 3147684 3148568
+ygiH FALSE + 3202716 3203333
+yacC FALSE - 136570 136917
+yeeX FALSE - 2077056 2077385
+ymgE FALSE + 1243951 1244205
+IS128 FALSE + 2651537 2651745
+rhaT FALSE - 4097514 4098548
+ynaA FALSE + 1424478 1425506
+hisH FALSE + 2092559 2093149
+flgB FALSE + 1130241 1130657
+waaZ FALSE - 3797368 3798219
+wzc FALSE - 2131514 2133676
+fhuF FALSE - 4602898 4603686
+kefC FALSE + 47769 49631
+idnK FALSE + 4492646 4493209
+yhaO FALSE - 3254701 3255969
+gmm FALSE - 2123767 2124246
+mmuP FALSE + 274549 275952
+yfgO FALSE - 2612842 2613903
+yggM FALSE - 3096580 3097587
+ybdG FALSE - 602639 603886
+lomR_1 FALSE + 1425482 1425637
+yfcF FALSE - 2417863 2418507
+thiQ FALSE - 72229 72927
+mltD FALSE - 232597 233955
+ydjZ FALSE + 1832832 1833539
+ybaM FALSE - 489334 489495
+recG FALSE + 3823233 3825314
+yoaC FALSE + 1892097 1892456
+hycA FALSE - 2847996 2848457
+ypeB FALSE - 2525963 2526181
+frvA FALSE - 4090400 4090846
+ydhZ FALSE - 1752956 1753165
+nlpE FALSE + 215269 215979
+yqiG FALSE + 3185422 3187887
+rbsC FALSE + 3933311 3934276
+yciC FALSE - 1310944 1311687
+hycH FALSE - 2841058 2841468
+qseB FALSE + 3167850 3168509
+ybeR FALSE + 675934 676641
+yibT FALSE - 3774194 3774403
+metB FALSE + 4126695 4127855
+pnuC FALSE + 782389 783108
+wecH FALSE + 3723910 3724905
+pntB FALSE - 1672996 1674384
+curA FALSE + 1517051 1518088
+yddB FALSE - 1573271 1575643
+fruB FALSE - 2260387 2261517
+glcC FALSE + 3126294 3127058
+tatD FALSE + 4021577 4022359
+yqhC FALSE - 3152284 3153240
+amiA FALSE + 2550374 2551243
+yiaC FALSE + 3711675 3712115
+ycaL FALSE + 959487 960251
+glvC FALSE - 3860520 3861626
+ygeW FALSE + 3004284 3005474
+ybbA FALSE + 518957 519643
+gadY FALSE + 3662887 3662991
+yjgH FALSE - 4470837 4471232
+frwD FALSE + 4145161 4145502
+yfdX FALSE - 2491789 2492424
+yhdW FALSE + 3417171 3418088
+fucA FALSE - 2931063 2931710
+flgH FALSE + 1134787 1135485
+ybgD FALSE - 751452 752018
+tabA FALSE + 4472885 4473337
+yidH FALSE - 3853983 3854330
+rfbX FALSE - 2106361 2107608
+alsE FALSE - 4305806 4306501
+ybcC FALSE - 565321 565584
+ygaC FALSE - 2797672 2798016
+yiaU FALSE + 3750015 3750989
+ydfI FALSE - 1627477 1628937
+ygiC FALSE + 3178443 3179603
+nagB FALSE - 702034 702834
+bamC FALSE - 2595853 2596887
+metL FALSE + 4127858 4130290
+ybaA FALSE + 475896 476249
+yfcC FALSE + 2415103 2416623
+wcaB FALSE - 2130091 2130579
+mngR FALSE - 764376 765098
+ynbD FALSE + 1478933 1480225
+yjbM FALSE + 4258622 4259329
+yeeE FALSE - 2082491 2083549
+modF FALSE - 791539 793011
+nikD FALSE + 3615038 3615802
+yidL FALSE + 3858276 3859199
+yfdV FALSE - 2487264 2488208
+xanQ FALSE + 3022373 3023773
+yqhG FALSE + 3155672 3156598
+garL FALSE - 3270809 3271579
+tomB FALSE - 479558 479932
+napB FALSE - 2296291 2296740
+ygjP FALSE + 3233982 3234485
+yhiI FALSE - 3627558 3628625
+mlc FALSE - 1665368 1666588
+mscL FALSE + 3436046 3436456
+yjfC FALSE + 4411051 4412214
+cheY FALSE - 1965072 1965461
+zapA FALSE + 3053634 3053963
+galF FALSE - 2111458 2112351
+dtd FALSE + 4075038 4075475
+bluF FALSE - 1213487 1214698
+metI FALSE - 220968 221621
+chpS TRUE + 4446470 4446721
+puuD FALSE + 1359144 1359908
+ytfA FALSE + 4425792 4426118
+torT FALSE + 1055484 1056512
+ygiL FALSE + 3183436 3183987
+yhiN FALSE - 3634231 3635433
+dsdC FALSE - 2474716 2475651
+phnN FALSE - 4313548 4314105
+eutK FALSE - 2553250 2553750
+mcrB FALSE - 4575981 4577360
+prpE FALSE + 351930 353816
+elaD FALSE + 2380735 2381946
+php FALSE - 3505734 3506612
+rsmG FALSE - 3921080 3921703
+cadB FALSE - 4356720 4358054
+yahE FALSE + 335149 336012
+proV FALSE + 2802837 2804039
+caiF FALSE + 34300 34695
+csiD FALSE + 2787007 2787984
+yeeN FALSE + 2054882 2055598
+mhpT FALSE + 374683 375894
+yehC FALSE - 2188948 2189667
+G0-10703 FALSE - 3365635 3365792
+nrfB FALSE + 4287268 4287834
+fis FALSE + 3409293 3409589
+cspG FALSE + 1050684 1050896
+rfbA FALSE - 2108162 2109043
+sbmA FALSE + 395863 397083
+ybaQ FALSE + 507442 507783
+ddlA FALSE - 399053 400147
+rcdA FALSE + 886646 887182
+ymgH FALSE + 1222688 1222909
+trpR FALSE + 4630783 4631109
+hyfI FALSE + 2608728 2609486
+yahC FALSE - 333749 334246
+yecH FALSE - 1987275 1987514
+yaiS FALSE - 383283 383840
+mntP FALSE + 1903712 1904278
+tdcG FALSE - 3256307 3257671
+yeaL FALSE + 1872376 1872822
+ibpB FALSE - 3864492 3864920
+yohD FALSE + 2223823 2224401
+feoC FALSE + 3540750 3540986
+yabI FALSE + 71351 72115
+yfdL FALSE - 2469566 2470084
+dadX FALSE + 1238102 1239172
+emrB FALSE + 2810638 2812176
+pqqL FALSE - 1570431 1573226
+dsbC FALSE - 3036134 3036844
+lomR_2 FALSE + 1426838 1427008
+hypA FALSE + 2848669 2849019
+fimI FALSE + 4541751 4542290
+citD FALSE - 649710 650006
+hmp FALSE + 2683857 2685047
+ynbB FALSE + 1476250 1477146
+yphD FALSE - 2673849 2674847
+chbA FALSE - 1817479 1817829
+yedV FALSE - 2034818 2036176
+yfeS FALSE + 2535771 2536505
+iclR FALSE - 4220827 4221651
+flhA FALSE - 1960996 1963074
+C0614 FALSE - 2651474 2651560
+wcaA FALSE - 2130582 2131421
+yddG FALSE - 1544312 1545193
+sgcR FALSE - 4524129 4524911
+ytjA FALSE + 4610133 4610312
+ydaS FALSE + 1418389 1418685
+ygcS FALSE - 2894555 2895892
+mog FALSE + 9306 9893
+thiH FALSE - 4188758 4189891
+ykiA FALSE + 407833 408174
+yieF FALSE + 3892675 3893241
+cynX FALSE + 359216 360370
+queC FALSE - 464076 464771
+kbaZ FALSE + 3276936 3278216
+ccmC FALSE - 2293605 2294342
+cobC FALSE - 668519 669130
+alkA FALSE - 2144716 2145564
+fecR FALSE - 4514787 4515740
+ydiQ FALSE + 1777641 1778405
+ynbE FALSE + 1443711 1443896
+ftsN TRUE - 4120403 4121362
+glf FALSE - 2105250 2106353
+yehD FALSE - 2189702 2190244
+yoaK FALSE + 1876797 1876895
+ygaM FALSE + 2798168 2798497
+yibI FALSE - 3769405 3769767
+thpR FALSE - 161501 162031
+cysP FALSE - 2540534 2541550
+yfdF FALSE + 2461034 2462092
+mdtI FALSE - 1670844 1671173
+rseB FALSE - 2705820 2706776
+torD FALSE + 1061022 1061621
+torC FALSE + 1057307 1058479
+dhaL FALSE - 1248348 1248980
+ycbV FALSE + 1002662 1003177
+ybeQ FALSE - 674793 675770
+yidI FALSE + 3854438 3854887
+tdk FALSE + 1292750 1293367
+bioD FALSE + 811493 812170
+fimC FALSE + 4542327 4543052
+yigE FALSE - 3998315 3999079
+yigF FALSE - 4000442 4000822
+ygjQ FALSE + 3234562 3235254
+ymfE FALSE - 1196756 1197460
+agaW FALSE + 3278723 3279124
+cysD FALSE - 2873443 2874351
+yccF FALSE - 1023125 1023571
+mntH FALSE - 2509490 2510728
+ybdO FALSE - 635939 636841
+emtA FALSE + 1242403 1243014
+fliL FALSE + 2017642 2018106
+ydeJ FALSE + 1622797 1623315
+yedZ FALSE + 2038507 2039142
+fimA FALSE + 4541138 4541686
+cueR FALSE + 513217 513624
+cnu FALSE + 1702973 1703188
+yedX FALSE + 2036980 2037393
+nagZ FALSE + 1163318 1164343
+lsrF FALSE + 1604124 1604999
+agaC FALSE + 3282707 3283510
+guaC FALSE + 113444 114487
+ycbK FALSE + 982298 982846
+chbB FALSE - 1819323 1819643
+yjeN FALSE + 4383416 4383730
+yidQ FALSE + 3865751 3866083
+ycgJ FALSE + 1225823 1226191
+yojI FALSE - 2304994 2306637
+yjtD FALSE + 4638965 4639651
+ykgG FALSE + 322982 323677
+dicC FALSE - 1645644 1645874
+ychS FALSE + 1285932 1286207
+ybaO FALSE + 467607 468065
+yfjI FALSE + 2757007 2758416
+ytfI FALSE + 4435730 4436668
+araE FALSE - 2978786 2980204
+ytfH FALSE + 4432136 4432516
+hisJ FALSE - 2424028 2424810
+relA FALSE - 2909439 2911673
+dicB FALSE + 1647633 1647821
+insN-1 FALSE + 269466 269870
+yhaB FALSE + 3265876 3266415
+nikE FALSE + 3615799 3616605
+yadL FALSE - 151626 152231
+yghU FALSE + 3136749 3137615
+flgM FALSE - 1129058 1129351
+ycbL FALSE + 982873 983520
+ybhQ FALSE + 823853 824263
+mltC FALSE + 3102455 3103534
+ycbJ FALSE + 970975 971868
+yeeY FALSE - 2085353 2086282
+alpA FALSE + 2756666 2756878
+chaB FALSE + 1271342 1271572
+yhfY FALSE - 3509082 3509444
+slyA FALSE - 1718414 1718848
+yjiT FALSE + 4570437 4571954
+yegP FALSE + 2163213 2163545
+speE FALSE - 135598 136464
+ydfX FALSE - 1645370 1645660
+narL FALSE - 1274402 1275052
+ydjH FALSE - 1854005 1854952
+yeeT FALSE + 2074841 2075062
+gatA FALSE - 2172619 2173071
+msrC FALSE - 1913655 1914206
+dpiA FALSE + 653085 653765
+yqjD FALSE + 3247397 3247702
+yfbO FALSE + 2386603 2387079
+yfbU FALSE - 2410122 2410616
+ygcN FALSE + 2890679 2891950
+wbbK FALSE - 2101415 2102533
+ycbF FALSE + 1003170 1003880
+bcsF FALSE + 3696049 3696240
+dcuA FALSE - 4363495 4364796
+ypjB FALSE - 2781660 2782451
+proX FALSE + 2805154 2806146
+phnC FALSE - 4322400 4323188
+ydiE FALSE + 1787637 1787828
+emrA FALSE + 2809449 2810621
+deoR FALSE - 881199 881957
+yeaQ FALSE - 1877031 1877279
+yfbN FALSE - 2385732 2386448
+ybeL FALSE + 674241 674723
+cedA FALSE - 1811445 1811687
+ylbG FALSE - 528869 529240
+prc FALSE - 1910792 1912840
+pyrD FALSE + 1003991 1005001
+wcaC FALSE - 2128877 2130094
+sdaB FALSE + 2927598 2928965
+yddK FALSE - 1542782 1543738
+yqjC FALSE + 3246991 3247359
+ybhB FALSE - 806656 807132
+ybiI FALSE - 837413 837679
+adhP FALSE - 1550852 1551862
+frwB FALSE + 4141647 4141967
+yadI FALSE + 144577 145017
+cysC FALSE - 2871409 2872014
+yhiD FALSE - 3653278 3653925
+oxyS FALSE - 4156308 4156417
+yifO FALSE - 3958035 3958310
+C0299 FALSE + 1229852 1229930
+yfgH FALSE + 2627814 2628332
+waaU TRUE - 3796262 3797335
+yfcV FALSE - 2453105 2453668
+yeaD FALSE + 1861874 1862758
+yhfG FALSE - 3489475 3489642
+ybjO FALSE + 897212 897700
+kefF FALSE + 47246 47776
+yafT FALSE + 237335 238120
+sgrS FALSE + 77367 77593
+rlmA FALSE - 1904275 1905084
+ybiX FALSE - 837753 838430
+G0-10699 FALSE + 1994930 1995121
+alkB FALSE - 2306713 2307363
+sfmF FALSE + 562553 563068
+yaiZ FALSE + 398817 399029
+betB FALSE - 326485 327957
+ydgC FALSE - 1679719 1680054
+yncI FALSE + 1528610 1529356
+ais FALSE - 2363040 2363642
+potI FALSE + 896307 897152
+ydfR FALSE - 1638078 1638389
+yafC FALSE - 229967 230881
+gltJ FALSE - 685152 685892
+ccmD FALSE - 2293399 2293608
+elaB FALSE - 2378744 2379049
+fabR FALSE + 4159090 4159794
+hofM FALSE - 3519994 3520773
+yahH FALSE + 339017 339313
+spy FALSE - 1823164 1823649
+loiP FALSE + 3079935 3080693
+uspD FALSE + 4111316 4111744
+entA FALSE + 627774 628520
+hypC FALSE + 2849886 2850158
+yfcI FALSE - 2420671 2421561
+narW FALSE - 1534638 1535333
+rydB FALSE - 1762737 1762804
+intR FALSE - 1410024 1411259
+mepS FALSE + 2268001 2268567
+proQ FALSE - 1912860 1913558
+yibG FALSE + 3766200 3766661
+evgA FALSE + 2481777 2482391
+G0-10700 FALSE - 2276280 2276520
+C0465 FALSE + 1970763 1970840
+wbbI FALSE - 2103089 2104081
+micC FALSE + 1435145 1435253
+yjiP FALSE + 4567021 4567332
+yjjY FALSE + 4638425 4638565
+ydcL FALSE + 1500481 1501149
+gatZ FALSE - 2173081 2174343
+yhbP FALSE - 3297494 3297937
+yjeI FALSE + 4370832 4371185
+mcaS FALSE - 1403683 1403775
+frmR FALSE - 378830 379105
+folD TRUE - 556098 556964
+csdE FALSE + 2942564 2943007
+gatC FALSE - 2170945 2172300
+greA FALSE - 3326261 3326737
+cspF FALSE + 1639879 1640091
+ygbE FALSE - 2871036 2871359
+dppC FALSE - 3701882 3702784
+ysaA FALSE - 3739132 3739605
+ptsP FALSE - 2964210 2966456
+hisQ FALSE - 2423252 2423938
+yfgD FALSE + 2615600 2615959
+sibC FALSE + 3054873 3055013
+ompF FALSE - 985117 986205
+osmY FALSE + 4609419 4610024
+dsrA FALSE - 2023251 2023337
+yghG FALSE - 3111089 3111499
+ydaU FALSE + 1419143 1420000
+argZ FALSE - 2816081 2816157
+lysZ FALSE + 780592 780667
+ycaR FALSE + 969896 970078
+yahL FALSE + 343400 344215
+mraZ FALSE + 89634 90092
+argX FALSE + 3980398 3980474
+ppiB FALSE - 553166 553660
+ygeK FALSE - 2992482 2992925
+yibJ FALSE + 3765244 3765945
+ubiJ FALSE + 4017647 4018252
+yfeY FALSE - 2548663 2549238
+rplP TRUE - 3446781 3447191
+C0664 FALSE + 2833077 2833189
+gspI FALSE + 3459996 3460373
+paaB FALSE + 1452892 1453179
+tufA FALSE - 3468167 3469351
+yaaY FALSE + 21181 21399
+yffN FALSE + 2559632 2560015
+hokD FALSE - 1643143 1643298
+tatA FALSE + 4019968 4020237
+rplT TRUE - 1797417 1797773
+hupB FALSE + 460675 460947
+yjbR FALSE + 4268681 4269037
+yaeH FALSE - 183709 184095
+rpmF FALSE + 1146590 1146763
+yodC FALSE - 2026212 2026394
+otsB FALSE - 1979611 1980411
+yhdV FALSE + 3416412 3416633
+yohO FALSE + 2213679 2213786
+lolA TRUE + 936592 937206
+ybgE FALSE + 773532 773825
+ychE FALSE + 1297821 1298468
+yceM FALSE + 1126029 1126952
+chbG FALSE - 1814410 1815159
+gntK FALSE - 3575088 3575615
+ydfW FALSE - 1645198 1645347
+gatB FALSE - 2172304 2172588
+cbrC FALSE + 3896045 3896632
+yqaA FALSE - 2814534 2814962
+yejG FALSE - 2275915 2276259
+ymfA FALSE - 1180487 1180948
+bssR FALSE + 877471 877854
+sibB FALSE + 2151670 2151805
+yjaB FALSE - 4211703 4212146
+yfdI FALSE + 2467153 2468484
+ydcZ FALSE - 1515906 1516355
+yaiY FALSE - 398249 398557
+rimJ FALSE + 1124785 1125369
+ypjC FALSE - 2782551 2783033
+yaiV FALSE + 393685 394353
+csrC FALSE + 4049059 4049303
+yiiF FALSE + 4077774 4077992
+tpke70 FALSE - 2494216 2494651
+ymfT FALSE + 1202247 1202447
+omrB FALSE - 2974326 2974407
+nohB FALSE + 580057 580602
+rrsG FALSE - 2727638 2729179
+fic FALSE - 3488883 3489485
+yaiI FALSE + 404988 405446
+tyrT FALSE - 1286761 1286845
+ybgC FALSE + 773975 774379
+ygeL FALSE - 2992959 2993114
+lacA FALSE - 360473 361084
+thrV FALSE - 3421602 3421677
+yggX FALSE + 3102115 3102390
+tusE FALSE - 1029562 1029891
+ydcX FALSE + 1515413 1515586
+yeiS FALSE + 2231622 2231861
+clpS FALSE + 922136 922456
+yodD FALSE + 2023010 2023237
+ariR FALSE + 1215592 1215858
+ynaK FALSE + 1423401 1423664
+rpmD TRUE - 3442565 3442744
+ykgL FALSE + 311336 311563
+ymgG FALSE - 1221867 1222142
+pspC FALSE + 1367049 1367408
+ydfB TRUE + 1646689 1646817
+yadM FALSE - 152243 152812
+yobD FALSE + 1902825 1903283
+yaeP FALSE - 213925 214125
+rrlD FALSE - 3421902 3424805
+yeiL FALSE + 2253377 2254036
+ybfN FALSE + 709013 709339
+ymjB FALSE + 1379813 1379926
+yfdY FALSE - 2493072 2493314
+dsrB FALSE - 2022659 2022847
+csgE FALSE - 1101375 1101764
+spf FALSE + 4047922 4048030
+cspC FALSE - 1905250 1905459
+yajL FALSE - 442275 442865
+ygiZ FALSE - 3169901 3170233
+ybcW FALSE + 579103 579309
+ybcM FALSE + 570677 571474
+yohP FALSE + 2227004 2227087
+frlD FALSE + 3501189 3501974
+yqeJ FALSE + 2987326 2987808
+yegJ FALSE + 2149209 2149670
+ychQ FALSE + 1266147 1266539
+rbfA FALSE - 3310799 3311200
+osmB FALSE - 1341134 1341352
+hfq FALSE + 4398311 4398619
+blr FALSE + 1702575 1702700
+yjfL FALSE + 4410002 4410400
+ycgZ FALSE + 1215012 1215248
+yoaH FALSE - 1892576 1892755
+ykfB FALSE - 264844 265311
+atpE FALSE - 3918973 3919212
+yehY FALSE - 2215422 2216579
+rem FALSE - 1642675 1642926
+ulaB FALSE + 4419416 4419721
+ymfS FALSE + 1207355 1207768
+ypfM FALSE - 2588829 2588888
+ysaB FALSE - 3723436 3723735
+rcnR FALSE - 2183546 2183818
+yhhH FALSE + 3621422 3621805
+ymgI FALSE - 1222213 1222386
+ydcH FALSE + 1496675 1496899
+rrlC FALSE + 3941727 3944630
+dut TRUE + 3811955 3812410
+ldrD FALSE - 3698003 3698110
+ybfK FALSE + 719806 720063
+rraA FALSE - 4116868 4117353
+pinE FALSE + 1208908 1209462
+csrB FALSE - 2922178 2922546
+ralR FALSE - 1411757 1411951
+sugE FALSE + 4374898 4375215
+glyW FALSE - 1990066 1990141
+yrbN FALSE - 3305875 3305955
+mlaB FALSE - 3334985 3335278
+ydhL FALSE - 1723705 1723944
+thiS FALSE - 4190660 4190860
+fimF FALSE + 4545765 4546295
+yfdP FALSE + 2471542 2471988
+yhdE FALSE - 3395807 3396400
+sra FALSE - 1553850 1553987
+kilR FALSE - 1416032 1416253
+ydfZ FALSE + 1627239 1627442
+aroF FALSE - 2738102 2739172
+ryfD FALSE - 2732175 2732317
+rzpD FALSE + 577330 577791
+pth TRUE - 1257152 1257736
+rimL FALSE + 1496962 1497501
+yccJ FALSE - 1066087 1066314
+ykfH FALSE - 263250 263471
+rpsI FALSE - 3375837 3376229
+ylcG FALSE + 572953 573093
+hinT FALSE + 1161108 1161467
+argW FALSE + 2464331 2464405
+leuT FALSE + 3980629 3980715
+yjcH FALSE - 4282922 4283236
+ychH FALSE + 1258014 1258292
+cspE FALSE + 656515 656724
+acrZ FALSE + 793996 794145
+fimE FALSE + 4540060 4540656
+yhbY FALSE + 3325812 3326105
+ybfL FALSE + 736123 737184
+groS TRUE + 4368711 4369004
+cheW FALSE - 1970860 1971363
+yjaA FALSE + 4211257 4211640
+ybcV FALSE - 578407 578817
+ptsH FALSE + 2531786 2532043
+G0-10697 FALSE + 1298697 1298951
+iscX FALSE - 2654558 2654758
+thrL FALSE + 190 255
+ryjA FALSE - 4275950 4276089
+ycdU FALSE + 1095066 1096052
+yncJ FALSE - 1506858 1507088
+pinR FALSE - 1431108 1431698
+yhhI FALSE + 3622401 3623537
+yhaI FALSE + 3250933 3251289
+yhfU FALSE - 3505370 3505723
+ypjJ FALSE + 2774899 2775099
+cbeA FALSE + 2075136 2075504
+yqeK FALSE - 2987957 2988382
+rplU TRUE - 3331162 3331473
+atl FALSE - 475206 475595
+yjiL FALSE - 4561945 4562712
+rdlA FALSE + 1268546 1268612
+mokC FALSE - 16751 16960
+ybdZ FALSE + 613165 613383
+ynhF FALSE - 1735480 1735569
+dinQ FALSE - 3645728 3645811
+aaeX FALSE - 3387156 3387359
+ygdI FALSE - 2940940 2941167
+serU FALSE - 2041492 2041581
+insJ FALSE + 3718703 3719224
+yaaX FALSE + 5234 5530
+ydhI FALSE + 1719049 1719285
+yobH FALSE + 1906949 1907188
+ygeI FALSE + 2991660 2991878
+sroA FALSE - 75516 75608
+lit FALSE + 1197918 1198811
+ygeP FALSE - 2995711 2996010
+waaS FALSE - 3802204 3803139
+matP FALSE + 1017708 1018160
+yqhA FALSE - 3146999 3147493
+napD FALSE - 2300772 2301035
+yciX FALSE + 1333315 1333482
+sibE FALSE - 3193119 3193262
+yqjE FALSE + 3247705 3248109
+valT FALSE + 779988 780063
+ydfC FALSE + 1646847 1647065
+yiaB FALSE - 3725430 3725771
+trpT FALSE + 3944980 3945055
+hofP FALSE - 3518637 3519041
+rof FALSE - 213678 213932
+yfbR FALSE + 2406884 2407483
+cyaR FALSE + 2165138 2165224
+ydcC FALSE + 1529840 1530976
+yghW FALSE - 3144472 3144759
+kdpF FALSE - 727955 728044
+ybjI FALSE - 884539 885354
+yoaF FALSE - 1875302 1875556
+yjgZ FALSE + 4499283 4499612
+ybbC FALSE + 526805 527173
+yqaE FALSE - 2794892 2795050
+ymgC FALSE + 1215971 1216219
+ydiZ FALSE + 1805424 1805714
+yshB FALSE - 4051670 4051780
+nc1 FALSE - 296361 296528
+nudI FALSE + 2362576 2363001
+insN-2 FALSE + 4505220 4505486
+ybaB FALSE + 493300 493629
+yoaI FALSE - 1872102 1872206
+ybfB FALSE + 732999 733325
+hdeA FALSE - 3654431 3654763
+rfbC FALSE - 2107605 2108162
+pspB FALSE + 1366825 1367049
+rseX FALSE + 2031673 2031763
+yoeE FALSE + 2068268 2068528
+yjcB FALSE - 4272783 4273064
+insI-1 FALSE + 269827 270978
+ydgU FALSE + 1669801 1669884
+ydcD FALSE + 1527946 1528428
+yibV FALSE + 3767368 3767703
+cmtB FALSE - 3076909 3077352
+yfdM FALSE - 2470134 2470409
+yciG FALSE - 1313880 1314059
+smpB FALSE + 2752918 2753400
+essQ FALSE - 1638394 1638609
+yeaC FALSE - 1859726 1859998
+yijD FALSE + 4159794 4160153
+yidG FALSE - 3853631 3853993
+relE FALSE - 1643370 1643657
+sieB FALSE + 1416695 1417183
+ydaG FALSE - 1417346 1417480
+gadB FALSE - 1568669 1570069
+ydaT FALSE + 1418708 1419130
+higA FALSE - 3231750 3232166
+rplL TRUE + 4178583 4178948
+pspD FALSE + 1367417 1367638
+rybA FALSE - 851948 852287
+yagL FALSE - 292444 293142
+yoeB FALSE - 2087235 2087489
+ohsC FALSE + 2698542 2698618
+C0719 FALSE + 3119380 3119601
+rybB FALSE - 887200 887280
+cspB FALSE - 1639363 1639578
+yebW FALSE + 1920145 1920336
+yobF FALSE - 1905472 1905615
+yciY FALSE + 1306812 1306985
+yoaG FALSE - 1877427 1877609
+yoaJ FALSE + 1876898 1876972
+tdcR FALSE + 3265402 3265620
+eyeA FALSE + 271804 271878
+ralA FALSE + 1411580 1411758
+sgrT FALSE + 77388 77519
+yojO FALSE + 2301628 2301792
+essD FALSE + 576621 576836
+yecF FALSE + 1993842 1994066
+cspH FALSE - 1050186 1050398
\ No newline at end of file
diff --git a/dataset/obs_rd_insertions.freq b/dataset/obs_rd_insertions.freq
new file mode 100644
index 0000000000000000000000000000000000000000..99b8367c72d7c5ac0f93be8a77e300950654628b
--- /dev/null
+++ b/dataset/obs_rd_insertions.freq
@@ -0,0 +1,2803 @@
+Sequence Position names fork orient freq
+random 1075 Lagging_0 Lagging Forward 1
+obs 6278 Lagging_0 Lagging Forward 1
+random 16232 Lagging_0 Lagging Forward 1
+random 17341 Lagging_0 Lagging Forward 1
+random 20310 Lagging_0 Lagging Forward 1
+random 23909 Lagging_0 Lagging Forward 1
+random 27344 Lagging_0 Lagging Forward 1
+obs 47626 Lagging_0 Lagging Forward 1
+random 48452 Lagging_0 Lagging Forward 1
+obs 50670 Lagging_0 Lagging Forward 1
+random 53139 Lagging_0 Lagging Forward 1
+obs 56949 Lagging_0 Lagging Forward 1
+random 58043 Lagging_0 Lagging Forward 1
+random 60569 Lagging_0 Lagging Forward 1
+random 65345 Lagging_0 Lagging Forward 1
+random 68989 Lagging_0 Lagging Forward 1
+random 72610 Lagging_0 Lagging Forward 1
+random 73231 Lagging_0 Lagging Forward 1
+random 74759 Lagging_0 Lagging Forward 1
+obs 79908 Lagging_0 Lagging Forward 2
+random 80460 Lagging_0 Lagging Forward 1
+random 80493 Lagging_0 Lagging Forward 1
+obs 82936 Lagging_0 Lagging Forward 1
+random 85610 Lagging_0 Lagging Forward 1
+random 89643 Lagging_0 Lagging Forward 1
+random 94032 Lagging_0 Lagging Forward 1
+random 96626 Lagging_0 Lagging Forward 1
+random 106515 Lagging_0 Lagging Forward 1
+random 108419 Lagging_0 Lagging Forward 1
+random 108619 Lagging_0 Lagging Forward 1
+random 115440 Lagging_0 Lagging Forward 1
+random 121669 Lagging_0 Lagging Forward 1
+obs 131096 Lagging_0 Lagging Forward 1
+random 131498 Lagging_0 Lagging Forward 1
+random 131993 Lagging_0 Lagging Forward 1
+obs 134422 Lagging_0 Lagging Forward 1
+random 143148 Lagging_0 Lagging Forward 1
+obs 147342 Lagging_0 Lagging Forward 1
+obs 161462 Lagging_0 Lagging Forward 1
+obs 162752 Lagging_0 Lagging Forward 1
+obs 163010 Lagging_0 Lagging Forward 1
+random 163267 Lagging_0 Lagging Forward 1
+random 167290 Lagging_0 Lagging Forward 1
+random 175078 Lagging_0 Lagging Forward 1
+random 176046 Lagging_0 Lagging Forward 1
+random 182098 Lagging_0 Lagging Forward 1
+random 182831 Lagging_0 Lagging Forward 1
+obs 185931 Lagging_0 Lagging Forward 1
+random 188344 Lagging_0 Lagging Forward 1
+random 190631 Lagging_0 Lagging Forward 1
+random 191338 Lagging_0 Lagging Forward 1
+obs 197823 Lagging_0 Lagging Forward 1
+obs 200492 Lagging_0 Lagging Forward 1
+random 200727 Lagging_0 Lagging Forward 1
+random 207669 Lagging_0 Lagging Forward 1
+random 207709 Lagging_0 Lagging Forward 1
+random 210277 Lagging_0 Lagging Forward 1
+obs 210465 Lagging_0 Lagging Forward 1
+random 212713 Lagging_0 Lagging Forward 1
+obs 222323 Lagging_0 Lagging Forward 1
+random 223777 Lagging_0 Lagging Forward 1
+random 228760 Lagging_0 Lagging Forward 1
+random 233985 Lagging_0 Lagging Forward 1
+random 234328 Lagging_0 Lagging Forward 1
+random 245146 Lagging_0 Lagging Forward 1
+random 247381 Lagging_0 Lagging Forward 1
+random 247701 Lagging_0 Lagging Forward 1
+obs 251031 Lagging_0 Lagging Forward 1
+random 256835 Lagging_0 Lagging Forward 1
+obs 258803 Lagging_0 Lagging Forward 1
+random 264872 Lagging_0 Lagging Forward 1
+random 265944 Lagging_0 Lagging Forward 1
+random 268966 Lagging_0 Lagging Forward 1
+random 272908 Lagging_0 Lagging Forward 1
+random 278362 Lagging_0 Lagging Forward 1
+obs 279619 Lagging_0 Lagging Forward 1
+random 297761 Lagging_0 Lagging Forward 1
+random 300172 Lagging_0 Lagging Forward 1
+random 302258 Lagging_0 Lagging Forward 1
+random 308039 Lagging_0 Lagging Forward 1
+random 309614 Lagging_0 Lagging Forward 1
+random 310848 Lagging_0 Lagging Forward 1
+random 312589 Lagging_0 Lagging Forward 1
+random 314851 Lagging_0 Lagging Forward 1
+random 330035 Lagging_0 Lagging Forward 1
+random 332777 Lagging_0 Lagging Forward 1
+random 340609 Lagging_0 Lagging Forward 1
+obs 359615 Lagging_0 Lagging Forward 1
+obs 359927 Lagging_0 Lagging Forward 1
+random 367138 Lagging_0 Lagging Forward 1
+random 369849 Lagging_0 Lagging Forward 1
+random 381675 Lagging_0 Lagging Forward 1
+random 384757 Lagging_0 Lagging Forward 1
+random 385988 Lagging_0 Lagging Forward 1
+random 386737 Lagging_0 Lagging Forward 1
+obs 393430 Lagging_0 Lagging Forward 1
+random 397414 Lagging_0 Lagging Forward 1
+obs 400187 Lagging_0 Lagging Forward 1
+obs 401935 Lagging_0 Lagging Forward 1
+random 405227 Lagging_0 Lagging Forward 1
+random 418883 Lagging_0 Lagging Forward 1
+random 420786 Lagging_0 Lagging Forward 1
+random 424353 Lagging_0 Lagging Forward 1
+obs 433818 Lagging_0 Lagging Forward 1
+random 442390 Lagging_0 Lagging Forward 1
+random 444373 Lagging_0 Lagging Forward 1
+random 450567 Lagging_0 Lagging Forward 1
+random 458591 Lagging_0 Lagging Forward 1
+random 470661 Lagging_0 Lagging Forward 1
+obs 473853 Lagging_0 Lagging Forward 2
+random 475068 Lagging_0 Lagging Forward 1
+random 478391 Lagging_0 Lagging Forward 1
+obs 480601 Lagging_0 Lagging Forward 1
+obs 490421 Lagging_0 Lagging Forward 1
+obs 492454 Lagging_0 Lagging Forward 3
+random 494665 Lagging_0 Lagging Forward 1
+random 499019 Lagging_0 Lagging Forward 1
+random 504212 Lagging_0 Lagging Forward 1
+obs 506157 Lagging_0 Lagging Forward 1
+obs 506406 Lagging_0 Lagging Forward 1
+random 510026 Lagging_0 Lagging Forward 1
+random 513535 Lagging_0 Lagging Forward 1
+random 514609 Lagging_0 Lagging Forward 1
+random 515792 Lagging_0 Lagging Forward 1
+obs 517477 Lagging_0 Lagging Forward 1
+random 529974 Lagging_0 Lagging Forward 1
+random 531141 Lagging_0 Lagging Forward 1
+obs 535910 Lagging_0 Lagging Forward 1
+random 540026 Lagging_0 Lagging Forward 1
+obs 541533 Lagging_0 Lagging Forward 1
+random 545348 Lagging_0 Lagging Forward 1
+random 550333 Lagging_0 Lagging Forward 1
+random 552784 Lagging_0 Lagging Forward 1
+random 554296 Lagging_0 Lagging Forward 1
+random 557798 Lagging_0 Lagging Forward 1
+random 567270 Lagging_0 Lagging Forward 1
+random 572036 Lagging_0 Lagging Forward 1
+random 584443 Lagging_0 Lagging Forward 1
+random 588307 Lagging_0 Lagging Forward 1
+random 589518 Lagging_0 Lagging Forward 1
+random 594690 Lagging_0 Lagging Forward 1
+obs 595937 Lagging_0 Lagging Forward 1
+random 600035 Lagging_0 Lagging Forward 1
+random 601086 Lagging_0 Lagging Forward 1
+random 612450 Lagging_0 Lagging Forward 1
+random 614213 Lagging_0 Lagging Forward 1
+random 614474 Lagging_0 Lagging Forward 1
+obs 618332 Lagging_0 Lagging Forward 1
+random 621194 Lagging_0 Lagging Forward 1
+random 624419 Lagging_0 Lagging Forward 1
+random 630525 Lagging_0 Lagging Forward 1
+random 633193 Lagging_0 Lagging Forward 1
+obs 636178 Lagging_0 Lagging Forward 1
+obs 640530 Lagging_0 Lagging Forward 1
+obs 643187 Lagging_0 Lagging Forward 1
+random 644119 Lagging_0 Lagging Forward 1
+random 651210 Lagging_0 Lagging Forward 1
+random 651924 Lagging_0 Lagging Forward 1
+random 653067 Lagging_0 Lagging Forward 1
+random 655636 Lagging_0 Lagging Forward 1
+random 668101 Lagging_0 Lagging Forward 1
+random 668121 Lagging_0 Lagging Forward 1
+random 670415 Lagging_0 Lagging Forward 1
+random 672215 Lagging_0 Lagging Forward 1
+obs 672741 Lagging_0 Lagging Forward 1
+obs 682127 Lagging_0 Lagging Forward 1
+random 683452 Lagging_0 Lagging Forward 1
+random 696306 Lagging_0 Lagging Forward 1
+obs 702054 Lagging_0 Lagging Forward 1
+random 702972 Lagging_0 Lagging Forward 1
+random 705674 Lagging_0 Lagging Forward 1
+random 705882 Lagging_0 Lagging Forward 1
+random 707186 Lagging_0 Lagging Forward 1
+random 708853 Lagging_0 Lagging Forward 1
+random 710530 Lagging_0 Lagging Forward 1
+random 711184 Lagging_0 Lagging Forward 1
+obs 712349 Lagging_0 Lagging Forward 1
+obs 725865 Lagging_0 Lagging Forward 2
+random 728297 Lagging_0 Lagging Forward 1
+random 739561 Lagging_0 Lagging Forward 1
+random 742946 Lagging_0 Lagging Forward 1
+random 743460 Lagging_0 Lagging Forward 1
+random 744074 Lagging_0 Lagging Forward 1
+obs 744700 Lagging_0 Lagging Forward 1
+random 747891 Lagging_0 Lagging Forward 1
+random 751465 Lagging_0 Lagging Forward 1
+random 754661 Lagging_0 Lagging Forward 1
+random 756822 Lagging_0 Lagging Forward 1
+random 758648 Lagging_0 Lagging Forward 1
+random 759477 Lagging_0 Lagging Forward 1
+obs 761594 Lagging_0 Lagging Forward 1
+random 762930 Lagging_0 Lagging Forward 1
+random 763805 Lagging_0 Lagging Forward 1
+random 767576 Lagging_0 Lagging Forward 1
+random 768519 Lagging_0 Lagging Forward 1
+obs 772423 Lagging_0 Lagging Forward 1
+random 772584 Lagging_0 Lagging Forward 1
+random 775064 Lagging_0 Lagging Forward 1
+random 775085 Lagging_0 Lagging Forward 1
+random 778012 Lagging_0 Lagging Forward 1
+random 784400 Lagging_0 Lagging Forward 1
+random 785215 Lagging_0 Lagging Forward 1
+random 788226 Lagging_0 Lagging Forward 1
+random 798467 Lagging_0 Lagging Forward 1
+random 798766 Lagging_0 Lagging Forward 1
+random 799409 Lagging_0 Lagging Forward 1
+random 809582 Lagging_0 Lagging Forward 1
+random 814034 Lagging_0 Lagging Forward 1
+random 819524 Lagging_0 Lagging Forward 1
+random 823496 Lagging_0 Lagging Forward 1
+obs 833789 Lagging_0 Lagging Forward 2
+random 838240 Lagging_0 Lagging Forward 1
+random 839955 Lagging_0 Lagging Forward 1
+obs 840446 Lagging_0 Lagging Forward 1
+obs 847968 Lagging_0 Lagging Forward 1
+random 852990 Lagging_0 Lagging Forward 1
+obs 859719 Lagging_0 Lagging Forward 1
+obs 860842 Lagging_0 Lagging Forward 1
+random 862290 Lagging_0 Lagging Forward 1
+random 867921 Lagging_0 Lagging Forward 1
+random 873190 Lagging_0 Lagging Forward 1
+random 873643 Lagging_0 Lagging Forward 1
+random 882091 Lagging_0 Lagging Forward 1
+random 887914 Lagging_0 Lagging Forward 1
+obs 891138 Lagging_0 Lagging Forward 2
+random 899116 Lagging_0 Lagging Forward 1
+obs 899477 Lagging_0 Lagging Forward 1
+random 900950 Lagging_0 Lagging Forward 1
+obs 905927 Lagging_0 Lagging Forward 1
+obs 910571 Lagging_0 Lagging Forward 1
+obs 911301 Lagging_0 Lagging Forward 1
+random 914205 Lagging_0 Lagging Forward 1
+random 914646 Lagging_0 Lagging Forward 1
+random 934938 Lagging_0 Lagging Forward 1
+obs 942460 Lagging_0 Lagging Forward 1
+random 944045 Lagging_0 Lagging Forward 1
+random 947704 Lagging_0 Lagging Forward 1
+random 952440 Lagging_0 Lagging Forward 1
+obs 961724 Lagging_0 Lagging Forward 1
+obs 961967 Lagging_0 Lagging Forward 1
+random 971159 Lagging_0 Lagging Forward 1
+obs 973920 Lagging_0 Lagging Forward 1
+obs 978929 Lagging_0 Lagging Forward 1
+random 979688 Lagging_0 Lagging Forward 1
+random 986959 Lagging_0 Lagging Forward 1
+obs 996686 Lagging_0 Lagging Forward 1
+random 1000370 Lagging_0 Lagging Forward 1
+random 1001903 Lagging_0 Lagging Forward 1
+random 1006549 Lagging_0 Lagging Forward 1
+obs 1009717 Lagging_0 Lagging Forward 1
+random 1026572 Lagging_0 Lagging Forward 1
+random 1042468 Lagging_0 Lagging Forward 1
+obs 1043726 Lagging_0 Lagging Forward 1
+random 1047574 Lagging_0 Lagging Forward 1
+random 1050051 Lagging_0 Lagging Forward 1
+random 1050986 Lagging_0 Lagging Forward 1
+random 1059680 Lagging_0 Lagging Forward 1
+random 1068819 Lagging_0 Lagging Forward 1
+random 1076145 Lagging_0 Lagging Forward 1
+obs 1093582 Lagging_0 Lagging Forward 2
+random 1093928 Lagging_0 Lagging Forward 1
+random 1102805 Lagging_0 Lagging Forward 1
+obs 1102851 Lagging_0 Lagging Forward 1
+random 1102912 Lagging_0 Lagging Forward 1
+obs 1108575 Lagging_0 Lagging Forward 1
+random 1110550 Lagging_0 Lagging Forward 1
+random 1112048 Lagging_0 Lagging Forward 1
+obs 1114675 Lagging_0 Lagging Forward 1
+random 1120926 Lagging_0 Lagging Forward 1
+obs 1127283 Lagging_0 Lagging Forward 2
+random 1127283 Lagging_0 Lagging Forward 1
+random 1128738 Lagging_0 Lagging Forward 1
+random 1131025 Lagging_0 Lagging Forward 1
+obs 1132327 Lagging_0 Lagging Forward 1
+obs 1132353 Lagging_0 Lagging Forward 2
+obs 1133587 Lagging_0 Lagging Forward 1
+random 1134088 Lagging_0 Lagging Forward 1
+random 1134121 Lagging_0 Lagging Forward 1
+obs 1138596 Lagging_0 Lagging Forward 1
+obs 1139155 Lagging_0 Lagging Forward 1
+obs 1143940 Lagging_0 Lagging Forward 1
+random 1148762 Lagging_0 Lagging Forward 1
+random 1153461 Lagging_0 Lagging Forward 1
+obs 1156361 Lagging_0 Lagging Forward 1
+random 1157016 Lagging_0 Lagging Forward 1
+random 1161592 Lagging_0 Lagging Forward 1
+random 1162178 Lagging_0 Lagging Forward 1
+obs 1165441 Lagging_0 Lagging Forward 2
+random 1169210 Lagging_0 Lagging Forward 1
+obs 1170309 Lagging_0 Lagging Forward 1
+random 1171143 Lagging_0 Lagging Forward 1
+random 1172345 Lagging_0 Lagging Forward 1
+obs 1172920 Lagging_0 Lagging Forward 1
+obs 1173883 Lagging_0 Lagging Forward 4
+obs 1180853 Lagging_0 Lagging Forward 1
+random 1181017 Lagging_0 Lagging Forward 1
+random 1188510 Lagging_0 Lagging Forward 1
+obs 1188793 Lagging_0 Lagging Forward 1
+obs 1191500 Lagging_0 Lagging Forward 1
+obs 1195172 Lagging_0 Lagging Forward 1
+obs 1200779 Lagging_0 Lagging Forward 1
+random 1201161 Lagging_0 Lagging Forward 1
+obs 1204504 Lagging_0 Lagging Forward 1
+obs 1204661 Lagging_0 Lagging Forward 1
+random 1204927 Lagging_0 Lagging Forward 1
+random 1206627 Lagging_0 Lagging Forward 1
+obs 1207899 Lagging_0 Lagging Forward 1
+random 1209244 Lagging_0 Lagging Forward 1
+obs 1211740 Lagging_0 Lagging Forward 2
+obs 1219300 Lagging_0 Lagging Forward 1
+random 1232031 Lagging_0 Lagging Forward 1
+random 1233256 Lagging_0 Lagging Forward 1
+obs 1237740 Lagging_0 Lagging Forward 1
+obs 1242088 Lagging_0 Lagging Forward 1
+obs 1244312 Lagging_0 Lagging Forward 1
+obs 1247054 Lagging_0 Lagging Forward 1
+random 1247212 Lagging_0 Lagging Forward 1
+random 1248148 Lagging_0 Lagging Forward 1
+random 1248288 Lagging_0 Lagging Forward 1
+random 1249910 Lagging_0 Lagging Forward 1
+obs 1252389 Lagging_0 Lagging Forward 1
+obs 1258479 Lagging_0 Lagging Forward 1
+obs 1260087 Lagging_0 Lagging Forward 2
+random 1261873 Lagging_0 Lagging Forward 1
+obs 1263321 Lagging_0 Lagging Forward 1
+random 1266693 Lagging_0 Lagging Forward 1
+random 1270644 Lagging_0 Lagging Forward 1
+obs 1274191 Lagging_0 Lagging Forward 4
+obs 1276290 Lagging_0 Lagging Forward 1
+random 1279331 Lagging_0 Lagging Forward 1
+random 1285849 Lagging_0 Lagging Forward 1
+obs 1286148 Lagging_0 Lagging Forward 1
+obs 1289269 Lagging_0 Lagging Forward 1
+random 1300426 Lagging_0 Lagging Forward 1
+obs 1313139 Lagging_0 Lagging Forward 1
+random 1314779 Lagging_0 Lagging Forward 1
+random 1315849 Lagging_0 Lagging Forward 1
+obs 1316395 Lagging_0 Lagging Forward 1
+obs 1316947 Lagging_0 Lagging Forward 1
+obs 1321972 Lagging_0 Lagging Forward 1
+random 1324832 Lagging_0 Lagging Forward 1
+obs 1325059 Lagging_0 Lagging Forward 1
+random 1326711 Lagging_0 Lagging Forward 1
+obs 1327110 Lagging_0 Lagging Forward 2
+obs 1327533 Lagging_0 Lagging Forward 1
+obs 1327974 Lagging_0 Lagging Forward 1
+random 1328510 Lagging_0 Lagging Forward 1
+random 1333408 Lagging_0 Lagging Forward 1
+obs 1334050 Lagging_0 Lagging Forward 1
+random 1337833 Lagging_0 Lagging Forward 1
+obs 1339323 Lagging_0 Lagging Forward 1
+obs 1339604 Lagging_0 Lagging Forward 1
+obs 1341620 Lagging_0 Lagging Forward 7
+obs 1341803 Lagging_0 Lagging Forward 1
+obs 1345016 Lagging_0 Lagging Forward 1
+random 1349010 Lagging_0 Lagging Forward 1
+obs 1352680 Lagging_0 Lagging Forward 1
+obs 1353353 Lagging_0 Lagging Forward 1
+obs 1363265 Lagging_0 Lagging Forward 1
+obs 1367206 Lagging_0 Lagging Forward 1
+obs 1367630 Lagging_0 Lagging Forward 2
+obs 1371327 Lagging_0 Lagging Forward 1
+random 1374836 Lagging_0 Lagging Forward 1
+obs 1378395 Lagging_0 Lagging Forward 1
+random 1381737 Lagging_0 Lagging Forward 1
+random 1384088 Lagging_0 Lagging Forward 1
+random 1392053 Lagging_0 Lagging Forward 1
+random 1392939 Lagging_0 Lagging Forward 1
+obs 1399012 Lagging_0 Lagging Forward 1
+random 1401351 Lagging_0 Lagging Forward 1
+obs 1418288 Lagging_0 Lagging Forward 1
+obs 1421515 Lagging_0 Lagging Forward 1
+obs 1423485 Lagging_0 Lagging Forward 1
+random 1423964 Lagging_0 Lagging Forward 1
+obs 1424006 Lagging_0 Lagging Forward 1
+random 1427055 Lagging_0 Lagging Forward 1
+obs 1431402 Lagging_0 Lagging Forward 1
+random 1432955 Lagging_0 Lagging Forward 1
+random 1433032 Lagging_0 Lagging Forward 1
+obs 1433599 Lagging_0 Lagging Forward 1
+obs 1435872 Lagging_0 Lagging Forward 1
+random 1435919 Lagging_0 Lagging Forward 1
+obs 1439335 Lagging_0 Lagging Forward 1
+random 1439749 Lagging_0 Lagging Forward 1
+random 1442460 Lagging_0 Lagging Forward 1
+obs 1445782 Lagging_0 Lagging Forward 1
+obs 1447701 Lagging_0 Lagging Forward 1
+obs 1450508 Lagging_0 Lagging Forward 1
+random 1453534 Lagging_0 Lagging Forward 1
+random 1457231 Lagging_0 Lagging Forward 1
+obs 1458392 Lagging_0 Lagging Forward 1
+obs 1462558 Lagging_0 Lagging Forward 1
+obs 1464183 Lagging_0 Lagging Forward 1
+random 1464666 Lagging_0 Lagging Forward 1
+obs 1470018 Lagging_0 Lagging Forward 1
+obs 1478918 Lagging_0 Lagging Forward 1
+random 1481234 Lagging_0 Lagging Forward 1
+random 1482809 Lagging_0 Lagging Forward 1
+random 1488991 Lagging_0 Lagging Forward 1
+obs 1490008 Lagging_0 Lagging Forward 1
+obs 1495239 Lagging_0 Lagging Forward 2
+obs 1501691 Lagging_0 Lagging Forward 3
+obs 1502459 Lagging_0 Lagging Forward 1
+random 1502518 Lagging_0 Lagging Forward 1
+obs 1507112 Lagging_0 Lagging Forward 1
+obs 1507827 Lagging_0 Lagging Forward 1
+obs 1512939 Lagging_0 Lagging Forward 1
+obs 1513034 Lagging_0 Lagging Forward 1
+obs 1522184 Lagging_0 Lagging Forward 1
+obs 1523783 Lagging_0 Lagging Forward 2
+random 1525449 Lagging_0 Lagging Forward 1
+obs 1526900 Lagging_0 Lagging Forward 1
+obs 1529675 Lagging_0 Lagging Forward 1
+random 1533069 Lagging_0 Lagging Forward 1
+obs 1537698 Lagging_0 Lagging Forward 1
+obs 1548497 Lagging_0 Lagging Forward 1
+random 1548690 Lagging_0 Lagging Forward 1
+random 1550701 Lagging_0 Lagging Forward 1
+random 1555105 Lagging_0 Lagging Forward 1
+obs 1555723 Lagging_0 Lagging Forward 6
+obs 1556909 Lagging_0 Lagging Forward 2
+random 1559566 Lagging_0 Lagging Forward 1
+obs 1561736 Lagging_0 Lagging Forward 1
+obs 1561748 Lagging_0 Lagging Forward 1
+random 1562610 Lagging_0 Lagging Forward 1
+obs 1564788 Lagging_0 Lagging Forward 1
+obs 1570386 Lagging_0 Lagging Forward 1
+random 1570389 Lagging_0 Lagging Forward 1
+random 1574477 Lagging_0 Lagging Forward 1
+random 1576137 Lagging_0 Lagging Forward 1
+obs 1577460 Lagging_0 Lagging Forward 1
+random 1589767 Lagging_0 Lagging Forward 1
+obs 1590460 Lagging_0 Lagging Forward 1
+random 1593556 Lagging_0 Lagging Forward 1
+obs 1593950 Lagging_0 Lagging Forward 1
+random 1594638 Lagging_0 Lagging Forward 1
+random 1596464 Lagging_0 Lagging Forward 1
+obs 1602637 Lagging_0 Lagging Forward 1
+obs 1603018 Lagging_0 Lagging Forward 1
+random 1605039 Lagging_0 Lagging Forward 1
+random 1608115 Lagging_0 Lagging Forward 1
+obs 1610971 Lagging_0 Lagging Forward 1
+obs 1613205 Lagging_0 Lagging Forward 1
+random 1614178 Lagging_0 Lagging Forward 1
+random 1614199 Lagging_0 Lagging Forward 1
+obs 1614552 Lagging_0 Lagging Forward 1
+random 1621604 Lagging_0 Lagging Forward 1
+random 1623603 Lagging_0 Lagging Forward 1
+random 1626024 Lagging_0 Lagging Forward 1
+random 1626089 Lagging_0 Lagging Forward 1
+random 1627121 Lagging_0 Lagging Forward 1
+random 1628584 Lagging_0 Lagging Forward 1
+obs 1631132 Lagging_0 Lagging Forward 1
+obs 1632360 Lagging_0 Lagging Forward 4
+obs 1633116 Lagging_0 Lagging Forward 1
+obs 1634843 Lagging_0 Lagging Forward 1
+obs 1635432 Lagging_0 Lagging Forward 1
+obs 1639735 Lagging_0 Lagging Forward 1
+obs 1640309 Lagging_0 Lagging Forward 1
+obs 1640876 Lagging_0 Lagging Forward 1
+random 1642639 Lagging_0 Lagging Forward 1
+obs 1643798 Lagging_0 Lagging Forward 1
+random 1646860 Lagging_0 Lagging Forward 1
+random 1649488 Lagging_0 Lagging Forward 1
+random 1651491 Lagging_0 Lagging Forward 1
+random 1652320 Lagging_0 Lagging Forward 1
+random 1655683 Lagging_0 Lagging Forward 1
+random 1658974 Lagging_0 Lagging Forward 1
+random 1659318 Lagging_0 Lagging Forward 1
+random 1665788 Lagging_0 Lagging Forward 1
+obs 1667018 Lagging_0 Lagging Forward 1
+random 1670815 Lagging_0 Lagging Forward 1
+random 1670935 Lagging_0 Lagging Forward 1
+obs 1676258 Lagging_0 Lagging Forward 1
+obs 1678138 Lagging_0 Lagging Forward 1
+random 1686518 Lagging_0 Lagging Forward 1
+random 1690401 Lagging_0 Lagging Forward 1
+obs 1694333 Lagging_0 Lagging Forward 1
+obs 1696306 Lagging_0 Lagging Forward 2
+obs 1697917 Lagging_0 Lagging Forward 2
+random 1701632 Lagging_0 Lagging Forward 1
+obs 1704013 Lagging_0 Lagging Forward 1
+obs 1711097 Lagging_0 Lagging Forward 1
+random 1711533 Lagging_0 Lagging Forward 1
+random 1717280 Lagging_0 Lagging Forward 1
+random 1721749 Lagging_0 Lagging Forward 1
+obs 1724717 Lagging_0 Lagging Forward 1
+obs 1731790 Lagging_0 Lagging Forward 1
+random 1733585 Lagging_0 Lagging Forward 1
+obs 1733615 Lagging_0 Lagging Forward 1
+random 1734732 Lagging_0 Lagging Forward 1
+random 1739676 Lagging_0 Lagging Forward 1
+obs 1741409 Lagging_0 Lagging Forward 1
+random 1749270 Lagging_0 Lagging Forward 1
+random 1767126 Lagging_0 Lagging Forward 1
+obs 1768035 Lagging_0 Lagging Forward 1
+obs 1771328 Lagging_0 Lagging Forward 3
+random 1771909 Lagging_0 Lagging Forward 1
+obs 1772045 Lagging_0 Lagging Forward 1
+obs 1776383 Lagging_0 Lagging Forward 9
+random 1778773 Lagging_0 Lagging Forward 1
+obs 1782768 Lagging_0 Lagging Forward 2
+obs 1785229 Lagging_0 Lagging Forward 3
+obs 1788750 Lagging_0 Lagging Forward 1
+obs 1789489 Lagging_0 Lagging Forward 1
+obs 1792959 Lagging_0 Lagging Forward 1
+obs 1796621 Lagging_0 Lagging Forward 2
+obs 1799539 Lagging_0 Lagging Forward 1
+obs 1803085 Lagging_0 Lagging Forward 1
+random 1804377 Lagging_0 Lagging Forward 1
+random 1808489 Lagging_0 Lagging Forward 1
+random 1808908 Lagging_0 Lagging Forward 1
+random 1809946 Lagging_0 Lagging Forward 1
+obs 1811568 Lagging_0 Lagging Forward 1
+random 1815082 Lagging_0 Lagging Forward 1
+random 1816242 Lagging_0 Lagging Forward 1
+obs 1818174 Lagging_0 Lagging Forward 1
+random 1818986 Lagging_0 Lagging Forward 1
+obs 1825261 Lagging_0 Lagging Forward 1
+random 1826202 Lagging_0 Lagging Forward 1
+obs 1827089 Lagging_0 Lagging Forward 9
+obs 1830367 Lagging_0 Lagging Forward 1
+obs 1833203 Lagging_0 Lagging Forward 1
+random 1835362 Lagging_0 Lagging Forward 1
+random 1836784 Lagging_0 Lagging Forward 1
+random 1838242 Lagging_0 Lagging Forward 1
+random 1840326 Lagging_0 Lagging Forward 1
+random 1846129 Lagging_0 Lagging Forward 1
+obs 1851615 Lagging_0 Lagging Forward 1
+random 1851678 Lagging_0 Lagging Forward 1
+obs 1852822 Lagging_0 Lagging Forward 1
+obs 1859710 Lagging_0 Lagging Forward 1
+obs 1860613 Lagging_0 Lagging Forward 1
+obs 1864085 Lagging_0 Lagging Forward 1
+random 1865434 Lagging_0 Lagging Forward 1
+random 1866971 Lagging_0 Lagging Forward 1
+obs 1872761 Lagging_0 Lagging Forward 1
+obs 1874278 Lagging_0 Lagging Forward 4
+obs 1875367 Lagging_0 Lagging Forward 1
+obs 1880377 Lagging_0 Lagging Forward 4
+random 1881676 Lagging_0 Lagging Forward 1
+random 1881928 Lagging_0 Lagging Forward 1
+obs 1890225 Lagging_0 Lagging Forward 1
+obs 1891280 Lagging_0 Lagging Forward 1
+random 1899286 Lagging_0 Lagging Forward 1
+obs 1902078 Lagging_0 Lagging Forward 1
+random 1905924 Lagging_0 Lagging Forward 1
+obs 1906191 Lagging_0 Lagging Forward 1
+obs 1907086 Lagging_0 Lagging Forward 1
+random 1908548 Lagging_0 Lagging Forward 1
+obs 1908727 Lagging_0 Lagging Forward 1
+obs 1909319 Lagging_0 Lagging Forward 1
+obs 1910691 Lagging_0 Lagging Forward 1
+random 1910730 Lagging_0 Lagging Forward 1
+random 1911722 Lagging_0 Lagging Forward 1
+obs 1915305 Lagging_0 Lagging Forward 1
+random 1915428 Lagging_0 Lagging Forward 1
+obs 1916019 Lagging_0 Lagging Forward 1
+random 1920363 Lagging_0 Lagging Forward 1
+random 1920391 Lagging_0 Lagging Forward 1
+obs 1921342 Lagging_0 Lagging Forward 1
+random 1921594 Lagging_0 Lagging Forward 1
+obs 1923886 Lagging_0 Lagging Forward 1
+obs 1926723 Lagging_0 Lagging Forward 2
+random 1926815 Lagging_0 Lagging Forward 1
+obs 1931317 Lagging_0 Lagging Forward 1
+obs 1931439 Lagging_0 Lagging Forward 1
+obs 1934031 Lagging_0 Lagging Forward 3
+obs 1935366 Lagging_0 Lagging Forward 1
+obs 1937587 Lagging_0 Lagging Forward 1
+random 1937875 Lagging_0 Lagging Forward 1
+random 1941078 Lagging_0 Lagging Forward 1
+obs 1945685 Lagging_0 Lagging Forward 3
+random 1948338 Lagging_0 Lagging Forward 1
+random 1952697 Lagging_0 Lagging Forward 1
+random 1954607 Lagging_0 Lagging Forward 1
+obs 1955529 Lagging_0 Lagging Forward 1
+obs 1955879 Lagging_0 Lagging Forward 1
+obs 1959304 Lagging_0 Lagging Forward 1
+random 1959466 Lagging_0 Lagging Forward 1
+obs 1960596 Lagging_0 Lagging Forward 1
+obs 1961858 Lagging_0 Lagging Forward 1
+obs 1962802 Lagging_0 Lagging Forward 1
+obs 1963305 Lagging_0 Lagging Forward 3
+random 1963962 Lagging_0 Lagging Forward 1
+random 1965106 Lagging_0 Lagging Forward 1
+random 1965697 Lagging_0 Lagging Forward 1
+obs 1965734 Lagging_0 Lagging Forward 1
+obs 1965968 Lagging_0 Lagging Forward 1
+random 1968193 Lagging_0 Lagging Forward 1
+obs 1973789 Lagging_0 Lagging Forward 1
+random 1979776 Lagging_0 Lagging Forward 1
+random 1980506 Lagging_0 Lagging Forward 1
+obs 1984379 Lagging_0 Lagging Forward 2
+obs 1984551 Lagging_0 Lagging Forward 1
+obs 1985248 Lagging_0 Lagging Forward 2
+obs 1985500 Lagging_0 Lagging Forward 1
+random 1985745 Lagging_0 Lagging Forward 1
+random 1986264 Lagging_0 Lagging Forward 1
+obs 1986443 Lagging_0 Lagging Forward 1
+obs 1987689 Lagging_0 Lagging Forward 1
+obs 1989077 Lagging_0 Lagging Forward 1
+obs 1992127 Lagging_0 Lagging Forward 1
+obs 1992170 Lagging_0 Lagging Forward 1
+random 1992636 Lagging_0 Lagging Forward 1
+random 1993522 Lagging_0 Lagging Forward 1
+random 1997420 Lagging_0 Lagging Forward 1
+obs 1999775 Lagging_0 Lagging Forward 1
+obs 2004422 Lagging_0 Lagging Forward 3
+obs 2004847 Lagging_0 Lagging Forward 1
+random 2008285 Lagging_0 Lagging Forward 1
+random 2008459 Lagging_0 Lagging Forward 1
+obs 2009280 Lagging_0 Lagging Forward 1
+obs 2009547 Lagging_0 Lagging Forward 1
+obs 2012476 Lagging_0 Lagging Forward 2
+obs 2012590 Lagging_0 Lagging Forward 1
+obs 2022060 Lagging_0 Lagging Forward 1
+obs 2022090 Lagging_0 Lagging Forward 2
+obs 2024740 Lagging_0 Lagging Forward 1
+random 2026565 Lagging_0 Lagging Forward 1
+random 2027075 Lagging_0 Lagging Forward 1
+random 2027519 Lagging_0 Lagging Forward 1
+random 2028578 Lagging_0 Lagging Forward 1
+random 2032419 Lagging_0 Lagging Forward 1
+random 2036481 Lagging_0 Lagging Forward 1
+random 2037249 Lagging_0 Lagging Forward 1
+obs 2039387 Lagging_0 Lagging Forward 1
+random 2041283 Lagging_0 Lagging Forward 1
+random 2059212 Lagging_0 Lagging Forward 1
+obs 2061145 Lagging_0 Lagging Forward 1
+obs 2063435 Lagging_0 Lagging Forward 1
+obs 2068696 Lagging_0 Lagging Forward 1
+random 2070025 Lagging_0 Lagging Forward 1
+obs 2071795 Lagging_0 Lagging Forward 1
+random 2072344 Lagging_0 Lagging Forward 1
+obs 2077454 Lagging_0 Lagging Forward 1
+random 2078258 Lagging_0 Lagging Forward 1
+random 2081154 Lagging_0 Lagging Forward 1
+obs 2081890 Lagging_0 Lagging Forward 1
+obs 2085318 Lagging_0 Lagging Forward 1
+random 2086436 Lagging_0 Lagging Forward 1
+obs 2087177 Lagging_0 Lagging Forward 1
+obs 2088520 Lagging_0 Lagging Forward 5
+obs 2089753 Lagging_0 Lagging Forward 1
+obs 2092898 Lagging_0 Lagging Forward 1
+obs 2096856 Lagging_0 Lagging Forward 1
+random 2096950 Lagging_0 Lagging Forward 1
+obs 2099596 Lagging_0 Lagging Forward 2
+obs 2103203 Lagging_0 Lagging Forward 1
+obs 2105433 Lagging_0 Lagging Forward 1
+random 2114170 Lagging_0 Lagging Forward 1
+obs 2114293 Lagging_0 Lagging Forward 1
+random 2118647 Lagging_0 Lagging Forward 1
+random 2119388 Lagging_0 Lagging Forward 1
+obs 2120915 Lagging_0 Lagging Forward 1
+obs 2123386 Lagging_0 Lagging Forward 1
+random 2124411 Lagging_0 Lagging Forward 1
+random 2125650 Lagging_0 Lagging Forward 1
+random 2126675 Lagging_0 Lagging Forward 1
+random 2128498 Lagging_0 Lagging Forward 1
+obs 2129611 Lagging_0 Lagging Forward 1
+obs 2134199 Lagging_0 Lagging Forward 1
+random 2140144 Lagging_0 Lagging Forward 1
+obs 2141692 Lagging_0 Lagging Forward 1
+obs 2146543 Lagging_0 Lagging Forward 1
+random 2146955 Lagging_0 Lagging Forward 1
+random 2148555 Lagging_0 Lagging Forward 1
+obs 2150401 Lagging_0 Lagging Forward 1
+obs 2151599 Lagging_0 Lagging Forward 1
+obs 2156820 Lagging_0 Lagging Forward 1
+random 2159717 Lagging_0 Lagging Forward 1
+obs 2167128 Lagging_0 Lagging Forward 1
+obs 2167354 Lagging_0 Lagging Forward 2
+obs 2168497 Lagging_0 Lagging Forward 1
+random 2169840 Lagging_0 Lagging Forward 1
+obs 2172244 Lagging_0 Lagging Forward 3
+random 2173202 Lagging_0 Lagging Forward 1
+obs 2173223 Lagging_0 Lagging Forward 2
+random 2184483 Lagging_0 Lagging Forward 1
+random 2192274 Lagging_0 Lagging Forward 1
+random 2196536 Lagging_0 Lagging Forward 1
+random 2197742 Lagging_0 Lagging Forward 1
+obs 2205639 Lagging_0 Lagging Forward 1
+obs 2213753 Lagging_0 Lagging Forward 1
+obs 2213848 Lagging_0 Lagging Forward 1
+random 2213867 Lagging_0 Lagging Forward 1
+random 2214119 Lagging_0 Lagging Forward 1
+obs 2216168 Lagging_0 Lagging Forward 1
+random 2217008 Lagging_0 Lagging Forward 1
+random 2218355 Lagging_0 Lagging Forward 1
+obs 2221247 Lagging_0 Lagging Forward 1
+random 2221832 Lagging_0 Lagging Forward 1
+obs 2224750 Lagging_0 Lagging Forward 1
+obs 2225815 Lagging_0 Lagging Forward 1
+obs 2227374 Lagging_0 Lagging Forward 1
+obs 2230818 Lagging_0 Lagging Forward 1
+random 2236090 Lagging_0 Lagging Forward 1
+obs 2245420 Lagging_0 Lagging Forward 3
+obs 2245906 Lagging_0 Lagging Forward 1
+random 2248999 Lagging_0 Lagging Forward 1
+obs 2250986 Lagging_0 Lagging Forward 1
+random 2251717 Lagging_0 Lagging Forward 1
+obs 2252203 Lagging_0 Lagging Forward 1
+random 2252629 Lagging_0 Lagging Forward 1
+obs 2253478 Lagging_0 Lagging Forward 1
+obs 2253733 Lagging_0 Lagging Forward 1
+random 2254723 Lagging_0 Lagging Forward 1
+obs 2255636 Lagging_0 Lagging Forward 1
+random 2261039 Lagging_0 Lagging Forward 1
+obs 2261858 Lagging_0 Lagging Forward 8
+obs 2262383 Lagging_0 Lagging Forward 9
+random 2265301 Lagging_0 Lagging Forward 1
+random 2266294 Lagging_0 Lagging Forward 1
+obs 2267473 Lagging_0 Lagging Forward 1
+obs 2267581 Lagging_0 Lagging Forward 2
+obs 2269653 Lagging_0 Lagging Forward 1
+obs 2270391 Lagging_0 Lagging Forward 1
+random 2270933 Lagging_0 Lagging Forward 1
+random 2272047 Lagging_0 Lagging Forward 1
+obs 2275269 Lagging_0 Lagging Forward 1
+random 2280332 Lagging_0 Lagging Forward 1
+random 2286641 Lagging_0 Lagging Forward 1
+obs 2290388 Lagging_0 Lagging Forward 1
+obs 2291530 Lagging_0 Lagging Forward 1
+random 2291962 Lagging_0 Lagging Forward 1
+obs 2292654 Lagging_0 Lagging Forward 1
+obs 2293799 Lagging_0 Lagging Forward 1
+obs 2303560 Lagging_0 Lagging Forward 1
+obs 2303815 Lagging_0 Lagging Forward 1
+random 2312075 Lagging_0 Lagging Forward 1
+obs 2313369 Lagging_0 Lagging Forward 1
+obs 2317257 Lagging_0 Lagging Forward 1
+obs 2320713 Lagging_0 Lagging Forward 1
+obs 4629826 Lagging_0 Lagging Forward 3
+random 4640323 Lagging_0 Lagging Forward 1
+random 2321364 Leading_0 Leading Forward 1
+obs 2321413 Leading_0 Leading Forward 1
+obs 2324113 Leading_0 Leading Forward 1
+random 2325087 Leading_0 Leading Forward 1
+random 2329061 Leading_0 Leading Forward 1
+random 2330004 Leading_0 Leading Forward 1
+random 2331183 Leading_0 Leading Forward 2
+obs 2333301 Leading_0 Leading Forward 1
+obs 2333715 Leading_0 Leading Forward 1
+obs 2333963 Leading_0 Leading Forward 1
+obs 2334508 Leading_0 Leading Forward 2
+obs 2334556 Leading_0 Leading Forward 1
+obs 2335537 Leading_0 Leading Forward 1
+random 2337782 Leading_0 Leading Forward 1
+random 2344303 Leading_0 Leading Forward 1
+random 2346006 Leading_0 Leading Forward 1
+random 2350990 Leading_0 Leading Forward 1
+obs 2352634 Leading_0 Leading Forward 1
+random 2353301 Leading_0 Leading Forward 1
+obs 2354530 Leading_0 Leading Forward 3
+obs 2355736 Leading_0 Leading Forward 2
+random 2357791 Leading_0 Leading Forward 1
+obs 2358418 Leading_0 Leading Forward 1
+obs 2359610 Leading_0 Leading Forward 1
+obs 2359756 Leading_0 Leading Forward 1
+random 2359880 Leading_0 Leading Forward 1
+obs 2360723 Leading_0 Leading Forward 1
+obs 2364312 Leading_0 Leading Forward 1
+random 2364380 Leading_0 Leading Forward 1
+obs 2364440 Leading_0 Leading Forward 1
+obs 2366325 Leading_0 Leading Forward 1
+obs 2367411 Leading_0 Leading Forward 1
+obs 2369182 Leading_0 Leading Forward 1
+obs 2370478 Leading_0 Leading Forward 1
+random 2372356 Leading_0 Leading Forward 1
+random 2375631 Leading_0 Leading Forward 1
+obs 2378827 Leading_0 Leading Forward 1
+obs 2379933 Leading_0 Leading Forward 1
+random 2381377 Leading_0 Leading Forward 1
+obs 2382551 Leading_0 Leading Forward 1
+random 2385516 Leading_0 Leading Forward 1
+random 2387509 Leading_0 Leading Forward 1
+random 2389817 Leading_0 Leading Forward 1
+obs 2393329 Leading_0 Leading Forward 1
+random 2396941 Leading_0 Leading Forward 1
+obs 2399357 Leading_0 Leading Forward 1
+random 2400330 Leading_0 Leading Forward 1
+obs 2404481 Leading_0 Leading Forward 2
+random 2404828 Leading_0 Leading Forward 1
+random 2406599 Leading_0 Leading Forward 1
+random 2417018 Leading_0 Leading Forward 1
+obs 2417345 Leading_0 Leading Forward 2
+obs 2419632 Leading_0 Leading Forward 1
+random 2420685 Leading_0 Leading Forward 1
+random 2423293 Leading_0 Leading Forward 1
+obs 2424042 Leading_0 Leading Forward 1
+obs 2425883 Leading_0 Leading Forward 1
+random 2428674 Leading_0 Leading Forward 1
+random 2428890 Leading_0 Leading Forward 1
+random 2444605 Leading_0 Leading Forward 1
+random 2451903 Leading_0 Leading Forward 1
+obs 2462259 Leading_0 Leading Forward 1
+random 2466300 Leading_0 Leading Forward 1
+obs 2475128 Leading_0 Leading Forward 1
+random 2478023 Leading_0 Leading Forward 1
+random 2479118 Leading_0 Leading Forward 1
+random 2481760 Leading_0 Leading Forward 1
+obs 2489116 Leading_0 Leading Forward 1
+obs 2491406 Leading_0 Leading Forward 1
+obs 2500923 Leading_0 Leading Forward 1
+random 2505663 Leading_0 Leading Forward 1
+random 2511840 Leading_0 Leading Forward 1
+obs 2513207 Leading_0 Leading Forward 1
+obs 2515985 Leading_0 Leading Forward 2
+random 2518416 Leading_0 Leading Forward 1
+random 2518538 Leading_0 Leading Forward 1
+obs 2519131 Leading_0 Leading Forward 1
+obs 2524016 Leading_0 Leading Forward 1
+obs 2526627 Leading_0 Leading Forward 1
+obs 2528680 Leading_0 Leading Forward 1
+obs 2532048 Leading_0 Leading Forward 5
+random 2532735 Leading_0 Leading Forward 1
+obs 2533071 Leading_0 Leading Forward 1
+obs 2533615 Leading_0 Leading Forward 1
+obs 2534851 Leading_0 Leading Forward 2
+random 2539599 Leading_0 Leading Forward 1
+obs 2539656 Leading_0 Leading Forward 1
+random 2542537 Leading_0 Leading Forward 1
+random 2546942 Leading_0 Leading Forward 1
+random 2547125 Leading_0 Leading Forward 1
+obs 2548269 Leading_0 Leading Forward 1
+obs 2551197 Leading_0 Leading Forward 1
+obs 2552776 Leading_0 Leading Forward 1
+random 2555474 Leading_0 Leading Forward 1
+random 2557356 Leading_0 Leading Forward 1
+random 2557757 Leading_0 Leading Forward 1
+obs 2558059 Leading_0 Leading Forward 1
+obs 2560106 Leading_0 Leading Forward 1
+random 2564354 Leading_0 Leading Forward 1
+random 2568195 Leading_0 Leading Forward 1
+random 2577574 Leading_0 Leading Forward 1
+random 2582490 Leading_0 Leading Forward 1
+random 2585315 Leading_0 Leading Forward 1
+obs 2588233 Leading_0 Leading Forward 1
+obs 2588796 Leading_0 Leading Forward 1
+obs 2591285 Leading_0 Leading Forward 2
+random 2591849 Leading_0 Leading Forward 1
+random 2596899 Leading_0 Leading Forward 1
+obs 2598507 Leading_0 Leading Forward 1
+random 2598918 Leading_0 Leading Forward 1
+obs 2599625 Leading_0 Leading Forward 1
+random 2607950 Leading_0 Leading Forward 1
+random 2608987 Leading_0 Leading Forward 1
+random 2609924 Leading_0 Leading Forward 1
+obs 2613808 Leading_0 Leading Forward 4
+obs 2621862 Leading_0 Leading Forward 1
+obs 2624242 Leading_0 Leading Forward 1
+random 2630548 Leading_0 Leading Forward 1
+obs 2634182 Leading_0 Leading Forward 1
+obs 2635235 Leading_0 Leading Forward 1
+obs 2635603 Leading_0 Leading Forward 2
+obs 2637555 Leading_0 Leading Forward 1
+obs 2637826 Leading_0 Leading Forward 1
+obs 2638050 Leading_0 Leading Forward 1
+obs 2642092 Leading_0 Leading Forward 1
+random 2642662 Leading_0 Leading Forward 1
+random 2644930 Leading_0 Leading Forward 1
+random 2646122 Leading_0 Leading Forward 1
+random 2646125 Leading_0 Leading Forward 1
+obs 2647468 Leading_0 Leading Forward 1
+random 2649311 Leading_0 Leading Forward 1
+random 2652818 Leading_0 Leading Forward 1
+random 2661511 Leading_0 Leading Forward 1
+random 2664890 Leading_0 Leading Forward 1
+obs 2667548 Leading_0 Leading Forward 1
+random 2672125 Leading_0 Leading Forward 1
+obs 2678543 Leading_0 Leading Forward 1
+random 2684529 Leading_0 Leading Forward 1
+obs 2684908 Leading_0 Leading Forward 1
+obs 2688713 Leading_0 Leading Forward 1
+obs 2689615 Leading_0 Leading Forward 1
+random 2699591 Leading_0 Leading Forward 1
+obs 2703258 Leading_0 Leading Forward 1
+random 2704644 Leading_0 Leading Forward 1
+random 2708112 Leading_0 Leading Forward 1
+obs 2709840 Leading_0 Leading Forward 1
+obs 2712664 Leading_0 Leading Forward 1
+obs 2715494 Leading_0 Leading Forward 1
+random 2719361 Leading_0 Leading Forward 1
+random 2722492 Leading_0 Leading Forward 1
+random 2723381 Leading_0 Leading Forward 1
+random 2729161 Leading_0 Leading Forward 1
+random 2733278 Leading_0 Leading Forward 1
+random 2739133 Leading_0 Leading Forward 1
+random 2743183 Leading_0 Leading Forward 1
+random 2744392 Leading_0 Leading Forward 1
+random 2749008 Leading_0 Leading Forward 1
+random 2749812 Leading_0 Leading Forward 1
+obs 2749888 Leading_0 Leading Forward 1
+obs 2750501 Leading_0 Leading Forward 1
+random 2751342 Leading_0 Leading Forward 1
+random 2751838 Leading_0 Leading Forward 1
+random 2753837 Leading_0 Leading Forward 1
+obs 2755891 Leading_0 Leading Forward 1
+obs 2759064 Leading_0 Leading Forward 1
+random 2761464 Leading_0 Leading Forward 1
+obs 2762106 Leading_0 Leading Forward 1
+random 2762415 Leading_0 Leading Forward 1
+random 2763603 Leading_0 Leading Forward 1
+obs 2765329 Leading_0 Leading Forward 2
+random 2765511 Leading_0 Leading Forward 1
+random 2768130 Leading_0 Leading Forward 1
+random 2770158 Leading_0 Leading Forward 1
+random 2771073 Leading_0 Leading Forward 1
+obs 2774237 Leading_0 Leading Forward 1
+obs 2775199 Leading_0 Leading Forward 3
+random 2776664 Leading_0 Leading Forward 1
+random 2779764 Leading_0 Leading Forward 1
+obs 2781973 Leading_0 Leading Forward 1
+obs 2782321 Leading_0 Leading Forward 1
+obs 2783167 Leading_0 Leading Forward 2
+obs 2788779 Leading_0 Leading Forward 1
+random 2796850 Leading_0 Leading Forward 1
+obs 2798634 Leading_0 Leading Forward 1
+obs 2798904 Leading_0 Leading Forward 2
+random 2800885 Leading_0 Leading Forward 1
+random 2804388 Leading_0 Leading Forward 1
+random 2805213 Leading_0 Leading Forward 1
+random 2805702 Leading_0 Leading Forward 1
+random 2806182 Leading_0 Leading Forward 1
+random 2808170 Leading_0 Leading Forward 1
+obs 2809112 Leading_0 Leading Forward 3
+obs 2816421 Leading_0 Leading Forward 1
+obs 2818007 Leading_0 Leading Forward 1
+obs 2819001 Leading_0 Leading Forward 1
+random 2824955 Leading_0 Leading Forward 1
+obs 2826377 Leading_0 Leading Forward 1
+obs 2828136 Leading_0 Leading Forward 1
+obs 2830071 Leading_0 Leading Forward 3
+obs 2830631 Leading_0 Leading Forward 1
+obs 2834733 Leading_0 Leading Forward 2
+obs 2836082 Leading_0 Leading Forward 1
+random 2839690 Leading_0 Leading Forward 1
+obs 2841630 Leading_0 Leading Forward 1
+obs 2842964 Leading_0 Leading Forward 2
+random 2843703 Leading_0 Leading Forward 1
+random 2851670 Leading_0 Leading Forward 1
+obs 2853229 Leading_0 Leading Forward 1
+obs 2853525 Leading_0 Leading Forward 2
+random 2855872 Leading_0 Leading Forward 1
+obs 2857108 Leading_0 Leading Forward 1
+obs 2857655 Leading_0 Leading Forward 1
+random 2861945 Leading_0 Leading Forward 1
+random 2862291 Leading_0 Leading Forward 1
+random 2864051 Leading_0 Leading Forward 1
+random 2870380 Leading_0 Leading Forward 1
+random 2874498 Leading_0 Leading Forward 1
+obs 2879830 Leading_0 Leading Forward 2
+random 2886328 Leading_0 Leading Forward 1
+obs 2892060 Leading_0 Leading Forward 1
+obs 2894649 Leading_0 Leading Forward 1
+obs 2896824 Leading_0 Leading Forward 1
+random 2897631 Leading_0 Leading Forward 1
+random 2900126 Leading_0 Leading Forward 1
+random 2906405 Leading_0 Leading Forward 1
+obs 2907653 Leading_0 Leading Forward 2
+random 2909424 Leading_0 Leading Forward 1
+random 2911047 Leading_0 Leading Forward 1
+random 2913800 Leading_0 Leading Forward 1
+obs 2915008 Leading_0 Leading Forward 1
+random 2916701 Leading_0 Leading Forward 1
+random 2917529 Leading_0 Leading Forward 1
+obs 2919449 Leading_0 Leading Forward 10
+random 2923055 Leading_0 Leading Forward 2
+obs 2925913 Leading_0 Leading Forward 1
+random 2933447 Leading_0 Leading Forward 1
+random 2938548 Leading_0 Leading Forward 1
+random 2943897 Leading_0 Leading Forward 1
+obs 2964605 Leading_0 Leading Forward 5
+random 2966923 Leading_0 Leading Forward 1
+random 2969433 Leading_0 Leading Forward 1
+obs 2977079 Leading_0 Leading Forward 2
+random 2980807 Leading_0 Leading Forward 1
+obs 2981650 Leading_0 Leading Forward 1
+random 2984677 Leading_0 Leading Forward 1
+obs 2987658 Leading_0 Leading Forward 1
+random 2989492 Leading_0 Leading Forward 1
+random 2992624 Leading_0 Leading Forward 1
+obs 2993211 Leading_0 Leading Forward 1
+obs 2994989 Leading_0 Leading Forward 1
+obs 2998638 Leading_0 Leading Forward 1
+random 2999399 Leading_0 Leading Forward 1
+random 3006214 Leading_0 Leading Forward 1
+random 3007778 Leading_0 Leading Forward 1
+obs 3008251 Leading_0 Leading Forward 1
+random 3013138 Leading_0 Leading Forward 1
+obs 3015313 Leading_0 Leading Forward 1
+obs 3016526 Leading_0 Leading Forward 2
+random 3018659 Leading_0 Leading Forward 1
+obs 3019036 Leading_0 Leading Forward 1
+random 3019152 Leading_0 Leading Forward 1
+random 3022281 Leading_0 Leading Forward 1
+obs 3024250 Leading_0 Leading Forward 1
+random 3025510 Leading_0 Leading Forward 1
+random 3028478 Leading_0 Leading Forward 1
+obs 3036279 Leading_0 Leading Forward 1
+random 3036972 Leading_0 Leading Forward 1
+obs 3044839 Leading_0 Leading Forward 1
+random 3052180 Leading_0 Leading Forward 1
+random 3052668 Leading_0 Leading Forward 1
+random 3054464 Leading_0 Leading Forward 1
+obs 3056282 Leading_0 Leading Forward 1
+random 3062816 Leading_0 Leading Forward 1
+random 3063428 Leading_0 Leading Forward 1
+random 3064402 Leading_0 Leading Forward 1
+random 3070650 Leading_0 Leading Forward 1
+random 3078857 Leading_0 Leading Forward 1
+random 3082730 Leading_0 Leading Forward 1
+obs 3082826 Leading_0 Leading Forward 1
+random 3085400 Leading_0 Leading Forward 1
+obs 3090753 Leading_0 Leading Forward 1
+obs 3097689 Leading_0 Leading Forward 1
+obs 3097930 Leading_0 Leading Forward 1
+obs 3097942 Leading_0 Leading Forward 2
+random 3098010 Leading_0 Leading Forward 1
+random 3098091 Leading_0 Leading Forward 1
+obs 3098173 Leading_0 Leading Forward 2
+obs 3107661 Leading_0 Leading Forward 8
+random 3112244 Leading_0 Leading Forward 1
+random 3113847 Leading_0 Leading Forward 1
+random 3115120 Leading_0 Leading Forward 1
+obs 3116763 Leading_0 Leading Forward 1
+random 3117143 Leading_0 Leading Forward 1
+random 3122274 Leading_0 Leading Forward 1
+obs 3127302 Leading_0 Leading Forward 1
+random 3139818 Leading_0 Leading Forward 1
+random 3141707 Leading_0 Leading Forward 1
+random 3144355 Leading_0 Leading Forward 1
+random 3145548 Leading_0 Leading Forward 1
+random 3148161 Leading_0 Leading Forward 1
+obs 3151322 Leading_0 Leading Forward 1
+random 3154543 Leading_0 Leading Forward 1
+random 3162952 Leading_0 Leading Forward 1
+random 3166735 Leading_0 Leading Forward 1
+random 3177294 Leading_0 Leading Forward 1
+random 3179819 Leading_0 Leading Forward 1
+random 3180159 Leading_0 Leading Forward 1
+random 3184440 Leading_0 Leading Forward 1
+random 3188383 Leading_0 Leading Forward 1
+random 3190655 Leading_0 Leading Forward 1
+random 3192417 Leading_0 Leading Forward 1
+random 3199440 Leading_0 Leading Forward 1
+obs 3200889 Leading_0 Leading Forward 1
+obs 3201416 Leading_0 Leading Forward 1
+random 3205809 Leading_0 Leading Forward 1
+obs 3206164 Leading_0 Leading Forward 3
+random 3212951 Leading_0 Leading Forward 1
+random 3213285 Leading_0 Leading Forward 1
+random 3220073 Leading_0 Leading Forward 1
+random 3223307 Leading_0 Leading Forward 1
+random 3223646 Leading_0 Leading Forward 1
+random 3224350 Leading_0 Leading Forward 1
+random 3224914 Leading_0 Leading Forward 1
+random 3227068 Leading_0 Leading Forward 1
+random 3231420 Leading_0 Leading Forward 1
+random 3233131 Leading_0 Leading Forward 1
+random 3234786 Leading_0 Leading Forward 1
+random 3236685 Leading_0 Leading Forward 1
+random 3237134 Leading_0 Leading Forward 1
+random 3243862 Leading_0 Leading Forward 1
+random 3244189 Leading_0 Leading Forward 1
+random 3245491 Leading_0 Leading Forward 1
+random 3245852 Leading_0 Leading Forward 1
+random 3251916 Leading_0 Leading Forward 1
+random 3253376 Leading_0 Leading Forward 1
+random 3255400 Leading_0 Leading Forward 1
+random 3263309 Leading_0 Leading Forward 1
+obs 3266061 Leading_0 Leading Forward 1
+random 3267563 Leading_0 Leading Forward 1
+obs 3268970 Leading_0 Leading Forward 1
+obs 3270034 Leading_0 Leading Forward 1
+random 3276955 Leading_0 Leading Forward 1
+obs 3285561 Leading_0 Leading Forward 3
+random 3286239 Leading_0 Leading Forward 1
+obs 3286434 Leading_0 Leading Forward 1
+obs 3286677 Leading_0 Leading Forward 1
+random 3290943 Leading_0 Leading Forward 1
+obs 3291234 Leading_0 Leading Forward 1
+random 3292991 Leading_0 Leading Forward 1
+random 3297456 Leading_0 Leading Forward 1
+random 3297738 Leading_0 Leading Forward 1
+random 3300132 Leading_0 Leading Forward 1
+random 3305484 Leading_0 Leading Forward 1
+random 3308151 Leading_0 Leading Forward 1
+obs 3310131 Leading_0 Leading Forward 1
+random 3320170 Leading_0 Leading Forward 1
+random 3332121 Leading_0 Leading Forward 1
+obs 3343662 Leading_0 Leading Forward 3
+obs 3345426 Leading_0 Leading Forward 2
+random 3350530 Leading_0 Leading Forward 1
+random 3351026 Leading_0 Leading Forward 1
+random 3352741 Leading_0 Leading Forward 1
+obs 3362630 Leading_0 Leading Forward 1
+random 3362938 Leading_0 Leading Forward 1
+random 3372115 Leading_0 Leading Forward 1
+random 3380285 Leading_0 Leading Forward 1
+random 3383311 Leading_0 Leading Forward 1
+random 3383696 Leading_0 Leading Forward 1
+obs 3392951 Leading_0 Leading Forward 1
+random 3397257 Leading_0 Leading Forward 1
+random 3397434 Leading_0 Leading Forward 1
+obs 3401796 Leading_0 Leading Forward 1
+obs 3402483 Leading_0 Leading Forward 1
+random 3403261 Leading_0 Leading Forward 1
+random 3412747 Leading_0 Leading Forward 1
+obs 3414428 Leading_0 Leading Forward 1
+random 3427184 Leading_0 Leading Forward 1
+random 3429743 Leading_0 Leading Forward 1
+random 3429993 Leading_0 Leading Forward 1
+random 3441326 Leading_0 Leading Forward 1
+random 3443753 Leading_0 Leading Forward 1
+obs 3445272 Leading_0 Leading Forward 1
+obs 3446251 Leading_0 Leading Forward 1
+obs 3446471 Leading_0 Leading Forward 1
+random 3457097 Leading_0 Leading Forward 1
+random 3464315 Leading_0 Leading Forward 1
+random 3465654 Leading_0 Leading Forward 1
+random 3466707 Leading_0 Leading Forward 1
+random 3468095 Leading_0 Leading Forward 1
+random 3471403 Leading_0 Leading Forward 1
+random 3471820 Leading_0 Leading Forward 1
+random 3476220 Leading_0 Leading Forward 1
+obs 3482634 Leading_0 Leading Forward 2
+obs 3486027 Leading_0 Leading Forward 1
+obs 3492096 Leading_0 Leading Forward 1
+obs 3494985 Leading_0 Leading Forward 1
+random 3497249 Leading_0 Leading Forward 1
+obs 3497943 Leading_0 Leading Forward 1
+random 3497990 Leading_0 Leading Forward 1
+random 3499052 Leading_0 Leading Forward 1
+random 3500268 Leading_0 Leading Forward 1
+obs 3500534 Leading_0 Leading Forward 1
+random 3504425 Leading_0 Leading Forward 1
+random 3510447 Leading_0 Leading Forward 1
+obs 3513978 Leading_0 Leading Forward 2
+random 3515223 Leading_0 Leading Forward 1
+obs 3516243 Leading_0 Leading Forward 1
+obs 3516383 Leading_0 Leading Forward 1
+random 3517102 Leading_0 Leading Forward 1
+random 3520527 Leading_0 Leading Forward 1
+obs 3521046 Leading_0 Leading Forward 1
+obs 3534654 Leading_0 Leading Forward 1
+random 3536662 Leading_0 Leading Forward 1
+obs 3540745 Leading_0 Leading Forward 1
+random 3541367 Leading_0 Leading Forward 1
+random 3542231 Leading_0 Leading Forward 1
+random 3543373 Leading_0 Leading Forward 1
+random 3547810 Leading_0 Leading Forward 1
+obs 3548251 Leading_0 Leading Forward 3
+random 3550572 Leading_0 Leading Forward 1
+random 3564585 Leading_0 Leading Forward 1
+obs 3577007 Leading_0 Leading Forward 1
+random 3587072 Leading_0 Leading Forward 1
+random 3592485 Leading_0 Leading Forward 1
+obs 3598349 Leading_0 Leading Forward 1
+random 3602081 Leading_0 Leading Forward 1
+random 3610591 Leading_0 Leading Forward 1
+random 3622220 Leading_0 Leading Forward 1
+random 3623789 Leading_0 Leading Forward 1
+random 3626564 Leading_0 Leading Forward 1
+obs 3628570 Leading_0 Leading Forward 1
+obs 3629251 Leading_0 Leading Forward 1
+random 3629725 Leading_0 Leading Forward 1
+random 3630804 Leading_0 Leading Forward 1
+random 3631459 Leading_0 Leading Forward 1
+random 3642827 Leading_0 Leading Forward 1
+obs 3642838 Leading_0 Leading Forward 2
+random 3644546 Leading_0 Leading Forward 1
+obs 3647139 Leading_0 Leading Forward 1
+random 3656918 Leading_0 Leading Forward 1
+random 3657252 Leading_0 Leading Forward 1
+random 3658904 Leading_0 Leading Forward 1
+random 3658997 Leading_0 Leading Forward 1
+random 3659478 Leading_0 Leading Forward 1
+obs 3659745 Leading_0 Leading Forward 1
+obs 3661156 Leading_0 Leading Forward 1
+random 3667333 Leading_0 Leading Forward 1
+random 3667790 Leading_0 Leading Forward 1
+random 3673238 Leading_0 Leading Forward 1
+random 3677220 Leading_0 Leading Forward 1
+random 3678757 Leading_0 Leading Forward 1
+obs 3680681 Leading_0 Leading Forward 2
+obs 3681519 Leading_0 Leading Forward 1
+random 3684861 Leading_0 Leading Forward 1
+random 3686602 Leading_0 Leading Forward 1
+obs 3695237 Leading_0 Leading Forward 1
+random 3701422 Leading_0 Leading Forward 1
+obs 3706384 Leading_0 Leading Forward 1
+random 3708984 Leading_0 Leading Forward 1
+random 3714360 Leading_0 Leading Forward 1
+random 3716069 Leading_0 Leading Forward 1
+random 3719039 Leading_0 Leading Forward 1
+obs 3734548 Leading_0 Leading Forward 1
+random 3737433 Leading_0 Leading Forward 1
+random 3739127 Leading_0 Leading Forward 1
+obs 3745757 Leading_0 Leading Forward 1
+random 3745991 Leading_0 Leading Forward 1
+random 3746693 Leading_0 Leading Forward 1
+random 3749500 Leading_0 Leading Forward 1
+random 3752992 Leading_0 Leading Forward 1
+random 3753255 Leading_0 Leading Forward 1
+obs 3756458 Leading_0 Leading Forward 1
+random 3757976 Leading_0 Leading Forward 1
+random 3758377 Leading_0 Leading Forward 1
+random 3759505 Leading_0 Leading Forward 1
+obs 3761565 Leading_0 Leading Forward 3
+obs 3761699 Leading_0 Leading Forward 2
+obs 3761786 Leading_0 Leading Forward 3
+obs 3763688 Leading_0 Leading Forward 1
+random 3769311 Leading_0 Leading Forward 1
+obs 3785822 Leading_0 Leading Forward 1
+obs 3800256 Leading_0 Leading Forward 1
+obs 3800537 Leading_0 Leading Forward 1
+random 3802043 Leading_0 Leading Forward 1
+random 3808126 Leading_0 Leading Forward 1
+random 3819790 Leading_0 Leading Forward 1
+random 3822424 Leading_0 Leading Forward 1
+obs 3830340 Leading_0 Leading Forward 1
+obs 3834485 Leading_0 Leading Forward 1
+obs 3842721 Leading_0 Leading Forward 1
+random 3844991 Leading_0 Leading Forward 1
+random 3851061 Leading_0 Leading Forward 1
+random 3852352 Leading_0 Leading Forward 1
+random 3854230 Leading_0 Leading Forward 1
+random 3858451 Leading_0 Leading Forward 1
+obs 3859545 Leading_0 Leading Forward 39
+obs 3859559 Leading_0 Leading Forward 1
+random 3860021 Leading_0 Leading Forward 1
+random 3865296 Leading_0 Leading Forward 1
+random 3868420 Leading_0 Leading Forward 1
+obs 3871794 Leading_0 Leading Forward 1
+random 3872699 Leading_0 Leading Forward 1
+obs 3872965 Leading_0 Leading Forward 1
+random 3882407 Leading_0 Leading Forward 1
+random 3882941 Leading_0 Leading Forward 1
+random 3891769 Leading_0 Leading Forward 1
+obs 3897952 Leading_0 Leading Forward 2
+random 3901712 Leading_0 Leading Forward 1
+obs 3902320 Leading_0 Leading Forward 2
+random 3902900 Leading_0 Leading Forward 1
+random 3903581 Leading_0 Leading Forward 1
+random 3905643 Leading_0 Leading Forward 1
+obs 3906837 Leading_0 Leading Forward 1
+random 3907397 Leading_0 Leading Forward 1
+obs 3913810 Leading_0 Leading Forward 1
+random 3915122 Leading_0 Leading Forward 1
+random 3918565 Leading_0 Leading Forward 1
+random 3923744 Leading_0 Leading Forward 1
+obs 3924316 Leading_0 Leading Forward 2
+obs 3924878 Leading_0 Leading Forward 1
+obs 3932131 Leading_0 Leading Forward 1
+random 3934335 Leading_0 Leading Forward 1
+obs 3942565 Leading_0 Leading Forward 1
+random 3945702 Leading_0 Leading Forward 1
+obs 3947484 Leading_0 Leading Forward 1
+obs 3948286 Leading_0 Leading Forward 1
+obs 3948501 Leading_0 Leading Forward 1
+random 3954823 Leading_0 Leading Forward 1
+random 3958057 Leading_0 Leading Forward 1
+random 3965095 Leading_0 Leading Forward 1
+random 3966271 Leading_0 Leading Forward 1
+random 3974494 Leading_0 Leading Forward 1
+random 3986880 Leading_0 Leading Forward 1
+random 3988055 Leading_0 Leading Forward 1
+obs 3997172 Leading_0 Leading Forward 1
+random 4003162 Leading_0 Leading Forward 1
+random 4009648 Leading_0 Leading Forward 1
+obs 4010858 Leading_0 Leading Forward 1
+random 4011813 Leading_0 Leading Forward 1
+random 4012140 Leading_0 Leading Forward 1
+random 4012878 Leading_0 Leading Forward 1
+random 4027226 Leading_0 Leading Forward 1
+random 4029906 Leading_0 Leading Forward 1
+obs 4030366 Leading_0 Leading Forward 3
+random 4042591 Leading_0 Leading Forward 1
+random 4044555 Leading_0 Leading Forward 1
+random 4059032 Leading_0 Leading Forward 1
+random 4059158 Leading_0 Leading Forward 1
+obs 4064190 Leading_0 Leading Forward 1
+obs 4065028 Leading_0 Leading Forward 2
+obs 4071647 Leading_0 Leading Forward 1
+random 4077866 Leading_0 Leading Forward 1
+obs 4078684 Leading_0 Leading Forward 2
+random 4078905 Leading_0 Leading Forward 1
+random 4084378 Leading_0 Leading Forward 1
+random 4090730 Leading_0 Leading Forward 1
+random 4096078 Leading_0 Leading Forward 1
+obs 4097407 Leading_0 Leading Forward 1
+random 4107939 Leading_0 Leading Forward 1
+random 4109471 Leading_0 Leading Forward 1
+obs 4111551 Leading_0 Leading Forward 1
+random 4113413 Leading_0 Leading Forward 1
+random 4114285 Leading_0 Leading Forward 1
+random 4117263 Leading_0 Leading Forward 1
+obs 4118945 Leading_0 Leading Forward 1
+random 4121307 Leading_0 Leading Forward 1
+random 4122185 Leading_0 Leading Forward 1
+random 4123790 Leading_0 Leading Forward 1
+random 4129439 Leading_0 Leading Forward 1
+random 4137528 Leading_0 Leading Forward 1
+random 4138817 Leading_0 Leading Forward 1
+obs 4144618 Leading_0 Leading Forward 1
+random 4145429 Leading_0 Leading Forward 1
+random 4148218 Leading_0 Leading Forward 1
+random 4149290 Leading_0 Leading Forward 1
+random 4165671 Leading_0 Leading Forward 1
+random 4171174 Leading_0 Leading Forward 1
+random 4192580 Leading_0 Leading Forward 1
+obs 4196103 Leading_0 Leading Forward 1
+obs 4197786 Leading_0 Leading Forward 2
+random 4199987 Leading_0 Leading Forward 1
+random 4201079 Leading_0 Leading Forward 1
+random 4202368 Leading_0 Leading Forward 1
+random 4202732 Leading_0 Leading Forward 1
+obs 4208537 Leading_0 Leading Forward 1
+random 4223047 Leading_0 Leading Forward 1
+random 4242809 Leading_0 Leading Forward 1
+random 4244575 Leading_0 Leading Forward 1
+random 4250531 Leading_0 Leading Forward 1
+random 4256371 Leading_0 Leading Forward 1
+random 4258217 Leading_0 Leading Forward 1
+obs 4269389 Leading_0 Leading Forward 1
+obs 4271501 Leading_0 Leading Forward 1
+obs 4278384 Leading_0 Leading Forward 2
+random 4292801 Leading_0 Leading Forward 1
+random 4293998 Leading_0 Leading Forward 1
+random 4300451 Leading_0 Leading Forward 1
+random 4300509 Leading_0 Leading Forward 1
+random 4304687 Leading_0 Leading Forward 1
+random 4308851 Leading_0 Leading Forward 1
+obs 4310696 Leading_0 Leading Forward 1
+random 4312253 Leading_0 Leading Forward 1
+random 4314950 Leading_0 Leading Forward 1
+random 4315558 Leading_0 Leading Forward 1
+random 4315564 Leading_0 Leading Forward 1
+random 4319878 Leading_0 Leading Forward 1
+random 4321774 Leading_0 Leading Forward 1
+random 4322742 Leading_0 Leading Forward 1
+obs 4324725 Leading_0 Leading Forward 1
+random 4329321 Leading_0 Leading Forward 1
+random 4330491 Leading_0 Leading Forward 1
+random 4335825 Leading_0 Leading Forward 1
+random 4337842 Leading_0 Leading Forward 1
+random 4348378 Leading_0 Leading Forward 1
+random 4353912 Leading_0 Leading Forward 1
+obs 4355381 Leading_0 Leading Forward 1
+obs 4361428 Leading_0 Leading Forward 3
+random 4366548 Leading_0 Leading Forward 1
+random 4368979 Leading_0 Leading Forward 1
+random 4371086 Leading_0 Leading Forward 1
+random 4378646 Leading_0 Leading Forward 1
+random 4381174 Leading_0 Leading Forward 1
+obs 4385808 Leading_0 Leading Forward 1
+random 4388623 Leading_0 Leading Forward 1
+random 4391759 Leading_0 Leading Forward 1
+random 4394780 Leading_0 Leading Forward 1
+random 4407002 Leading_0 Leading Forward 1
+random 4407020 Leading_0 Leading Forward 1
+obs 4412766 Leading_0 Leading Forward 1
+random 4413135 Leading_0 Leading Forward 1
+random 4415854 Leading_0 Leading Forward 1
+obs 4416387 Leading_0 Leading Forward 2
+random 4416814 Leading_0 Leading Forward 1
+obs 4421730 Leading_0 Leading Forward 1
+random 4421788 Leading_0 Leading Forward 1
+random 4422033 Leading_0 Leading Forward 1
+obs 4425130 Leading_0 Leading Forward 1
+random 4426888 Leading_0 Leading Forward 1
+random 4435360 Leading_0 Leading Forward 1
+obs 4437756 Leading_0 Leading Forward 1
+obs 4438293 Leading_0 Leading Forward 2
+random 4438360 Leading_0 Leading Forward 1
+random 4461245 Leading_0 Leading Forward 1
+random 4462383 Leading_0 Leading Forward 1
+random 4477280 Leading_0 Leading Forward 1
+random 4491265 Leading_0 Leading Forward 1
+random 4503888 Leading_0 Leading Forward 1
+obs 4504336 Leading_0 Leading Forward 1
+obs 4505826 Leading_0 Leading Forward 1
+random 4521599 Leading_0 Leading Forward 1
+random 4542420 Leading_0 Leading Forward 1
+random 4543107 Leading_0 Leading Forward 1
+random 4543627 Leading_0 Leading Forward 1
+obs 4545225 Leading_0 Leading Forward 1
+random 4556390 Leading_0 Leading Forward 1
+random 4562918 Leading_0 Leading Forward 1
+random 4563317 Leading_0 Leading Forward 1
+random 4568479 Leading_0 Leading Forward 1
+obs 4592008 Leading_0 Leading Forward 1
+random 4593951 Leading_0 Leading Forward 1
+random 4594578 Leading_0 Leading Forward 1
+random 4607316 Leading_0 Leading Forward 1
+random 4607610 Leading_0 Leading Forward 1
+random 4608630 Leading_0 Leading Forward 1
+random 2321850 Lagging_16 Lagging Reverse 1
+obs 2324508 Lagging_16 Lagging Reverse 2
+obs 2327776 Lagging_16 Lagging Reverse 1
+obs 2331238 Lagging_16 Lagging Reverse 1
+obs 2332118 Lagging_16 Lagging Reverse 2
+obs 2332191 Lagging_16 Lagging Reverse 2
+obs 2333673 Lagging_16 Lagging Reverse 2
+obs 2335573 Lagging_16 Lagging Reverse 1
+obs 2336464 Lagging_16 Lagging Reverse 1
+random 2338951 Lagging_16 Lagging Reverse 1
+obs 2343021 Lagging_16 Lagging Reverse 3
+obs 2345096 Lagging_16 Lagging Reverse 1
+random 2347096 Lagging_16 Lagging Reverse 1
+obs 2349156 Lagging_16 Lagging Reverse 15
+random 2351038 Lagging_16 Lagging Reverse 1
+obs 2352945 Lagging_16 Lagging Reverse 2
+obs 2353039 Lagging_16 Lagging Reverse 1
+obs 2355516 Lagging_16 Lagging Reverse 1
+random 2357698 Lagging_16 Lagging Reverse 1
+random 2359733 Lagging_16 Lagging Reverse 1
+obs 2361120 Lagging_16 Lagging Reverse 6
+obs 2364046 Lagging_16 Lagging Reverse 1
+obs 2364432 Lagging_16 Lagging Reverse 1
+obs 2365702 Lagging_16 Lagging Reverse 1
+random 2365702 Lagging_16 Lagging Reverse 1
+random 2368103 Lagging_16 Lagging Reverse 1
+random 2377110 Lagging_16 Lagging Reverse 1
+random 2378230 Lagging_16 Lagging Reverse 1
+obs 2378819 Lagging_16 Lagging Reverse 21
+random 2382145 Lagging_16 Lagging Reverse 1
+obs 2382541 Lagging_16 Lagging Reverse 1
+obs 2382543 Lagging_16 Lagging Reverse 5
+random 2385256 Lagging_16 Lagging Reverse 1
+random 2386183 Lagging_16 Lagging Reverse 1
+random 2391027 Lagging_16 Lagging Reverse 1
+obs 2394256 Lagging_16 Lagging Reverse 1
+random 2394364 Lagging_16 Lagging Reverse 1
+obs 2396411 Lagging_16 Lagging Reverse 1
+random 2396422 Lagging_16 Lagging Reverse 1
+obs 2399745 Lagging_16 Lagging Reverse 1
+obs 2401118 Lagging_16 Lagging Reverse 1
+random 2403451 Lagging_16 Lagging Reverse 1
+obs 2406336 Lagging_16 Lagging Reverse 1
+obs 2406789 Lagging_16 Lagging Reverse 1
+random 2408611 Lagging_16 Lagging Reverse 1
+obs 2408742 Lagging_16 Lagging Reverse 1
+random 2410354 Lagging_16 Lagging Reverse 1
+obs 2413095 Lagging_16 Lagging Reverse 1
+obs 2413106 Lagging_16 Lagging Reverse 1
+random 2413146 Lagging_16 Lagging Reverse 1
+obs 2413596 Lagging_16 Lagging Reverse 1
+obs 2413695 Lagging_16 Lagging Reverse 1
+obs 2419342 Lagging_16 Lagging Reverse 2
+random 2421433 Lagging_16 Lagging Reverse 1
+obs 2422747 Lagging_16 Lagging Reverse 1
+obs 2424167 Lagging_16 Lagging Reverse 1
+obs 2424912 Lagging_16 Lagging Reverse 1
+random 2426626 Lagging_16 Lagging Reverse 1
+obs 2427894 Lagging_16 Lagging Reverse 1
+random 2428653 Lagging_16 Lagging Reverse 1
+obs 2428843 Lagging_16 Lagging Reverse 1
+obs 2429029 Lagging_16 Lagging Reverse 1
+random 2435938 Lagging_16 Lagging Reverse 1
+obs 2435989 Lagging_16 Lagging Reverse 1
+obs 2443021 Lagging_16 Lagging Reverse 1
+obs 2444063 Lagging_16 Lagging Reverse 1
+obs 2447560 Lagging_16 Lagging Reverse 1
+obs 2451142 Lagging_16 Lagging Reverse 1
+random 2459101 Lagging_16 Lagging Reverse 1
+random 2461562 Lagging_16 Lagging Reverse 1
+obs 2462874 Lagging_16 Lagging Reverse 1
+obs 2463077 Lagging_16 Lagging Reverse 1
+random 2467382 Lagging_16 Lagging Reverse 1
+obs 2470531 Lagging_16 Lagging Reverse 7
+random 2474772 Lagging_16 Lagging Reverse 1
+random 2486251 Lagging_16 Lagging Reverse 1
+obs 2486805 Lagging_16 Lagging Reverse 1
+random 2489454 Lagging_16 Lagging Reverse 1
+obs 2498573 Lagging_16 Lagging Reverse 1
+obs 2501160 Lagging_16 Lagging Reverse 1
+random 2505325 Lagging_16 Lagging Reverse 1
+random 2509721 Lagging_16 Lagging Reverse 1
+obs 2513137 Lagging_16 Lagging Reverse 1
+obs 2518487 Lagging_16 Lagging Reverse 1
+obs 2519070 Lagging_16 Lagging Reverse 1
+obs 2522162 Lagging_16 Lagging Reverse 1
+obs 2524008 Lagging_16 Lagging Reverse 1
+obs 2524160 Lagging_16 Lagging Reverse 1
+random 2525360 Lagging_16 Lagging Reverse 1
+obs 2528748 Lagging_16 Lagging Reverse 1
+obs 2528922 Lagging_16 Lagging Reverse 1
+random 2530127 Lagging_16 Lagging Reverse 1
+obs 2532004 Lagging_16 Lagging Reverse 1
+obs 2532298 Lagging_16 Lagging Reverse 1
+random 2532961 Lagging_16 Lagging Reverse 1
+obs 2534843 Lagging_16 Lagging Reverse 3
+obs 2535445 Lagging_16 Lagging Reverse 1
+random 2535677 Lagging_16 Lagging Reverse 1
+random 2539405 Lagging_16 Lagging Reverse 1
+obs 2540263 Lagging_16 Lagging Reverse 1
+random 2540536 Lagging_16 Lagging Reverse 1
+obs 2544389 Lagging_16 Lagging Reverse 3
+obs 2545117 Lagging_16 Lagging Reverse 2
+random 2546912 Lagging_16 Lagging Reverse 1
+random 2547345 Lagging_16 Lagging Reverse 1
+random 2549208 Lagging_16 Lagging Reverse 1
+obs 2551054 Lagging_16 Lagging Reverse 1
+obs 2551193 Lagging_16 Lagging Reverse 1
+obs 2551381 Lagging_16 Lagging Reverse 1
+obs 2551586 Lagging_16 Lagging Reverse 1
+obs 2553963 Lagging_16 Lagging Reverse 7
+random 2555289 Lagging_16 Lagging Reverse 1
+random 2556996 Lagging_16 Lagging Reverse 1
+random 2570321 Lagging_16 Lagging Reverse 1
+random 2580315 Lagging_16 Lagging Reverse 1
+random 2582828 Lagging_16 Lagging Reverse 1
+random 2583718 Lagging_16 Lagging Reverse 1
+random 2584542 Lagging_16 Lagging Reverse 1
+random 2588312 Lagging_16 Lagging Reverse 1
+obs 2589717 Lagging_16 Lagging Reverse 1
+obs 2591876 Lagging_16 Lagging Reverse 1
+obs 2592089 Lagging_16 Lagging Reverse 1
+random 2601044 Lagging_16 Lagging Reverse 1
+random 2601091 Lagging_16 Lagging Reverse 1
+random 2604111 Lagging_16 Lagging Reverse 1
+random 2609006 Lagging_16 Lagging Reverse 1
+random 2610162 Lagging_16 Lagging Reverse 1
+random 2612217 Lagging_16 Lagging Reverse 1
+obs 2613260 Lagging_16 Lagging Reverse 1
+obs 2614799 Lagging_16 Lagging Reverse 1
+random 2618167 Lagging_16 Lagging Reverse 1
+obs 2618211 Lagging_16 Lagging Reverse 1
+obs 2619994 Lagging_16 Lagging Reverse 1
+random 2624129 Lagging_16 Lagging Reverse 1
+obs 2626945 Lagging_16 Lagging Reverse 1
+obs 2628203 Lagging_16 Lagging Reverse 2
+obs 2629822 Lagging_16 Lagging Reverse 1
+random 2630230 Lagging_16 Lagging Reverse 1
+obs 2632768 Lagging_16 Lagging Reverse 5
+obs 2632784 Lagging_16 Lagging Reverse 2
+obs 2635594 Lagging_16 Lagging Reverse 1
+obs 2636255 Lagging_16 Lagging Reverse 2
+obs 2643603 Lagging_16 Lagging Reverse 1
+obs 2643615 Lagging_16 Lagging Reverse 1
+random 2657148 Lagging_16 Lagging Reverse 1
+random 2659020 Lagging_16 Lagging Reverse 1
+random 2660666 Lagging_16 Lagging Reverse 1
+random 2661750 Lagging_16 Lagging Reverse 1
+random 2662078 Lagging_16 Lagging Reverse 1
+obs 2667233 Lagging_16 Lagging Reverse 1
+obs 2667317 Lagging_16 Lagging Reverse 1
+obs 2667852 Lagging_16 Lagging Reverse 1
+random 2676678 Lagging_16 Lagging Reverse 1
+obs 2680246 Lagging_16 Lagging Reverse 1
+random 2681209 Lagging_16 Lagging Reverse 1
+random 2683741 Lagging_16 Lagging Reverse 1
+random 2689759 Lagging_16 Lagging Reverse 1
+obs 2690110 Lagging_16 Lagging Reverse 1
+random 2691354 Lagging_16 Lagging Reverse 1
+random 2693340 Lagging_16 Lagging Reverse 1
+obs 2697728 Lagging_16 Lagging Reverse 1
+random 2702041 Lagging_16 Lagging Reverse 1
+random 2703864 Lagging_16 Lagging Reverse 1
+random 2706598 Lagging_16 Lagging Reverse 1
+random 2706889 Lagging_16 Lagging Reverse 1
+random 2714858 Lagging_16 Lagging Reverse 1
+random 2718474 Lagging_16 Lagging Reverse 1
+obs 2718582 Lagging_16 Lagging Reverse 1
+obs 2719278 Lagging_16 Lagging Reverse 1
+random 2720671 Lagging_16 Lagging Reverse 1
+random 2725560 Lagging_16 Lagging Reverse 1
+obs 2725864 Lagging_16 Lagging Reverse 1
+obs 2726509 Lagging_16 Lagging Reverse 1
+random 2727020 Lagging_16 Lagging Reverse 1
+random 2727501 Lagging_16 Lagging Reverse 1
+random 2727682 Lagging_16 Lagging Reverse 1
+random 2730410 Lagging_16 Lagging Reverse 1
+obs 2732351 Lagging_16 Lagging Reverse 1
+random 2732385 Lagging_16 Lagging Reverse 1
+random 2736200 Lagging_16 Lagging Reverse 1
+obs 2738509 Lagging_16 Lagging Reverse 2
+random 2738513 Lagging_16 Lagging Reverse 1
+obs 2751983 Lagging_16 Lagging Reverse 1
+obs 2763222 Lagging_16 Lagging Reverse 1
+obs 2764813 Lagging_16 Lagging Reverse 1
+random 2766678 Lagging_16 Lagging Reverse 1
+random 2767311 Lagging_16 Lagging Reverse 1
+obs 2769579 Lagging_16 Lagging Reverse 1
+random 2773179 Lagging_16 Lagging Reverse 1
+obs 2776718 Lagging_16 Lagging Reverse 6
+obs 2776796 Lagging_16 Lagging Reverse 1
+random 2782878 Lagging_16 Lagging Reverse 1
+random 2786603 Lagging_16 Lagging Reverse 1
+obs 2789426 Lagging_16 Lagging Reverse 1
+random 2790854 Lagging_16 Lagging Reverse 1
+obs 2791592 Lagging_16 Lagging Reverse 1
+obs 2792078 Lagging_16 Lagging Reverse 1
+random 2792406 Lagging_16 Lagging Reverse 1
+obs 2794852 Lagging_16 Lagging Reverse 1
+obs 2795375 Lagging_16 Lagging Reverse 1
+obs 2799445 Lagging_16 Lagging Reverse 1
+obs 2801519 Lagging_16 Lagging Reverse 1
+random 2801861 Lagging_16 Lagging Reverse 1
+obs 2802407 Lagging_16 Lagging Reverse 1
+obs 2802549 Lagging_16 Lagging Reverse 1
+random 2803992 Lagging_16 Lagging Reverse 1
+random 2804454 Lagging_16 Lagging Reverse 1
+obs 2809104 Lagging_16 Lagging Reverse 1
+obs 2811306 Lagging_16 Lagging Reverse 1
+random 2817485 Lagging_16 Lagging Reverse 1
+obs 2818280 Lagging_16 Lagging Reverse 2
+obs 2819212 Lagging_16 Lagging Reverse 4
+random 2820237 Lagging_16 Lagging Reverse 1
+obs 2821456 Lagging_16 Lagging Reverse 1
+random 2823489 Lagging_16 Lagging Reverse 1
+obs 2827595 Lagging_16 Lagging Reverse 1
+obs 2828131 Lagging_16 Lagging Reverse 1
+random 2828224 Lagging_16 Lagging Reverse 1
+obs 2829461 Lagging_16 Lagging Reverse 1
+obs 2830062 Lagging_16 Lagging Reverse 2
+random 2833897 Lagging_16 Lagging Reverse 1
+random 2839510 Lagging_16 Lagging Reverse 1
+random 2840801 Lagging_16 Lagging Reverse 1
+obs 2840950 Lagging_16 Lagging Reverse 1
+obs 2842282 Lagging_16 Lagging Reverse 1
+obs 2842956 Lagging_16 Lagging Reverse 4
+obs 2848089 Lagging_16 Lagging Reverse 1
+obs 2848113 Lagging_16 Lagging Reverse 1
+obs 2850303 Lagging_16 Lagging Reverse 1
+random 2850568 Lagging_16 Lagging Reverse 1
+random 2857741 Lagging_16 Lagging Reverse 1
+random 2859574 Lagging_16 Lagging Reverse 1
+random 2861252 Lagging_16 Lagging Reverse 1
+obs 2863797 Lagging_16 Lagging Reverse 1
+random 2868206 Lagging_16 Lagging Reverse 1
+random 2872448 Lagging_16 Lagging Reverse 1
+random 2876396 Lagging_16 Lagging Reverse 1
+random 2879883 Lagging_16 Lagging Reverse 1
+random 2888099 Lagging_16 Lagging Reverse 1
+random 2891987 Lagging_16 Lagging Reverse 1
+obs 2896017 Lagging_16 Lagging Reverse 1
+random 2898773 Lagging_16 Lagging Reverse 1
+obs 2902212 Lagging_16 Lagging Reverse 1
+random 2902743 Lagging_16 Lagging Reverse 1
+obs 2905236 Lagging_16 Lagging Reverse 1
+obs 2905261 Lagging_16 Lagging Reverse 1
+random 2905514 Lagging_16 Lagging Reverse 1
+obs 2907645 Lagging_16 Lagging Reverse 1
+random 2914619 Lagging_16 Lagging Reverse 1
+random 2915798 Lagging_16 Lagging Reverse 1
+obs 2919440 Lagging_16 Lagging Reverse 3
+obs 2923282 Lagging_16 Lagging Reverse 1
+random 2923773 Lagging_16 Lagging Reverse 1
+obs 2924272 Lagging_16 Lagging Reverse 1
+random 2925541 Lagging_16 Lagging Reverse 1
+random 2927514 Lagging_16 Lagging Reverse 1
+obs 2929206 Lagging_16 Lagging Reverse 2
+random 2930058 Lagging_16 Lagging Reverse 1
+random 2930750 Lagging_16 Lagging Reverse 1
+random 2935853 Lagging_16 Lagging Reverse 1
+random 2939702 Lagging_16 Lagging Reverse 1
+random 2941317 Lagging_16 Lagging Reverse 1
+obs 2942366 Lagging_16 Lagging Reverse 1
+random 2942795 Lagging_16 Lagging Reverse 1
+obs 2943399 Lagging_16 Lagging Reverse 1
+random 2945181 Lagging_16 Lagging Reverse 1
+random 2945466 Lagging_16 Lagging Reverse 1
+obs 2947445 Lagging_16 Lagging Reverse 1
+obs 2947463 Lagging_16 Lagging Reverse 1
+obs 2949329 Lagging_16 Lagging Reverse 1
+random 2955983 Lagging_16 Lagging Reverse 1
+obs 2957319 Lagging_16 Lagging Reverse 1
+random 2957319 Lagging_16 Lagging Reverse 1
+random 2960779 Lagging_16 Lagging Reverse 1
+obs 2961040 Lagging_16 Lagging Reverse 1
+random 2961103 Lagging_16 Lagging Reverse 1
+obs 2964195 Lagging_16 Lagging Reverse 1
+obs 2964596 Lagging_16 Lagging Reverse 5
+random 2967520 Lagging_16 Lagging Reverse 1
+obs 2968548 Lagging_16 Lagging Reverse 1
+obs 2971309 Lagging_16 Lagging Reverse 1
+random 2975846 Lagging_16 Lagging Reverse 1
+obs 2978968 Lagging_16 Lagging Reverse 1
+random 2984372 Lagging_16 Lagging Reverse 1
+random 2984578 Lagging_16 Lagging Reverse 1
+random 2992548 Lagging_16 Lagging Reverse 1
+random 2992650 Lagging_16 Lagging Reverse 1
+random 2995069 Lagging_16 Lagging Reverse 1
+random 2996897 Lagging_16 Lagging Reverse 1
+random 2998553 Lagging_16 Lagging Reverse 1
+random 2999133 Lagging_16 Lagging Reverse 1
+random 3000600 Lagging_16 Lagging Reverse 1
+obs 3000692 Lagging_16 Lagging Reverse 1
+obs 3003277 Lagging_16 Lagging Reverse 1
+random 3003650 Lagging_16 Lagging Reverse 1
+random 3008993 Lagging_16 Lagging Reverse 1
+obs 3009289 Lagging_16 Lagging Reverse 1
+obs 3009290 Lagging_16 Lagging Reverse 1
+random 3009802 Lagging_16 Lagging Reverse 1
+obs 3014633 Lagging_16 Lagging Reverse 1
+random 3015717 Lagging_16 Lagging Reverse 1
+random 3017249 Lagging_16 Lagging Reverse 1
+obs 3020543 Lagging_16 Lagging Reverse 1
+obs 3024242 Lagging_16 Lagging Reverse 1
+obs 3025928 Lagging_16 Lagging Reverse 1
+random 3027826 Lagging_16 Lagging Reverse 1
+random 3031369 Lagging_16 Lagging Reverse 1
+random 3036389 Lagging_16 Lagging Reverse 1
+random 3036697 Lagging_16 Lagging Reverse 1
+obs 3038726 Lagging_16 Lagging Reverse 1
+obs 3043209 Lagging_16 Lagging Reverse 2
+obs 3044831 Lagging_16 Lagging Reverse 1
+random 3049723 Lagging_16 Lagging Reverse 1
+obs 3052003 Lagging_16 Lagging Reverse 1
+obs 3064394 Lagging_16 Lagging Reverse 1
+obs 3064501 Lagging_16 Lagging Reverse 1
+random 3066405 Lagging_16 Lagging Reverse 1
+obs 3071321 Lagging_16 Lagging Reverse 2
+obs 3076987 Lagging_16 Lagging Reverse 1
+random 3081006 Lagging_16 Lagging Reverse 1
+obs 3082181 Lagging_16 Lagging Reverse 1
+random 3088223 Lagging_16 Lagging Reverse 1
+random 3089064 Lagging_16 Lagging Reverse 1
+random 3092594 Lagging_16 Lagging Reverse 1
+random 3096131 Lagging_16 Lagging Reverse 1
+obs 3098165 Lagging_16 Lagging Reverse 1
+obs 3098275 Lagging_16 Lagging Reverse 1
+random 3105636 Lagging_16 Lagging Reverse 1
+random 3105650 Lagging_16 Lagging Reverse 1
+obs 3107053 Lagging_16 Lagging Reverse 1
+obs 3107076 Lagging_16 Lagging Reverse 1
+obs 3107780 Lagging_16 Lagging Reverse 2
+random 3112264 Lagging_16 Lagging Reverse 1
+random 3113630 Lagging_16 Lagging Reverse 1
+random 3116557 Lagging_16 Lagging Reverse 1
+obs 3119408 Lagging_16 Lagging Reverse 1
+random 3120408 Lagging_16 Lagging Reverse 1
+random 3120493 Lagging_16 Lagging Reverse 1
+obs 3121239 Lagging_16 Lagging Reverse 1
+random 3124926 Lagging_16 Lagging Reverse 1
+obs 3125052 Lagging_16 Lagging Reverse 1
+random 3125241 Lagging_16 Lagging Reverse 1
+obs 3125716 Lagging_16 Lagging Reverse 1
+obs 3125789 Lagging_16 Lagging Reverse 1
+random 3131029 Lagging_16 Lagging Reverse 1
+random 3131293 Lagging_16 Lagging Reverse 1
+random 3135249 Lagging_16 Lagging Reverse 1
+random 3135562 Lagging_16 Lagging Reverse 1
+random 3135892 Lagging_16 Lagging Reverse 1
+random 3140388 Lagging_16 Lagging Reverse 1
+obs 3147611 Lagging_16 Lagging Reverse 1
+random 3155286 Lagging_16 Lagging Reverse 1
+obs 3156319 Lagging_16 Lagging Reverse 1
+random 3157369 Lagging_16 Lagging Reverse 1
+random 3162943 Lagging_16 Lagging Reverse 1
+random 3166257 Lagging_16 Lagging Reverse 1
+obs 3166934 Lagging_16 Lagging Reverse 1
+random 3174644 Lagging_16 Lagging Reverse 1
+random 3181586 Lagging_16 Lagging Reverse 1
+random 3182732 Lagging_16 Lagging Reverse 1
+random 3190620 Lagging_16 Lagging Reverse 1
+random 3193099 Lagging_16 Lagging Reverse 1
+obs 3200322 Lagging_16 Lagging Reverse 1
+random 3203587 Lagging_16 Lagging Reverse 1
+obs 3203966 Lagging_16 Lagging Reverse 1
+obs 3205074 Lagging_16 Lagging Reverse 1
+obs 3205650 Lagging_16 Lagging Reverse 3
+random 3208063 Lagging_16 Lagging Reverse 1
+obs 3209472 Lagging_16 Lagging Reverse 2
+random 3212083 Lagging_16 Lagging Reverse 1
+random 3213052 Lagging_16 Lagging Reverse 1
+random 3214802 Lagging_16 Lagging Reverse 1
+random 3215307 Lagging_16 Lagging Reverse 1
+obs 3218373 Lagging_16 Lagging Reverse 2
+random 3226048 Lagging_16 Lagging Reverse 1
+random 3229190 Lagging_16 Lagging Reverse 1
+obs 3230082 Lagging_16 Lagging Reverse 1
+random 3233347 Lagging_16 Lagging Reverse 1
+random 3247969 Lagging_16 Lagging Reverse 1
+random 3248974 Lagging_16 Lagging Reverse 1
+random 3249307 Lagging_16 Lagging Reverse 1
+random 3250356 Lagging_16 Lagging Reverse 1
+obs 3252283 Lagging_16 Lagging Reverse 1
+obs 3253553 Lagging_16 Lagging Reverse 1
+random 3255250 Lagging_16 Lagging Reverse 1
+obs 3258803 Lagging_16 Lagging Reverse 1
+random 3264677 Lagging_16 Lagging Reverse 1
+obs 3272982 Lagging_16 Lagging Reverse 1
+obs 3281734 Lagging_16 Lagging Reverse 1
+random 3285420 Lagging_16 Lagging Reverse 1
+obs 3294212 Lagging_16 Lagging Reverse 1
+random 3294835 Lagging_16 Lagging Reverse 1
+random 3298947 Lagging_16 Lagging Reverse 1
+random 3302042 Lagging_16 Lagging Reverse 1
+random 3303139 Lagging_16 Lagging Reverse 1
+random 3306712 Lagging_16 Lagging Reverse 1
+obs 3310136 Lagging_16 Lagging Reverse 1
+random 3314150 Lagging_16 Lagging Reverse 1
+random 3314373 Lagging_16 Lagging Reverse 1
+obs 3314852 Lagging_16 Lagging Reverse 1
+obs 3315187 Lagging_16 Lagging Reverse 1
+obs 3326148 Lagging_16 Lagging Reverse 1
+random 3329949 Lagging_16 Lagging Reverse 1
+random 3330800 Lagging_16 Lagging Reverse 1
+random 3337505 Lagging_16 Lagging Reverse 1
+obs 3339933 Lagging_16 Lagging Reverse 1
+random 3341044 Lagging_16 Lagging Reverse 1
+obs 3360469 Lagging_16 Lagging Reverse 3
+obs 3366735 Lagging_16 Lagging Reverse 3
+obs 3367962 Lagging_16 Lagging Reverse 1
+random 3370237 Lagging_16 Lagging Reverse 1
+random 3385085 Lagging_16 Lagging Reverse 1
+obs 3387228 Lagging_16 Lagging Reverse 1
+random 3388011 Lagging_16 Lagging Reverse 1
+obs 3390786 Lagging_16 Lagging Reverse 3
+random 3391170 Lagging_16 Lagging Reverse 1
+obs 3392698 Lagging_16 Lagging Reverse 1
+obs 3403026 Lagging_16 Lagging Reverse 2
+random 3403073 Lagging_16 Lagging Reverse 1
+obs 3403764 Lagging_16 Lagging Reverse 1
+obs 3408385 Lagging_16 Lagging Reverse 2
+random 3409394 Lagging_16 Lagging Reverse 1
+obs 3414998 Lagging_16 Lagging Reverse 1
+random 3415629 Lagging_16 Lagging Reverse 1
+random 3418553 Lagging_16 Lagging Reverse 1
+random 3425163 Lagging_16 Lagging Reverse 1
+obs 3427008 Lagging_16 Lagging Reverse 1
+obs 3428279 Lagging_16 Lagging Reverse 1
+obs 3430318 Lagging_16 Lagging Reverse 3
+random 3432442 Lagging_16 Lagging Reverse 1
+obs 3439910 Lagging_16 Lagging Reverse 1
+random 3443619 Lagging_16 Lagging Reverse 1
+random 3453893 Lagging_16 Lagging Reverse 1
+obs 3455630 Lagging_16 Lagging Reverse 1
+obs 3456680 Lagging_16 Lagging Reverse 1
+random 3456984 Lagging_16 Lagging Reverse 1
+obs 3457539 Lagging_16 Lagging Reverse 1
+random 3460613 Lagging_16 Lagging Reverse 1
+random 3466210 Lagging_16 Lagging Reverse 1
+random 3472411 Lagging_16 Lagging Reverse 1
+obs 3474153 Lagging_16 Lagging Reverse 1
+random 3474529 Lagging_16 Lagging Reverse 1
+obs 3481255 Lagging_16 Lagging Reverse 1
+random 3481309 Lagging_16 Lagging Reverse 1
+obs 3493217 Lagging_16 Lagging Reverse 2
+random 3495492 Lagging_16 Lagging Reverse 1
+random 3498773 Lagging_16 Lagging Reverse 1
+obs 3500920 Lagging_16 Lagging Reverse 1
+obs 3505748 Lagging_16 Lagging Reverse 1
+random 3506779 Lagging_16 Lagging Reverse 1
+random 3508151 Lagging_16 Lagging Reverse 1
+obs 3508254 Lagging_16 Lagging Reverse 1
+random 3510363 Lagging_16 Lagging Reverse 1
+random 3521263 Lagging_16 Lagging Reverse 1
+obs 3522565 Lagging_16 Lagging Reverse 1
+obs 3524471 Lagging_16 Lagging Reverse 1
+random 3525362 Lagging_16 Lagging Reverse 1
+obs 3525824 Lagging_16 Lagging Reverse 1
+obs 3527242 Lagging_16 Lagging Reverse 1
+random 3532018 Lagging_16 Lagging Reverse 1
+obs 3534646 Lagging_16 Lagging Reverse 1
+random 3539573 Lagging_16 Lagging Reverse 1
+random 3540970 Lagging_16 Lagging Reverse 1
+random 3552375 Lagging_16 Lagging Reverse 1
+random 3552612 Lagging_16 Lagging Reverse 1
+random 3556298 Lagging_16 Lagging Reverse 1
+random 3563615 Lagging_16 Lagging Reverse 1
+random 3567977 Lagging_16 Lagging Reverse 1
+obs 3569581 Lagging_16 Lagging Reverse 1
+random 3575600 Lagging_16 Lagging Reverse 1
+random 3576746 Lagging_16 Lagging Reverse 1
+random 3580173 Lagging_16 Lagging Reverse 1
+random 3581009 Lagging_16 Lagging Reverse 1
+random 3584702 Lagging_16 Lagging Reverse 1
+random 3588066 Lagging_16 Lagging Reverse 1
+random 3606074 Lagging_16 Lagging Reverse 1
+obs 3629654 Lagging_16 Lagging Reverse 1
+obs 3630799 Lagging_16 Lagging Reverse 1
+obs 3631269 Lagging_16 Lagging Reverse 1
+obs 3636688 Lagging_16 Lagging Reverse 1
+obs 3639720 Lagging_16 Lagging Reverse 1
+random 3640818 Lagging_16 Lagging Reverse 1
+obs 3643871 Lagging_16 Lagging Reverse 1
+obs 3644641 Lagging_16 Lagging Reverse 1
+random 3649530 Lagging_16 Lagging Reverse 1
+random 3659292 Lagging_16 Lagging Reverse 1
+random 3662912 Lagging_16 Lagging Reverse 1
+obs 3663156 Lagging_16 Lagging Reverse 1
+random 3664643 Lagging_16 Lagging Reverse 1
+random 3670178 Lagging_16 Lagging Reverse 1
+random 3674984 Lagging_16 Lagging Reverse 1
+random 3675714 Lagging_16 Lagging Reverse 1
+obs 3685060 Lagging_16 Lagging Reverse 1
+random 3686869 Lagging_16 Lagging Reverse 1
+random 3693497 Lagging_16 Lagging Reverse 1
+obs 3694803 Lagging_16 Lagging Reverse 3
+obs 3695230 Lagging_16 Lagging Reverse 1
+random 3712251 Lagging_16 Lagging Reverse 1
+random 3714134 Lagging_16 Lagging Reverse 1
+random 3715938 Lagging_16 Lagging Reverse 1
+random 3740466 Lagging_16 Lagging Reverse 1
+random 3742873 Lagging_16 Lagging Reverse 1
+obs 3745583 Lagging_16 Lagging Reverse 1
+obs 3749277 Lagging_16 Lagging Reverse 1
+obs 3752231 Lagging_16 Lagging Reverse 1
+random 3752977 Lagging_16 Lagging Reverse 1
+random 3759408 Lagging_16 Lagging Reverse 1
+random 3774545 Lagging_16 Lagging Reverse 1
+random 3776410 Lagging_16 Lagging Reverse 1
+obs 3776434 Lagging_16 Lagging Reverse 4
+random 3777674 Lagging_16 Lagging Reverse 1
+obs 3778584 Lagging_16 Lagging Reverse 1
+random 3780671 Lagging_16 Lagging Reverse 1
+obs 3785868 Lagging_16 Lagging Reverse 1
+random 3788428 Lagging_16 Lagging Reverse 1
+random 3793860 Lagging_16 Lagging Reverse 1
+obs 3794340 Lagging_16 Lagging Reverse 1
+random 3804027 Lagging_16 Lagging Reverse 1
+random 3810652 Lagging_16 Lagging Reverse 1
+random 3816415 Lagging_16 Lagging Reverse 1
+obs 3819187 Lagging_16 Lagging Reverse 1
+random 3825633 Lagging_16 Lagging Reverse 1
+random 3826421 Lagging_16 Lagging Reverse 1
+obs 3826889 Lagging_16 Lagging Reverse 1
+obs 3827627 Lagging_16 Lagging Reverse 1
+obs 3833113 Lagging_16 Lagging Reverse 1
+random 3836306 Lagging_16 Lagging Reverse 1
+random 3838848 Lagging_16 Lagging Reverse 1
+random 3846625 Lagging_16 Lagging Reverse 1
+obs 3847317 Lagging_16 Lagging Reverse 1
+random 3852403 Lagging_16 Lagging Reverse 1
+obs 3856976 Lagging_16 Lagging Reverse 1
+random 3861945 Lagging_16 Lagging Reverse 1
+random 3870658 Lagging_16 Lagging Reverse 1
+random 3872154 Lagging_16 Lagging Reverse 1
+obs 3874713 Lagging_16 Lagging Reverse 1
+obs 3875034 Lagging_16 Lagging Reverse 1
+random 3875780 Lagging_16 Lagging Reverse 1
+random 3883592 Lagging_16 Lagging Reverse 1
+obs 3884164 Lagging_16 Lagging Reverse 1
+random 3892163 Lagging_16 Lagging Reverse 1
+random 3893429 Lagging_16 Lagging Reverse 1
+random 3900097 Lagging_16 Lagging Reverse 1
+random 3903897 Lagging_16 Lagging Reverse 1
+obs 3903921 Lagging_16 Lagging Reverse 1
+random 3905284 Lagging_16 Lagging Reverse 1
+random 3911067 Lagging_16 Lagging Reverse 1
+obs 3912832 Lagging_16 Lagging Reverse 1
+random 3922751 Lagging_16 Lagging Reverse 1
+obs 3924347 Lagging_16 Lagging Reverse 4
+obs 3932866 Lagging_16 Lagging Reverse 2
+obs 3933798 Lagging_16 Lagging Reverse 7
+random 3943207 Lagging_16 Lagging Reverse 1
+random 3943937 Lagging_16 Lagging Reverse 1
+random 3944020 Lagging_16 Lagging Reverse 1
+random 3950681 Lagging_16 Lagging Reverse 1
+obs 3951402 Lagging_16 Lagging Reverse 1
+random 3957938 Lagging_16 Lagging Reverse 1
+random 3970022 Lagging_16 Lagging Reverse 1
+random 3978819 Lagging_16 Lagging Reverse 1
+obs 3981065 Lagging_16 Lagging Reverse 1
+obs 3981856 Lagging_16 Lagging Reverse 1
+random 3982072 Lagging_16 Lagging Reverse 1
+random 3983174 Lagging_16 Lagging Reverse 1
+random 3991577 Lagging_16 Lagging Reverse 1
+obs 3997164 Lagging_16 Lagging Reverse 2
+random 3999699 Lagging_16 Lagging Reverse 1
+random 4013733 Lagging_16 Lagging Reverse 1
+random 4015927 Lagging_16 Lagging Reverse 1
+random 4017240 Lagging_16 Lagging Reverse 1
+random 4020003 Lagging_16 Lagging Reverse 1
+random 4021073 Lagging_16 Lagging Reverse 1
+random 4036659 Lagging_16 Lagging Reverse 1
+obs 4048969 Lagging_16 Lagging Reverse 1
+random 4057503 Lagging_16 Lagging Reverse 1
+random 4066261 Lagging_16 Lagging Reverse 1
+random 4066442 Lagging_16 Lagging Reverse 1
+random 4078054 Lagging_16 Lagging Reverse 1
+obs 4079141 Lagging_16 Lagging Reverse 1
+obs 4080493 Lagging_16 Lagging Reverse 1
+random 4099906 Lagging_16 Lagging Reverse 1
+random 4101403 Lagging_16 Lagging Reverse 1
+random 4103561 Lagging_16 Lagging Reverse 1
+obs 4106961 Lagging_16 Lagging Reverse 1
+random 4112126 Lagging_16 Lagging Reverse 1
+random 4122479 Lagging_16 Lagging Reverse 1
+random 4126492 Lagging_16 Lagging Reverse 1
+random 4131193 Lagging_16 Lagging Reverse 1
+random 4133063 Lagging_16 Lagging Reverse 1
+random 4148176 Lagging_16 Lagging Reverse 1
+obs 4148918 Lagging_16 Lagging Reverse 1
+random 4153716 Lagging_16 Lagging Reverse 1
+random 4159231 Lagging_16 Lagging Reverse 1
+random 4163737 Lagging_16 Lagging Reverse 1
+random 4167229 Lagging_16 Lagging Reverse 1
+obs 4170392 Lagging_16 Lagging Reverse 3
+random 4171368 Lagging_16 Lagging Reverse 1
+obs 4176262 Lagging_16 Lagging Reverse 1
+random 4177550 Lagging_16 Lagging Reverse 1
+obs 4181240 Lagging_16 Lagging Reverse 1
+obs 4197036 Lagging_16 Lagging Reverse 1
+obs 4200647 Lagging_16 Lagging Reverse 1
+random 4205708 Lagging_16 Lagging Reverse 1
+random 4208018 Lagging_16 Lagging Reverse 1
+random 4208774 Lagging_16 Lagging Reverse 1
+random 4210127 Lagging_16 Lagging Reverse 1
+random 4211403 Lagging_16 Lagging Reverse 1
+random 4218627 Lagging_16 Lagging Reverse 1
+obs 4223594 Lagging_16 Lagging Reverse 1
+random 4224166 Lagging_16 Lagging Reverse 1
+random 4226584 Lagging_16 Lagging Reverse 1
+random 4227051 Lagging_16 Lagging Reverse 1
+random 4231426 Lagging_16 Lagging Reverse 1
+random 4232656 Lagging_16 Lagging Reverse 1
+random 4235821 Lagging_16 Lagging Reverse 1
+random 4237161 Lagging_16 Lagging Reverse 1
+obs 4240174 Lagging_16 Lagging Reverse 1
+random 4244108 Lagging_16 Lagging Reverse 1
+random 4254567 Lagging_16 Lagging Reverse 1
+random 4257447 Lagging_16 Lagging Reverse 1
+random 4260001 Lagging_16 Lagging Reverse 1
+obs 4265216 Lagging_16 Lagging Reverse 1
+random 4268309 Lagging_16 Lagging Reverse 1
+random 4273711 Lagging_16 Lagging Reverse 1
+obs 4278620 Lagging_16 Lagging Reverse 1
+obs 4280733 Lagging_16 Lagging Reverse 1
+random 4281248 Lagging_16 Lagging Reverse 1
+random 4282919 Lagging_16 Lagging Reverse 1
+random 4285109 Lagging_16 Lagging Reverse 1
+obs 4285376 Lagging_16 Lagging Reverse 1
+random 4288073 Lagging_16 Lagging Reverse 1
+obs 4289745 Lagging_16 Lagging Reverse 1
+random 4290648 Lagging_16 Lagging Reverse 1
+random 4293614 Lagging_16 Lagging Reverse 1
+random 4297598 Lagging_16 Lagging Reverse 1
+random 4301377 Lagging_16 Lagging Reverse 1
+random 4320095 Lagging_16 Lagging Reverse 1
+random 4321255 Lagging_16 Lagging Reverse 1
+random 4323796 Lagging_16 Lagging Reverse 1
+random 4327745 Lagging_16 Lagging Reverse 1
+random 4330431 Lagging_16 Lagging Reverse 1
+random 4332734 Lagging_16 Lagging Reverse 1
+random 4344514 Lagging_16 Lagging Reverse 1
+random 4345763 Lagging_16 Lagging Reverse 1
+random 4355825 Lagging_16 Lagging Reverse 1
+obs 4361420 Lagging_16 Lagging Reverse 2
+random 4365298 Lagging_16 Lagging Reverse 1
+random 4369056 Lagging_16 Lagging Reverse 1
+random 4389569 Lagging_16 Lagging Reverse 1
+obs 4391768 Lagging_16 Lagging Reverse 1
+random 4396792 Lagging_16 Lagging Reverse 1
+random 4401624 Lagging_16 Lagging Reverse 1
+random 4408358 Lagging_16 Lagging Reverse 1
+random 4408525 Lagging_16 Lagging Reverse 1
+random 4409334 Lagging_16 Lagging Reverse 1
+obs 4409592 Lagging_16 Lagging Reverse 1
+obs 4410594 Lagging_16 Lagging Reverse 1
+random 4412718 Lagging_16 Lagging Reverse 1
+random 4420386 Lagging_16 Lagging Reverse 1
+random 4424684 Lagging_16 Lagging Reverse 1
+random 4426300 Lagging_16 Lagging Reverse 1
+random 4431606 Lagging_16 Lagging Reverse 1
+random 4431762 Lagging_16 Lagging Reverse 1
+random 4433516 Lagging_16 Lagging Reverse 1
+random 4437703 Lagging_16 Lagging Reverse 1
+random 4444412 Lagging_16 Lagging Reverse 1
+random 4455454 Lagging_16 Lagging Reverse 1
+random 4458876 Lagging_16 Lagging Reverse 1
+obs 4469009 Lagging_16 Lagging Reverse 1
+random 4472202 Lagging_16 Lagging Reverse 1
+random 4472558 Lagging_16 Lagging Reverse 1
+random 4481797 Lagging_16 Lagging Reverse 1
+random 4494024 Lagging_16 Lagging Reverse 1
+random 4497451 Lagging_16 Lagging Reverse 1
+obs 4503913 Lagging_16 Lagging Reverse 1
+random 4509216 Lagging_16 Lagging Reverse 1
+random 4510243 Lagging_16 Lagging Reverse 1
+random 4521899 Lagging_16 Lagging Reverse 1
+obs 4534045 Lagging_16 Lagging Reverse 1
+random 4535802 Lagging_16 Lagging Reverse 1
+obs 4536334 Lagging_16 Lagging Reverse 1
+random 4536850 Lagging_16 Lagging Reverse 1
+random 4539932 Lagging_16 Lagging Reverse 1
+random 4539962 Lagging_16 Lagging Reverse 1
+random 4542984 Lagging_16 Lagging Reverse 1
+random 4545103 Lagging_16 Lagging Reverse 1
+random 4547929 Lagging_16 Lagging Reverse 1
+random 4559467 Lagging_16 Lagging Reverse 1
+random 4559951 Lagging_16 Lagging Reverse 1
+random 4566513 Lagging_16 Lagging Reverse 1
+random 4570535 Lagging_16 Lagging Reverse 1
+random 4573104 Lagging_16 Lagging Reverse 1
+obs 4577530 Lagging_16 Lagging Reverse 1
+random 4578618 Lagging_16 Lagging Reverse 1
+random 4583381 Lagging_16 Lagging Reverse 1
+obs 4587532 Lagging_16 Lagging Reverse 1
+obs 4597616 Lagging_16 Lagging Reverse 1
+random 4600324 Lagging_16 Lagging Reverse 1
+random 4602042 Lagging_16 Lagging Reverse 1
+obs 4606050 Lagging_16 Lagging Reverse 1
+obs 4606471 Lagging_16 Lagging Reverse 1
+random 4611567 Lagging_16 Lagging Reverse 1
+random 4611943 Lagging_16 Lagging Reverse 1
+random 4613770 Lagging_16 Lagging Reverse 1
+random 4626826 Lagging_16 Lagging Reverse 1
+random 5254 Leading_16 Leading Reverse 1
+random 12936 Leading_16 Leading Reverse 1
+random 37939 Leading_16 Leading Reverse 1
+random 48082 Leading_16 Leading Reverse 1
+random 55069 Leading_16 Leading Reverse 1
+random 65826 Leading_16 Leading Reverse 1
+random 67552 Leading_16 Leading Reverse 1
+random 71860 Leading_16 Leading Reverse 1
+obs 82921 Leading_16 Leading Reverse 1
+random 83560 Leading_16 Leading Reverse 1
+random 85206 Leading_16 Leading Reverse 1
+random 95578 Leading_16 Leading Reverse 1
+random 105417 Leading_16 Leading Reverse 1
+obs 108311 Leading_16 Leading Reverse 1
+random 116737 Leading_16 Leading Reverse 1
+random 118856 Leading_16 Leading Reverse 1
+obs 121430 Leading_16 Leading Reverse 1
+random 125079 Leading_16 Leading Reverse 1
+obs 131454 Leading_16 Leading Reverse 1
+obs 138639 Leading_16 Leading Reverse 1
+random 156047 Leading_16 Leading Reverse 1
+random 160807 Leading_16 Leading Reverse 1
+random 165997 Leading_16 Leading Reverse 1
+random 167396 Leading_16 Leading Reverse 1
+random 168969 Leading_16 Leading Reverse 1
+obs 172873 Leading_16 Leading Reverse 1
+random 181278 Leading_16 Leading Reverse 1
+random 186488 Leading_16 Leading Reverse 1
+random 204542 Leading_16 Leading Reverse 1
+random 211177 Leading_16 Leading Reverse 1
+random 215209 Leading_16 Leading Reverse 1
+random 217636 Leading_16 Leading Reverse 1
+random 227301 Leading_16 Leading Reverse 1
+random 229801 Leading_16 Leading Reverse 1
+random 236286 Leading_16 Leading Reverse 1
+random 244205 Leading_16 Leading Reverse 1
+random 250239 Leading_16 Leading Reverse 1
+random 251317 Leading_16 Leading Reverse 1
+random 256248 Leading_16 Leading Reverse 1
+random 257824 Leading_16 Leading Reverse 1
+random 262091 Leading_16 Leading Reverse 1
+random 274688 Leading_16 Leading Reverse 1
+random 278621 Leading_16 Leading Reverse 1
+obs 284212 Leading_16 Leading Reverse 1
+random 293739 Leading_16 Leading Reverse 1
+random 297987 Leading_16 Leading Reverse 1
+random 302255 Leading_16 Leading Reverse 1
+random 302835 Leading_16 Leading Reverse 1
+random 303656 Leading_16 Leading Reverse 1
+random 314762 Leading_16 Leading Reverse 1
+random 319277 Leading_16 Leading Reverse 1
+random 319508 Leading_16 Leading Reverse 1
+random 320646 Leading_16 Leading Reverse 1
+obs 324440 Leading_16 Leading Reverse 1
+random 329845 Leading_16 Leading Reverse 1
+random 337299 Leading_16 Leading Reverse 1
+random 342740 Leading_16 Leading Reverse 1
+random 348370 Leading_16 Leading Reverse 1
+random 352685 Leading_16 Leading Reverse 1
+random 353596 Leading_16 Leading Reverse 1
+random 354873 Leading_16 Leading Reverse 1
+random 356604 Leading_16 Leading Reverse 1
+random 356805 Leading_16 Leading Reverse 1
+obs 358223 Leading_16 Leading Reverse 1
+random 359062 Leading_16 Leading Reverse 1
+random 362156 Leading_16 Leading Reverse 1
+random 370207 Leading_16 Leading Reverse 1
+random 370328 Leading_16 Leading Reverse 1
+obs 379273 Leading_16 Leading Reverse 1
+random 380539 Leading_16 Leading Reverse 1
+random 383992 Leading_16 Leading Reverse 1
+random 385539 Leading_16 Leading Reverse 1
+random 387070 Leading_16 Leading Reverse 1
+random 388914 Leading_16 Leading Reverse 1
+random 396701 Leading_16 Leading Reverse 1
+random 402439 Leading_16 Leading Reverse 1
+random 404095 Leading_16 Leading Reverse 1
+random 404389 Leading_16 Leading Reverse 1
+random 405035 Leading_16 Leading Reverse 1
+random 406966 Leading_16 Leading Reverse 1
+obs 411254 Leading_16 Leading Reverse 1
+random 411342 Leading_16 Leading Reverse 1
+random 415683 Leading_16 Leading Reverse 1
+random 424097 Leading_16 Leading Reverse 1
+random 434158 Leading_16 Leading Reverse 1
+random 440657 Leading_16 Leading Reverse 1
+obs 444131 Leading_16 Leading Reverse 1
+random 447903 Leading_16 Leading Reverse 1
+random 450016 Leading_16 Leading Reverse 1
+random 453761 Leading_16 Leading Reverse 1
+random 468017 Leading_16 Leading Reverse 1
+random 472121 Leading_16 Leading Reverse 1
+obs 473844 Leading_16 Leading Reverse 1
+obs 474103 Leading_16 Leading Reverse 1
+random 474601 Leading_16 Leading Reverse 1
+random 481697 Leading_16 Leading Reverse 1
+random 482498 Leading_16 Leading Reverse 1
+random 483912 Leading_16 Leading Reverse 1
+obs 484732 Leading_16 Leading Reverse 2
+obs 486075 Leading_16 Leading Reverse 1
+random 488334 Leading_16 Leading Reverse 1
+random 491559 Leading_16 Leading Reverse 1
+random 495087 Leading_16 Leading Reverse 1
+random 495129 Leading_16 Leading Reverse 1
+random 498116 Leading_16 Leading Reverse 1
+random 499210 Leading_16 Leading Reverse 1
+random 499790 Leading_16 Leading Reverse 1
+random 500349 Leading_16 Leading Reverse 1
+random 503150 Leading_16 Leading Reverse 1
+random 506631 Leading_16 Leading Reverse 1
+random 518584 Leading_16 Leading Reverse 1
+random 519494 Leading_16 Leading Reverse 1
+random 519954 Leading_16 Leading Reverse 1
+random 526846 Leading_16 Leading Reverse 1
+obs 537762 Leading_16 Leading Reverse 2
+obs 543570 Leading_16 Leading Reverse 1
+random 545586 Leading_16 Leading Reverse 1
+random 547637 Leading_16 Leading Reverse 1
+random 547645 Leading_16 Leading Reverse 1
+random 555932 Leading_16 Leading Reverse 1
+random 570895 Leading_16 Leading Reverse 1
+random 593052 Leading_16 Leading Reverse 1
+random 593760 Leading_16 Leading Reverse 1
+random 596288 Leading_16 Leading Reverse 1
+random 597877 Leading_16 Leading Reverse 1
+random 602095 Leading_16 Leading Reverse 1
+obs 603548 Leading_16 Leading Reverse 1
+random 606515 Leading_16 Leading Reverse 1
+random 608574 Leading_16 Leading Reverse 1
+random 610824 Leading_16 Leading Reverse 1
+random 617625 Leading_16 Leading Reverse 1
+random 617722 Leading_16 Leading Reverse 1
+random 619202 Leading_16 Leading Reverse 1
+random 619702 Leading_16 Leading Reverse 1
+random 620017 Leading_16 Leading Reverse 1
+random 629581 Leading_16 Leading Reverse 1
+random 631642 Leading_16 Leading Reverse 1
+random 635551 Leading_16 Leading Reverse 1
+random 637799 Leading_16 Leading Reverse 1
+random 644180 Leading_16 Leading Reverse 1
+random 647465 Leading_16 Leading Reverse 1
+obs 651478 Leading_16 Leading Reverse 1
+random 653031 Leading_16 Leading Reverse 1
+obs 667360 Leading_16 Leading Reverse 2
+random 669205 Leading_16 Leading Reverse 1
+obs 671674 Leading_16 Leading Reverse 1
+random 671726 Leading_16 Leading Reverse 1
+random 672207 Leading_16 Leading Reverse 1
+random 674355 Leading_16 Leading Reverse 1
+obs 674976 Leading_16 Leading Reverse 2
+random 682859 Leading_16 Leading Reverse 1
+obs 688530 Leading_16 Leading Reverse 1
+random 691989 Leading_16 Leading Reverse 1
+random 693129 Leading_16 Leading Reverse 1
+random 693232 Leading_16 Leading Reverse 1
+random 694051 Leading_16 Leading Reverse 1
+random 700045 Leading_16 Leading Reverse 1
+random 708950 Leading_16 Leading Reverse 1
+random 713491 Leading_16 Leading Reverse 1
+obs 725368 Leading_16 Leading Reverse 2
+random 726964 Leading_16 Leading Reverse 1
+obs 737434 Leading_16 Leading Reverse 1
+random 737864 Leading_16 Leading Reverse 1
+random 757122 Leading_16 Leading Reverse 1
+random 764734 Leading_16 Leading Reverse 1
+random 767293 Leading_16 Leading Reverse 1
+random 767380 Leading_16 Leading Reverse 1
+random 771492 Leading_16 Leading Reverse 1
+obs 774818 Leading_16 Leading Reverse 1
+random 781111 Leading_16 Leading Reverse 1
+random 783297 Leading_16 Leading Reverse 1
+random 784859 Leading_16 Leading Reverse 1
+random 788006 Leading_16 Leading Reverse 1
+obs 792209 Leading_16 Leading Reverse 1
+random 798758 Leading_16 Leading Reverse 1
+random 799556 Leading_16 Leading Reverse 1
+random 801539 Leading_16 Leading Reverse 1
+random 801616 Leading_16 Leading Reverse 1
+random 803188 Leading_16 Leading Reverse 1
+random 806143 Leading_16 Leading Reverse 1
+random 813747 Leading_16 Leading Reverse 1
+random 814130 Leading_16 Leading Reverse 1
+random 815141 Leading_16 Leading Reverse 1
+obs 816680 Leading_16 Leading Reverse 1
+random 817846 Leading_16 Leading Reverse 1
+random 820619 Leading_16 Leading Reverse 1
+random 822374 Leading_16 Leading Reverse 1
+random 829544 Leading_16 Leading Reverse 1
+random 831029 Leading_16 Leading Reverse 1
+obs 831686 Leading_16 Leading Reverse 1
+random 834296 Leading_16 Leading Reverse 1
+random 839838 Leading_16 Leading Reverse 1
+random 841063 Leading_16 Leading Reverse 2
+obs 846884 Leading_16 Leading Reverse 1
+random 849122 Leading_16 Leading Reverse 1
+random 851116 Leading_16 Leading Reverse 1
+obs 855385 Leading_16 Leading Reverse 1
+random 862935 Leading_16 Leading Reverse 1
+random 866749 Leading_16 Leading Reverse 1
+random 867044 Leading_16 Leading Reverse 1
+random 869967 Leading_16 Leading Reverse 1
+random 872787 Leading_16 Leading Reverse 1
+random 873462 Leading_16 Leading Reverse 1
+random 875903 Leading_16 Leading Reverse 1
+random 897406 Leading_16 Leading Reverse 1
+random 898721 Leading_16 Leading Reverse 1
+obs 903254 Leading_16 Leading Reverse 1
+random 919212 Leading_16 Leading Reverse 1
+random 920802 Leading_16 Leading Reverse 1
+random 926221 Leading_16 Leading Reverse 1
+random 927439 Leading_16 Leading Reverse 1
+random 935861 Leading_16 Leading Reverse 1
+random 940829 Leading_16 Leading Reverse 1
+random 941598 Leading_16 Leading Reverse 1
+random 946525 Leading_16 Leading Reverse 1
+obs 956961 Leading_16 Leading Reverse 1
+random 958027 Leading_16 Leading Reverse 1
+random 962030 Leading_16 Leading Reverse 1
+random 968720 Leading_16 Leading Reverse 1
+obs 975046 Leading_16 Leading Reverse 4
+random 979207 Leading_16 Leading Reverse 1
+random 984784 Leading_16 Leading Reverse 1
+obs 988121 Leading_16 Leading Reverse 1
+random 990648 Leading_16 Leading Reverse 1
+random 996302 Leading_16 Leading Reverse 1
+obs 1002390 Leading_16 Leading Reverse 1
+random 1003616 Leading_16 Leading Reverse 1
+random 1008858 Leading_16 Leading Reverse 1
+obs 1019628 Leading_16 Leading Reverse 1
+random 1020078 Leading_16 Leading Reverse 1
+random 1023084 Leading_16 Leading Reverse 1
+random 1023121 Leading_16 Leading Reverse 1
+obs 1029769 Leading_16 Leading Reverse 1
+random 1030956 Leading_16 Leading Reverse 1
+random 1034070 Leading_16 Leading Reverse 1
+random 1041387 Leading_16 Leading Reverse 1
+obs 1045943 Leading_16 Leading Reverse 1
+random 1047349 Leading_16 Leading Reverse 1
+random 1055525 Leading_16 Leading Reverse 1
+obs 1065237 Leading_16 Leading Reverse 1
+obs 1066941 Leading_16 Leading Reverse 1
+random 1067536 Leading_16 Leading Reverse 1
+obs 1067994 Leading_16 Leading Reverse 5
+obs 1070743 Leading_16 Leading Reverse 1
+obs 1078795 Leading_16 Leading Reverse 1
+obs 1083927 Leading_16 Leading Reverse 1
+random 1084072 Leading_16 Leading Reverse 1
+random 1086740 Leading_16 Leading Reverse 1
+random 1091125 Leading_16 Leading Reverse 1
+random 1095158 Leading_16 Leading Reverse 1
+random 1095808 Leading_16 Leading Reverse 1
+random 1101593 Leading_16 Leading Reverse 1
+random 1102239 Leading_16 Leading Reverse 1
+obs 1108556 Leading_16 Leading Reverse 1
+random 1110162 Leading_16 Leading Reverse 1
+obs 1117001 Leading_16 Leading Reverse 2
+obs 1119778 Leading_16 Leading Reverse 2
+random 1120645 Leading_16 Leading Reverse 1
+random 1123121 Leading_16 Leading Reverse 1
+random 1125883 Leading_16 Leading Reverse 1
+random 1136633 Leading_16 Leading Reverse 1
+obs 1137017 Leading_16 Leading Reverse 1
+obs 1148910 Leading_16 Leading Reverse 2
+random 1156915 Leading_16 Leading Reverse 1
+obs 1157800 Leading_16 Leading Reverse 2
+obs 1159872 Leading_16 Leading Reverse 1
+random 1161352 Leading_16 Leading Reverse 1
+random 1162861 Leading_16 Leading Reverse 1
+obs 1165194 Leading_16 Leading Reverse 1
+obs 1170301 Leading_16 Leading Reverse 1
+obs 1170434 Leading_16 Leading Reverse 1
+obs 1173203 Leading_16 Leading Reverse 1
+random 1182758 Leading_16 Leading Reverse 1
+random 1182940 Leading_16 Leading Reverse 1
+random 1189339 Leading_16 Leading Reverse 1
+random 1193415 Leading_16 Leading Reverse 1
+random 1194651 Leading_16 Leading Reverse 1
+obs 1197101 Leading_16 Leading Reverse 1
+random 1201192 Leading_16 Leading Reverse 1
+random 1203850 Leading_16 Leading Reverse 1
+obs 1205189 Leading_16 Leading Reverse 1
+obs 1209692 Leading_16 Leading Reverse 1
+random 1217148 Leading_16 Leading Reverse 1
+random 1224235 Leading_16 Leading Reverse 1
+obs 1225199 Leading_16 Leading Reverse 1
+random 1236502 Leading_16 Leading Reverse 1
+random 1241687 Leading_16 Leading Reverse 1
+random 1242987 Leading_16 Leading Reverse 1
+obs 1244403 Leading_16 Leading Reverse 1
+random 1251211 Leading_16 Leading Reverse 1
+random 1265614 Leading_16 Leading Reverse 1
+random 1267199 Leading_16 Leading Reverse 1
+obs 1284055 Leading_16 Leading Reverse 1
+random 1291049 Leading_16 Leading Reverse 1
+obs 1291962 Leading_16 Leading Reverse 2
+random 1294559 Leading_16 Leading Reverse 1
+random 1297111 Leading_16 Leading Reverse 1
+random 1302134 Leading_16 Leading Reverse 1
+obs 1312109 Leading_16 Leading Reverse 1
+random 1315714 Leading_16 Leading Reverse 1
+obs 1316015 Leading_16 Leading Reverse 1
+obs 1316368 Leading_16 Leading Reverse 1
+obs 1320698 Leading_16 Leading Reverse 1
+obs 1320791 Leading_16 Leading Reverse 2
+obs 1323049 Leading_16 Leading Reverse 1
+random 1323469 Leading_16 Leading Reverse 1
+random 1323810 Leading_16 Leading Reverse 1
+obs 1324086 Leading_16 Leading Reverse 1
+obs 1327115 Leading_16 Leading Reverse 1
+obs 1327476 Leading_16 Leading Reverse 1
+obs 1334270 Leading_16 Leading Reverse 1
+random 1338159 Leading_16 Leading Reverse 1
+obs 1339622 Leading_16 Leading Reverse 1
+obs 1342918 Leading_16 Leading Reverse 1
+obs 1344794 Leading_16 Leading Reverse 1
+random 1348180 Leading_16 Leading Reverse 1
+random 1351835 Leading_16 Leading Reverse 1
+random 1353819 Leading_16 Leading Reverse 1
+random 1356121 Leading_16 Leading Reverse 1
+random 1356516 Leading_16 Leading Reverse 1
+random 1360001 Leading_16 Leading Reverse 1
+random 1366457 Leading_16 Leading Reverse 1
+random 1367108 Leading_16 Leading Reverse 1
+random 1376603 Leading_16 Leading Reverse 1
+random 1380238 Leading_16 Leading Reverse 1
+random 1395852 Leading_16 Leading Reverse 1
+obs 1406075 Leading_16 Leading Reverse 1
+obs 1413090 Leading_16 Leading Reverse 1
+obs 1413663 Leading_16 Leading Reverse 1
+random 1414208 Leading_16 Leading Reverse 1
+obs 1416223 Leading_16 Leading Reverse 1
+random 1418651 Leading_16 Leading Reverse 1
+random 1419721 Leading_16 Leading Reverse 1
+obs 1420748 Leading_16 Leading Reverse 1
+obs 1421507 Leading_16 Leading Reverse 2
+random 1429806 Leading_16 Leading Reverse 1
+obs 1432681 Leading_16 Leading Reverse 1
+random 1433496 Leading_16 Leading Reverse 1
+random 1437183 Leading_16 Leading Reverse 1
+random 1439843 Leading_16 Leading Reverse 1
+obs 1440253 Leading_16 Leading Reverse 1
+random 1445686 Leading_16 Leading Reverse 1
+random 1448799 Leading_16 Leading Reverse 1
+random 1455852 Leading_16 Leading Reverse 1
+random 1456804 Leading_16 Leading Reverse 1
+random 1462264 Leading_16 Leading Reverse 1
+obs 1463042 Leading_16 Leading Reverse 1
+obs 1463485 Leading_16 Leading Reverse 1
+random 1465224 Leading_16 Leading Reverse 1
+random 1469597 Leading_16 Leading Reverse 1
+random 1470492 Leading_16 Leading Reverse 1
+random 1477958 Leading_16 Leading Reverse 1
+obs 1478869 Leading_16 Leading Reverse 1
+obs 1483094 Leading_16 Leading Reverse 1
+obs 1484444 Leading_16 Leading Reverse 1
+random 1485096 Leading_16 Leading Reverse 1
+obs 1486099 Leading_16 Leading Reverse 1
+random 1489763 Leading_16 Leading Reverse 1
+obs 1492573 Leading_16 Leading Reverse 1
+obs 1495794 Leading_16 Leading Reverse 1
+random 1497453 Leading_16 Leading Reverse 1
+obs 1499275 Leading_16 Leading Reverse 1
+random 1507326 Leading_16 Leading Reverse 1
+obs 1511056 Leading_16 Leading Reverse 1
+obs 1517929 Leading_16 Leading Reverse 1
+obs 1518350 Leading_16 Leading Reverse 1
+obs 1519070 Leading_16 Leading Reverse 1
+obs 1519629 Leading_16 Leading Reverse 1
+obs 1524388 Leading_16 Leading Reverse 1
+random 1526657 Leading_16 Leading Reverse 1
+random 1528748 Leading_16 Leading Reverse 1
+obs 1529666 Leading_16 Leading Reverse 1
+random 1530026 Leading_16 Leading Reverse 1
+obs 1532554 Leading_16 Leading Reverse 2
+random 1535843 Leading_16 Leading Reverse 1
+obs 1536988 Leading_16 Leading Reverse 1
+random 1538408 Leading_16 Leading Reverse 1
+random 1544361 Leading_16 Leading Reverse 1
+obs 1548180 Leading_16 Leading Reverse 3
+obs 1548192 Leading_16 Leading Reverse 17
+obs 1548845 Leading_16 Leading Reverse 1
+obs 1549819 Leading_16 Leading Reverse 1
+obs 1550257 Leading_16 Leading Reverse 1
+obs 1555070 Leading_16 Leading Reverse 1
+random 1557784 Leading_16 Leading Reverse 1
+obs 1561737 Leading_16 Leading Reverse 1
+random 1566383 Leading_16 Leading Reverse 1
+random 1571482 Leading_16 Leading Reverse 1
+random 1578294 Leading_16 Leading Reverse 1
+random 1581400 Leading_16 Leading Reverse 1
+random 1582665 Leading_16 Leading Reverse 1
+obs 1584462 Leading_16 Leading Reverse 3
+obs 1591884 Leading_16 Leading Reverse 1
+obs 1596465 Leading_16 Leading Reverse 1
+random 1599635 Leading_16 Leading Reverse 1
+obs 1602377 Leading_16 Leading Reverse 1
+obs 1603635 Leading_16 Leading Reverse 3
+random 1604911 Leading_16 Leading Reverse 1
+random 1605016 Leading_16 Leading Reverse 1
+random 1606130 Leading_16 Leading Reverse 1
+obs 1610951 Leading_16 Leading Reverse 5
+obs 1616663 Leading_16 Leading Reverse 1
+random 1617248 Leading_16 Leading Reverse 1
+obs 1617791 Leading_16 Leading Reverse 1
+obs 1618225 Leading_16 Leading Reverse 1
+random 1618740 Leading_16 Leading Reverse 1
+random 1619411 Leading_16 Leading Reverse 1
+random 1625178 Leading_16 Leading Reverse 1
+obs 1629357 Leading_16 Leading Reverse 1
+obs 1629495 Leading_16 Leading Reverse 1
+random 1640226 Leading_16 Leading Reverse 1
+obs 1640718 Leading_16 Leading Reverse 1
+random 1641472 Leading_16 Leading Reverse 1
+random 1641566 Leading_16 Leading Reverse 1
+obs 1643189 Leading_16 Leading Reverse 1
+obs 1643790 Leading_16 Leading Reverse 10
+random 1646063 Leading_16 Leading Reverse 1
+obs 1646821 Leading_16 Leading Reverse 1
+obs 1647360 Leading_16 Leading Reverse 1
+random 1654859 Leading_16 Leading Reverse 1
+random 1662514 Leading_16 Leading Reverse 1
+random 1663553 Leading_16 Leading Reverse 1
+random 1664123 Leading_16 Leading Reverse 1
+obs 1673360 Leading_16 Leading Reverse 1
+obs 1675492 Leading_16 Leading Reverse 1
+random 1675822 Leading_16 Leading Reverse 1
+obs 1676582 Leading_16 Leading Reverse 1
+random 1680074 Leading_16 Leading Reverse 1
+random 1681549 Leading_16 Leading Reverse 1
+random 1681993 Leading_16 Leading Reverse 1
+obs 1684338 Leading_16 Leading Reverse 1
+obs 1685958 Leading_16 Leading Reverse 2
+obs 1693735 Leading_16 Leading Reverse 1
+random 1694235 Leading_16 Leading Reverse 1
+obs 1694628 Leading_16 Leading Reverse 1
+obs 1698280 Leading_16 Leading Reverse 1
+random 1698640 Leading_16 Leading Reverse 1
+random 1699024 Leading_16 Leading Reverse 1
+random 1700946 Leading_16 Leading Reverse 1
+random 1703682 Leading_16 Leading Reverse 1
+random 1704444 Leading_16 Leading Reverse 1
+random 1711758 Leading_16 Leading Reverse 1
+obs 1714519 Leading_16 Leading Reverse 1
+random 1716455 Leading_16 Leading Reverse 1
+random 1723953 Leading_16 Leading Reverse 1
+obs 1724722 Leading_16 Leading Reverse 1
+obs 1725079 Leading_16 Leading Reverse 2
+random 1725659 Leading_16 Leading Reverse 1
+random 1729340 Leading_16 Leading Reverse 1
+random 1732262 Leading_16 Leading Reverse 1
+obs 1734227 Leading_16 Leading Reverse 1
+random 1734528 Leading_16 Leading Reverse 1
+obs 1738201 Leading_16 Leading Reverse 2
+random 1739558 Leading_16 Leading Reverse 1
+random 1740640 Leading_16 Leading Reverse 1
+obs 1741589 Leading_16 Leading Reverse 1
+random 1741671 Leading_16 Leading Reverse 1
+obs 1743716 Leading_16 Leading Reverse 1
+obs 1744090 Leading_16 Leading Reverse 1
+obs 1746079 Leading_16 Leading Reverse 1
+obs 1749724 Leading_16 Leading Reverse 1
+random 1752622 Leading_16 Leading Reverse 1
+random 1755593 Leading_16 Leading Reverse 1
+random 1756880 Leading_16 Leading Reverse 1
+obs 1757721 Leading_16 Leading Reverse 1
+obs 1758241 Leading_16 Leading Reverse 1
+random 1759675 Leading_16 Leading Reverse 1
+random 1759785 Leading_16 Leading Reverse 1
+random 1760241 Leading_16 Leading Reverse 1
+obs 1762445 Leading_16 Leading Reverse 1
+obs 1762898 Leading_16 Leading Reverse 1
+obs 1764238 Leading_16 Leading Reverse 2
+random 1769614 Leading_16 Leading Reverse 1
+random 1771146 Leading_16 Leading Reverse 1
+obs 1774052 Leading_16 Leading Reverse 1
+obs 1777121 Leading_16 Leading Reverse 2
+random 1778827 Leading_16 Leading Reverse 1
+obs 1778863 Leading_16 Leading Reverse 1
+random 1778976 Leading_16 Leading Reverse 1
+obs 1782186 Leading_16 Leading Reverse 1
+obs 1782895 Leading_16 Leading Reverse 1
+obs 1785221 Leading_16 Leading Reverse 2
+random 1786494 Leading_16 Leading Reverse 1
+obs 1788856 Leading_16 Leading Reverse 1
+random 1792454 Leading_16 Leading Reverse 1
+obs 1793213 Leading_16 Leading Reverse 1
+obs 1797558 Leading_16 Leading Reverse 1
+random 1797952 Leading_16 Leading Reverse 1
+obs 1799422 Leading_16 Leading Reverse 9
+obs 1802545 Leading_16 Leading Reverse 2
+obs 1803356 Leading_16 Leading Reverse 1
+obs 1803749 Leading_16 Leading Reverse 1
+obs 1806288 Leading_16 Leading Reverse 1
+random 1809379 Leading_16 Leading Reverse 1
+obs 1827081 Leading_16 Leading Reverse 2
+random 1845749 Leading_16 Leading Reverse 1
+random 1853686 Leading_16 Leading Reverse 1
+obs 1855965 Leading_16 Leading Reverse 1
+obs 1858289 Leading_16 Leading Reverse 2
+random 1861600 Leading_16 Leading Reverse 1
+random 1864300 Leading_16 Leading Reverse 1
+obs 1873059 Leading_16 Leading Reverse 2
+obs 1878676 Leading_16 Leading Reverse 1
+random 1881215 Leading_16 Leading Reverse 1
+obs 1882180 Leading_16 Leading Reverse 1
+obs 1883440 Leading_16 Leading Reverse 2
+obs 1886721 Leading_16 Leading Reverse 1
+random 1886793 Leading_16 Leading Reverse 1
+obs 1897534 Leading_16 Leading Reverse 2
+random 1899381 Leading_16 Leading Reverse 1
+obs 1899481 Leading_16 Leading Reverse 1
+random 1900633 Leading_16 Leading Reverse 1
+obs 1900837 Leading_16 Leading Reverse 1
+random 1903835 Leading_16 Leading Reverse 1
+obs 1905566 Leading_16 Leading Reverse 1
+obs 1911691 Leading_16 Leading Reverse 2
+random 1913963 Leading_16 Leading Reverse 1
+obs 1917728 Leading_16 Leading Reverse 1
+random 1921512 Leading_16 Leading Reverse 1
+random 1921693 Leading_16 Leading Reverse 1
+obs 1923878 Leading_16 Leading Reverse 1
+random 1924808 Leading_16 Leading Reverse 1
+obs 1926714 Leading_16 Leading Reverse 2
+random 1928793 Leading_16 Leading Reverse 1
+obs 1929104 Leading_16 Leading Reverse 1
+obs 1934022 Leading_16 Leading Reverse 1
+obs 1936850 Leading_16 Leading Reverse 1
+obs 1937074 Leading_16 Leading Reverse 1
+obs 1937578 Leading_16 Leading Reverse 5
+obs 1939412 Leading_16 Leading Reverse 1
+random 1940562 Leading_16 Leading Reverse 1
+random 1943245 Leading_16 Leading Reverse 1
+obs 1947257 Leading_16 Leading Reverse 1
+obs 1947379 Leading_16 Leading Reverse 1
+obs 1947469 Leading_16 Leading Reverse 2
+obs 1955533 Leading_16 Leading Reverse 2
+obs 1955871 Leading_16 Leading Reverse 1
+obs 1957307 Leading_16 Leading Reverse 1
+obs 1957870 Leading_16 Leading Reverse 1
+obs 1958088 Leading_16 Leading Reverse 1
+obs 1959295 Leading_16 Leading Reverse 1
+obs 1959655 Leading_16 Leading Reverse 1
+obs 1959737 Leading_16 Leading Reverse 2
+random 1961126 Leading_16 Leading Reverse 1
+obs 1964302 Leading_16 Leading Reverse 1
+random 1964430 Leading_16 Leading Reverse 1
+random 1965292 Leading_16 Leading Reverse 1
+obs 1967897 Leading_16 Leading Reverse 1
+random 1968184 Leading_16 Leading Reverse 1
+obs 1971271 Leading_16 Leading Reverse 1
+obs 1974903 Leading_16 Leading Reverse 1
+random 1978875 Leading_16 Leading Reverse 1
+obs 1981788 Leading_16 Leading Reverse 1
+obs 1981841 Leading_16 Leading Reverse 8
+random 1984335 Leading_16 Leading Reverse 1
+obs 1985123 Leading_16 Leading Reverse 6
+random 1987169 Leading_16 Leading Reverse 1
+random 1990597 Leading_16 Leading Reverse 1
+obs 1991257 Leading_16 Leading Reverse 1
+random 1991277 Leading_16 Leading Reverse 1
+random 1993016 Leading_16 Leading Reverse 1
+random 1994324 Leading_16 Leading Reverse 1
+random 1995111 Leading_16 Leading Reverse 1
+obs 2000940 Leading_16 Leading Reverse 1
+random 2005384 Leading_16 Leading Reverse 1
+obs 2005849 Leading_16 Leading Reverse 1
+obs 2007380 Leading_16 Leading Reverse 1
+random 2009219 Leading_16 Leading Reverse 1
+obs 2009542 Leading_16 Leading Reverse 1
+obs 2010780 Leading_16 Leading Reverse 2
+obs 2011901 Leading_16 Leading Reverse 1
+obs 2013292 Leading_16 Leading Reverse 1
+random 2013635 Leading_16 Leading Reverse 1
+random 2014464 Leading_16 Leading Reverse 1
+random 2020997 Leading_16 Leading Reverse 1
+obs 2021477 Leading_16 Leading Reverse 1
+obs 2021572 Leading_16 Leading Reverse 1
+random 2023191 Leading_16 Leading Reverse 1
+random 2028525 Leading_16 Leading Reverse 1
+obs 2030358 Leading_16 Leading Reverse 1
+obs 2034832 Leading_16 Leading Reverse 1
+obs 2035539 Leading_16 Leading Reverse 1
+obs 2039379 Leading_16 Leading Reverse 1
+obs 2041275 Leading_16 Leading Reverse 1
+random 2042075 Leading_16 Leading Reverse 1
+obs 2044084 Leading_16 Leading Reverse 2
+obs 2055389 Leading_16 Leading Reverse 1
+random 2055547 Leading_16 Leading Reverse 1
+random 2059063 Leading_16 Leading Reverse 1
+obs 2070616 Leading_16 Leading Reverse 3
+random 2074805 Leading_16 Leading Reverse 1
+obs 2075042 Leading_16 Leading Reverse 1
+obs 2077419 Leading_16 Leading Reverse 1
+obs 2077842 Leading_16 Leading Reverse 2
+obs 2078274 Leading_16 Leading Reverse 1
+random 2079478 Leading_16 Leading Reverse 1
+random 2082784 Leading_16 Leading Reverse 1
+obs 2083634 Leading_16 Leading Reverse 1
+obs 2085229 Leading_16 Leading Reverse 1
+obs 2085393 Leading_16 Leading Reverse 1
+obs 2087169 Leading_16 Leading Reverse 1
+obs 2087583 Leading_16 Leading Reverse 1
+obs 2089104 Leading_16 Leading Reverse 1
+obs 2090805 Leading_16 Leading Reverse 1
+random 2093801 Leading_16 Leading Reverse 1
+obs 2093825 Leading_16 Leading Reverse 1
+obs 2094102 Leading_16 Leading Reverse 1
+obs 2099447 Leading_16 Leading Reverse 1
+random 2100671 Leading_16 Leading Reverse 1
+random 2102563 Leading_16 Leading Reverse 1
+random 2106233 Leading_16 Leading Reverse 1
+random 2106456 Leading_16 Leading Reverse 1
+obs 2108581 Leading_16 Leading Reverse 2
+random 2109312 Leading_16 Leading Reverse 1
+random 2109909 Leading_16 Leading Reverse 1
+random 2111688 Leading_16 Leading Reverse 1
+random 2115442 Leading_16 Leading Reverse 1
+random 2115695 Leading_16 Leading Reverse 1
+obs 2121372 Leading_16 Leading Reverse 3
+random 2121624 Leading_16 Leading Reverse 1
+obs 2129364 Leading_16 Leading Reverse 1
+obs 2133463 Leading_16 Leading Reverse 4
+random 2144923 Leading_16 Leading Reverse 1
+random 2147508 Leading_16 Leading Reverse 1
+obs 2148774 Leading_16 Leading Reverse 1
+obs 2151507 Leading_16 Leading Reverse 1
+obs 2153893 Leading_16 Leading Reverse 1
+obs 2155652 Leading_16 Leading Reverse 2
+random 2161158 Leading_16 Leading Reverse 1
+random 2161639 Leading_16 Leading Reverse 1
+random 2162517 Leading_16 Leading Reverse 1
+obs 2164889 Leading_16 Leading Reverse 1
+obs 2165059 Leading_16 Leading Reverse 1
+random 2165135 Leading_16 Leading Reverse 1
+obs 2167817 Leading_16 Leading Reverse 2
+obs 2168931 Leading_16 Leading Reverse 1
+obs 2169616 Leading_16 Leading Reverse 1
+obs 2172302 Leading_16 Leading Reverse 1
+obs 2177224 Leading_16 Leading Reverse 2
+random 2178636 Leading_16 Leading Reverse 1
+obs 2180301 Leading_16 Leading Reverse 1
+random 2183708 Leading_16 Leading Reverse 1
+random 2184275 Leading_16 Leading Reverse 1
+obs 2185635 Leading_16 Leading Reverse 1
+random 2193262 Leading_16 Leading Reverse 1
+random 2196315 Leading_16 Leading Reverse 1
+obs 2205267 Leading_16 Leading Reverse 1
+obs 2210751 Leading_16 Leading Reverse 14
+random 2212236 Leading_16 Leading Reverse 1
+obs 2214323 Leading_16 Leading Reverse 1
+random 2214941 Leading_16 Leading Reverse 1
+random 2220676 Leading_16 Leading Reverse 1
+obs 2221618 Leading_16 Leading Reverse 2
+obs 2224349 Leading_16 Leading Reverse 1
+random 2224859 Leading_16 Leading Reverse 1
+obs 2224991 Leading_16 Leading Reverse 1
+obs 2225147 Leading_16 Leading Reverse 1
+obs 2225391 Leading_16 Leading Reverse 2
+obs 2225996 Leading_16 Leading Reverse 9
+obs 2227678 Leading_16 Leading Reverse 11
+random 2227798 Leading_16 Leading Reverse 1
+random 2228116 Leading_16 Leading Reverse 1
+obs 2237367 Leading_16 Leading Reverse 1
+obs 2237392 Leading_16 Leading Reverse 2
+random 2237852 Leading_16 Leading Reverse 1
+random 2242113 Leading_16 Leading Reverse 1
+obs 2246581 Leading_16 Leading Reverse 1
+obs 2247983 Leading_16 Leading Reverse 1
+random 2248793 Leading_16 Leading Reverse 1
+obs 2252126 Leading_16 Leading Reverse 1
+random 2253313 Leading_16 Leading Reverse 1
+random 2255393 Leading_16 Leading Reverse 1
+random 2256895 Leading_16 Leading Reverse 1
+obs 2260289 Leading_16 Leading Reverse 1
+random 2262847 Leading_16 Leading Reverse 1
+obs 2264430 Leading_16 Leading Reverse 1
+obs 2264939 Leading_16 Leading Reverse 1
+random 2265972 Leading_16 Leading Reverse 1
+random 2267503 Leading_16 Leading Reverse 1
+obs 2268160 Leading_16 Leading Reverse 1
+obs 2271895 Leading_16 Leading Reverse 1
+random 2272717 Leading_16 Leading Reverse 1
+random 2280638 Leading_16 Leading Reverse 1
+obs 2281939 Leading_16 Leading Reverse 2
+obs 2286078 Leading_16 Leading Reverse 1
+random 2288643 Leading_16 Leading Reverse 1
+obs 2289870 Leading_16 Leading Reverse 2
+random 2295220 Leading_16 Leading Reverse 1
+random 2300294 Leading_16 Leading Reverse 1
+random 2302357 Leading_16 Leading Reverse 1
+random 2312261 Leading_16 Leading Reverse 1
+random 2312282 Leading_16 Leading Reverse 1
+random 2317153 Leading_16 Leading Reverse 1
+random 2318366 Leading_16 Leading Reverse 1
+random 2319268 Leading_16 Leading Reverse 1
+random 4629143 Leading_16 Leading Reverse 1
+random 4630285 Leading_16 Leading Reverse 1
+obs 4639089 Leading_16 Leading Reverse 1
diff --git a/dataset/obs_rd_insertions.pos b/dataset/obs_rd_insertions.pos
new file mode 100644
index 0000000000000000000000000000000000000000..b57e03e497d0ae6b9acea04773d5a02ee3c134ac
--- /dev/null
+++ b/dataset/obs_rd_insertions.pos
@@ -0,0 +1,3321 @@
+Sequence Position names fork orient
+obs 6278 Lagging_0 Lagging Forward
+obs 47626 Lagging_0 Lagging Forward
+obs 50670 Lagging_0 Lagging Forward
+obs 56949 Lagging_0 Lagging Forward
+obs 79908 Lagging_0 Lagging Forward
+obs 79908 Lagging_0 Lagging Forward
+obs 82921 Leading_16 Leading Reverse
+obs 82936 Lagging_0 Lagging Forward
+obs 108311 Leading_16 Leading Reverse
+obs 121430 Leading_16 Leading Reverse
+obs 131096 Lagging_0 Lagging Forward
+obs 131454 Leading_16 Leading Reverse
+obs 134422 Lagging_0 Lagging Forward
+obs 138639 Leading_16 Leading Reverse
+obs 147342 Lagging_0 Lagging Forward
+obs 161462 Lagging_0 Lagging Forward
+obs 162752 Lagging_0 Lagging Forward
+obs 163010 Lagging_0 Lagging Forward
+obs 172873 Leading_16 Leading Reverse
+obs 185931 Lagging_0 Lagging Forward
+obs 197823 Lagging_0 Lagging Forward
+obs 200492 Lagging_0 Lagging Forward
+obs 210465 Lagging_0 Lagging Forward
+obs 222323 Lagging_0 Lagging Forward
+obs 251031 Lagging_0 Lagging Forward
+obs 258803 Lagging_0 Lagging Forward
+obs 279619 Lagging_0 Lagging Forward
+obs 284212 Leading_16 Leading Reverse
+obs 324440 Leading_16 Leading Reverse
+obs 358223 Leading_16 Leading Reverse
+obs 359615 Lagging_0 Lagging Forward
+obs 359927 Lagging_0 Lagging Forward
+obs 379273 Leading_16 Leading Reverse
+obs 393430 Lagging_0 Lagging Forward
+obs 400187 Lagging_0 Lagging Forward
+obs 401935 Lagging_0 Lagging Forward
+obs 411254 Leading_16 Leading Reverse
+obs 433818 Lagging_0 Lagging Forward
+obs 444131 Leading_16 Leading Reverse
+obs 473844 Leading_16 Leading Reverse
+obs 473853 Lagging_0 Lagging Forward
+obs 473853 Lagging_0 Lagging Forward
+obs 474103 Leading_16 Leading Reverse
+obs 480601 Lagging_0 Lagging Forward
+obs 484732 Leading_16 Leading Reverse
+obs 484732 Leading_16 Leading Reverse
+obs 486075 Leading_16 Leading Reverse
+obs 490421 Lagging_0 Lagging Forward
+obs 492454 Lagging_0 Lagging Forward
+obs 492454 Lagging_0 Lagging Forward
+obs 492454 Lagging_0 Lagging Forward
+obs 506157 Lagging_0 Lagging Forward
+obs 506406 Lagging_0 Lagging Forward
+obs 517477 Lagging_0 Lagging Forward
+obs 535910 Lagging_0 Lagging Forward
+obs 537762 Leading_16 Leading Reverse
+obs 537762 Leading_16 Leading Reverse
+obs 541533 Lagging_0 Lagging Forward
+obs 543570 Leading_16 Leading Reverse
+obs 595937 Lagging_0 Lagging Forward
+obs 603548 Leading_16 Leading Reverse
+obs 618332 Lagging_0 Lagging Forward
+obs 636178 Lagging_0 Lagging Forward
+obs 640530 Lagging_0 Lagging Forward
+obs 643187 Lagging_0 Lagging Forward
+obs 651478 Leading_16 Leading Reverse
+obs 667360 Leading_16 Leading Reverse
+obs 667360 Leading_16 Leading Reverse
+obs 671674 Leading_16 Leading Reverse
+obs 672741 Lagging_0 Lagging Forward
+obs 674976 Leading_16 Leading Reverse
+obs 674976 Leading_16 Leading Reverse
+obs 682127 Lagging_0 Lagging Forward
+obs 688530 Leading_16 Leading Reverse
+obs 702054 Lagging_0 Lagging Forward
+obs 712349 Lagging_0 Lagging Forward
+obs 725368 Leading_16 Leading Reverse
+obs 725368 Leading_16 Leading Reverse
+obs 725865 Lagging_0 Lagging Forward
+obs 725865 Lagging_0 Lagging Forward
+obs 737434 Leading_16 Leading Reverse
+obs 744700 Lagging_0 Lagging Forward
+obs 761594 Lagging_0 Lagging Forward
+obs 772423 Lagging_0 Lagging Forward
+obs 774818 Leading_16 Leading Reverse
+obs 792209 Leading_16 Leading Reverse
+obs 816680 Leading_16 Leading Reverse
+obs 831686 Leading_16 Leading Reverse
+obs 833789 Lagging_0 Lagging Forward
+obs 833789 Lagging_0 Lagging Forward
+obs 840446 Lagging_0 Lagging Forward
+obs 846884 Leading_16 Leading Reverse
+obs 847968 Lagging_0 Lagging Forward
+obs 855385 Leading_16 Leading Reverse
+obs 859719 Lagging_0 Lagging Forward
+obs 860842 Lagging_0 Lagging Forward
+obs 891138 Lagging_0 Lagging Forward
+obs 891138 Lagging_0 Lagging Forward
+obs 899477 Lagging_0 Lagging Forward
+obs 903254 Leading_16 Leading Reverse
+obs 905927 Lagging_0 Lagging Forward
+obs 910571 Lagging_0 Lagging Forward
+obs 911301 Lagging_0 Lagging Forward
+obs 942460 Lagging_0 Lagging Forward
+obs 956961 Leading_16 Leading Reverse
+obs 961724 Lagging_0 Lagging Forward
+obs 961967 Lagging_0 Lagging Forward
+obs 973920 Lagging_0 Lagging Forward
+obs 975046 Leading_16 Leading Reverse
+obs 975046 Leading_16 Leading Reverse
+obs 975046 Leading_16 Leading Reverse
+obs 975046 Leading_16 Leading Reverse
+obs 978929 Lagging_0 Lagging Forward
+obs 988121 Leading_16 Leading Reverse
+obs 996686 Lagging_0 Lagging Forward
+obs 1002390 Leading_16 Leading Reverse
+obs 1009717 Lagging_0 Lagging Forward
+obs 1019628 Leading_16 Leading Reverse
+obs 1029769 Leading_16 Leading Reverse
+obs 1043726 Lagging_0 Lagging Forward
+obs 1045943 Leading_16 Leading Reverse
+obs 1065237 Leading_16 Leading Reverse
+obs 1066941 Leading_16 Leading Reverse
+obs 1067994 Leading_16 Leading Reverse
+obs 1067994 Leading_16 Leading Reverse
+obs 1067994 Leading_16 Leading Reverse
+obs 1067994 Leading_16 Leading Reverse
+obs 1067994 Leading_16 Leading Reverse
+obs 1070743 Leading_16 Leading Reverse
+obs 1078795 Leading_16 Leading Reverse
+obs 1083927 Leading_16 Leading Reverse
+obs 1093582 Lagging_0 Lagging Forward
+obs 1093582 Lagging_0 Lagging Forward
+obs 1102851 Lagging_0 Lagging Forward
+obs 1108556 Leading_16 Leading Reverse
+obs 1108575 Lagging_0 Lagging Forward
+obs 1114675 Lagging_0 Lagging Forward
+obs 1117001 Leading_16 Leading Reverse
+obs 1117001 Leading_16 Leading Reverse
+obs 1119778 Leading_16 Leading Reverse
+obs 1119778 Leading_16 Leading Reverse
+obs 1127283 Lagging_0 Lagging Forward
+obs 1127283 Lagging_0 Lagging Forward
+obs 1132327 Lagging_0 Lagging Forward
+obs 1132353 Lagging_0 Lagging Forward
+obs 1132353 Lagging_0 Lagging Forward
+obs 1133587 Lagging_0 Lagging Forward
+obs 1137017 Leading_16 Leading Reverse
+obs 1138596 Lagging_0 Lagging Forward
+obs 1139155 Lagging_0 Lagging Forward
+obs 1143940 Lagging_0 Lagging Forward
+obs 1148910 Leading_16 Leading Reverse
+obs 1148910 Leading_16 Leading Reverse
+obs 1156361 Lagging_0 Lagging Forward
+obs 1157800 Leading_16 Leading Reverse
+obs 1157800 Leading_16 Leading Reverse
+obs 1159872 Leading_16 Leading Reverse
+obs 1165194 Leading_16 Leading Reverse
+obs 1165441 Lagging_0 Lagging Forward
+obs 1165441 Lagging_0 Lagging Forward
+obs 1170301 Leading_16 Leading Reverse
+obs 1170434 Leading_16 Leading Reverse
+obs 1170309 Lagging_0 Lagging Forward
+obs 1172920 Lagging_0 Lagging Forward
+obs 1173203 Leading_16 Leading Reverse
+obs 1173883 Lagging_0 Lagging Forward
+obs 1173883 Lagging_0 Lagging Forward
+obs 1173883 Lagging_0 Lagging Forward
+obs 1173883 Lagging_0 Lagging Forward
+obs 1180853 Lagging_0 Lagging Forward
+obs 1188793 Lagging_0 Lagging Forward
+obs 1191500 Lagging_0 Lagging Forward
+obs 1195172 Lagging_0 Lagging Forward
+obs 1197101 Leading_16 Leading Reverse
+obs 1200779 Lagging_0 Lagging Forward
+obs 1204504 Lagging_0 Lagging Forward
+obs 1204661 Lagging_0 Lagging Forward
+obs 1205189 Leading_16 Leading Reverse
+obs 1207899 Lagging_0 Lagging Forward
+obs 1209692 Leading_16 Leading Reverse
+obs 1211740 Lagging_0 Lagging Forward
+obs 1211740 Lagging_0 Lagging Forward
+obs 1219300 Lagging_0 Lagging Forward
+obs 1225199 Leading_16 Leading Reverse
+obs 1237740 Lagging_0 Lagging Forward
+obs 1242088 Lagging_0 Lagging Forward
+obs 1244403 Leading_16 Leading Reverse
+obs 1244312 Lagging_0 Lagging Forward
+obs 1247054 Lagging_0 Lagging Forward
+obs 1252389 Lagging_0 Lagging Forward
+obs 1258479 Lagging_0 Lagging Forward
+obs 1260087 Lagging_0 Lagging Forward
+obs 1260087 Lagging_0 Lagging Forward
+obs 1263321 Lagging_0 Lagging Forward
+obs 1274191 Lagging_0 Lagging Forward
+obs 1274191 Lagging_0 Lagging Forward
+obs 1274191 Lagging_0 Lagging Forward
+obs 1274191 Lagging_0 Lagging Forward
+obs 1276290 Lagging_0 Lagging Forward
+obs 1284055 Leading_16 Leading Reverse
+obs 1286148 Lagging_0 Lagging Forward
+obs 1289269 Lagging_0 Lagging Forward
+obs 1291962 Leading_16 Leading Reverse
+obs 1291962 Leading_16 Leading Reverse
+obs 1312109 Leading_16 Leading Reverse
+obs 1313139 Lagging_0 Lagging Forward
+obs 1316015 Leading_16 Leading Reverse
+obs 1316368 Leading_16 Leading Reverse
+obs 1316395 Lagging_0 Lagging Forward
+obs 1316947 Lagging_0 Lagging Forward
+obs 1320698 Leading_16 Leading Reverse
+obs 1320791 Leading_16 Leading Reverse
+obs 1320791 Leading_16 Leading Reverse
+obs 1321972 Lagging_0 Lagging Forward
+obs 1323049 Leading_16 Leading Reverse
+obs 1324086 Leading_16 Leading Reverse
+obs 1325059 Lagging_0 Lagging Forward
+obs 1327115 Leading_16 Leading Reverse
+obs 1327110 Lagging_0 Lagging Forward
+obs 1327110 Lagging_0 Lagging Forward
+obs 1327476 Leading_16 Leading Reverse
+obs 1327533 Lagging_0 Lagging Forward
+obs 1327974 Lagging_0 Lagging Forward
+obs 1334050 Lagging_0 Lagging Forward
+obs 1334270 Leading_16 Leading Reverse
+obs 1339323 Lagging_0 Lagging Forward
+obs 1339622 Leading_16 Leading Reverse
+obs 1339604 Lagging_0 Lagging Forward
+obs 1341620 Lagging_0 Lagging Forward
+obs 1341620 Lagging_0 Lagging Forward
+obs 1341620 Lagging_0 Lagging Forward
+obs 1341620 Lagging_0 Lagging Forward
+obs 1341620 Lagging_0 Lagging Forward
+obs 1341620 Lagging_0 Lagging Forward
+obs 1341620 Lagging_0 Lagging Forward
+obs 1341803 Lagging_0 Lagging Forward
+obs 1342918 Leading_16 Leading Reverse
+obs 1344794 Leading_16 Leading Reverse
+obs 1345016 Lagging_0 Lagging Forward
+obs 1352680 Lagging_0 Lagging Forward
+obs 1353353 Lagging_0 Lagging Forward
+obs 1363265 Lagging_0 Lagging Forward
+obs 1367206 Lagging_0 Lagging Forward
+obs 1367630 Lagging_0 Lagging Forward
+obs 1367630 Lagging_0 Lagging Forward
+obs 1371327 Lagging_0 Lagging Forward
+obs 1378395 Lagging_0 Lagging Forward
+obs 1399012 Lagging_0 Lagging Forward
+obs 1406075 Leading_16 Leading Reverse
+obs 1413090 Leading_16 Leading Reverse
+obs 1413663 Leading_16 Leading Reverse
+obs 1416223 Leading_16 Leading Reverse
+obs 1418288 Lagging_0 Lagging Forward
+obs 1420748 Leading_16 Leading Reverse
+obs 1421507 Leading_16 Leading Reverse
+obs 1421507 Leading_16 Leading Reverse
+obs 1421515 Lagging_0 Lagging Forward
+obs 1423485 Lagging_0 Lagging Forward
+obs 1424006 Lagging_0 Lagging Forward
+obs 1431402 Lagging_0 Lagging Forward
+obs 1432681 Leading_16 Leading Reverse
+obs 1433599 Lagging_0 Lagging Forward
+obs 1435872 Lagging_0 Lagging Forward
+obs 1439335 Lagging_0 Lagging Forward
+obs 1440253 Leading_16 Leading Reverse
+obs 1445782 Lagging_0 Lagging Forward
+obs 1447701 Lagging_0 Lagging Forward
+obs 1450508 Lagging_0 Lagging Forward
+obs 1458392 Lagging_0 Lagging Forward
+obs 1462558 Lagging_0 Lagging Forward
+obs 1463042 Leading_16 Leading Reverse
+obs 1463485 Leading_16 Leading Reverse
+obs 1464183 Lagging_0 Lagging Forward
+obs 1470018 Lagging_0 Lagging Forward
+obs 1478869 Leading_16 Leading Reverse
+obs 1478918 Lagging_0 Lagging Forward
+obs 1483094 Leading_16 Leading Reverse
+obs 1484444 Leading_16 Leading Reverse
+obs 1486099 Leading_16 Leading Reverse
+obs 1490008 Lagging_0 Lagging Forward
+obs 1492573 Leading_16 Leading Reverse
+obs 1495239 Lagging_0 Lagging Forward
+obs 1495239 Lagging_0 Lagging Forward
+obs 1495794 Leading_16 Leading Reverse
+obs 1499275 Leading_16 Leading Reverse
+obs 1501691 Lagging_0 Lagging Forward
+obs 1501691 Lagging_0 Lagging Forward
+obs 1501691 Lagging_0 Lagging Forward
+obs 1502459 Lagging_0 Lagging Forward
+obs 1507112 Lagging_0 Lagging Forward
+obs 1507827 Lagging_0 Lagging Forward
+obs 1511056 Leading_16 Leading Reverse
+obs 1512939 Lagging_0 Lagging Forward
+obs 1513034 Lagging_0 Lagging Forward
+obs 1517929 Leading_16 Leading Reverse
+obs 1518350 Leading_16 Leading Reverse
+obs 1519070 Leading_16 Leading Reverse
+obs 1519629 Leading_16 Leading Reverse
+obs 1522184 Lagging_0 Lagging Forward
+obs 1523783 Lagging_0 Lagging Forward
+obs 1523783 Lagging_0 Lagging Forward
+obs 1524388 Leading_16 Leading Reverse
+obs 1526900 Lagging_0 Lagging Forward
+obs 1529666 Leading_16 Leading Reverse
+obs 1529675 Lagging_0 Lagging Forward
+obs 1532554 Leading_16 Leading Reverse
+obs 1532554 Leading_16 Leading Reverse
+obs 1536988 Leading_16 Leading Reverse
+obs 1537698 Lagging_0 Lagging Forward
+obs 1548180 Leading_16 Leading Reverse
+obs 1548180 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548180 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548192 Leading_16 Leading Reverse
+obs 1548497 Lagging_0 Lagging Forward
+obs 1548845 Leading_16 Leading Reverse
+obs 1549819 Leading_16 Leading Reverse
+obs 1550257 Leading_16 Leading Reverse
+obs 1555070 Leading_16 Leading Reverse
+obs 1555723 Lagging_0 Lagging Forward
+obs 1555723 Lagging_0 Lagging Forward
+obs 1555723 Lagging_0 Lagging Forward
+obs 1555723 Lagging_0 Lagging Forward
+obs 1555723 Lagging_0 Lagging Forward
+obs 1555723 Lagging_0 Lagging Forward
+obs 1556909 Lagging_0 Lagging Forward
+obs 1556909 Lagging_0 Lagging Forward
+obs 1561737 Leading_16 Leading Reverse
+obs 1561736 Lagging_0 Lagging Forward
+obs 1561748 Lagging_0 Lagging Forward
+obs 1564788 Lagging_0 Lagging Forward
+obs 1570386 Lagging_0 Lagging Forward
+obs 1577460 Lagging_0 Lagging Forward
+obs 1584462 Leading_16 Leading Reverse
+obs 1584462 Leading_16 Leading Reverse
+obs 1584462 Leading_16 Leading Reverse
+obs 1590460 Lagging_0 Lagging Forward
+obs 1591884 Leading_16 Leading Reverse
+obs 1593950 Lagging_0 Lagging Forward
+obs 1596465 Leading_16 Leading Reverse
+obs 1602377 Leading_16 Leading Reverse
+obs 1602637 Lagging_0 Lagging Forward
+obs 1603018 Lagging_0 Lagging Forward
+obs 1603635 Leading_16 Leading Reverse
+obs 1603635 Leading_16 Leading Reverse
+obs 1603635 Leading_16 Leading Reverse
+obs 1610951 Leading_16 Leading Reverse
+obs 1610951 Leading_16 Leading Reverse
+obs 1610951 Leading_16 Leading Reverse
+obs 1610951 Leading_16 Leading Reverse
+obs 1610951 Leading_16 Leading Reverse
+obs 1610971 Lagging_0 Lagging Forward
+obs 1613205 Lagging_0 Lagging Forward
+obs 1614552 Lagging_0 Lagging Forward
+obs 1616663 Leading_16 Leading Reverse
+obs 1617791 Leading_16 Leading Reverse
+obs 1618225 Leading_16 Leading Reverse
+obs 1629357 Leading_16 Leading Reverse
+obs 1629495 Leading_16 Leading Reverse
+obs 1631132 Lagging_0 Lagging Forward
+obs 1632360 Lagging_0 Lagging Forward
+obs 1632360 Lagging_0 Lagging Forward
+obs 1632360 Lagging_0 Lagging Forward
+obs 1632360 Lagging_0 Lagging Forward
+obs 1633116 Lagging_0 Lagging Forward
+obs 1634843 Lagging_0 Lagging Forward
+obs 1635432 Lagging_0 Lagging Forward
+obs 1639735 Lagging_0 Lagging Forward
+obs 1640309 Lagging_0 Lagging Forward
+obs 1640718 Leading_16 Leading Reverse
+obs 1640876 Lagging_0 Lagging Forward
+obs 1643189 Leading_16 Leading Reverse
+obs 1643790 Leading_16 Leading Reverse
+obs 1643790 Leading_16 Leading Reverse
+obs 1643790 Leading_16 Leading Reverse
+obs 1643790 Leading_16 Leading Reverse
+obs 1643790 Leading_16 Leading Reverse
+obs 1643790 Leading_16 Leading Reverse
+obs 1643790 Leading_16 Leading Reverse
+obs 1643790 Leading_16 Leading Reverse
+obs 1643790 Leading_16 Leading Reverse
+obs 1643790 Leading_16 Leading Reverse
+obs 1643798 Lagging_0 Lagging Forward
+obs 1646821 Leading_16 Leading Reverse
+obs 1647360 Leading_16 Leading Reverse
+obs 1667018 Lagging_0 Lagging Forward
+obs 1673360 Leading_16 Leading Reverse
+obs 1675492 Leading_16 Leading Reverse
+obs 1676258 Lagging_0 Lagging Forward
+obs 1676582 Leading_16 Leading Reverse
+obs 1678138 Lagging_0 Lagging Forward
+obs 1684338 Leading_16 Leading Reverse
+obs 1685958 Leading_16 Leading Reverse
+obs 1685958 Leading_16 Leading Reverse
+obs 1693735 Leading_16 Leading Reverse
+obs 1694333 Lagging_0 Lagging Forward
+obs 1694628 Leading_16 Leading Reverse
+obs 1696306 Lagging_0 Lagging Forward
+obs 1696306 Lagging_0 Lagging Forward
+obs 1697917 Lagging_0 Lagging Forward
+obs 1697917 Lagging_0 Lagging Forward
+obs 1698280 Leading_16 Leading Reverse
+obs 1704013 Lagging_0 Lagging Forward
+obs 1711097 Lagging_0 Lagging Forward
+obs 1714519 Leading_16 Leading Reverse
+obs 1724722 Leading_16 Leading Reverse
+obs 1724717 Lagging_0 Lagging Forward
+obs 1725079 Leading_16 Leading Reverse
+obs 1725079 Leading_16 Leading Reverse
+obs 1731790 Lagging_0 Lagging Forward
+obs 1733615 Lagging_0 Lagging Forward
+obs 1734227 Leading_16 Leading Reverse
+obs 1738201 Leading_16 Leading Reverse
+obs 1738201 Leading_16 Leading Reverse
+obs 1741409 Lagging_0 Lagging Forward
+obs 1741589 Leading_16 Leading Reverse
+obs 1743716 Leading_16 Leading Reverse
+obs 1744090 Leading_16 Leading Reverse
+obs 1746079 Leading_16 Leading Reverse
+obs 1749724 Leading_16 Leading Reverse
+obs 1757721 Leading_16 Leading Reverse
+obs 1758241 Leading_16 Leading Reverse
+obs 1762445 Leading_16 Leading Reverse
+obs 1762898 Leading_16 Leading Reverse
+obs 1764238 Leading_16 Leading Reverse
+obs 1764238 Leading_16 Leading Reverse
+obs 1768035 Lagging_0 Lagging Forward
+obs 1771328 Lagging_0 Lagging Forward
+obs 1771328 Lagging_0 Lagging Forward
+obs 1771328 Lagging_0 Lagging Forward
+obs 1772045 Lagging_0 Lagging Forward
+obs 1774052 Leading_16 Leading Reverse
+obs 1776383 Lagging_0 Lagging Forward
+obs 1776383 Lagging_0 Lagging Forward
+obs 1776383 Lagging_0 Lagging Forward
+obs 1776383 Lagging_0 Lagging Forward
+obs 1776383 Lagging_0 Lagging Forward
+obs 1776383 Lagging_0 Lagging Forward
+obs 1776383 Lagging_0 Lagging Forward
+obs 1776383 Lagging_0 Lagging Forward
+obs 1776383 Lagging_0 Lagging Forward
+obs 1777121 Leading_16 Leading Reverse
+obs 1777121 Leading_16 Leading Reverse
+obs 1778863 Leading_16 Leading Reverse
+obs 1782186 Leading_16 Leading Reverse
+obs 1782768 Lagging_0 Lagging Forward
+obs 1782768 Lagging_0 Lagging Forward
+obs 1782895 Leading_16 Leading Reverse
+obs 1785221 Leading_16 Leading Reverse
+obs 1785221 Leading_16 Leading Reverse
+obs 1785229 Lagging_0 Lagging Forward
+obs 1785229 Lagging_0 Lagging Forward
+obs 1785229 Lagging_0 Lagging Forward
+obs 1788750 Lagging_0 Lagging Forward
+obs 1788856 Leading_16 Leading Reverse
+obs 1789489 Lagging_0 Lagging Forward
+obs 1792959 Lagging_0 Lagging Forward
+obs 1793213 Leading_16 Leading Reverse
+obs 1796621 Lagging_0 Lagging Forward
+obs 1796621 Lagging_0 Lagging Forward
+obs 1797558 Leading_16 Leading Reverse
+obs 1799422 Leading_16 Leading Reverse
+obs 1799422 Leading_16 Leading Reverse
+obs 1799422 Leading_16 Leading Reverse
+obs 1799422 Leading_16 Leading Reverse
+obs 1799422 Leading_16 Leading Reverse
+obs 1799422 Leading_16 Leading Reverse
+obs 1799422 Leading_16 Leading Reverse
+obs 1799422 Leading_16 Leading Reverse
+obs 1799422 Leading_16 Leading Reverse
+obs 1799539 Lagging_0 Lagging Forward
+obs 1802545 Leading_16 Leading Reverse
+obs 1802545 Leading_16 Leading Reverse
+obs 1803085 Lagging_0 Lagging Forward
+obs 1803356 Leading_16 Leading Reverse
+obs 1803749 Leading_16 Leading Reverse
+obs 1806288 Leading_16 Leading Reverse
+obs 1811568 Lagging_0 Lagging Forward
+obs 1818174 Lagging_0 Lagging Forward
+obs 1825261 Lagging_0 Lagging Forward
+obs 1827081 Leading_16 Leading Reverse
+obs 1827081 Leading_16 Leading Reverse
+obs 1827089 Lagging_0 Lagging Forward
+obs 1827089 Lagging_0 Lagging Forward
+obs 1827089 Lagging_0 Lagging Forward
+obs 1827089 Lagging_0 Lagging Forward
+obs 1827089 Lagging_0 Lagging Forward
+obs 1827089 Lagging_0 Lagging Forward
+obs 1827089 Lagging_0 Lagging Forward
+obs 1827089 Lagging_0 Lagging Forward
+obs 1827089 Lagging_0 Lagging Forward
+obs 1830367 Lagging_0 Lagging Forward
+obs 1833203 Lagging_0 Lagging Forward
+obs 1851615 Lagging_0 Lagging Forward
+obs 1852822 Lagging_0 Lagging Forward
+obs 1855965 Leading_16 Leading Reverse
+obs 1858289 Leading_16 Leading Reverse
+obs 1858289 Leading_16 Leading Reverse
+obs 1859710 Lagging_0 Lagging Forward
+obs 1860613 Lagging_0 Lagging Forward
+obs 1864085 Lagging_0 Lagging Forward
+obs 1872761 Lagging_0 Lagging Forward
+obs 1873059 Leading_16 Leading Reverse
+obs 1873059 Leading_16 Leading Reverse
+obs 1874278 Lagging_0 Lagging Forward
+obs 1874278 Lagging_0 Lagging Forward
+obs 1874278 Lagging_0 Lagging Forward
+obs 1874278 Lagging_0 Lagging Forward
+obs 1875367 Lagging_0 Lagging Forward
+obs 1878676 Leading_16 Leading Reverse
+obs 1880377 Lagging_0 Lagging Forward
+obs 1880377 Lagging_0 Lagging Forward
+obs 1880377 Lagging_0 Lagging Forward
+obs 1880377 Lagging_0 Lagging Forward
+obs 1882180 Leading_16 Leading Reverse
+obs 1883440 Leading_16 Leading Reverse
+obs 1883440 Leading_16 Leading Reverse
+obs 1886721 Leading_16 Leading Reverse
+obs 1890225 Lagging_0 Lagging Forward
+obs 1891280 Lagging_0 Lagging Forward
+obs 1897534 Leading_16 Leading Reverse
+obs 1897534 Leading_16 Leading Reverse
+obs 1899481 Leading_16 Leading Reverse
+obs 1900837 Leading_16 Leading Reverse
+obs 1902078 Lagging_0 Lagging Forward
+obs 1905566 Leading_16 Leading Reverse
+obs 1906191 Lagging_0 Lagging Forward
+obs 1907086 Lagging_0 Lagging Forward
+obs 1908727 Lagging_0 Lagging Forward
+obs 1909319 Lagging_0 Lagging Forward
+obs 1910691 Lagging_0 Lagging Forward
+obs 1911691 Leading_16 Leading Reverse
+obs 1911691 Leading_16 Leading Reverse
+obs 1915305 Lagging_0 Lagging Forward
+obs 1916019 Lagging_0 Lagging Forward
+obs 1917728 Leading_16 Leading Reverse
+obs 1921342 Lagging_0 Lagging Forward
+obs 1923878 Leading_16 Leading Reverse
+obs 1923886 Lagging_0 Lagging Forward
+obs 1926714 Leading_16 Leading Reverse
+obs 1926714 Leading_16 Leading Reverse
+obs 1926723 Lagging_0 Lagging Forward
+obs 1926723 Lagging_0 Lagging Forward
+obs 1929104 Leading_16 Leading Reverse
+obs 1931317 Lagging_0 Lagging Forward
+obs 1931439 Lagging_0 Lagging Forward
+obs 1934022 Leading_16 Leading Reverse
+obs 1934031 Lagging_0 Lagging Forward
+obs 1934031 Lagging_0 Lagging Forward
+obs 1934031 Lagging_0 Lagging Forward
+obs 1935366 Lagging_0 Lagging Forward
+obs 1936850 Leading_16 Leading Reverse
+obs 1937074 Leading_16 Leading Reverse
+obs 1937578 Leading_16 Leading Reverse
+obs 1937578 Leading_16 Leading Reverse
+obs 1937578 Leading_16 Leading Reverse
+obs 1937578 Leading_16 Leading Reverse
+obs 1937578 Leading_16 Leading Reverse
+obs 1937587 Lagging_0 Lagging Forward
+obs 1939412 Leading_16 Leading Reverse
+obs 1945685 Lagging_0 Lagging Forward
+obs 1945685 Lagging_0 Lagging Forward
+obs 1945685 Lagging_0 Lagging Forward
+obs 1947257 Leading_16 Leading Reverse
+obs 1947379 Leading_16 Leading Reverse
+obs 1947469 Leading_16 Leading Reverse
+obs 1947469 Leading_16 Leading Reverse
+obs 1955533 Leading_16 Leading Reverse
+obs 1955533 Leading_16 Leading Reverse
+obs 1955529 Lagging_0 Lagging Forward
+obs 1955871 Leading_16 Leading Reverse
+obs 1955879 Lagging_0 Lagging Forward
+obs 1957307 Leading_16 Leading Reverse
+obs 1957870 Leading_16 Leading Reverse
+obs 1958088 Leading_16 Leading Reverse
+obs 1959295 Leading_16 Leading Reverse
+obs 1959304 Lagging_0 Lagging Forward
+obs 1959655 Leading_16 Leading Reverse
+obs 1959737 Leading_16 Leading Reverse
+obs 1959737 Leading_16 Leading Reverse
+obs 1960596 Lagging_0 Lagging Forward
+obs 1961858 Lagging_0 Lagging Forward
+obs 1962802 Lagging_0 Lagging Forward
+obs 1963305 Lagging_0 Lagging Forward
+obs 1963305 Lagging_0 Lagging Forward
+obs 1963305 Lagging_0 Lagging Forward
+obs 1964302 Leading_16 Leading Reverse
+obs 1965734 Lagging_0 Lagging Forward
+obs 1965968 Lagging_0 Lagging Forward
+obs 1967897 Leading_16 Leading Reverse
+obs 1971271 Leading_16 Leading Reverse
+obs 1973789 Lagging_0 Lagging Forward
+obs 1974903 Leading_16 Leading Reverse
+obs 1981788 Leading_16 Leading Reverse
+obs 1981841 Leading_16 Leading Reverse
+obs 1981841 Leading_16 Leading Reverse
+obs 1981841 Leading_16 Leading Reverse
+obs 1981841 Leading_16 Leading Reverse
+obs 1981841 Leading_16 Leading Reverse
+obs 1981841 Leading_16 Leading Reverse
+obs 1981841 Leading_16 Leading Reverse
+obs 1981841 Leading_16 Leading Reverse
+obs 1984379 Lagging_0 Lagging Forward
+obs 1984379 Lagging_0 Lagging Forward
+obs 1984551 Lagging_0 Lagging Forward
+obs 1985123 Leading_16 Leading Reverse
+obs 1985123 Leading_16 Leading Reverse
+obs 1985123 Leading_16 Leading Reverse
+obs 1985123 Leading_16 Leading Reverse
+obs 1985123 Leading_16 Leading Reverse
+obs 1985123 Leading_16 Leading Reverse
+obs 1985248 Lagging_0 Lagging Forward
+obs 1985248 Lagging_0 Lagging Forward
+obs 1985500 Lagging_0 Lagging Forward
+obs 1986443 Lagging_0 Lagging Forward
+obs 1987689 Lagging_0 Lagging Forward
+obs 1989077 Lagging_0 Lagging Forward
+obs 1991257 Leading_16 Leading Reverse
+obs 1992127 Lagging_0 Lagging Forward
+obs 1992170 Lagging_0 Lagging Forward
+obs 1999775 Lagging_0 Lagging Forward
+obs 2000940 Leading_16 Leading Reverse
+obs 2004422 Lagging_0 Lagging Forward
+obs 2004422 Lagging_0 Lagging Forward
+obs 2004422 Lagging_0 Lagging Forward
+obs 2004847 Lagging_0 Lagging Forward
+obs 2005849 Leading_16 Leading Reverse
+obs 2007380 Leading_16 Leading Reverse
+obs 2009280 Lagging_0 Lagging Forward
+obs 2009542 Leading_16 Leading Reverse
+obs 2009547 Lagging_0 Lagging Forward
+obs 2010780 Leading_16 Leading Reverse
+obs 2010780 Leading_16 Leading Reverse
+obs 2011901 Leading_16 Leading Reverse
+obs 2012476 Lagging_0 Lagging Forward
+obs 2012476 Lagging_0 Lagging Forward
+obs 2012590 Lagging_0 Lagging Forward
+obs 2013292 Leading_16 Leading Reverse
+obs 2021477 Leading_16 Leading Reverse
+obs 2021572 Leading_16 Leading Reverse
+obs 2022060 Lagging_0 Lagging Forward
+obs 2022090 Lagging_0 Lagging Forward
+obs 2022090 Lagging_0 Lagging Forward
+obs 2024740 Lagging_0 Lagging Forward
+obs 2030358 Leading_16 Leading Reverse
+obs 2034832 Leading_16 Leading Reverse
+obs 2035539 Leading_16 Leading Reverse
+obs 2039379 Leading_16 Leading Reverse
+obs 2039387 Lagging_0 Lagging Forward
+obs 2041275 Leading_16 Leading Reverse
+obs 2044084 Leading_16 Leading Reverse
+obs 2044084 Leading_16 Leading Reverse
+obs 2055389 Leading_16 Leading Reverse
+obs 2061145 Lagging_0 Lagging Forward
+obs 2063435 Lagging_0 Lagging Forward
+obs 2068696 Lagging_0 Lagging Forward
+obs 2070616 Leading_16 Leading Reverse
+obs 2070616 Leading_16 Leading Reverse
+obs 2070616 Leading_16 Leading Reverse
+obs 2071795 Lagging_0 Lagging Forward
+obs 2075042 Leading_16 Leading Reverse
+obs 2077419 Leading_16 Leading Reverse
+obs 2077454 Lagging_0 Lagging Forward
+obs 2077842 Leading_16 Leading Reverse
+obs 2077842 Leading_16 Leading Reverse
+obs 2078274 Leading_16 Leading Reverse
+obs 2081890 Lagging_0 Lagging Forward
+obs 2083634 Leading_16 Leading Reverse
+obs 2085229 Leading_16 Leading Reverse
+obs 2085318 Lagging_0 Lagging Forward
+obs 2085393 Leading_16 Leading Reverse
+obs 2087169 Leading_16 Leading Reverse
+obs 2087177 Lagging_0 Lagging Forward
+obs 2087583 Leading_16 Leading Reverse
+obs 2088520 Lagging_0 Lagging Forward
+obs 2088520 Lagging_0 Lagging Forward
+obs 2088520 Lagging_0 Lagging Forward
+obs 2088520 Lagging_0 Lagging Forward
+obs 2088520 Lagging_0 Lagging Forward
+obs 2089104 Leading_16 Leading Reverse
+obs 2089753 Lagging_0 Lagging Forward
+obs 2090805 Leading_16 Leading Reverse
+obs 2092898 Lagging_0 Lagging Forward
+obs 2093825 Leading_16 Leading Reverse
+obs 2094102 Leading_16 Leading Reverse
+obs 2096856 Lagging_0 Lagging Forward
+obs 2099447 Leading_16 Leading Reverse
+obs 2099596 Lagging_0 Lagging Forward
+obs 2099596 Lagging_0 Lagging Forward
+obs 2103203 Lagging_0 Lagging Forward
+obs 2105433 Lagging_0 Lagging Forward
+obs 2108581 Leading_16 Leading Reverse
+obs 2108581 Leading_16 Leading Reverse
+obs 2114293 Lagging_0 Lagging Forward
+obs 2120915 Lagging_0 Lagging Forward
+obs 2121372 Leading_16 Leading Reverse
+obs 2121372 Leading_16 Leading Reverse
+obs 2121372 Leading_16 Leading Reverse
+obs 2123386 Lagging_0 Lagging Forward
+obs 2129364 Leading_16 Leading Reverse
+obs 2129611 Lagging_0 Lagging Forward
+obs 2133463 Leading_16 Leading Reverse
+obs 2133463 Leading_16 Leading Reverse
+obs 2133463 Leading_16 Leading Reverse
+obs 2133463 Leading_16 Leading Reverse
+obs 2134199 Lagging_0 Lagging Forward
+obs 2141692 Lagging_0 Lagging Forward
+obs 2146543 Lagging_0 Lagging Forward
+obs 2148774 Leading_16 Leading Reverse
+obs 2150401 Lagging_0 Lagging Forward
+obs 2151507 Leading_16 Leading Reverse
+obs 2151599 Lagging_0 Lagging Forward
+obs 2153893 Leading_16 Leading Reverse
+obs 2155652 Leading_16 Leading Reverse
+obs 2155652 Leading_16 Leading Reverse
+obs 2156820 Lagging_0 Lagging Forward
+obs 2164889 Leading_16 Leading Reverse
+obs 2165059 Leading_16 Leading Reverse
+obs 2167128 Lagging_0 Lagging Forward
+obs 2167354 Lagging_0 Lagging Forward
+obs 2167354 Lagging_0 Lagging Forward
+obs 2167817 Leading_16 Leading Reverse
+obs 2167817 Leading_16 Leading Reverse
+obs 2168497 Lagging_0 Lagging Forward
+obs 2168931 Leading_16 Leading Reverse
+obs 2169616 Leading_16 Leading Reverse
+obs 2172302 Leading_16 Leading Reverse
+obs 2172244 Lagging_0 Lagging Forward
+obs 2172244 Lagging_0 Lagging Forward
+obs 2172244 Lagging_0 Lagging Forward
+obs 2173223 Lagging_0 Lagging Forward
+obs 2173223 Lagging_0 Lagging Forward
+obs 2177224 Leading_16 Leading Reverse
+obs 2177224 Leading_16 Leading Reverse
+obs 2180301 Leading_16 Leading Reverse
+obs 2185635 Leading_16 Leading Reverse
+obs 2205267 Leading_16 Leading Reverse
+obs 2205639 Lagging_0 Lagging Forward
+obs 2210751 Leading_16 Leading Reverse
+obs 2210751 Leading_16 Leading Reverse
+obs 2210751 Leading_16 Leading Reverse
+obs 2210751 Leading_16 Leading Reverse
+obs 2210751 Leading_16 Leading Reverse
+obs 2210751 Leading_16 Leading Reverse
+obs 2210751 Leading_16 Leading Reverse
+obs 2210751 Leading_16 Leading Reverse
+obs 2210751 Leading_16 Leading Reverse
+obs 2210751 Leading_16 Leading Reverse
+obs 2210751 Leading_16 Leading Reverse
+obs 2210751 Leading_16 Leading Reverse
+obs 2210751 Leading_16 Leading Reverse
+obs 2210751 Leading_16 Leading Reverse
+obs 2213753 Lagging_0 Lagging Forward
+obs 2213848 Lagging_0 Lagging Forward
+obs 2214323 Leading_16 Leading Reverse
+obs 2216168 Lagging_0 Lagging Forward
+obs 2221247 Lagging_0 Lagging Forward
+obs 2221618 Leading_16 Leading Reverse
+obs 2221618 Leading_16 Leading Reverse
+obs 2224349 Leading_16 Leading Reverse
+obs 2224750 Lagging_0 Lagging Forward
+obs 2224991 Leading_16 Leading Reverse
+obs 2225147 Leading_16 Leading Reverse
+obs 2225391 Leading_16 Leading Reverse
+obs 2225391 Leading_16 Leading Reverse
+obs 2225815 Lagging_0 Lagging Forward
+obs 2225996 Leading_16 Leading Reverse
+obs 2225996 Leading_16 Leading Reverse
+obs 2225996 Leading_16 Leading Reverse
+obs 2225996 Leading_16 Leading Reverse
+obs 2225996 Leading_16 Leading Reverse
+obs 2225996 Leading_16 Leading Reverse
+obs 2225996 Leading_16 Leading Reverse
+obs 2225996 Leading_16 Leading Reverse
+obs 2225996 Leading_16 Leading Reverse
+obs 2227374 Lagging_0 Lagging Forward
+obs 2227678 Leading_16 Leading Reverse
+obs 2227678 Leading_16 Leading Reverse
+obs 2227678 Leading_16 Leading Reverse
+obs 2227678 Leading_16 Leading Reverse
+obs 2227678 Leading_16 Leading Reverse
+obs 2227678 Leading_16 Leading Reverse
+obs 2227678 Leading_16 Leading Reverse
+obs 2227678 Leading_16 Leading Reverse
+obs 2227678 Leading_16 Leading Reverse
+obs 2227678 Leading_16 Leading Reverse
+obs 2227678 Leading_16 Leading Reverse
+obs 2230818 Lagging_0 Lagging Forward
+obs 2237392 Leading_16 Leading Reverse
+obs 2237392 Leading_16 Leading Reverse
+obs 2237367 Leading_16 Leading Reverse
+obs 2245420 Lagging_0 Lagging Forward
+obs 2245420 Lagging_0 Lagging Forward
+obs 2245420 Lagging_0 Lagging Forward
+obs 2245906 Lagging_0 Lagging Forward
+obs 2246581 Leading_16 Leading Reverse
+obs 2247983 Leading_16 Leading Reverse
+obs 2250986 Lagging_0 Lagging Forward
+obs 2252126 Leading_16 Leading Reverse
+obs 2252203 Lagging_0 Lagging Forward
+obs 2253478 Lagging_0 Lagging Forward
+obs 2253733 Lagging_0 Lagging Forward
+obs 2255636 Lagging_0 Lagging Forward
+obs 2260289 Leading_16 Leading Reverse
+obs 2261858 Lagging_0 Lagging Forward
+obs 2261858 Lagging_0 Lagging Forward
+obs 2261858 Lagging_0 Lagging Forward
+obs 2261858 Lagging_0 Lagging Forward
+obs 2261858 Lagging_0 Lagging Forward
+obs 2261858 Lagging_0 Lagging Forward
+obs 2261858 Lagging_0 Lagging Forward
+obs 2261858 Lagging_0 Lagging Forward
+obs 2262383 Lagging_0 Lagging Forward
+obs 2262383 Lagging_0 Lagging Forward
+obs 2262383 Lagging_0 Lagging Forward
+obs 2262383 Lagging_0 Lagging Forward
+obs 2262383 Lagging_0 Lagging Forward
+obs 2262383 Lagging_0 Lagging Forward
+obs 2262383 Lagging_0 Lagging Forward
+obs 2262383 Lagging_0 Lagging Forward
+obs 2262383 Lagging_0 Lagging Forward
+obs 2264430 Leading_16 Leading Reverse
+obs 2264939 Leading_16 Leading Reverse
+obs 2267473 Lagging_0 Lagging Forward
+obs 2267581 Lagging_0 Lagging Forward
+obs 2267581 Lagging_0 Lagging Forward
+obs 2268160 Leading_16 Leading Reverse
+obs 2269653 Lagging_0 Lagging Forward
+obs 2270391 Lagging_0 Lagging Forward
+obs 2271895 Leading_16 Leading Reverse
+obs 2275269 Lagging_0 Lagging Forward
+obs 2281939 Leading_16 Leading Reverse
+obs 2281939 Leading_16 Leading Reverse
+obs 2286078 Leading_16 Leading Reverse
+obs 2289870 Leading_16 Leading Reverse
+obs 2289870 Leading_16 Leading Reverse
+obs 2290388 Lagging_0 Lagging Forward
+obs 2291530 Lagging_0 Lagging Forward
+obs 2292654 Lagging_0 Lagging Forward
+obs 2293799 Lagging_0 Lagging Forward
+obs 2303560 Lagging_0 Lagging Forward
+obs 2303815 Lagging_0 Lagging Forward
+obs 2313369 Lagging_0 Lagging Forward
+obs 2317257 Lagging_0 Lagging Forward
+obs 2320713 Lagging_0 Lagging Forward
+obs 2321413 Leading_0 Leading Forward
+obs 2324113 Leading_0 Leading Forward
+obs 2324508 Lagging_16 Lagging Reverse
+obs 2324508 Lagging_16 Lagging Reverse
+obs 2327776 Lagging_16 Lagging Reverse
+obs 2331238 Lagging_16 Lagging Reverse
+obs 2332118 Lagging_16 Lagging Reverse
+obs 2332118 Lagging_16 Lagging Reverse
+obs 2332191 Lagging_16 Lagging Reverse
+obs 2332191 Lagging_16 Lagging Reverse
+obs 2333301 Leading_0 Leading Forward
+obs 2333673 Lagging_16 Lagging Reverse
+obs 2333673 Lagging_16 Lagging Reverse
+obs 2333715 Leading_0 Leading Forward
+obs 2333963 Leading_0 Leading Forward
+obs 2334508 Leading_0 Leading Forward
+obs 2334508 Leading_0 Leading Forward
+obs 2334556 Leading_0 Leading Forward
+obs 2335573 Lagging_16 Lagging Reverse
+obs 2335537 Leading_0 Leading Forward
+obs 2336464 Lagging_16 Lagging Reverse
+obs 2343021 Lagging_16 Lagging Reverse
+obs 2343021 Lagging_16 Lagging Reverse
+obs 2343021 Lagging_16 Lagging Reverse
+obs 2345096 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2349156 Lagging_16 Lagging Reverse
+obs 2352634 Leading_0 Leading Forward
+obs 2352945 Lagging_16 Lagging Reverse
+obs 2352945 Lagging_16 Lagging Reverse
+obs 2353039 Lagging_16 Lagging Reverse
+obs 2354530 Leading_0 Leading Forward
+obs 2354530 Leading_0 Leading Forward
+obs 2354530 Leading_0 Leading Forward
+obs 2355516 Lagging_16 Lagging Reverse
+obs 2355736 Leading_0 Leading Forward
+obs 2355736 Leading_0 Leading Forward
+obs 2358418 Leading_0 Leading Forward
+obs 2359610 Leading_0 Leading Forward
+obs 2359756 Leading_0 Leading Forward
+obs 2360723 Leading_0 Leading Forward
+obs 2361120 Lagging_16 Lagging Reverse
+obs 2361120 Lagging_16 Lagging Reverse
+obs 2361120 Lagging_16 Lagging Reverse
+obs 2361120 Lagging_16 Lagging Reverse
+obs 2361120 Lagging_16 Lagging Reverse
+obs 2361120 Lagging_16 Lagging Reverse
+obs 2364046 Lagging_16 Lagging Reverse
+obs 2364432 Lagging_16 Lagging Reverse
+obs 2364312 Leading_0 Leading Forward
+obs 2364440 Leading_0 Leading Forward
+obs 2365702 Lagging_16 Lagging Reverse
+obs 2366325 Leading_0 Leading Forward
+obs 2367411 Leading_0 Leading Forward
+obs 2369182 Leading_0 Leading Forward
+obs 2370478 Leading_0 Leading Forward
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378819 Lagging_16 Lagging Reverse
+obs 2378827 Leading_0 Leading Forward
+obs 2379933 Leading_0 Leading Forward
+obs 2382541 Lagging_16 Lagging Reverse
+obs 2382543 Lagging_16 Lagging Reverse
+obs 2382543 Lagging_16 Lagging Reverse
+obs 2382543 Lagging_16 Lagging Reverse
+obs 2382543 Lagging_16 Lagging Reverse
+obs 2382543 Lagging_16 Lagging Reverse
+obs 2382551 Leading_0 Leading Forward
+obs 2393329 Leading_0 Leading Forward
+obs 2394256 Lagging_16 Lagging Reverse
+obs 2396411 Lagging_16 Lagging Reverse
+obs 2399357 Leading_0 Leading Forward
+obs 2399745 Lagging_16 Lagging Reverse
+obs 2401118 Lagging_16 Lagging Reverse
+obs 2404481 Leading_0 Leading Forward
+obs 2404481 Leading_0 Leading Forward
+obs 2406336 Lagging_16 Lagging Reverse
+obs 2406789 Lagging_16 Lagging Reverse
+obs 2408742 Lagging_16 Lagging Reverse
+obs 2413106 Lagging_16 Lagging Reverse
+obs 2413095 Lagging_16 Lagging Reverse
+obs 2413596 Lagging_16 Lagging Reverse
+obs 2413695 Lagging_16 Lagging Reverse
+obs 2417345 Leading_0 Leading Forward
+obs 2417345 Leading_0 Leading Forward
+obs 2419342 Lagging_16 Lagging Reverse
+obs 2419342 Lagging_16 Lagging Reverse
+obs 2419632 Leading_0 Leading Forward
+obs 2422747 Lagging_16 Lagging Reverse
+obs 2424167 Lagging_16 Lagging Reverse
+obs 2424042 Leading_0 Leading Forward
+obs 2424912 Lagging_16 Lagging Reverse
+obs 2425883 Leading_0 Leading Forward
+obs 2427894 Lagging_16 Lagging Reverse
+obs 2428843 Lagging_16 Lagging Reverse
+obs 2429029 Lagging_16 Lagging Reverse
+obs 2435989 Lagging_16 Lagging Reverse
+obs 2443021 Lagging_16 Lagging Reverse
+obs 2444063 Lagging_16 Lagging Reverse
+obs 2447560 Lagging_16 Lagging Reverse
+obs 2451142 Lagging_16 Lagging Reverse
+obs 2462259 Leading_0 Leading Forward
+obs 2462874 Lagging_16 Lagging Reverse
+obs 2463077 Lagging_16 Lagging Reverse
+obs 2470531 Lagging_16 Lagging Reverse
+obs 2470531 Lagging_16 Lagging Reverse
+obs 2470531 Lagging_16 Lagging Reverse
+obs 2470531 Lagging_16 Lagging Reverse
+obs 2470531 Lagging_16 Lagging Reverse
+obs 2470531 Lagging_16 Lagging Reverse
+obs 2470531 Lagging_16 Lagging Reverse
+obs 2475128 Leading_0 Leading Forward
+obs 2486805 Lagging_16 Lagging Reverse
+obs 2489116 Leading_0 Leading Forward
+obs 2491406 Leading_0 Leading Forward
+obs 2498573 Lagging_16 Lagging Reverse
+obs 2500923 Leading_0 Leading Forward
+obs 2501160 Lagging_16 Lagging Reverse
+obs 2513137 Lagging_16 Lagging Reverse
+obs 2513207 Leading_0 Leading Forward
+obs 2515985 Leading_0 Leading Forward
+obs 2515985 Leading_0 Leading Forward
+obs 2518487 Lagging_16 Lagging Reverse
+obs 2519070 Lagging_16 Lagging Reverse
+obs 2519131 Leading_0 Leading Forward
+obs 2522162 Lagging_16 Lagging Reverse
+obs 2524008 Lagging_16 Lagging Reverse
+obs 2524016 Leading_0 Leading Forward
+obs 2524160 Lagging_16 Lagging Reverse
+obs 2526627 Leading_0 Leading Forward
+obs 2528748 Lagging_16 Lagging Reverse
+obs 2528680 Leading_0 Leading Forward
+obs 2528922 Lagging_16 Lagging Reverse
+obs 2532004 Lagging_16 Lagging Reverse
+obs 2532048 Leading_0 Leading Forward
+obs 2532048 Leading_0 Leading Forward
+obs 2532048 Leading_0 Leading Forward
+obs 2532048 Leading_0 Leading Forward
+obs 2532048 Leading_0 Leading Forward
+obs 2532298 Lagging_16 Lagging Reverse
+obs 2533071 Leading_0 Leading Forward
+obs 2533615 Leading_0 Leading Forward
+obs 2534843 Lagging_16 Lagging Reverse
+obs 2534843 Lagging_16 Lagging Reverse
+obs 2534843 Lagging_16 Lagging Reverse
+obs 2534851 Leading_0 Leading Forward
+obs 2534851 Leading_0 Leading Forward
+obs 2535445 Lagging_16 Lagging Reverse
+obs 2539656 Leading_0 Leading Forward
+obs 2540263 Lagging_16 Lagging Reverse
+obs 2544389 Lagging_16 Lagging Reverse
+obs 2544389 Lagging_16 Lagging Reverse
+obs 2544389 Lagging_16 Lagging Reverse
+obs 2545117 Lagging_16 Lagging Reverse
+obs 2545117 Lagging_16 Lagging Reverse
+obs 2548269 Leading_0 Leading Forward
+obs 2551054 Lagging_16 Lagging Reverse
+obs 2551193 Lagging_16 Lagging Reverse
+obs 2551197 Leading_0 Leading Forward
+obs 2551381 Lagging_16 Lagging Reverse
+obs 2551586 Lagging_16 Lagging Reverse
+obs 2552776 Leading_0 Leading Forward
+obs 2553963 Lagging_16 Lagging Reverse
+obs 2553963 Lagging_16 Lagging Reverse
+obs 2553963 Lagging_16 Lagging Reverse
+obs 2553963 Lagging_16 Lagging Reverse
+obs 2553963 Lagging_16 Lagging Reverse
+obs 2553963 Lagging_16 Lagging Reverse
+obs 2553963 Lagging_16 Lagging Reverse
+obs 2558059 Leading_0 Leading Forward
+obs 2560106 Leading_0 Leading Forward
+obs 2588233 Leading_0 Leading Forward
+obs 2588796 Leading_0 Leading Forward
+obs 2589717 Lagging_16 Lagging Reverse
+obs 2591285 Leading_0 Leading Forward
+obs 2591285 Leading_0 Leading Forward
+obs 2591876 Lagging_16 Lagging Reverse
+obs 2592089 Lagging_16 Lagging Reverse
+obs 2598507 Leading_0 Leading Forward
+obs 2599625 Leading_0 Leading Forward
+obs 2613260 Lagging_16 Lagging Reverse
+obs 2613808 Leading_0 Leading Forward
+obs 2613808 Leading_0 Leading Forward
+obs 2613808 Leading_0 Leading Forward
+obs 2613808 Leading_0 Leading Forward
+obs 2614799 Lagging_16 Lagging Reverse
+obs 2618211 Lagging_16 Lagging Reverse
+obs 2619994 Lagging_16 Lagging Reverse
+obs 2621862 Leading_0 Leading Forward
+obs 2624242 Leading_0 Leading Forward
+obs 2626945 Lagging_16 Lagging Reverse
+obs 2628203 Lagging_16 Lagging Reverse
+obs 2628203 Lagging_16 Lagging Reverse
+obs 2629822 Lagging_16 Lagging Reverse
+obs 2632768 Lagging_16 Lagging Reverse
+obs 2632784 Lagging_16 Lagging Reverse
+obs 2632784 Lagging_16 Lagging Reverse
+obs 2632768 Lagging_16 Lagging Reverse
+obs 2632768 Lagging_16 Lagging Reverse
+obs 2632768 Lagging_16 Lagging Reverse
+obs 2632768 Lagging_16 Lagging Reverse
+obs 2634182 Leading_0 Leading Forward
+obs 2635235 Leading_0 Leading Forward
+obs 2635594 Lagging_16 Lagging Reverse
+obs 2635603 Leading_0 Leading Forward
+obs 2635603 Leading_0 Leading Forward
+obs 2636255 Lagging_16 Lagging Reverse
+obs 2636255 Lagging_16 Lagging Reverse
+obs 2637555 Leading_0 Leading Forward
+obs 2637826 Leading_0 Leading Forward
+obs 2638050 Leading_0 Leading Forward
+obs 2642092 Leading_0 Leading Forward
+obs 2643603 Lagging_16 Lagging Reverse
+obs 2643615 Lagging_16 Lagging Reverse
+obs 2647468 Leading_0 Leading Forward
+obs 2667233 Lagging_16 Lagging Reverse
+obs 2667317 Lagging_16 Lagging Reverse
+obs 2667548 Leading_0 Leading Forward
+obs 2667852 Lagging_16 Lagging Reverse
+obs 2678543 Leading_0 Leading Forward
+obs 2680246 Lagging_16 Lagging Reverse
+obs 2684908 Leading_0 Leading Forward
+obs 2688713 Leading_0 Leading Forward
+obs 2689615 Leading_0 Leading Forward
+obs 2690110 Lagging_16 Lagging Reverse
+obs 2697728 Lagging_16 Lagging Reverse
+obs 2703258 Leading_0 Leading Forward
+obs 2709840 Leading_0 Leading Forward
+obs 2712664 Leading_0 Leading Forward
+obs 2715494 Leading_0 Leading Forward
+obs 2718582 Lagging_16 Lagging Reverse
+obs 2719278 Lagging_16 Lagging Reverse
+obs 2725864 Lagging_16 Lagging Reverse
+obs 2726509 Lagging_16 Lagging Reverse
+obs 2732351 Lagging_16 Lagging Reverse
+obs 2738509 Lagging_16 Lagging Reverse
+obs 2738509 Lagging_16 Lagging Reverse
+obs 2749888 Leading_0 Leading Forward
+obs 2750501 Leading_0 Leading Forward
+obs 2751983 Lagging_16 Lagging Reverse
+obs 2755891 Leading_0 Leading Forward
+obs 2759064 Leading_0 Leading Forward
+obs 2762106 Leading_0 Leading Forward
+obs 2763222 Lagging_16 Lagging Reverse
+obs 2764813 Lagging_16 Lagging Reverse
+obs 2765329 Leading_0 Leading Forward
+obs 2765329 Leading_0 Leading Forward
+obs 2769579 Lagging_16 Lagging Reverse
+obs 2774237 Leading_0 Leading Forward
+obs 2775199 Leading_0 Leading Forward
+obs 2775199 Leading_0 Leading Forward
+obs 2775199 Leading_0 Leading Forward
+obs 2776718 Lagging_16 Lagging Reverse
+obs 2776718 Lagging_16 Lagging Reverse
+obs 2776718 Lagging_16 Lagging Reverse
+obs 2776718 Lagging_16 Lagging Reverse
+obs 2776718 Lagging_16 Lagging Reverse
+obs 2776796 Lagging_16 Lagging Reverse
+obs 2776718 Lagging_16 Lagging Reverse
+obs 2781973 Leading_0 Leading Forward
+obs 2782321 Leading_0 Leading Forward
+obs 2783167 Leading_0 Leading Forward
+obs 2783167 Leading_0 Leading Forward
+obs 2788779 Leading_0 Leading Forward
+obs 2789426 Lagging_16 Lagging Reverse
+obs 2791592 Lagging_16 Lagging Reverse
+obs 2792078 Lagging_16 Lagging Reverse
+obs 2794852 Lagging_16 Lagging Reverse
+obs 2795375 Lagging_16 Lagging Reverse
+obs 2798634 Leading_0 Leading Forward
+obs 2798904 Leading_0 Leading Forward
+obs 2798904 Leading_0 Leading Forward
+obs 2799445 Lagging_16 Lagging Reverse
+obs 2801519 Lagging_16 Lagging Reverse
+obs 2802407 Lagging_16 Lagging Reverse
+obs 2802549 Lagging_16 Lagging Reverse
+obs 2809104 Lagging_16 Lagging Reverse
+obs 2809112 Leading_0 Leading Forward
+obs 2809112 Leading_0 Leading Forward
+obs 2809112 Leading_0 Leading Forward
+obs 2811306 Lagging_16 Lagging Reverse
+obs 2816421 Leading_0 Leading Forward
+obs 2818007 Leading_0 Leading Forward
+obs 2818280 Lagging_16 Lagging Reverse
+obs 2818280 Lagging_16 Lagging Reverse
+obs 2819001 Leading_0 Leading Forward
+obs 2819212 Lagging_16 Lagging Reverse
+obs 2819212 Lagging_16 Lagging Reverse
+obs 2819212 Lagging_16 Lagging Reverse
+obs 2819212 Lagging_16 Lagging Reverse
+obs 2821456 Lagging_16 Lagging Reverse
+obs 2826377 Leading_0 Leading Forward
+obs 2827595 Lagging_16 Lagging Reverse
+obs 2828131 Lagging_16 Lagging Reverse
+obs 2828136 Leading_0 Leading Forward
+obs 2829461 Lagging_16 Lagging Reverse
+obs 2830062 Lagging_16 Lagging Reverse
+obs 2830062 Lagging_16 Lagging Reverse
+obs 2830071 Leading_0 Leading Forward
+obs 2830071 Leading_0 Leading Forward
+obs 2830071 Leading_0 Leading Forward
+obs 2830631 Leading_0 Leading Forward
+obs 2834733 Leading_0 Leading Forward
+obs 2834733 Leading_0 Leading Forward
+obs 2836082 Leading_0 Leading Forward
+obs 2840950 Lagging_16 Lagging Reverse
+obs 2841630 Leading_0 Leading Forward
+obs 2842282 Lagging_16 Lagging Reverse
+obs 2842956 Lagging_16 Lagging Reverse
+obs 2842956 Lagging_16 Lagging Reverse
+obs 2842956 Lagging_16 Lagging Reverse
+obs 2842956 Lagging_16 Lagging Reverse
+obs 2842964 Leading_0 Leading Forward
+obs 2842964 Leading_0 Leading Forward
+obs 2848089 Lagging_16 Lagging Reverse
+obs 2848113 Lagging_16 Lagging Reverse
+obs 2850303 Lagging_16 Lagging Reverse
+obs 2853229 Leading_0 Leading Forward
+obs 2853525 Leading_0 Leading Forward
+obs 2853525 Leading_0 Leading Forward
+obs 2857108 Leading_0 Leading Forward
+obs 2857655 Leading_0 Leading Forward
+obs 2863797 Lagging_16 Lagging Reverse
+obs 2879830 Leading_0 Leading Forward
+obs 2879830 Leading_0 Leading Forward
+obs 2892060 Leading_0 Leading Forward
+obs 2894649 Leading_0 Leading Forward
+obs 2896017 Lagging_16 Lagging Reverse
+obs 2896824 Leading_0 Leading Forward
+obs 2902212 Lagging_16 Lagging Reverse
+obs 2905236 Lagging_16 Lagging Reverse
+obs 2905261 Lagging_16 Lagging Reverse
+obs 2907645 Lagging_16 Lagging Reverse
+obs 2907653 Leading_0 Leading Forward
+obs 2907653 Leading_0 Leading Forward
+obs 2915008 Leading_0 Leading Forward
+obs 2919440 Lagging_16 Lagging Reverse
+obs 2919440 Lagging_16 Lagging Reverse
+obs 2919440 Lagging_16 Lagging Reverse
+obs 2919449 Leading_0 Leading Forward
+obs 2919449 Leading_0 Leading Forward
+obs 2919449 Leading_0 Leading Forward
+obs 2919449 Leading_0 Leading Forward
+obs 2919449 Leading_0 Leading Forward
+obs 2919449 Leading_0 Leading Forward
+obs 2919449 Leading_0 Leading Forward
+obs 2919449 Leading_0 Leading Forward
+obs 2919449 Leading_0 Leading Forward
+obs 2919449 Leading_0 Leading Forward
+obs 2923282 Lagging_16 Lagging Reverse
+obs 2924272 Lagging_16 Lagging Reverse
+obs 2925913 Leading_0 Leading Forward
+obs 2929206 Lagging_16 Lagging Reverse
+obs 2929206 Lagging_16 Lagging Reverse
+obs 2942366 Lagging_16 Lagging Reverse
+obs 2943399 Lagging_16 Lagging Reverse
+obs 2947445 Lagging_16 Lagging Reverse
+obs 2947463 Lagging_16 Lagging Reverse
+obs 2949329 Lagging_16 Lagging Reverse
+obs 2957319 Lagging_16 Lagging Reverse
+obs 2961040 Lagging_16 Lagging Reverse
+obs 2964195 Lagging_16 Lagging Reverse
+obs 2964596 Lagging_16 Lagging Reverse
+obs 2964596 Lagging_16 Lagging Reverse
+obs 2964596 Lagging_16 Lagging Reverse
+obs 2964596 Lagging_16 Lagging Reverse
+obs 2964596 Lagging_16 Lagging Reverse
+obs 2964605 Leading_0 Leading Forward
+obs 2964605 Leading_0 Leading Forward
+obs 2964605 Leading_0 Leading Forward
+obs 2964605 Leading_0 Leading Forward
+obs 2964605 Leading_0 Leading Forward
+obs 2968548 Lagging_16 Lagging Reverse
+obs 2971309 Lagging_16 Lagging Reverse
+obs 2977079 Leading_0 Leading Forward
+obs 2977079 Leading_0 Leading Forward
+obs 2978968 Lagging_16 Lagging Reverse
+obs 2981650 Leading_0 Leading Forward
+obs 2987658 Leading_0 Leading Forward
+obs 2993211 Leading_0 Leading Forward
+obs 2994989 Leading_0 Leading Forward
+obs 2998638 Leading_0 Leading Forward
+obs 3000692 Lagging_16 Lagging Reverse
+obs 3003277 Lagging_16 Lagging Reverse
+obs 3008251 Leading_0 Leading Forward
+obs 3009289 Lagging_16 Lagging Reverse
+obs 3009290 Lagging_16 Lagging Reverse
+obs 3014633 Lagging_16 Lagging Reverse
+obs 3015313 Leading_0 Leading Forward
+obs 3016526 Leading_0 Leading Forward
+obs 3016526 Leading_0 Leading Forward
+obs 3019036 Leading_0 Leading Forward
+obs 3020543 Lagging_16 Lagging Reverse
+obs 3024242 Lagging_16 Lagging Reverse
+obs 3024250 Leading_0 Leading Forward
+obs 3025928 Lagging_16 Lagging Reverse
+obs 3036279 Leading_0 Leading Forward
+obs 3038726 Lagging_16 Lagging Reverse
+obs 3043209 Lagging_16 Lagging Reverse
+obs 3043209 Lagging_16 Lagging Reverse
+obs 3044831 Lagging_16 Lagging Reverse
+obs 3044839 Leading_0 Leading Forward
+obs 3052003 Lagging_16 Lagging Reverse
+obs 3056282 Leading_0 Leading Forward
+obs 3064394 Lagging_16 Lagging Reverse
+obs 3064501 Lagging_16 Lagging Reverse
+obs 3071321 Lagging_16 Lagging Reverse
+obs 3071321 Lagging_16 Lagging Reverse
+obs 3076987 Lagging_16 Lagging Reverse
+obs 3082181 Lagging_16 Lagging Reverse
+obs 3082826 Leading_0 Leading Forward
+obs 3090753 Leading_0 Leading Forward
+obs 3097689 Leading_0 Leading Forward
+obs 3097930 Leading_0 Leading Forward
+obs 3097942 Leading_0 Leading Forward
+obs 3097942 Leading_0 Leading Forward
+obs 3098165 Lagging_16 Lagging Reverse
+obs 3098275 Lagging_16 Lagging Reverse
+obs 3098173 Leading_0 Leading Forward
+obs 3098173 Leading_0 Leading Forward
+obs 3107053 Lagging_16 Lagging Reverse
+obs 3107076 Lagging_16 Lagging Reverse
+obs 3107780 Lagging_16 Lagging Reverse
+obs 3107661 Leading_0 Leading Forward
+obs 3107661 Leading_0 Leading Forward
+obs 3107661 Leading_0 Leading Forward
+obs 3107661 Leading_0 Leading Forward
+obs 3107661 Leading_0 Leading Forward
+obs 3107661 Leading_0 Leading Forward
+obs 3107661 Leading_0 Leading Forward
+obs 3107661 Leading_0 Leading Forward
+obs 3107780 Lagging_16 Lagging Reverse
+obs 3116763 Leading_0 Leading Forward
+obs 3119408 Lagging_16 Lagging Reverse
+obs 3121239 Lagging_16 Lagging Reverse
+obs 3125052 Lagging_16 Lagging Reverse
+obs 3125716 Lagging_16 Lagging Reverse
+obs 3125789 Lagging_16 Lagging Reverse
+obs 3127302 Leading_0 Leading Forward
+obs 3147611 Lagging_16 Lagging Reverse
+obs 3151322 Leading_0 Leading Forward
+obs 3156319 Lagging_16 Lagging Reverse
+obs 3166934 Lagging_16 Lagging Reverse
+obs 3200322 Lagging_16 Lagging Reverse
+obs 3200889 Leading_0 Leading Forward
+obs 3201416 Leading_0 Leading Forward
+obs 3203966 Lagging_16 Lagging Reverse
+obs 3205074 Lagging_16 Lagging Reverse
+obs 3205650 Lagging_16 Lagging Reverse
+obs 3205650 Lagging_16 Lagging Reverse
+obs 3205650 Lagging_16 Lagging Reverse
+obs 3206164 Leading_0 Leading Forward
+obs 3206164 Leading_0 Leading Forward
+obs 3206164 Leading_0 Leading Forward
+obs 3209472 Lagging_16 Lagging Reverse
+obs 3209472 Lagging_16 Lagging Reverse
+obs 3218373 Lagging_16 Lagging Reverse
+obs 3218373 Lagging_16 Lagging Reverse
+obs 3230082 Lagging_16 Lagging Reverse
+obs 3252283 Lagging_16 Lagging Reverse
+obs 3253553 Lagging_16 Lagging Reverse
+obs 3258803 Lagging_16 Lagging Reverse
+obs 3266061 Leading_0 Leading Forward
+obs 3268970 Leading_0 Leading Forward
+obs 3270034 Leading_0 Leading Forward
+obs 3272982 Lagging_16 Lagging Reverse
+obs 3281734 Lagging_16 Lagging Reverse
+obs 3285561 Leading_0 Leading Forward
+obs 3285561 Leading_0 Leading Forward
+obs 3285561 Leading_0 Leading Forward
+obs 3286434 Leading_0 Leading Forward
+obs 3286677 Leading_0 Leading Forward
+obs 3291234 Leading_0 Leading Forward
+obs 3294212 Lagging_16 Lagging Reverse
+obs 3310136 Lagging_16 Lagging Reverse
+obs 3310131 Leading_0 Leading Forward
+obs 3314852 Lagging_16 Lagging Reverse
+obs 3315187 Lagging_16 Lagging Reverse
+obs 3326148 Lagging_16 Lagging Reverse
+obs 3339933 Lagging_16 Lagging Reverse
+obs 3343662 Leading_0 Leading Forward
+obs 3343662 Leading_0 Leading Forward
+obs 3343662 Leading_0 Leading Forward
+obs 3345426 Leading_0 Leading Forward
+obs 3345426 Leading_0 Leading Forward
+obs 3360469 Lagging_16 Lagging Reverse
+obs 3360469 Lagging_16 Lagging Reverse
+obs 3360469 Lagging_16 Lagging Reverse
+obs 3362630 Leading_0 Leading Forward
+obs 3366735 Lagging_16 Lagging Reverse
+obs 3366735 Lagging_16 Lagging Reverse
+obs 3366735 Lagging_16 Lagging Reverse
+obs 3367962 Lagging_16 Lagging Reverse
+obs 3387228 Lagging_16 Lagging Reverse
+obs 3390786 Lagging_16 Lagging Reverse
+obs 3390786 Lagging_16 Lagging Reverse
+obs 3390786 Lagging_16 Lagging Reverse
+obs 3392698 Lagging_16 Lagging Reverse
+obs 3392951 Leading_0 Leading Forward
+obs 3401796 Leading_0 Leading Forward
+obs 3402483 Leading_0 Leading Forward
+obs 3403026 Lagging_16 Lagging Reverse
+obs 3403026 Lagging_16 Lagging Reverse
+obs 3403764 Lagging_16 Lagging Reverse
+obs 3408385 Lagging_16 Lagging Reverse
+obs 3408385 Lagging_16 Lagging Reverse
+obs 3414428 Leading_0 Leading Forward
+obs 3414998 Lagging_16 Lagging Reverse
+obs 3427008 Lagging_16 Lagging Reverse
+obs 3428279 Lagging_16 Lagging Reverse
+obs 3430318 Lagging_16 Lagging Reverse
+obs 3430318 Lagging_16 Lagging Reverse
+obs 3430318 Lagging_16 Lagging Reverse
+obs 3439910 Lagging_16 Lagging Reverse
+obs 3445272 Leading_0 Leading Forward
+obs 3446251 Leading_0 Leading Forward
+obs 3446471 Leading_0 Leading Forward
+obs 3455630 Lagging_16 Lagging Reverse
+obs 3456680 Lagging_16 Lagging Reverse
+obs 3457539 Lagging_16 Lagging Reverse
+obs 3474153 Lagging_16 Lagging Reverse
+obs 3481255 Lagging_16 Lagging Reverse
+obs 3482634 Leading_0 Leading Forward
+obs 3482634 Leading_0 Leading Forward
+obs 3486027 Leading_0 Leading Forward
+obs 3492096 Leading_0 Leading Forward
+obs 3493217 Lagging_16 Lagging Reverse
+obs 3493217 Lagging_16 Lagging Reverse
+obs 3494985 Leading_0 Leading Forward
+obs 3497943 Leading_0 Leading Forward
+obs 3500534 Leading_0 Leading Forward
+obs 3500920 Lagging_16 Lagging Reverse
+obs 3505748 Lagging_16 Lagging Reverse
+obs 3508254 Lagging_16 Lagging Reverse
+obs 3513978 Leading_0 Leading Forward
+obs 3513978 Leading_0 Leading Forward
+obs 3516243 Leading_0 Leading Forward
+obs 3516383 Leading_0 Leading Forward
+obs 3521046 Leading_0 Leading Forward
+obs 3522565 Lagging_16 Lagging Reverse
+obs 3524471 Lagging_16 Lagging Reverse
+obs 3525824 Lagging_16 Lagging Reverse
+obs 3527242 Lagging_16 Lagging Reverse
+obs 3534646 Lagging_16 Lagging Reverse
+obs 3534654 Leading_0 Leading Forward
+obs 3540745 Leading_0 Leading Forward
+obs 3548251 Leading_0 Leading Forward
+obs 3548251 Leading_0 Leading Forward
+obs 3548251 Leading_0 Leading Forward
+obs 3569581 Lagging_16 Lagging Reverse
+obs 3577007 Leading_0 Leading Forward
+obs 3598349 Leading_0 Leading Forward
+obs 3628570 Leading_0 Leading Forward
+obs 3629251 Leading_0 Leading Forward
+obs 3629654 Lagging_16 Lagging Reverse
+obs 3630799 Lagging_16 Lagging Reverse
+obs 3631269 Lagging_16 Lagging Reverse
+obs 3636688 Lagging_16 Lagging Reverse
+obs 3639720 Lagging_16 Lagging Reverse
+obs 3642838 Leading_0 Leading Forward
+obs 3642838 Leading_0 Leading Forward
+obs 3643871 Lagging_16 Lagging Reverse
+obs 3644641 Lagging_16 Lagging Reverse
+obs 3647139 Leading_0 Leading Forward
+obs 3659745 Leading_0 Leading Forward
+obs 3661156 Leading_0 Leading Forward
+obs 3663156 Lagging_16 Lagging Reverse
+obs 3680681 Leading_0 Leading Forward
+obs 3680681 Leading_0 Leading Forward
+obs 3681519 Leading_0 Leading Forward
+obs 3685060 Lagging_16 Lagging Reverse
+obs 3694803 Lagging_16 Lagging Reverse
+obs 3694803 Lagging_16 Lagging Reverse
+obs 3694803 Lagging_16 Lagging Reverse
+obs 3695230 Lagging_16 Lagging Reverse
+obs 3695237 Leading_0 Leading Forward
+obs 3706384 Leading_0 Leading Forward
+obs 3734548 Leading_0 Leading Forward
+obs 3745583 Lagging_16 Lagging Reverse
+obs 3745757 Leading_0 Leading Forward
+obs 3749277 Lagging_16 Lagging Reverse
+obs 3752231 Lagging_16 Lagging Reverse
+obs 3756458 Leading_0 Leading Forward
+obs 3761565 Leading_0 Leading Forward
+obs 3761565 Leading_0 Leading Forward
+obs 3761565 Leading_0 Leading Forward
+obs 3761699 Leading_0 Leading Forward
+obs 3761699 Leading_0 Leading Forward
+obs 3761786 Leading_0 Leading Forward
+obs 3761786 Leading_0 Leading Forward
+obs 3761786 Leading_0 Leading Forward
+obs 3763688 Leading_0 Leading Forward
+obs 3776434 Lagging_16 Lagging Reverse
+obs 3776434 Lagging_16 Lagging Reverse
+obs 3776434 Lagging_16 Lagging Reverse
+obs 3776434 Lagging_16 Lagging Reverse
+obs 3778584 Lagging_16 Lagging Reverse
+obs 3785822 Leading_0 Leading Forward
+obs 3785868 Lagging_16 Lagging Reverse
+obs 3794340 Lagging_16 Lagging Reverse
+obs 3800256 Leading_0 Leading Forward
+obs 3800537 Leading_0 Leading Forward
+obs 3819187 Lagging_16 Lagging Reverse
+obs 3826889 Lagging_16 Lagging Reverse
+obs 3827627 Lagging_16 Lagging Reverse
+obs 3830340 Leading_0 Leading Forward
+obs 3833113 Lagging_16 Lagging Reverse
+obs 3834485 Leading_0 Leading Forward
+obs 3842721 Leading_0 Leading Forward
+obs 3847317 Lagging_16 Lagging Reverse
+obs 3856976 Lagging_16 Lagging Reverse
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859545 Leading_0 Leading Forward
+obs 3859559 Leading_0 Leading Forward
+obs 3871794 Leading_0 Leading Forward
+obs 3872965 Leading_0 Leading Forward
+obs 3874713 Lagging_16 Lagging Reverse
+obs 3875034 Lagging_16 Lagging Reverse
+obs 3884164 Lagging_16 Lagging Reverse
+obs 3897952 Leading_0 Leading Forward
+obs 3897952 Leading_0 Leading Forward
+obs 3902320 Leading_0 Leading Forward
+obs 3902320 Leading_0 Leading Forward
+obs 3903921 Lagging_16 Lagging Reverse
+obs 3906837 Leading_0 Leading Forward
+obs 3912832 Lagging_16 Lagging Reverse
+obs 3913810 Leading_0 Leading Forward
+obs 3924347 Lagging_16 Lagging Reverse
+obs 3924347 Lagging_16 Lagging Reverse
+obs 3924347 Lagging_16 Lagging Reverse
+obs 3924347 Lagging_16 Lagging Reverse
+obs 3924316 Leading_0 Leading Forward
+obs 3924316 Leading_0 Leading Forward
+obs 3924878 Leading_0 Leading Forward
+obs 3932131 Leading_0 Leading Forward
+obs 3932866 Lagging_16 Lagging Reverse
+obs 3932866 Lagging_16 Lagging Reverse
+obs 3933798 Lagging_16 Lagging Reverse
+obs 3933798 Lagging_16 Lagging Reverse
+obs 3933798 Lagging_16 Lagging Reverse
+obs 3933798 Lagging_16 Lagging Reverse
+obs 3933798 Lagging_16 Lagging Reverse
+obs 3933798 Lagging_16 Lagging Reverse
+obs 3933798 Lagging_16 Lagging Reverse
+obs 3942565 Leading_0 Leading Forward
+obs 3947484 Leading_0 Leading Forward
+obs 3948286 Leading_0 Leading Forward
+obs 3948501 Leading_0 Leading Forward
+obs 3951402 Lagging_16 Lagging Reverse
+obs 3981065 Lagging_16 Lagging Reverse
+obs 3981856 Lagging_16 Lagging Reverse
+obs 3997164 Lagging_16 Lagging Reverse
+obs 3997164 Lagging_16 Lagging Reverse
+obs 3997172 Leading_0 Leading Forward
+obs 4010858 Leading_0 Leading Forward
+obs 4030366 Leading_0 Leading Forward
+obs 4030366 Leading_0 Leading Forward
+obs 4030366 Leading_0 Leading Forward
+obs 4048969 Lagging_16 Lagging Reverse
+obs 4064190 Leading_0 Leading Forward
+obs 4065028 Leading_0 Leading Forward
+obs 4065028 Leading_0 Leading Forward
+obs 4071647 Leading_0 Leading Forward
+obs 4078684 Leading_0 Leading Forward
+obs 4078684 Leading_0 Leading Forward
+obs 4079141 Lagging_16 Lagging Reverse
+obs 4080493 Lagging_16 Lagging Reverse
+obs 4097407 Leading_0 Leading Forward
+obs 4106961 Lagging_16 Lagging Reverse
+obs 4111551 Leading_0 Leading Forward
+obs 4118945 Leading_0 Leading Forward
+obs 4144618 Leading_0 Leading Forward
+obs 4148918 Lagging_16 Lagging Reverse
+obs 4170392 Lagging_16 Lagging Reverse
+obs 4170392 Lagging_16 Lagging Reverse
+obs 4170392 Lagging_16 Lagging Reverse
+obs 4176262 Lagging_16 Lagging Reverse
+obs 4181240 Lagging_16 Lagging Reverse
+obs 4196103 Leading_0 Leading Forward
+obs 4197036 Lagging_16 Lagging Reverse
+obs 4197786 Leading_0 Leading Forward
+obs 4197786 Leading_0 Leading Forward
+obs 4200647 Lagging_16 Lagging Reverse
+obs 4208537 Leading_0 Leading Forward
+obs 4223594 Lagging_16 Lagging Reverse
+obs 4240174 Lagging_16 Lagging Reverse
+obs 4265216 Lagging_16 Lagging Reverse
+obs 4269389 Leading_0 Leading Forward
+obs 4271501 Leading_0 Leading Forward
+obs 4278384 Leading_0 Leading Forward
+obs 4278384 Leading_0 Leading Forward
+obs 4278620 Lagging_16 Lagging Reverse
+obs 4280733 Lagging_16 Lagging Reverse
+obs 4285376 Lagging_16 Lagging Reverse
+obs 4289745 Lagging_16 Lagging Reverse
+obs 4310696 Leading_0 Leading Forward
+obs 4324725 Leading_0 Leading Forward
+obs 4355381 Leading_0 Leading Forward
+obs 4361420 Lagging_16 Lagging Reverse
+obs 4361420 Lagging_16 Lagging Reverse
+obs 4361428 Leading_0 Leading Forward
+obs 4361428 Leading_0 Leading Forward
+obs 4361428 Leading_0 Leading Forward
+obs 4385808 Leading_0 Leading Forward
+obs 4391768 Lagging_16 Lagging Reverse
+obs 4409592 Lagging_16 Lagging Reverse
+obs 4410594 Lagging_16 Lagging Reverse
+obs 4412766 Leading_0 Leading Forward
+obs 4416387 Leading_0 Leading Forward
+obs 4416387 Leading_0 Leading Forward
+obs 4421730 Leading_0 Leading Forward
+obs 4425130 Leading_0 Leading Forward
+obs 4437756 Leading_0 Leading Forward
+obs 4438293 Leading_0 Leading Forward
+obs 4438293 Leading_0 Leading Forward
+obs 4469009 Lagging_16 Lagging Reverse
+obs 4503913 Lagging_16 Lagging Reverse
+obs 4504336 Leading_0 Leading Forward
+obs 4505826 Leading_0 Leading Forward
+obs 4534045 Lagging_16 Lagging Reverse
+obs 4536334 Lagging_16 Lagging Reverse
+obs 4545225 Leading_0 Leading Forward
+obs 4577530 Lagging_16 Lagging Reverse
+obs 4587532 Lagging_16 Lagging Reverse
+obs 4592008 Leading_0 Leading Forward
+obs 4597616 Lagging_16 Lagging Reverse
+obs 4606050 Lagging_16 Lagging Reverse
+obs 4606471 Lagging_16 Lagging Reverse
+obs 4629826 Lagging_0 Lagging Forward
+obs 4629826 Lagging_0 Lagging Forward
+obs 4629826 Lagging_0 Lagging Forward
+obs 4639089 Leading_16 Leading Reverse
+random 1075 Lagging_0 Lagging Forward
+random 5254 Leading_16 Leading Reverse
+random 12936 Leading_16 Leading Reverse
+random 16232 Lagging_0 Lagging Forward
+random 17341 Lagging_0 Lagging Forward
+random 20310 Lagging_0 Lagging Forward
+random 23909 Lagging_0 Lagging Forward
+random 27344 Lagging_0 Lagging Forward
+random 37939 Leading_16 Leading Reverse
+random 48082 Leading_16 Leading Reverse
+random 48452 Lagging_0 Lagging Forward
+random 53139 Lagging_0 Lagging Forward
+random 55069 Leading_16 Leading Reverse
+random 58043 Lagging_0 Lagging Forward
+random 60569 Lagging_0 Lagging Forward
+random 65345 Lagging_0 Lagging Forward
+random 65826 Leading_16 Leading Reverse
+random 67552 Leading_16 Leading Reverse
+random 68989 Lagging_0 Lagging Forward
+random 71860 Leading_16 Leading Reverse
+random 72610 Lagging_0 Lagging Forward
+random 73231 Lagging_0 Lagging Forward
+random 74759 Lagging_0 Lagging Forward
+random 80460 Lagging_0 Lagging Forward
+random 80493 Lagging_0 Lagging Forward
+random 83560 Leading_16 Leading Reverse
+random 85206 Leading_16 Leading Reverse
+random 85610 Lagging_0 Lagging Forward
+random 89643 Lagging_0 Lagging Forward
+random 94032 Lagging_0 Lagging Forward
+random 95578 Leading_16 Leading Reverse
+random 96626 Lagging_0 Lagging Forward
+random 105417 Leading_16 Leading Reverse
+random 106515 Lagging_0 Lagging Forward
+random 108419 Lagging_0 Lagging Forward
+random 108619 Lagging_0 Lagging Forward
+random 115440 Lagging_0 Lagging Forward
+random 116737 Leading_16 Leading Reverse
+random 118856 Leading_16 Leading Reverse
+random 121669 Lagging_0 Lagging Forward
+random 125079 Leading_16 Leading Reverse
+random 131498 Lagging_0 Lagging Forward
+random 131993 Lagging_0 Lagging Forward
+random 143148 Lagging_0 Lagging Forward
+random 156047 Leading_16 Leading Reverse
+random 160807 Leading_16 Leading Reverse
+random 163267 Lagging_0 Lagging Forward
+random 165997 Leading_16 Leading Reverse
+random 167290 Lagging_0 Lagging Forward
+random 167396 Leading_16 Leading Reverse
+random 168969 Leading_16 Leading Reverse
+random 175078 Lagging_0 Lagging Forward
+random 176046 Lagging_0 Lagging Forward
+random 181278 Leading_16 Leading Reverse
+random 182098 Lagging_0 Lagging Forward
+random 182831 Lagging_0 Lagging Forward
+random 186488 Leading_16 Leading Reverse
+random 188344 Lagging_0 Lagging Forward
+random 190631 Lagging_0 Lagging Forward
+random 191338 Lagging_0 Lagging Forward
+random 200727 Lagging_0 Lagging Forward
+random 204542 Leading_16 Leading Reverse
+random 207669 Lagging_0 Lagging Forward
+random 207709 Lagging_0 Lagging Forward
+random 210277 Lagging_0 Lagging Forward
+random 211177 Leading_16 Leading Reverse
+random 212713 Lagging_0 Lagging Forward
+random 215209 Leading_16 Leading Reverse
+random 217636 Leading_16 Leading Reverse
+random 223777 Lagging_0 Lagging Forward
+random 227301 Leading_16 Leading Reverse
+random 228760 Lagging_0 Lagging Forward
+random 229801 Leading_16 Leading Reverse
+random 233985 Lagging_0 Lagging Forward
+random 234328 Lagging_0 Lagging Forward
+random 236286 Leading_16 Leading Reverse
+random 244205 Leading_16 Leading Reverse
+random 245146 Lagging_0 Lagging Forward
+random 247381 Lagging_0 Lagging Forward
+random 247701 Lagging_0 Lagging Forward
+random 250239 Leading_16 Leading Reverse
+random 251317 Leading_16 Leading Reverse
+random 256248 Leading_16 Leading Reverse
+random 256835 Lagging_0 Lagging Forward
+random 257824 Leading_16 Leading Reverse
+random 262091 Leading_16 Leading Reverse
+random 264872 Lagging_0 Lagging Forward
+random 265944 Lagging_0 Lagging Forward
+random 268966 Lagging_0 Lagging Forward
+random 272908 Lagging_0 Lagging Forward
+random 274688 Leading_16 Leading Reverse
+random 278362 Lagging_0 Lagging Forward
+random 278621 Leading_16 Leading Reverse
+random 293739 Leading_16 Leading Reverse
+random 297761 Lagging_0 Lagging Forward
+random 297987 Leading_16 Leading Reverse
+random 300172 Lagging_0 Lagging Forward
+random 302255 Leading_16 Leading Reverse
+random 302258 Lagging_0 Lagging Forward
+random 302835 Leading_16 Leading Reverse
+random 303656 Leading_16 Leading Reverse
+random 308039 Lagging_0 Lagging Forward
+random 309614 Lagging_0 Lagging Forward
+random 310848 Lagging_0 Lagging Forward
+random 312589 Lagging_0 Lagging Forward
+random 314762 Leading_16 Leading Reverse
+random 314851 Lagging_0 Lagging Forward
+random 319277 Leading_16 Leading Reverse
+random 319508 Leading_16 Leading Reverse
+random 320646 Leading_16 Leading Reverse
+random 329845 Leading_16 Leading Reverse
+random 330035 Lagging_0 Lagging Forward
+random 332777 Lagging_0 Lagging Forward
+random 337299 Leading_16 Leading Reverse
+random 340609 Lagging_0 Lagging Forward
+random 342740 Leading_16 Leading Reverse
+random 348370 Leading_16 Leading Reverse
+random 352685 Leading_16 Leading Reverse
+random 353596 Leading_16 Leading Reverse
+random 354873 Leading_16 Leading Reverse
+random 356604 Leading_16 Leading Reverse
+random 356805 Leading_16 Leading Reverse
+random 359062 Leading_16 Leading Reverse
+random 362156 Leading_16 Leading Reverse
+random 367138 Lagging_0 Lagging Forward
+random 369849 Lagging_0 Lagging Forward
+random 370207 Leading_16 Leading Reverse
+random 370328 Leading_16 Leading Reverse
+random 380539 Leading_16 Leading Reverse
+random 381675 Lagging_0 Lagging Forward
+random 383992 Leading_16 Leading Reverse
+random 384757 Lagging_0 Lagging Forward
+random 385539 Leading_16 Leading Reverse
+random 385988 Lagging_0 Lagging Forward
+random 386737 Lagging_0 Lagging Forward
+random 387070 Leading_16 Leading Reverse
+random 388914 Leading_16 Leading Reverse
+random 396701 Leading_16 Leading Reverse
+random 397414 Lagging_0 Lagging Forward
+random 402439 Leading_16 Leading Reverse
+random 404095 Leading_16 Leading Reverse
+random 404389 Leading_16 Leading Reverse
+random 405035 Leading_16 Leading Reverse
+random 405227 Lagging_0 Lagging Forward
+random 406966 Leading_16 Leading Reverse
+random 411342 Leading_16 Leading Reverse
+random 415683 Leading_16 Leading Reverse
+random 418883 Lagging_0 Lagging Forward
+random 420786 Lagging_0 Lagging Forward
+random 424097 Leading_16 Leading Reverse
+random 424353 Lagging_0 Lagging Forward
+random 434158 Leading_16 Leading Reverse
+random 440657 Leading_16 Leading Reverse
+random 442390 Lagging_0 Lagging Forward
+random 444373 Lagging_0 Lagging Forward
+random 447903 Leading_16 Leading Reverse
+random 450016 Leading_16 Leading Reverse
+random 450567 Lagging_0 Lagging Forward
+random 453761 Leading_16 Leading Reverse
+random 458591 Lagging_0 Lagging Forward
+random 468017 Leading_16 Leading Reverse
+random 470661 Lagging_0 Lagging Forward
+random 472121 Leading_16 Leading Reverse
+random 474601 Leading_16 Leading Reverse
+random 475068 Lagging_0 Lagging Forward
+random 478391 Lagging_0 Lagging Forward
+random 481697 Leading_16 Leading Reverse
+random 482498 Leading_16 Leading Reverse
+random 483912 Leading_16 Leading Reverse
+random 488334 Leading_16 Leading Reverse
+random 491559 Leading_16 Leading Reverse
+random 494665 Lagging_0 Lagging Forward
+random 495087 Leading_16 Leading Reverse
+random 495129 Leading_16 Leading Reverse
+random 498116 Leading_16 Leading Reverse
+random 499019 Lagging_0 Lagging Forward
+random 499210 Leading_16 Leading Reverse
+random 499790 Leading_16 Leading Reverse
+random 500349 Leading_16 Leading Reverse
+random 503150 Leading_16 Leading Reverse
+random 504212 Lagging_0 Lagging Forward
+random 506631 Leading_16 Leading Reverse
+random 510026 Lagging_0 Lagging Forward
+random 513535 Lagging_0 Lagging Forward
+random 514609 Lagging_0 Lagging Forward
+random 515792 Lagging_0 Lagging Forward
+random 518584 Leading_16 Leading Reverse
+random 519494 Leading_16 Leading Reverse
+random 519954 Leading_16 Leading Reverse
+random 526846 Leading_16 Leading Reverse
+random 529974 Lagging_0 Lagging Forward
+random 531141 Lagging_0 Lagging Forward
+random 540026 Lagging_0 Lagging Forward
+random 545348 Lagging_0 Lagging Forward
+random 545586 Leading_16 Leading Reverse
+random 547637 Leading_16 Leading Reverse
+random 547645 Leading_16 Leading Reverse
+random 550333 Lagging_0 Lagging Forward
+random 552784 Lagging_0 Lagging Forward
+random 554296 Lagging_0 Lagging Forward
+random 555932 Leading_16 Leading Reverse
+random 557798 Lagging_0 Lagging Forward
+random 567270 Lagging_0 Lagging Forward
+random 570895 Leading_16 Leading Reverse
+random 572036 Lagging_0 Lagging Forward
+random 584443 Lagging_0 Lagging Forward
+random 588307 Lagging_0 Lagging Forward
+random 589518 Lagging_0 Lagging Forward
+random 593052 Leading_16 Leading Reverse
+random 593760 Leading_16 Leading Reverse
+random 594690 Lagging_0 Lagging Forward
+random 596288 Leading_16 Leading Reverse
+random 597877 Leading_16 Leading Reverse
+random 600035 Lagging_0 Lagging Forward
+random 601086 Lagging_0 Lagging Forward
+random 602095 Leading_16 Leading Reverse
+random 606515 Leading_16 Leading Reverse
+random 608574 Leading_16 Leading Reverse
+random 610824 Leading_16 Leading Reverse
+random 612450 Lagging_0 Lagging Forward
+random 614213 Lagging_0 Lagging Forward
+random 614474 Lagging_0 Lagging Forward
+random 617625 Leading_16 Leading Reverse
+random 617722 Leading_16 Leading Reverse
+random 619202 Leading_16 Leading Reverse
+random 619702 Leading_16 Leading Reverse
+random 620017 Leading_16 Leading Reverse
+random 621194 Lagging_0 Lagging Forward
+random 624419 Lagging_0 Lagging Forward
+random 629581 Leading_16 Leading Reverse
+random 630525 Lagging_0 Lagging Forward
+random 631642 Leading_16 Leading Reverse
+random 633193 Lagging_0 Lagging Forward
+random 635551 Leading_16 Leading Reverse
+random 637799 Leading_16 Leading Reverse
+random 644119 Lagging_0 Lagging Forward
+random 644180 Leading_16 Leading Reverse
+random 647465 Leading_16 Leading Reverse
+random 651210 Lagging_0 Lagging Forward
+random 651924 Lagging_0 Lagging Forward
+random 653031 Leading_16 Leading Reverse
+random 653067 Lagging_0 Lagging Forward
+random 655636 Lagging_0 Lagging Forward
+random 668101 Lagging_0 Lagging Forward
+random 668121 Lagging_0 Lagging Forward
+random 669205 Leading_16 Leading Reverse
+random 670415 Lagging_0 Lagging Forward
+random 671726 Leading_16 Leading Reverse
+random 672207 Leading_16 Leading Reverse
+random 672215 Lagging_0 Lagging Forward
+random 674355 Leading_16 Leading Reverse
+random 682859 Leading_16 Leading Reverse
+random 683452 Lagging_0 Lagging Forward
+random 691989 Leading_16 Leading Reverse
+random 693129 Leading_16 Leading Reverse
+random 693232 Leading_16 Leading Reverse
+random 694051 Leading_16 Leading Reverse
+random 696306 Lagging_0 Lagging Forward
+random 700045 Leading_16 Leading Reverse
+random 702972 Lagging_0 Lagging Forward
+random 705674 Lagging_0 Lagging Forward
+random 705882 Lagging_0 Lagging Forward
+random 707186 Lagging_0 Lagging Forward
+random 708853 Lagging_0 Lagging Forward
+random 708950 Leading_16 Leading Reverse
+random 710530 Lagging_0 Lagging Forward
+random 711184 Lagging_0 Lagging Forward
+random 713491 Leading_16 Leading Reverse
+random 726964 Leading_16 Leading Reverse
+random 728297 Lagging_0 Lagging Forward
+random 737864 Leading_16 Leading Reverse
+random 739561 Lagging_0 Lagging Forward
+random 742946 Lagging_0 Lagging Forward
+random 743460 Lagging_0 Lagging Forward
+random 744074 Lagging_0 Lagging Forward
+random 747891 Lagging_0 Lagging Forward
+random 751465 Lagging_0 Lagging Forward
+random 754661 Lagging_0 Lagging Forward
+random 756822 Lagging_0 Lagging Forward
+random 757122 Leading_16 Leading Reverse
+random 758648 Lagging_0 Lagging Forward
+random 759477 Lagging_0 Lagging Forward
+random 762930 Lagging_0 Lagging Forward
+random 763805 Lagging_0 Lagging Forward
+random 764734 Leading_16 Leading Reverse
+random 767293 Leading_16 Leading Reverse
+random 767380 Leading_16 Leading Reverse
+random 767576 Lagging_0 Lagging Forward
+random 768519 Lagging_0 Lagging Forward
+random 771492 Leading_16 Leading Reverse
+random 772584 Lagging_0 Lagging Forward
+random 775064 Lagging_0 Lagging Forward
+random 775085 Lagging_0 Lagging Forward
+random 778012 Lagging_0 Lagging Forward
+random 781111 Leading_16 Leading Reverse
+random 783297 Leading_16 Leading Reverse
+random 784400 Lagging_0 Lagging Forward
+random 784859 Leading_16 Leading Reverse
+random 785215 Lagging_0 Lagging Forward
+random 788006 Leading_16 Leading Reverse
+random 788226 Lagging_0 Lagging Forward
+random 798467 Lagging_0 Lagging Forward
+random 798758 Leading_16 Leading Reverse
+random 798766 Lagging_0 Lagging Forward
+random 799409 Lagging_0 Lagging Forward
+random 799556 Leading_16 Leading Reverse
+random 801539 Leading_16 Leading Reverse
+random 801616 Leading_16 Leading Reverse
+random 803188 Leading_16 Leading Reverse
+random 806143 Leading_16 Leading Reverse
+random 809582 Lagging_0 Lagging Forward
+random 813747 Leading_16 Leading Reverse
+random 814034 Lagging_0 Lagging Forward
+random 814130 Leading_16 Leading Reverse
+random 815141 Leading_16 Leading Reverse
+random 817846 Leading_16 Leading Reverse
+random 819524 Lagging_0 Lagging Forward
+random 820619 Leading_16 Leading Reverse
+random 822374 Leading_16 Leading Reverse
+random 823496 Lagging_0 Lagging Forward
+random 829544 Leading_16 Leading Reverse
+random 831029 Leading_16 Leading Reverse
+random 834296 Leading_16 Leading Reverse
+random 838240 Lagging_0 Lagging Forward
+random 839838 Leading_16 Leading Reverse
+random 839955 Lagging_0 Lagging Forward
+random 841063 Leading_16 Leading Reverse
+random 841063 Leading_16 Leading Reverse
+random 849122 Leading_16 Leading Reverse
+random 851116 Leading_16 Leading Reverse
+random 852990 Lagging_0 Lagging Forward
+random 862290 Lagging_0 Lagging Forward
+random 862935 Leading_16 Leading Reverse
+random 866749 Leading_16 Leading Reverse
+random 867044 Leading_16 Leading Reverse
+random 867921 Lagging_0 Lagging Forward
+random 869967 Leading_16 Leading Reverse
+random 872787 Leading_16 Leading Reverse
+random 873190 Lagging_0 Lagging Forward
+random 873462 Leading_16 Leading Reverse
+random 873643 Lagging_0 Lagging Forward
+random 875903 Leading_16 Leading Reverse
+random 882091 Lagging_0 Lagging Forward
+random 887914 Lagging_0 Lagging Forward
+random 897406 Leading_16 Leading Reverse
+random 898721 Leading_16 Leading Reverse
+random 899116 Lagging_0 Lagging Forward
+random 900950 Lagging_0 Lagging Forward
+random 914205 Lagging_0 Lagging Forward
+random 914646 Lagging_0 Lagging Forward
+random 919212 Leading_16 Leading Reverse
+random 920802 Leading_16 Leading Reverse
+random 926221 Leading_16 Leading Reverse
+random 927439 Leading_16 Leading Reverse
+random 934938 Lagging_0 Lagging Forward
+random 935861 Leading_16 Leading Reverse
+random 940829 Leading_16 Leading Reverse
+random 941598 Leading_16 Leading Reverse
+random 944045 Lagging_0 Lagging Forward
+random 946525 Leading_16 Leading Reverse
+random 947704 Lagging_0 Lagging Forward
+random 952440 Lagging_0 Lagging Forward
+random 958027 Leading_16 Leading Reverse
+random 962030 Leading_16 Leading Reverse
+random 968720 Leading_16 Leading Reverse
+random 971159 Lagging_0 Lagging Forward
+random 979207 Leading_16 Leading Reverse
+random 979688 Lagging_0 Lagging Forward
+random 984784 Leading_16 Leading Reverse
+random 986959 Lagging_0 Lagging Forward
+random 990648 Leading_16 Leading Reverse
+random 996302 Leading_16 Leading Reverse
+random 1000370 Lagging_0 Lagging Forward
+random 1001903 Lagging_0 Lagging Forward
+random 1003616 Leading_16 Leading Reverse
+random 1006549 Lagging_0 Lagging Forward
+random 1008858 Leading_16 Leading Reverse
+random 1020078 Leading_16 Leading Reverse
+random 1023084 Leading_16 Leading Reverse
+random 1023121 Leading_16 Leading Reverse
+random 1026572 Lagging_0 Lagging Forward
+random 1030956 Leading_16 Leading Reverse
+random 1034070 Leading_16 Leading Reverse
+random 1041387 Leading_16 Leading Reverse
+random 1042468 Lagging_0 Lagging Forward
+random 1047349 Leading_16 Leading Reverse
+random 1047574 Lagging_0 Lagging Forward
+random 1050051 Lagging_0 Lagging Forward
+random 1050986 Lagging_0 Lagging Forward
+random 1055525 Leading_16 Leading Reverse
+random 1059680 Lagging_0 Lagging Forward
+random 1067536 Leading_16 Leading Reverse
+random 1068819 Lagging_0 Lagging Forward
+random 1076145 Lagging_0 Lagging Forward
+random 1084072 Leading_16 Leading Reverse
+random 1086740 Leading_16 Leading Reverse
+random 1091125 Leading_16 Leading Reverse
+random 1093928 Lagging_0 Lagging Forward
+random 1095158 Leading_16 Leading Reverse
+random 1095808 Leading_16 Leading Reverse
+random 1101593 Leading_16 Leading Reverse
+random 1102239 Leading_16 Leading Reverse
+random 1102805 Lagging_0 Lagging Forward
+random 1102912 Lagging_0 Lagging Forward
+random 1110162 Leading_16 Leading Reverse
+random 1110550 Lagging_0 Lagging Forward
+random 1112048 Lagging_0 Lagging Forward
+random 1120645 Leading_16 Leading Reverse
+random 1120926 Lagging_0 Lagging Forward
+random 1123121 Leading_16 Leading Reverse
+random 1125883 Leading_16 Leading Reverse
+random 1127283 Lagging_0 Lagging Forward
+random 1128738 Lagging_0 Lagging Forward
+random 1131025 Lagging_0 Lagging Forward
+random 1134088 Lagging_0 Lagging Forward
+random 1134121 Lagging_0 Lagging Forward
+random 1136633 Leading_16 Leading Reverse
+random 1148762 Lagging_0 Lagging Forward
+random 1153461 Lagging_0 Lagging Forward
+random 1156915 Leading_16 Leading Reverse
+random 1157016 Lagging_0 Lagging Forward
+random 1161352 Leading_16 Leading Reverse
+random 1161592 Lagging_0 Lagging Forward
+random 1162178 Lagging_0 Lagging Forward
+random 1162861 Leading_16 Leading Reverse
+random 1169210 Lagging_0 Lagging Forward
+random 1171143 Lagging_0 Lagging Forward
+random 1172345 Lagging_0 Lagging Forward
+random 1181017 Lagging_0 Lagging Forward
+random 1182758 Leading_16 Leading Reverse
+random 1182940 Leading_16 Leading Reverse
+random 1188510 Lagging_0 Lagging Forward
+random 1189339 Leading_16 Leading Reverse
+random 1193415 Leading_16 Leading Reverse
+random 1194651 Leading_16 Leading Reverse
+random 1201161 Lagging_0 Lagging Forward
+random 1201192 Leading_16 Leading Reverse
+random 1203850 Leading_16 Leading Reverse
+random 1204927 Lagging_0 Lagging Forward
+random 1206627 Lagging_0 Lagging Forward
+random 1209244 Lagging_0 Lagging Forward
+random 1217148 Leading_16 Leading Reverse
+random 1224235 Leading_16 Leading Reverse
+random 1232031 Lagging_0 Lagging Forward
+random 1233256 Lagging_0 Lagging Forward
+random 1236502 Leading_16 Leading Reverse
+random 1241687 Leading_16 Leading Reverse
+random 1242987 Leading_16 Leading Reverse
+random 1247212 Lagging_0 Lagging Forward
+random 1248148 Lagging_0 Lagging Forward
+random 1248288 Lagging_0 Lagging Forward
+random 1249910 Lagging_0 Lagging Forward
+random 1251211 Leading_16 Leading Reverse
+random 1261873 Lagging_0 Lagging Forward
+random 1265614 Leading_16 Leading Reverse
+random 1266693 Lagging_0 Lagging Forward
+random 1267199 Leading_16 Leading Reverse
+random 1270644 Lagging_0 Lagging Forward
+random 1279331 Lagging_0 Lagging Forward
+random 1285849 Lagging_0 Lagging Forward
+random 1291049 Leading_16 Leading Reverse
+random 1294559 Leading_16 Leading Reverse
+random 1297111 Leading_16 Leading Reverse
+random 1300426 Lagging_0 Lagging Forward
+random 1302134 Leading_16 Leading Reverse
+random 1314779 Lagging_0 Lagging Forward
+random 1315714 Leading_16 Leading Reverse
+random 1315849 Lagging_0 Lagging Forward
+random 1323469 Leading_16 Leading Reverse
+random 1323810 Leading_16 Leading Reverse
+random 1324832 Lagging_0 Lagging Forward
+random 1326711 Lagging_0 Lagging Forward
+random 1328510 Lagging_0 Lagging Forward
+random 1333408 Lagging_0 Lagging Forward
+random 1337833 Lagging_0 Lagging Forward
+random 1338159 Leading_16 Leading Reverse
+random 1348180 Leading_16 Leading Reverse
+random 1349010 Lagging_0 Lagging Forward
+random 1351835 Leading_16 Leading Reverse
+random 1353819 Leading_16 Leading Reverse
+random 1356121 Leading_16 Leading Reverse
+random 1356516 Leading_16 Leading Reverse
+random 1360001 Leading_16 Leading Reverse
+random 1366457 Leading_16 Leading Reverse
+random 1367108 Leading_16 Leading Reverse
+random 1374836 Lagging_0 Lagging Forward
+random 1376603 Leading_16 Leading Reverse
+random 1380238 Leading_16 Leading Reverse
+random 1381737 Lagging_0 Lagging Forward
+random 1384088 Lagging_0 Lagging Forward
+random 1392053 Lagging_0 Lagging Forward
+random 1392939 Lagging_0 Lagging Forward
+random 1395852 Leading_16 Leading Reverse
+random 1401351 Lagging_0 Lagging Forward
+random 1414208 Leading_16 Leading Reverse
+random 1418651 Leading_16 Leading Reverse
+random 1419721 Leading_16 Leading Reverse
+random 1423964 Lagging_0 Lagging Forward
+random 1427055 Lagging_0 Lagging Forward
+random 1429806 Leading_16 Leading Reverse
+random 1432955 Lagging_0 Lagging Forward
+random 1433032 Lagging_0 Lagging Forward
+random 1433496 Leading_16 Leading Reverse
+random 1435919 Lagging_0 Lagging Forward
+random 1437183 Leading_16 Leading Reverse
+random 1439749 Lagging_0 Lagging Forward
+random 1439843 Leading_16 Leading Reverse
+random 1442460 Lagging_0 Lagging Forward
+random 1445686 Leading_16 Leading Reverse
+random 1448799 Leading_16 Leading Reverse
+random 1453534 Lagging_0 Lagging Forward
+random 1455852 Leading_16 Leading Reverse
+random 1456804 Leading_16 Leading Reverse
+random 1457231 Lagging_0 Lagging Forward
+random 1462264 Leading_16 Leading Reverse
+random 1464666 Lagging_0 Lagging Forward
+random 1465224 Leading_16 Leading Reverse
+random 1469597 Leading_16 Leading Reverse
+random 1470492 Leading_16 Leading Reverse
+random 1477958 Leading_16 Leading Reverse
+random 1481234 Lagging_0 Lagging Forward
+random 1482809 Lagging_0 Lagging Forward
+random 1485096 Leading_16 Leading Reverse
+random 1488991 Lagging_0 Lagging Forward
+random 1489763 Leading_16 Leading Reverse
+random 1497453 Leading_16 Leading Reverse
+random 1502518 Lagging_0 Lagging Forward
+random 1507326 Leading_16 Leading Reverse
+random 1525449 Lagging_0 Lagging Forward
+random 1526657 Leading_16 Leading Reverse
+random 1528748 Leading_16 Leading Reverse
+random 1530026 Leading_16 Leading Reverse
+random 1533069 Lagging_0 Lagging Forward
+random 1535843 Leading_16 Leading Reverse
+random 1538408 Leading_16 Leading Reverse
+random 1544361 Leading_16 Leading Reverse
+random 1548690 Lagging_0 Lagging Forward
+random 1550701 Lagging_0 Lagging Forward
+random 1555105 Lagging_0 Lagging Forward
+random 1557784 Leading_16 Leading Reverse
+random 1559566 Lagging_0 Lagging Forward
+random 1562610 Lagging_0 Lagging Forward
+random 1566383 Leading_16 Leading Reverse
+random 1570389 Lagging_0 Lagging Forward
+random 1571482 Leading_16 Leading Reverse
+random 1574477 Lagging_0 Lagging Forward
+random 1576137 Lagging_0 Lagging Forward
+random 1578294 Leading_16 Leading Reverse
+random 1581400 Leading_16 Leading Reverse
+random 1582665 Leading_16 Leading Reverse
+random 1589767 Lagging_0 Lagging Forward
+random 1593556 Lagging_0 Lagging Forward
+random 1594638 Lagging_0 Lagging Forward
+random 1596464 Lagging_0 Lagging Forward
+random 1599635 Leading_16 Leading Reverse
+random 1604911 Leading_16 Leading Reverse
+random 1605016 Leading_16 Leading Reverse
+random 1605039 Lagging_0 Lagging Forward
+random 1606130 Leading_16 Leading Reverse
+random 1608115 Lagging_0 Lagging Forward
+random 1614178 Lagging_0 Lagging Forward
+random 1614199 Lagging_0 Lagging Forward
+random 1617248 Leading_16 Leading Reverse
+random 1618740 Leading_16 Leading Reverse
+random 1619411 Leading_16 Leading Reverse
+random 1621604 Lagging_0 Lagging Forward
+random 1623603 Lagging_0 Lagging Forward
+random 1625178 Leading_16 Leading Reverse
+random 1626024 Lagging_0 Lagging Forward
+random 1626089 Lagging_0 Lagging Forward
+random 1627121 Lagging_0 Lagging Forward
+random 1628584 Lagging_0 Lagging Forward
+random 1640226 Leading_16 Leading Reverse
+random 1641472 Leading_16 Leading Reverse
+random 1641566 Leading_16 Leading Reverse
+random 1642639 Lagging_0 Lagging Forward
+random 1646063 Leading_16 Leading Reverse
+random 1646860 Lagging_0 Lagging Forward
+random 1649488 Lagging_0 Lagging Forward
+random 1651491 Lagging_0 Lagging Forward
+random 1652320 Lagging_0 Lagging Forward
+random 1654859 Leading_16 Leading Reverse
+random 1655683 Lagging_0 Lagging Forward
+random 1658974 Lagging_0 Lagging Forward
+random 1659318 Lagging_0 Lagging Forward
+random 1662514 Leading_16 Leading Reverse
+random 1663553 Leading_16 Leading Reverse
+random 1664123 Leading_16 Leading Reverse
+random 1665788 Lagging_0 Lagging Forward
+random 1670815 Lagging_0 Lagging Forward
+random 1670935 Lagging_0 Lagging Forward
+random 1675822 Leading_16 Leading Reverse
+random 1680074 Leading_16 Leading Reverse
+random 1681549 Leading_16 Leading Reverse
+random 1681993 Leading_16 Leading Reverse
+random 1686518 Lagging_0 Lagging Forward
+random 1690401 Lagging_0 Lagging Forward
+random 1694235 Leading_16 Leading Reverse
+random 1698640 Leading_16 Leading Reverse
+random 1699024 Leading_16 Leading Reverse
+random 1700946 Leading_16 Leading Reverse
+random 1701632 Lagging_0 Lagging Forward
+random 1703682 Leading_16 Leading Reverse
+random 1704444 Leading_16 Leading Reverse
+random 1711533 Lagging_0 Lagging Forward
+random 1711758 Leading_16 Leading Reverse
+random 1716455 Leading_16 Leading Reverse
+random 1717280 Lagging_0 Lagging Forward
+random 1721749 Lagging_0 Lagging Forward
+random 1723953 Leading_16 Leading Reverse
+random 1725659 Leading_16 Leading Reverse
+random 1729340 Leading_16 Leading Reverse
+random 1732262 Leading_16 Leading Reverse
+random 1733585 Lagging_0 Lagging Forward
+random 1734528 Leading_16 Leading Reverse
+random 1734732 Lagging_0 Lagging Forward
+random 1739558 Leading_16 Leading Reverse
+random 1739676 Lagging_0 Lagging Forward
+random 1740640 Leading_16 Leading Reverse
+random 1741671 Leading_16 Leading Reverse
+random 1749270 Lagging_0 Lagging Forward
+random 1752622 Leading_16 Leading Reverse
+random 1755593 Leading_16 Leading Reverse
+random 1756880 Leading_16 Leading Reverse
+random 1759675 Leading_16 Leading Reverse
+random 1759785 Leading_16 Leading Reverse
+random 1760241 Leading_16 Leading Reverse
+random 1767126 Lagging_0 Lagging Forward
+random 1769614 Leading_16 Leading Reverse
+random 1771146 Leading_16 Leading Reverse
+random 1771909 Lagging_0 Lagging Forward
+random 1778773 Lagging_0 Lagging Forward
+random 1778827 Leading_16 Leading Reverse
+random 1778976 Leading_16 Leading Reverse
+random 1786494 Leading_16 Leading Reverse
+random 1792454 Leading_16 Leading Reverse
+random 1797952 Leading_16 Leading Reverse
+random 1804377 Lagging_0 Lagging Forward
+random 1808489 Lagging_0 Lagging Forward
+random 1808908 Lagging_0 Lagging Forward
+random 1809379 Leading_16 Leading Reverse
+random 1809946 Lagging_0 Lagging Forward
+random 1815082 Lagging_0 Lagging Forward
+random 1816242 Lagging_0 Lagging Forward
+random 1818986 Lagging_0 Lagging Forward
+random 1826202 Lagging_0 Lagging Forward
+random 1835362 Lagging_0 Lagging Forward
+random 1836784 Lagging_0 Lagging Forward
+random 1838242 Lagging_0 Lagging Forward
+random 1840326 Lagging_0 Lagging Forward
+random 1845749 Leading_16 Leading Reverse
+random 1846129 Lagging_0 Lagging Forward
+random 1851678 Lagging_0 Lagging Forward
+random 1853686 Leading_16 Leading Reverse
+random 1861600 Leading_16 Leading Reverse
+random 1864300 Leading_16 Leading Reverse
+random 1865434 Lagging_0 Lagging Forward
+random 1866971 Lagging_0 Lagging Forward
+random 1881215 Leading_16 Leading Reverse
+random 1881676 Lagging_0 Lagging Forward
+random 1881928 Lagging_0 Lagging Forward
+random 1886793 Leading_16 Leading Reverse
+random 1899286 Lagging_0 Lagging Forward
+random 1899381 Leading_16 Leading Reverse
+random 1900633 Leading_16 Leading Reverse
+random 1903835 Leading_16 Leading Reverse
+random 1905924 Lagging_0 Lagging Forward
+random 1908548 Lagging_0 Lagging Forward
+random 1910730 Lagging_0 Lagging Forward
+random 1911722 Lagging_0 Lagging Forward
+random 1913963 Leading_16 Leading Reverse
+random 1915428 Lagging_0 Lagging Forward
+random 1920363 Lagging_0 Lagging Forward
+random 1920391 Lagging_0 Lagging Forward
+random 1921512 Leading_16 Leading Reverse
+random 1921594 Lagging_0 Lagging Forward
+random 1921693 Leading_16 Leading Reverse
+random 1924808 Leading_16 Leading Reverse
+random 1926815 Lagging_0 Lagging Forward
+random 1928793 Leading_16 Leading Reverse
+random 1937875 Lagging_0 Lagging Forward
+random 1940562 Leading_16 Leading Reverse
+random 1941078 Lagging_0 Lagging Forward
+random 1943245 Leading_16 Leading Reverse
+random 1948338 Lagging_0 Lagging Forward
+random 1952697 Lagging_0 Lagging Forward
+random 1954607 Lagging_0 Lagging Forward
+random 1959466 Lagging_0 Lagging Forward
+random 1961126 Leading_16 Leading Reverse
+random 1963962 Lagging_0 Lagging Forward
+random 1964430 Leading_16 Leading Reverse
+random 1965106 Lagging_0 Lagging Forward
+random 1965292 Leading_16 Leading Reverse
+random 1965697 Lagging_0 Lagging Forward
+random 1968184 Leading_16 Leading Reverse
+random 1968193 Lagging_0 Lagging Forward
+random 1978875 Leading_16 Leading Reverse
+random 1979776 Lagging_0 Lagging Forward
+random 1980506 Lagging_0 Lagging Forward
+random 1984335 Leading_16 Leading Reverse
+random 1985745 Lagging_0 Lagging Forward
+random 1986264 Lagging_0 Lagging Forward
+random 1987169 Leading_16 Leading Reverse
+random 1990597 Leading_16 Leading Reverse
+random 1991277 Leading_16 Leading Reverse
+random 1992636 Lagging_0 Lagging Forward
+random 1993016 Leading_16 Leading Reverse
+random 1993522 Lagging_0 Lagging Forward
+random 1994324 Leading_16 Leading Reverse
+random 1995111 Leading_16 Leading Reverse
+random 1997420 Lagging_0 Lagging Forward
+random 2005384 Leading_16 Leading Reverse
+random 2008285 Lagging_0 Lagging Forward
+random 2008459 Lagging_0 Lagging Forward
+random 2009219 Leading_16 Leading Reverse
+random 2013635 Leading_16 Leading Reverse
+random 2014464 Leading_16 Leading Reverse
+random 2020997 Leading_16 Leading Reverse
+random 2023191 Leading_16 Leading Reverse
+random 2026565 Lagging_0 Lagging Forward
+random 2027075 Lagging_0 Lagging Forward
+random 2027519 Lagging_0 Lagging Forward
+random 2028525 Leading_16 Leading Reverse
+random 2028578 Lagging_0 Lagging Forward
+random 2032419 Lagging_0 Lagging Forward
+random 2036481 Lagging_0 Lagging Forward
+random 2037249 Lagging_0 Lagging Forward
+random 2041283 Lagging_0 Lagging Forward
+random 2042075 Leading_16 Leading Reverse
+random 2055547 Leading_16 Leading Reverse
+random 2059063 Leading_16 Leading Reverse
+random 2059212 Lagging_0 Lagging Forward
+random 2070025 Lagging_0 Lagging Forward
+random 2072344 Lagging_0 Lagging Forward
+random 2074805 Leading_16 Leading Reverse
+random 2078258 Lagging_0 Lagging Forward
+random 2079478 Leading_16 Leading Reverse
+random 2081154 Lagging_0 Lagging Forward
+random 2082784 Leading_16 Leading Reverse
+random 2086436 Lagging_0 Lagging Forward
+random 2093801 Leading_16 Leading Reverse
+random 2096950 Lagging_0 Lagging Forward
+random 2100671 Leading_16 Leading Reverse
+random 2102563 Leading_16 Leading Reverse
+random 2106233 Leading_16 Leading Reverse
+random 2106456 Leading_16 Leading Reverse
+random 2109312 Leading_16 Leading Reverse
+random 2109909 Leading_16 Leading Reverse
+random 2111688 Leading_16 Leading Reverse
+random 2114170 Lagging_0 Lagging Forward
+random 2115442 Leading_16 Leading Reverse
+random 2115695 Leading_16 Leading Reverse
+random 2118647 Lagging_0 Lagging Forward
+random 2119388 Lagging_0 Lagging Forward
+random 2121624 Leading_16 Leading Reverse
+random 2124411 Lagging_0 Lagging Forward
+random 2125650 Lagging_0 Lagging Forward
+random 2126675 Lagging_0 Lagging Forward
+random 2128498 Lagging_0 Lagging Forward
+random 2140144 Lagging_0 Lagging Forward
+random 2144923 Leading_16 Leading Reverse
+random 2146955 Lagging_0 Lagging Forward
+random 2147508 Leading_16 Leading Reverse
+random 2148555 Lagging_0 Lagging Forward
+random 2159717 Lagging_0 Lagging Forward
+random 2161158 Leading_16 Leading Reverse
+random 2161639 Leading_16 Leading Reverse
+random 2162517 Leading_16 Leading Reverse
+random 2165135 Leading_16 Leading Reverse
+random 2169840 Lagging_0 Lagging Forward
+random 2173202 Lagging_0 Lagging Forward
+random 2178636 Leading_16 Leading Reverse
+random 2183708 Leading_16 Leading Reverse
+random 2184275 Leading_16 Leading Reverse
+random 2184483 Lagging_0 Lagging Forward
+random 2192274 Lagging_0 Lagging Forward
+random 2193262 Leading_16 Leading Reverse
+random 2196315 Leading_16 Leading Reverse
+random 2196536 Lagging_0 Lagging Forward
+random 2197742 Lagging_0 Lagging Forward
+random 2212236 Leading_16 Leading Reverse
+random 2213867 Lagging_0 Lagging Forward
+random 2214119 Lagging_0 Lagging Forward
+random 2214941 Leading_16 Leading Reverse
+random 2217008 Lagging_0 Lagging Forward
+random 2218355 Lagging_0 Lagging Forward
+random 2220676 Leading_16 Leading Reverse
+random 2221832 Lagging_0 Lagging Forward
+random 2224859 Leading_16 Leading Reverse
+random 2227798 Leading_16 Leading Reverse
+random 2228116 Leading_16 Leading Reverse
+random 2236090 Lagging_0 Lagging Forward
+random 2237852 Leading_16 Leading Reverse
+random 2242113 Leading_16 Leading Reverse
+random 2248793 Leading_16 Leading Reverse
+random 2248999 Lagging_0 Lagging Forward
+random 2251717 Lagging_0 Lagging Forward
+random 2252629 Lagging_0 Lagging Forward
+random 2253313 Leading_16 Leading Reverse
+random 2254723 Lagging_0 Lagging Forward
+random 2255393 Leading_16 Leading Reverse
+random 2256895 Leading_16 Leading Reverse
+random 2261039 Lagging_0 Lagging Forward
+random 2262847 Leading_16 Leading Reverse
+random 2265301 Lagging_0 Lagging Forward
+random 2265972 Leading_16 Leading Reverse
+random 2266294 Lagging_0 Lagging Forward
+random 2267503 Leading_16 Leading Reverse
+random 2270933 Lagging_0 Lagging Forward
+random 2272047 Lagging_0 Lagging Forward
+random 2272717 Leading_16 Leading Reverse
+random 2280332 Lagging_0 Lagging Forward
+random 2280638 Leading_16 Leading Reverse
+random 2286641 Lagging_0 Lagging Forward
+random 2288643 Leading_16 Leading Reverse
+random 2291962 Lagging_0 Lagging Forward
+random 2295220 Leading_16 Leading Reverse
+random 2300294 Leading_16 Leading Reverse
+random 2302357 Leading_16 Leading Reverse
+random 2312075 Lagging_0 Lagging Forward
+random 2312261 Leading_16 Leading Reverse
+random 2312282 Leading_16 Leading Reverse
+random 2317153 Leading_16 Leading Reverse
+random 2318366 Leading_16 Leading Reverse
+random 2319268 Leading_16 Leading Reverse
+random 2321364 Leading_0 Leading Forward
+random 2321850 Lagging_16 Lagging Reverse
+random 2325087 Leading_0 Leading Forward
+random 2329061 Leading_0 Leading Forward
+random 2330004 Leading_0 Leading Forward
+random 2331183 Leading_0 Leading Forward
+random 2331183 Leading_0 Leading Forward
+random 2337782 Leading_0 Leading Forward
+random 2338951 Lagging_16 Lagging Reverse
+random 2344303 Leading_0 Leading Forward
+random 2346006 Leading_0 Leading Forward
+random 2347096 Lagging_16 Lagging Reverse
+random 2350990 Leading_0 Leading Forward
+random 2351038 Lagging_16 Lagging Reverse
+random 2353301 Leading_0 Leading Forward
+random 2357698 Lagging_16 Lagging Reverse
+random 2357791 Leading_0 Leading Forward
+random 2359733 Lagging_16 Lagging Reverse
+random 2359880 Leading_0 Leading Forward
+random 2364380 Leading_0 Leading Forward
+random 2365702 Lagging_16 Lagging Reverse
+random 2368103 Lagging_16 Lagging Reverse
+random 2372356 Leading_0 Leading Forward
+random 2375631 Leading_0 Leading Forward
+random 2377110 Lagging_16 Lagging Reverse
+random 2378230 Lagging_16 Lagging Reverse
+random 2381377 Leading_0 Leading Forward
+random 2382145 Lagging_16 Lagging Reverse
+random 2385256 Lagging_16 Lagging Reverse
+random 2385516 Leading_0 Leading Forward
+random 2386183 Lagging_16 Lagging Reverse
+random 2387509 Leading_0 Leading Forward
+random 2389817 Leading_0 Leading Forward
+random 2391027 Lagging_16 Lagging Reverse
+random 2394364 Lagging_16 Lagging Reverse
+random 2396422 Lagging_16 Lagging Reverse
+random 2396941 Leading_0 Leading Forward
+random 2400330 Leading_0 Leading Forward
+random 2403451 Lagging_16 Lagging Reverse
+random 2404828 Leading_0 Leading Forward
+random 2406599 Leading_0 Leading Forward
+random 2408611 Lagging_16 Lagging Reverse
+random 2410354 Lagging_16 Lagging Reverse
+random 2413146 Lagging_16 Lagging Reverse
+random 2417018 Leading_0 Leading Forward
+random 2420685 Leading_0 Leading Forward
+random 2421433 Lagging_16 Lagging Reverse
+random 2423293 Leading_0 Leading Forward
+random 2426626 Lagging_16 Lagging Reverse
+random 2428653 Lagging_16 Lagging Reverse
+random 2428674 Leading_0 Leading Forward
+random 2428890 Leading_0 Leading Forward
+random 2435938 Lagging_16 Lagging Reverse
+random 2444605 Leading_0 Leading Forward
+random 2451903 Leading_0 Leading Forward
+random 2459101 Lagging_16 Lagging Reverse
+random 2461562 Lagging_16 Lagging Reverse
+random 2466300 Leading_0 Leading Forward
+random 2467382 Lagging_16 Lagging Reverse
+random 2474772 Lagging_16 Lagging Reverse
+random 2478023 Leading_0 Leading Forward
+random 2479118 Leading_0 Leading Forward
+random 2481760 Leading_0 Leading Forward
+random 2486251 Lagging_16 Lagging Reverse
+random 2489454 Lagging_16 Lagging Reverse
+random 2505325 Lagging_16 Lagging Reverse
+random 2505663 Leading_0 Leading Forward
+random 2509721 Lagging_16 Lagging Reverse
+random 2511840 Leading_0 Leading Forward
+random 2518416 Leading_0 Leading Forward
+random 2518538 Leading_0 Leading Forward
+random 2525360 Lagging_16 Lagging Reverse
+random 2530127 Lagging_16 Lagging Reverse
+random 2532735 Leading_0 Leading Forward
+random 2532961 Lagging_16 Lagging Reverse
+random 2535677 Lagging_16 Lagging Reverse
+random 2539405 Lagging_16 Lagging Reverse
+random 2539599 Leading_0 Leading Forward
+random 2540536 Lagging_16 Lagging Reverse
+random 2542537 Leading_0 Leading Forward
+random 2546912 Lagging_16 Lagging Reverse
+random 2546942 Leading_0 Leading Forward
+random 2547125 Leading_0 Leading Forward
+random 2547345 Lagging_16 Lagging Reverse
+random 2549208 Lagging_16 Lagging Reverse
+random 2555289 Lagging_16 Lagging Reverse
+random 2555474 Leading_0 Leading Forward
+random 2556996 Lagging_16 Lagging Reverse
+random 2557356 Leading_0 Leading Forward
+random 2557757 Leading_0 Leading Forward
+random 2564354 Leading_0 Leading Forward
+random 2568195 Leading_0 Leading Forward
+random 2570321 Lagging_16 Lagging Reverse
+random 2577574 Leading_0 Leading Forward
+random 2580315 Lagging_16 Lagging Reverse
+random 2582490 Leading_0 Leading Forward
+random 2582828 Lagging_16 Lagging Reverse
+random 2583718 Lagging_16 Lagging Reverse
+random 2584542 Lagging_16 Lagging Reverse
+random 2585315 Leading_0 Leading Forward
+random 2588312 Lagging_16 Lagging Reverse
+random 2591849 Leading_0 Leading Forward
+random 2596899 Leading_0 Leading Forward
+random 2598918 Leading_0 Leading Forward
+random 2601044 Lagging_16 Lagging Reverse
+random 2601091 Lagging_16 Lagging Reverse
+random 2604111 Lagging_16 Lagging Reverse
+random 2607950 Leading_0 Leading Forward
+random 2608987 Leading_0 Leading Forward
+random 2609006 Lagging_16 Lagging Reverse
+random 2609924 Leading_0 Leading Forward
+random 2610162 Lagging_16 Lagging Reverse
+random 2612217 Lagging_16 Lagging Reverse
+random 2618167 Lagging_16 Lagging Reverse
+random 2624129 Lagging_16 Lagging Reverse
+random 2630230 Lagging_16 Lagging Reverse
+random 2630548 Leading_0 Leading Forward
+random 2642662 Leading_0 Leading Forward
+random 2644930 Leading_0 Leading Forward
+random 2646122 Leading_0 Leading Forward
+random 2646125 Leading_0 Leading Forward
+random 2649311 Leading_0 Leading Forward
+random 2652818 Leading_0 Leading Forward
+random 2657148 Lagging_16 Lagging Reverse
+random 2659020 Lagging_16 Lagging Reverse
+random 2660666 Lagging_16 Lagging Reverse
+random 2661511 Leading_0 Leading Forward
+random 2661750 Lagging_16 Lagging Reverse
+random 2662078 Lagging_16 Lagging Reverse
+random 2664890 Leading_0 Leading Forward
+random 2672125 Leading_0 Leading Forward
+random 2676678 Lagging_16 Lagging Reverse
+random 2681209 Lagging_16 Lagging Reverse
+random 2683741 Lagging_16 Lagging Reverse
+random 2684529 Leading_0 Leading Forward
+random 2689759 Lagging_16 Lagging Reverse
+random 2691354 Lagging_16 Lagging Reverse
+random 2693340 Lagging_16 Lagging Reverse
+random 2699591 Leading_0 Leading Forward
+random 2702041 Lagging_16 Lagging Reverse
+random 2703864 Lagging_16 Lagging Reverse
+random 2704644 Leading_0 Leading Forward
+random 2706598 Lagging_16 Lagging Reverse
+random 2706889 Lagging_16 Lagging Reverse
+random 2708112 Leading_0 Leading Forward
+random 2714858 Lagging_16 Lagging Reverse
+random 2718474 Lagging_16 Lagging Reverse
+random 2719361 Leading_0 Leading Forward
+random 2720671 Lagging_16 Lagging Reverse
+random 2722492 Leading_0 Leading Forward
+random 2723381 Leading_0 Leading Forward
+random 2725560 Lagging_16 Lagging Reverse
+random 2727020 Lagging_16 Lagging Reverse
+random 2727501 Lagging_16 Lagging Reverse
+random 2727682 Lagging_16 Lagging Reverse
+random 2729161 Leading_0 Leading Forward
+random 2730410 Lagging_16 Lagging Reverse
+random 2732385 Lagging_16 Lagging Reverse
+random 2733278 Leading_0 Leading Forward
+random 2736200 Lagging_16 Lagging Reverse
+random 2738513 Lagging_16 Lagging Reverse
+random 2739133 Leading_0 Leading Forward
+random 2743183 Leading_0 Leading Forward
+random 2744392 Leading_0 Leading Forward
+random 2749008 Leading_0 Leading Forward
+random 2749812 Leading_0 Leading Forward
+random 2751342 Leading_0 Leading Forward
+random 2751838 Leading_0 Leading Forward
+random 2753837 Leading_0 Leading Forward
+random 2761464 Leading_0 Leading Forward
+random 2762415 Leading_0 Leading Forward
+random 2763603 Leading_0 Leading Forward
+random 2765511 Leading_0 Leading Forward
+random 2766678 Lagging_16 Lagging Reverse
+random 2767311 Lagging_16 Lagging Reverse
+random 2768130 Leading_0 Leading Forward
+random 2770158 Leading_0 Leading Forward
+random 2771073 Leading_0 Leading Forward
+random 2773179 Lagging_16 Lagging Reverse
+random 2776664 Leading_0 Leading Forward
+random 2779764 Leading_0 Leading Forward
+random 2782878 Lagging_16 Lagging Reverse
+random 2786603 Lagging_16 Lagging Reverse
+random 2790854 Lagging_16 Lagging Reverse
+random 2792406 Lagging_16 Lagging Reverse
+random 2796850 Leading_0 Leading Forward
+random 2800885 Leading_0 Leading Forward
+random 2801861 Lagging_16 Lagging Reverse
+random 2803992 Lagging_16 Lagging Reverse
+random 2804388 Leading_0 Leading Forward
+random 2804454 Lagging_16 Lagging Reverse
+random 2805213 Leading_0 Leading Forward
+random 2805702 Leading_0 Leading Forward
+random 2806182 Leading_0 Leading Forward
+random 2808170 Leading_0 Leading Forward
+random 2817485 Lagging_16 Lagging Reverse
+random 2820237 Lagging_16 Lagging Reverse
+random 2823489 Lagging_16 Lagging Reverse
+random 2824955 Leading_0 Leading Forward
+random 2828224 Lagging_16 Lagging Reverse
+random 2833897 Lagging_16 Lagging Reverse
+random 2839510 Lagging_16 Lagging Reverse
+random 2839690 Leading_0 Leading Forward
+random 2840801 Lagging_16 Lagging Reverse
+random 2843703 Leading_0 Leading Forward
+random 2850568 Lagging_16 Lagging Reverse
+random 2851670 Leading_0 Leading Forward
+random 2855872 Leading_0 Leading Forward
+random 2857741 Lagging_16 Lagging Reverse
+random 2859574 Lagging_16 Lagging Reverse
+random 2861252 Lagging_16 Lagging Reverse
+random 2861945 Leading_0 Leading Forward
+random 2862291 Leading_0 Leading Forward
+random 2864051 Leading_0 Leading Forward
+random 2868206 Lagging_16 Lagging Reverse
+random 2870380 Leading_0 Leading Forward
+random 2872448 Lagging_16 Lagging Reverse
+random 2874498 Leading_0 Leading Forward
+random 2876396 Lagging_16 Lagging Reverse
+random 2879883 Lagging_16 Lagging Reverse
+random 2886328 Leading_0 Leading Forward
+random 2888099 Lagging_16 Lagging Reverse
+random 2891987 Lagging_16 Lagging Reverse
+random 2897631 Leading_0 Leading Forward
+random 2898773 Lagging_16 Lagging Reverse
+random 2900126 Leading_0 Leading Forward
+random 2902743 Lagging_16 Lagging Reverse
+random 2905514 Lagging_16 Lagging Reverse
+random 2906405 Leading_0 Leading Forward
+random 2909424 Leading_0 Leading Forward
+random 2911047 Leading_0 Leading Forward
+random 2913800 Leading_0 Leading Forward
+random 2914619 Lagging_16 Lagging Reverse
+random 2915798 Lagging_16 Lagging Reverse
+random 2916701 Leading_0 Leading Forward
+random 2917529 Leading_0 Leading Forward
+random 2923055 Leading_0 Leading Forward
+random 2923055 Leading_0 Leading Forward
+random 2923773 Lagging_16 Lagging Reverse
+random 2925541 Lagging_16 Lagging Reverse
+random 2927514 Lagging_16 Lagging Reverse
+random 2930058 Lagging_16 Lagging Reverse
+random 2930750 Lagging_16 Lagging Reverse
+random 2933447 Leading_0 Leading Forward
+random 2935853 Lagging_16 Lagging Reverse
+random 2938548 Leading_0 Leading Forward
+random 2939702 Lagging_16 Lagging Reverse
+random 2941317 Lagging_16 Lagging Reverse
+random 2942795 Lagging_16 Lagging Reverse
+random 2943897 Leading_0 Leading Forward
+random 2945181 Lagging_16 Lagging Reverse
+random 2945466 Lagging_16 Lagging Reverse
+random 2955983 Lagging_16 Lagging Reverse
+random 2957319 Lagging_16 Lagging Reverse
+random 2960779 Lagging_16 Lagging Reverse
+random 2961103 Lagging_16 Lagging Reverse
+random 2966923 Leading_0 Leading Forward
+random 2967520 Lagging_16 Lagging Reverse
+random 2969433 Leading_0 Leading Forward
+random 2975846 Lagging_16 Lagging Reverse
+random 2980807 Leading_0 Leading Forward
+random 2984372 Lagging_16 Lagging Reverse
+random 2984578 Lagging_16 Lagging Reverse
+random 2984677 Leading_0 Leading Forward
+random 2989492 Leading_0 Leading Forward
+random 2992548 Lagging_16 Lagging Reverse
+random 2992624 Leading_0 Leading Forward
+random 2992650 Lagging_16 Lagging Reverse
+random 2995069 Lagging_16 Lagging Reverse
+random 2996897 Lagging_16 Lagging Reverse
+random 2998553 Lagging_16 Lagging Reverse
+random 2999133 Lagging_16 Lagging Reverse
+random 2999399 Leading_0 Leading Forward
+random 3000600 Lagging_16 Lagging Reverse
+random 3003650 Lagging_16 Lagging Reverse
+random 3006214 Leading_0 Leading Forward
+random 3007778 Leading_0 Leading Forward
+random 3008993 Lagging_16 Lagging Reverse
+random 3009802 Lagging_16 Lagging Reverse
+random 3013138 Leading_0 Leading Forward
+random 3015717 Lagging_16 Lagging Reverse
+random 3017249 Lagging_16 Lagging Reverse
+random 3018659 Leading_0 Leading Forward
+random 3019152 Leading_0 Leading Forward
+random 3022281 Leading_0 Leading Forward
+random 3025510 Leading_0 Leading Forward
+random 3027826 Lagging_16 Lagging Reverse
+random 3028478 Leading_0 Leading Forward
+random 3031369 Lagging_16 Lagging Reverse
+random 3036389 Lagging_16 Lagging Reverse
+random 3036697 Lagging_16 Lagging Reverse
+random 3036972 Leading_0 Leading Forward
+random 3049723 Lagging_16 Lagging Reverse
+random 3052180 Leading_0 Leading Forward
+random 3052668 Leading_0 Leading Forward
+random 3054464 Leading_0 Leading Forward
+random 3062816 Leading_0 Leading Forward
+random 3063428 Leading_0 Leading Forward
+random 3064402 Leading_0 Leading Forward
+random 3066405 Lagging_16 Lagging Reverse
+random 3070650 Leading_0 Leading Forward
+random 3078857 Leading_0 Leading Forward
+random 3081006 Lagging_16 Lagging Reverse
+random 3082730 Leading_0 Leading Forward
+random 3085400 Leading_0 Leading Forward
+random 3088223 Lagging_16 Lagging Reverse
+random 3089064 Lagging_16 Lagging Reverse
+random 3092594 Lagging_16 Lagging Reverse
+random 3096131 Lagging_16 Lagging Reverse
+random 3098010 Leading_0 Leading Forward
+random 3098091 Leading_0 Leading Forward
+random 3105636 Lagging_16 Lagging Reverse
+random 3105650 Lagging_16 Lagging Reverse
+random 3112244 Leading_0 Leading Forward
+random 3112264 Lagging_16 Lagging Reverse
+random 3113630 Lagging_16 Lagging Reverse
+random 3113847 Leading_0 Leading Forward
+random 3115120 Leading_0 Leading Forward
+random 3116557 Lagging_16 Lagging Reverse
+random 3117143 Leading_0 Leading Forward
+random 3120408 Lagging_16 Lagging Reverse
+random 3120493 Lagging_16 Lagging Reverse
+random 3122274 Leading_0 Leading Forward
+random 3124926 Lagging_16 Lagging Reverse
+random 3125241 Lagging_16 Lagging Reverse
+random 3131029 Lagging_16 Lagging Reverse
+random 3131293 Lagging_16 Lagging Reverse
+random 3135249 Lagging_16 Lagging Reverse
+random 3135562 Lagging_16 Lagging Reverse
+random 3135892 Lagging_16 Lagging Reverse
+random 3139818 Leading_0 Leading Forward
+random 3140388 Lagging_16 Lagging Reverse
+random 3141707 Leading_0 Leading Forward
+random 3144355 Leading_0 Leading Forward
+random 3145548 Leading_0 Leading Forward
+random 3148161 Leading_0 Leading Forward
+random 3154543 Leading_0 Leading Forward
+random 3155286 Lagging_16 Lagging Reverse
+random 3157369 Lagging_16 Lagging Reverse
+random 3162943 Lagging_16 Lagging Reverse
+random 3162952 Leading_0 Leading Forward
+random 3166257 Lagging_16 Lagging Reverse
+random 3166735 Leading_0 Leading Forward
+random 3174644 Lagging_16 Lagging Reverse
+random 3177294 Leading_0 Leading Forward
+random 3179819 Leading_0 Leading Forward
+random 3180159 Leading_0 Leading Forward
+random 3181586 Lagging_16 Lagging Reverse
+random 3182732 Lagging_16 Lagging Reverse
+random 3184440 Leading_0 Leading Forward
+random 3188383 Leading_0 Leading Forward
+random 3190620 Lagging_16 Lagging Reverse
+random 3190655 Leading_0 Leading Forward
+random 3192417 Leading_0 Leading Forward
+random 3193099 Lagging_16 Lagging Reverse
+random 3199440 Leading_0 Leading Forward
+random 3203587 Lagging_16 Lagging Reverse
+random 3205809 Leading_0 Leading Forward
+random 3208063 Lagging_16 Lagging Reverse
+random 3212083 Lagging_16 Lagging Reverse
+random 3212951 Leading_0 Leading Forward
+random 3213052 Lagging_16 Lagging Reverse
+random 3213285 Leading_0 Leading Forward
+random 3214802 Lagging_16 Lagging Reverse
+random 3215307 Lagging_16 Lagging Reverse
+random 3220073 Leading_0 Leading Forward
+random 3223307 Leading_0 Leading Forward
+random 3223646 Leading_0 Leading Forward
+random 3224350 Leading_0 Leading Forward
+random 3224914 Leading_0 Leading Forward
+random 3226048 Lagging_16 Lagging Reverse
+random 3227068 Leading_0 Leading Forward
+random 3229190 Lagging_16 Lagging Reverse
+random 3231420 Leading_0 Leading Forward
+random 3233131 Leading_0 Leading Forward
+random 3233347 Lagging_16 Lagging Reverse
+random 3234786 Leading_0 Leading Forward
+random 3236685 Leading_0 Leading Forward
+random 3237134 Leading_0 Leading Forward
+random 3243862 Leading_0 Leading Forward
+random 3244189 Leading_0 Leading Forward
+random 3245491 Leading_0 Leading Forward
+random 3245852 Leading_0 Leading Forward
+random 3247969 Lagging_16 Lagging Reverse
+random 3248974 Lagging_16 Lagging Reverse
+random 3249307 Lagging_16 Lagging Reverse
+random 3250356 Lagging_16 Lagging Reverse
+random 3251916 Leading_0 Leading Forward
+random 3253376 Leading_0 Leading Forward
+random 3255250 Lagging_16 Lagging Reverse
+random 3255400 Leading_0 Leading Forward
+random 3263309 Leading_0 Leading Forward
+random 3264677 Lagging_16 Lagging Reverse
+random 3267563 Leading_0 Leading Forward
+random 3276955 Leading_0 Leading Forward
+random 3285420 Lagging_16 Lagging Reverse
+random 3286239 Leading_0 Leading Forward
+random 3290943 Leading_0 Leading Forward
+random 3292991 Leading_0 Leading Forward
+random 3294835 Lagging_16 Lagging Reverse
+random 3297456 Leading_0 Leading Forward
+random 3297738 Leading_0 Leading Forward
+random 3298947 Lagging_16 Lagging Reverse
+random 3300132 Leading_0 Leading Forward
+random 3302042 Lagging_16 Lagging Reverse
+random 3303139 Lagging_16 Lagging Reverse
+random 3305484 Leading_0 Leading Forward
+random 3306712 Lagging_16 Lagging Reverse
+random 3308151 Leading_0 Leading Forward
+random 3314150 Lagging_16 Lagging Reverse
+random 3314373 Lagging_16 Lagging Reverse
+random 3320170 Leading_0 Leading Forward
+random 3329949 Lagging_16 Lagging Reverse
+random 3330800 Lagging_16 Lagging Reverse
+random 3332121 Leading_0 Leading Forward
+random 3337505 Lagging_16 Lagging Reverse
+random 3341044 Lagging_16 Lagging Reverse
+random 3350530 Leading_0 Leading Forward
+random 3351026 Leading_0 Leading Forward
+random 3352741 Leading_0 Leading Forward
+random 3362938 Leading_0 Leading Forward
+random 3370237 Lagging_16 Lagging Reverse
+random 3372115 Leading_0 Leading Forward
+random 3380285 Leading_0 Leading Forward
+random 3383311 Leading_0 Leading Forward
+random 3383696 Leading_0 Leading Forward
+random 3385085 Lagging_16 Lagging Reverse
+random 3388011 Lagging_16 Lagging Reverse
+random 3391170 Lagging_16 Lagging Reverse
+random 3397257 Leading_0 Leading Forward
+random 3397434 Leading_0 Leading Forward
+random 3403073 Lagging_16 Lagging Reverse
+random 3403261 Leading_0 Leading Forward
+random 3409394 Lagging_16 Lagging Reverse
+random 3412747 Leading_0 Leading Forward
+random 3415629 Lagging_16 Lagging Reverse
+random 3418553 Lagging_16 Lagging Reverse
+random 3425163 Lagging_16 Lagging Reverse
+random 3427184 Leading_0 Leading Forward
+random 3429743 Leading_0 Leading Forward
+random 3429993 Leading_0 Leading Forward
+random 3432442 Lagging_16 Lagging Reverse
+random 3441326 Leading_0 Leading Forward
+random 3443619 Lagging_16 Lagging Reverse
+random 3443753 Leading_0 Leading Forward
+random 3453893 Lagging_16 Lagging Reverse
+random 3456984 Lagging_16 Lagging Reverse
+random 3457097 Leading_0 Leading Forward
+random 3460613 Lagging_16 Lagging Reverse
+random 3464315 Leading_0 Leading Forward
+random 3465654 Leading_0 Leading Forward
+random 3466210 Lagging_16 Lagging Reverse
+random 3466707 Leading_0 Leading Forward
+random 3468095 Leading_0 Leading Forward
+random 3471403 Leading_0 Leading Forward
+random 3471820 Leading_0 Leading Forward
+random 3472411 Lagging_16 Lagging Reverse
+random 3474529 Lagging_16 Lagging Reverse
+random 3476220 Leading_0 Leading Forward
+random 3481309 Lagging_16 Lagging Reverse
+random 3495492 Lagging_16 Lagging Reverse
+random 3497249 Leading_0 Leading Forward
+random 3497990 Leading_0 Leading Forward
+random 3498773 Lagging_16 Lagging Reverse
+random 3499052 Leading_0 Leading Forward
+random 3500268 Leading_0 Leading Forward
+random 3504425 Leading_0 Leading Forward
+random 3506779 Lagging_16 Lagging Reverse
+random 3508151 Lagging_16 Lagging Reverse
+random 3510363 Lagging_16 Lagging Reverse
+random 3510447 Leading_0 Leading Forward
+random 3515223 Leading_0 Leading Forward
+random 3517102 Leading_0 Leading Forward
+random 3520527 Leading_0 Leading Forward
+random 3521263 Lagging_16 Lagging Reverse
+random 3525362 Lagging_16 Lagging Reverse
+random 3532018 Lagging_16 Lagging Reverse
+random 3536662 Leading_0 Leading Forward
+random 3539573 Lagging_16 Lagging Reverse
+random 3540970 Lagging_16 Lagging Reverse
+random 3541367 Leading_0 Leading Forward
+random 3542231 Leading_0 Leading Forward
+random 3543373 Leading_0 Leading Forward
+random 3547810 Leading_0 Leading Forward
+random 3550572 Leading_0 Leading Forward
+random 3552375 Lagging_16 Lagging Reverse
+random 3552612 Lagging_16 Lagging Reverse
+random 3556298 Lagging_16 Lagging Reverse
+random 3563615 Lagging_16 Lagging Reverse
+random 3564585 Leading_0 Leading Forward
+random 3567977 Lagging_16 Lagging Reverse
+random 3575600 Lagging_16 Lagging Reverse
+random 3576746 Lagging_16 Lagging Reverse
+random 3580173 Lagging_16 Lagging Reverse
+random 3581009 Lagging_16 Lagging Reverse
+random 3584702 Lagging_16 Lagging Reverse
+random 3587072 Leading_0 Leading Forward
+random 3588066 Lagging_16 Lagging Reverse
+random 3592485 Leading_0 Leading Forward
+random 3602081 Leading_0 Leading Forward
+random 3606074 Lagging_16 Lagging Reverse
+random 3610591 Leading_0 Leading Forward
+random 3622220 Leading_0 Leading Forward
+random 3623789 Leading_0 Leading Forward
+random 3626564 Leading_0 Leading Forward
+random 3629725 Leading_0 Leading Forward
+random 3630804 Leading_0 Leading Forward
+random 3631459 Leading_0 Leading Forward
+random 3640818 Lagging_16 Lagging Reverse
+random 3642827 Leading_0 Leading Forward
+random 3644546 Leading_0 Leading Forward
+random 3649530 Lagging_16 Lagging Reverse
+random 3656918 Leading_0 Leading Forward
+random 3657252 Leading_0 Leading Forward
+random 3658904 Leading_0 Leading Forward
+random 3658997 Leading_0 Leading Forward
+random 3659292 Lagging_16 Lagging Reverse
+random 3659478 Leading_0 Leading Forward
+random 3662912 Lagging_16 Lagging Reverse
+random 3664643 Lagging_16 Lagging Reverse
+random 3667333 Leading_0 Leading Forward
+random 3667790 Leading_0 Leading Forward
+random 3670178 Lagging_16 Lagging Reverse
+random 3673238 Leading_0 Leading Forward
+random 3674984 Lagging_16 Lagging Reverse
+random 3675714 Lagging_16 Lagging Reverse
+random 3677220 Leading_0 Leading Forward
+random 3678757 Leading_0 Leading Forward
+random 3684861 Leading_0 Leading Forward
+random 3686602 Leading_0 Leading Forward
+random 3686869 Lagging_16 Lagging Reverse
+random 3693497 Lagging_16 Lagging Reverse
+random 3701422 Leading_0 Leading Forward
+random 3708984 Leading_0 Leading Forward
+random 3712251 Lagging_16 Lagging Reverse
+random 3714134 Lagging_16 Lagging Reverse
+random 3714360 Leading_0 Leading Forward
+random 3715938 Lagging_16 Lagging Reverse
+random 3716069 Leading_0 Leading Forward
+random 3719039 Leading_0 Leading Forward
+random 3737433 Leading_0 Leading Forward
+random 3739127 Leading_0 Leading Forward
+random 3740466 Lagging_16 Lagging Reverse
+random 3742873 Lagging_16 Lagging Reverse
+random 3745991 Leading_0 Leading Forward
+random 3746693 Leading_0 Leading Forward
+random 3749500 Leading_0 Leading Forward
+random 3752977 Lagging_16 Lagging Reverse
+random 3752992 Leading_0 Leading Forward
+random 3753255 Leading_0 Leading Forward
+random 3757976 Leading_0 Leading Forward
+random 3758377 Leading_0 Leading Forward
+random 3759408 Lagging_16 Lagging Reverse
+random 3759505 Leading_0 Leading Forward
+random 3769311 Leading_0 Leading Forward
+random 3774545 Lagging_16 Lagging Reverse
+random 3776410 Lagging_16 Lagging Reverse
+random 3777674 Lagging_16 Lagging Reverse
+random 3780671 Lagging_16 Lagging Reverse
+random 3788428 Lagging_16 Lagging Reverse
+random 3793860 Lagging_16 Lagging Reverse
+random 3802043 Leading_0 Leading Forward
+random 3804027 Lagging_16 Lagging Reverse
+random 3808126 Leading_0 Leading Forward
+random 3810652 Lagging_16 Lagging Reverse
+random 3816415 Lagging_16 Lagging Reverse
+random 3819790 Leading_0 Leading Forward
+random 3822424 Leading_0 Leading Forward
+random 3825633 Lagging_16 Lagging Reverse
+random 3826421 Lagging_16 Lagging Reverse
+random 3836306 Lagging_16 Lagging Reverse
+random 3838848 Lagging_16 Lagging Reverse
+random 3844991 Leading_0 Leading Forward
+random 3846625 Lagging_16 Lagging Reverse
+random 3851061 Leading_0 Leading Forward
+random 3852352 Leading_0 Leading Forward
+random 3852403 Lagging_16 Lagging Reverse
+random 3854230 Leading_0 Leading Forward
+random 3858451 Leading_0 Leading Forward
+random 3860021 Leading_0 Leading Forward
+random 3861945 Lagging_16 Lagging Reverse
+random 3865296 Leading_0 Leading Forward
+random 3868420 Leading_0 Leading Forward
+random 3870658 Lagging_16 Lagging Reverse
+random 3872154 Lagging_16 Lagging Reverse
+random 3872699 Leading_0 Leading Forward
+random 3875780 Lagging_16 Lagging Reverse
+random 3882407 Leading_0 Leading Forward
+random 3882941 Leading_0 Leading Forward
+random 3883592 Lagging_16 Lagging Reverse
+random 3891769 Leading_0 Leading Forward
+random 3892163 Lagging_16 Lagging Reverse
+random 3893429 Lagging_16 Lagging Reverse
+random 3900097 Lagging_16 Lagging Reverse
+random 3901712 Leading_0 Leading Forward
+random 3902900 Leading_0 Leading Forward
+random 3903581 Leading_0 Leading Forward
+random 3903897 Lagging_16 Lagging Reverse
+random 3905284 Lagging_16 Lagging Reverse
+random 3905643 Leading_0 Leading Forward
+random 3907397 Leading_0 Leading Forward
+random 3911067 Lagging_16 Lagging Reverse
+random 3915122 Leading_0 Leading Forward
+random 3918565 Leading_0 Leading Forward
+random 3922751 Lagging_16 Lagging Reverse
+random 3923744 Leading_0 Leading Forward
+random 3934335 Leading_0 Leading Forward
+random 3943207 Lagging_16 Lagging Reverse
+random 3943937 Lagging_16 Lagging Reverse
+random 3944020 Lagging_16 Lagging Reverse
+random 3945702 Leading_0 Leading Forward
+random 3950681 Lagging_16 Lagging Reverse
+random 3954823 Leading_0 Leading Forward
+random 3957938 Lagging_16 Lagging Reverse
+random 3958057 Leading_0 Leading Forward
+random 3965095 Leading_0 Leading Forward
+random 3966271 Leading_0 Leading Forward
+random 3970022 Lagging_16 Lagging Reverse
+random 3974494 Leading_0 Leading Forward
+random 3978819 Lagging_16 Lagging Reverse
+random 3982072 Lagging_16 Lagging Reverse
+random 3983174 Lagging_16 Lagging Reverse
+random 3986880 Leading_0 Leading Forward
+random 3988055 Leading_0 Leading Forward
+random 3991577 Lagging_16 Lagging Reverse
+random 3999699 Lagging_16 Lagging Reverse
+random 4003162 Leading_0 Leading Forward
+random 4009648 Leading_0 Leading Forward
+random 4011813 Leading_0 Leading Forward
+random 4012140 Leading_0 Leading Forward
+random 4012878 Leading_0 Leading Forward
+random 4013733 Lagging_16 Lagging Reverse
+random 4015927 Lagging_16 Lagging Reverse
+random 4017240 Lagging_16 Lagging Reverse
+random 4020003 Lagging_16 Lagging Reverse
+random 4021073 Lagging_16 Lagging Reverse
+random 4027226 Leading_0 Leading Forward
+random 4029906 Leading_0 Leading Forward
+random 4036659 Lagging_16 Lagging Reverse
+random 4042591 Leading_0 Leading Forward
+random 4044555 Leading_0 Leading Forward
+random 4057503 Lagging_16 Lagging Reverse
+random 4059032 Leading_0 Leading Forward
+random 4059158 Leading_0 Leading Forward
+random 4066261 Lagging_16 Lagging Reverse
+random 4066442 Lagging_16 Lagging Reverse
+random 4077866 Leading_0 Leading Forward
+random 4078054 Lagging_16 Lagging Reverse
+random 4078905 Leading_0 Leading Forward
+random 4084378 Leading_0 Leading Forward
+random 4090730 Leading_0 Leading Forward
+random 4096078 Leading_0 Leading Forward
+random 4099906 Lagging_16 Lagging Reverse
+random 4101403 Lagging_16 Lagging Reverse
+random 4103561 Lagging_16 Lagging Reverse
+random 4107939 Leading_0 Leading Forward
+random 4109471 Leading_0 Leading Forward
+random 4112126 Lagging_16 Lagging Reverse
+random 4113413 Leading_0 Leading Forward
+random 4114285 Leading_0 Leading Forward
+random 4117263 Leading_0 Leading Forward
+random 4121307 Leading_0 Leading Forward
+random 4122185 Leading_0 Leading Forward
+random 4122479 Lagging_16 Lagging Reverse
+random 4123790 Leading_0 Leading Forward
+random 4126492 Lagging_16 Lagging Reverse
+random 4129439 Leading_0 Leading Forward
+random 4131193 Lagging_16 Lagging Reverse
+random 4133063 Lagging_16 Lagging Reverse
+random 4137528 Leading_0 Leading Forward
+random 4138817 Leading_0 Leading Forward
+random 4145429 Leading_0 Leading Forward
+random 4148176 Lagging_16 Lagging Reverse
+random 4148218 Leading_0 Leading Forward
+random 4149290 Leading_0 Leading Forward
+random 4153716 Lagging_16 Lagging Reverse
+random 4159231 Lagging_16 Lagging Reverse
+random 4163737 Lagging_16 Lagging Reverse
+random 4165671 Leading_0 Leading Forward
+random 4167229 Lagging_16 Lagging Reverse
+random 4171174 Leading_0 Leading Forward
+random 4171368 Lagging_16 Lagging Reverse
+random 4177550 Lagging_16 Lagging Reverse
+random 4192580 Leading_0 Leading Forward
+random 4199987 Leading_0 Leading Forward
+random 4201079 Leading_0 Leading Forward
+random 4202368 Leading_0 Leading Forward
+random 4202732 Leading_0 Leading Forward
+random 4205708 Lagging_16 Lagging Reverse
+random 4208018 Lagging_16 Lagging Reverse
+random 4208774 Lagging_16 Lagging Reverse
+random 4210127 Lagging_16 Lagging Reverse
+random 4211403 Lagging_16 Lagging Reverse
+random 4218627 Lagging_16 Lagging Reverse
+random 4223047 Leading_0 Leading Forward
+random 4224166 Lagging_16 Lagging Reverse
+random 4226584 Lagging_16 Lagging Reverse
+random 4227051 Lagging_16 Lagging Reverse
+random 4231426 Lagging_16 Lagging Reverse
+random 4232656 Lagging_16 Lagging Reverse
+random 4235821 Lagging_16 Lagging Reverse
+random 4237161 Lagging_16 Lagging Reverse
+random 4242809 Leading_0 Leading Forward
+random 4244108 Lagging_16 Lagging Reverse
+random 4244575 Leading_0 Leading Forward
+random 4250531 Leading_0 Leading Forward
+random 4254567 Lagging_16 Lagging Reverse
+random 4256371 Leading_0 Leading Forward
+random 4257447 Lagging_16 Lagging Reverse
+random 4258217 Leading_0 Leading Forward
+random 4260001 Lagging_16 Lagging Reverse
+random 4268309 Lagging_16 Lagging Reverse
+random 4273711 Lagging_16 Lagging Reverse
+random 4281248 Lagging_16 Lagging Reverse
+random 4282919 Lagging_16 Lagging Reverse
+random 4285109 Lagging_16 Lagging Reverse
+random 4288073 Lagging_16 Lagging Reverse
+random 4290648 Lagging_16 Lagging Reverse
+random 4292801 Leading_0 Leading Forward
+random 4293614 Lagging_16 Lagging Reverse
+random 4293998 Leading_0 Leading Forward
+random 4297598 Lagging_16 Lagging Reverse
+random 4300451 Leading_0 Leading Forward
+random 4300509 Leading_0 Leading Forward
+random 4301377 Lagging_16 Lagging Reverse
+random 4304687 Leading_0 Leading Forward
+random 4308851 Leading_0 Leading Forward
+random 4312253 Leading_0 Leading Forward
+random 4314950 Leading_0 Leading Forward
+random 4315558 Leading_0 Leading Forward
+random 4315564 Leading_0 Leading Forward
+random 4319878 Leading_0 Leading Forward
+random 4320095 Lagging_16 Lagging Reverse
+random 4321255 Lagging_16 Lagging Reverse
+random 4321774 Leading_0 Leading Forward
+random 4322742 Leading_0 Leading Forward
+random 4323796 Lagging_16 Lagging Reverse
+random 4327745 Lagging_16 Lagging Reverse
+random 4329321 Leading_0 Leading Forward
+random 4330431 Lagging_16 Lagging Reverse
+random 4330491 Leading_0 Leading Forward
+random 4332734 Lagging_16 Lagging Reverse
+random 4335825 Leading_0 Leading Forward
+random 4337842 Leading_0 Leading Forward
+random 4344514 Lagging_16 Lagging Reverse
+random 4345763 Lagging_16 Lagging Reverse
+random 4348378 Leading_0 Leading Forward
+random 4353912 Leading_0 Leading Forward
+random 4355825 Lagging_16 Lagging Reverse
+random 4365298 Lagging_16 Lagging Reverse
+random 4366548 Leading_0 Leading Forward
+random 4368979 Leading_0 Leading Forward
+random 4369056 Lagging_16 Lagging Reverse
+random 4371086 Leading_0 Leading Forward
+random 4378646 Leading_0 Leading Forward
+random 4381174 Leading_0 Leading Forward
+random 4388623 Leading_0 Leading Forward
+random 4389569 Lagging_16 Lagging Reverse
+random 4391759 Leading_0 Leading Forward
+random 4394780 Leading_0 Leading Forward
+random 4396792 Lagging_16 Lagging Reverse
+random 4401624 Lagging_16 Lagging Reverse
+random 4407002 Leading_0 Leading Forward
+random 4407020 Leading_0 Leading Forward
+random 4408358 Lagging_16 Lagging Reverse
+random 4408525 Lagging_16 Lagging Reverse
+random 4409334 Lagging_16 Lagging Reverse
+random 4412718 Lagging_16 Lagging Reverse
+random 4413135 Leading_0 Leading Forward
+random 4415854 Leading_0 Leading Forward
+random 4416814 Leading_0 Leading Forward
+random 4420386 Lagging_16 Lagging Reverse
+random 4421788 Leading_0 Leading Forward
+random 4422033 Leading_0 Leading Forward
+random 4424684 Lagging_16 Lagging Reverse
+random 4426300 Lagging_16 Lagging Reverse
+random 4426888 Leading_0 Leading Forward
+random 4431606 Lagging_16 Lagging Reverse
+random 4431762 Lagging_16 Lagging Reverse
+random 4433516 Lagging_16 Lagging Reverse
+random 4435360 Leading_0 Leading Forward
+random 4437703 Lagging_16 Lagging Reverse
+random 4438360 Leading_0 Leading Forward
+random 4444412 Lagging_16 Lagging Reverse
+random 4455454 Lagging_16 Lagging Reverse
+random 4458876 Lagging_16 Lagging Reverse
+random 4461245 Leading_0 Leading Forward
+random 4462383 Leading_0 Leading Forward
+random 4472202 Lagging_16 Lagging Reverse
+random 4472558 Lagging_16 Lagging Reverse
+random 4477280 Leading_0 Leading Forward
+random 4481797 Lagging_16 Lagging Reverse
+random 4491265 Leading_0 Leading Forward
+random 4494024 Lagging_16 Lagging Reverse
+random 4497451 Lagging_16 Lagging Reverse
+random 4503888 Leading_0 Leading Forward
+random 4509216 Lagging_16 Lagging Reverse
+random 4510243 Lagging_16 Lagging Reverse
+random 4521599 Leading_0 Leading Forward
+random 4521899 Lagging_16 Lagging Reverse
+random 4535802 Lagging_16 Lagging Reverse
+random 4536850 Lagging_16 Lagging Reverse
+random 4539932 Lagging_16 Lagging Reverse
+random 4539962 Lagging_16 Lagging Reverse
+random 4542420 Leading_0 Leading Forward
+random 4542984 Lagging_16 Lagging Reverse
+random 4543107 Leading_0 Leading Forward
+random 4543627 Leading_0 Leading Forward
+random 4545103 Lagging_16 Lagging Reverse
+random 4547929 Lagging_16 Lagging Reverse
+random 4556390 Leading_0 Leading Forward
+random 4559467 Lagging_16 Lagging Reverse
+random 4559951 Lagging_16 Lagging Reverse
+random 4562918 Leading_0 Leading Forward
+random 4563317 Leading_0 Leading Forward
+random 4566513 Lagging_16 Lagging Reverse
+random 4568479 Leading_0 Leading Forward
+random 4570535 Lagging_16 Lagging Reverse
+random 4573104 Lagging_16 Lagging Reverse
+random 4578618 Lagging_16 Lagging Reverse
+random 4583381 Lagging_16 Lagging Reverse
+random 4593951 Leading_0 Leading Forward
+random 4594578 Leading_0 Leading Forward
+random 4600324 Lagging_16 Lagging Reverse
+random 4602042 Lagging_16 Lagging Reverse
+random 4607316 Leading_0 Leading Forward
+random 4607610 Leading_0 Leading Forward
+random 4608630 Leading_0 Leading Forward
+random 4611567 Lagging_16 Lagging Reverse
+random 4611943 Lagging_16 Lagging Reverse
+random 4613770 Lagging_16 Lagging Reverse
+random 4626826 Lagging_16 Lagging Reverse
+random 4629143 Leading_16 Leading Reverse
+random 4630285 Leading_16 Leading Reverse
+random 4640323 Lagging_0 Lagging Forward
diff --git a/dataset/test.fastq2_q20.pos b/dataset/test.fastq2_q20.pos
new file mode 100644
index 0000000000000000000000000000000000000000..bf59fc414eaa6cd599aa2c44e78f224fc9aebfa9
--- /dev/null
+++ b/dataset/test.fastq2_q20.pos
@@ -0,0 +1,2182 @@
+0 6278
+0 47626
+0 50670
+0 56949
+0 79908
+0 79908
+16 82921
+0 82936
+16 108311
+16 121430
+0 131096
+16 131454
+0 134422
+16 138639
+0 147342
+0 161462
+0 162752
+0 163010
+16 172873
+0 185931
+0 197823
+0 200492
+0 210465
+0 222323
+0 251031
+0 258803
+0 279619
+16 284212
+16 324440
+16 358223
+0 359615
+0 359927
+16 379273
+0 393430
+0 400187
+0 401935
+16 411254
+0 433818
+16 444131
+16 473844
+0 473853
+0 473853
+16 474103
+0 480601
+16 484732
+16 484732
+16 486075
+0 490421
+0 492454
+0 492454
+0 492454
+0 506157
+0 506406
+0 517477
+0 535910
+16 537762
+16 537762
+0 541533
+16 543570
+0 595937
+16 603548
+0 618332
+0 636178
+0 640530
+0 643187
+16 651478
+16 667360
+16 667360
+16 671674
+0 672741
+16 674976
+16 674976
+0 682127
+16 688530
+0 702054
+0 712349
+16 725368
+16 725368
+0 725865
+0 725865
+16 737434
+0 744700
+0 761594
+0 772423
+16 774818
+16 792209
+16 816680
+16 831686
+0 833789
+0 833789
+0 840446
+16 846884
+0 847968
+16 855385
+0 859719
+0 860842
+0 891138
+0 891138
+0 899477
+16 903254
+0 905927
+0 910571
+0 911301
+0 942460
+16 956961
+0 961724
+0 961967
+0 973920
+16 975046
+16 975046
+16 975046
+16 975046
+16 975046
+0 978929
+16 988121
+0 996686
+16 1002390
+0 1009717
+16 1019628
+16 1029769
+0 1043726
+16 1045943
+16 1065237
+16 1066941
+16 1067994
+16 1067994
+16 1067994
+16 1067994
+16 1067994
+16 1067994
+16 1067994
+16 1070743
+16 1078795
+16 1083927
+0 1093582
+0 1093582
+0 1102851
+16 1108556
+0 1108575
+0 1114675
+16 1117001
+16 1117001
+16 1119778
+16 1119778
+0 1127283
+0 1127283
+0 1127283
+0 1127283
+0 1127283
+0 1127283
+0 1132327
+0 1132353
+0 1132353
+0 1133587
+16 1137017
+0 1138596
+0 1139155
+0 1143940
+16 1148910
+16 1148910
+0 1156361
+16 1157800
+16 1157800
+16 1159872
+16 1165194
+0 1165441
+0 1165441
+16 1170301
+16 1170434
+0 1170309
+0 1172920
+16 1173203
+0 1173883
+0 1173883
+0 1173883
+0 1173883
+0 1180853
+0 1188793
+0 1191500
+0 1195172
+16 1197101
+0 1200779
+0 1204504
+0 1204661
+16 1205189
+0 1207899
+16 1209692
+0 1211740
+0 1211740
+0 1219300
+0 1219300
+16 1225199
+0 1237740
+0 1242088
+16 1244403
+0 1244312
+0 1247054
+0 1252389
+0 1258479
+0 1260087
+0 1260087
+0 1263321
+0 1274191
+0 1274191
+0 1274191
+0 1274191
+0 1274191
+0 1274191
+0 1276290
+16 1284055
+0 1286148
+0 1289269
+16 1291962
+16 1291962
+16 1312109
+0 1313139
+16 1316015
+16 1316368
+0 1316395
+0 1316947
+16 1320698
+16 1320791
+16 1320791
+16 1320791
+0 1321972
+16 1323049
+16 1324086
+0 1325059
+0 1325059
+16 1327115
+0 1327110
+0 1327110
+16 1327476
+0 1327533
+0 1327533
+0 1327533
+0 1327533
+0 1327974
+0 1334050
+16 1334270
+0 1339323
+16 1339622
+0 1339604
+0 1341620
+0 1341620
+0 1341620
+0 1341620
+0 1341620
+0 1341620
+0 1341620
+0 1341620
+0 1341620
+0 1341620
+0 1341620
+0 1341620
+0 1341620
+0 1341620
+0 1341620
+0 1341803
+16 1342918
+16 1344794
+0 1345016
+0 1352680
+0 1353353
+0 1363265
+0 1367206
+0 1367630
+0 1367630
+0 1371327
+0 1378395
+0 1399012
+16 1406075
+16 1413090
+16 1413663
+16 1416223
+0 1418288
+0 1418288
+16 1420748
+16 1421507
+16 1421507
+0 1421515
+0 1423485
+0 1424006
+0 1431402
+16 1432681
+0 1433599
+0 1435872
+0 1439335
+16 1440253
+0 1445782
+0 1447701
+0 1450508
+0 1458392
+0 1462558
+16 1463042
+16 1463485
+0 1464183
+0 1470018
+16 1478869
+0 1478918
+16 1483094
+16 1484444
+16 1486099
+0 1490008
+16 1492573
+0 1495239
+0 1495239
+16 1495794
+16 1499275
+0 1501691
+0 1501691
+0 1501691
+0 1501691
+0 1501691
+0 1502459
+0 1507112
+0 1507827
+16 1511056
+0 1512939
+0 1513034
+16 1517929
+16 1518350
+16 1519070
+16 1519629
+0 1522184
+0 1523783
+0 1523783
+16 1524388
+0 1526900
+16 1529666
+0 1529675
+0 1529675
+16 1532554
+16 1532554
+16 1536988
+16 1536988
+0 1537698
+16 1548180
+16 1548180
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548192
+16 1548180
+16 1548192
+16 1548192
+16 1548192
+0 1548497
+16 1548845
+16 1549819
+16 1550257
+16 1555070
+0 1555723
+0 1555723
+0 1555723
+0 1555723
+0 1555723
+0 1555723
+0 1555723
+0 1555723
+0 1555723
+0 1555723
+0 1555723
+0 1555723
+0 1555723
+0 1555723
+0 1555723
+0 1556909
+0 1556909
+16 1561737
+0 1561736
+0 1561748
+0 1564788
+0 1570386
+0 1577460
+16 1584462
+16 1584462
+16 1584462
+0 1590460
+16 1591884
+0 1593950
+16 1596465
+16 1602377
+0 1602637
+0 1603018
+16 1603635
+16 1603635
+16 1603635
+16 1610951
+16 1610951
+16 1610951
+16 1610951
+16 1610951
+16 1610951
+16 1610951
+0 1610971
+0 1610971
+0 1613205
+0 1614552
+16 1616663
+16 1617791
+16 1618225
+16 1629357
+16 1629495
+0 1631132
+0 1632360
+0 1632360
+0 1632360
+0 1632360
+0 1633116
+0 1634843
+0 1635432
+0 1639735
+0 1640309
+16 1640718
+0 1640876
+16 1643189
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+16 1643790
+0 1643798
+16 1646821
+16 1647360
+0 1667018
+16 1673360
+16 1675492
+0 1676258
+16 1676582
+0 1678138
+16 1684338
+16 1685958
+16 1685958
+16 1693735
+0 1694333
+16 1694628
+0 1696306
+0 1696306
+0 1697917
+0 1697917
+16 1698280
+0 1704013
+0 1711097
+16 1714519
+16 1724722
+0 1724717
+16 1725079
+16 1725079
+16 1725079
+16 1725079
+0 1731790
+0 1733615
+16 1734227
+16 1738201
+16 1738201
+0 1741409
+0 1741409
+16 1741589
+16 1743716
+16 1744090
+16 1746079
+16 1749724
+16 1757721
+16 1758241
+16 1762445
+16 1762898
+16 1764238
+16 1764238
+0 1768035
+0 1771328
+0 1771328
+0 1771328
+0 1772045
+16 1774052
+0 1776383
+0 1776383
+0 1776383
+0 1776383
+0 1776383
+0 1776383
+0 1776383
+0 1776383
+0 1776383
+0 1776383
+0 1776383
+0 1776383
+0 1776383
+0 1776383
+16 1777121
+16 1777121
+16 1777121
+16 1777121
+16 1778863
+16 1782186
+0 1782768
+0 1782768
+16 1782895
+16 1785221
+16 1785221
+0 1785229
+0 1785229
+0 1785229
+0 1788750
+0 1788750
+0 1788750
+0 1788750
+16 1788856
+0 1789489
+0 1792959
+16 1793213
+0 1796621
+0 1796621
+16 1797558
+16 1799422
+16 1799422
+16 1799422
+16 1799422
+16 1799422
+16 1799422
+16 1799422
+16 1799422
+16 1799422
+16 1799422
+16 1799422
+16 1799422
+16 1799422
+16 1799422
+16 1799422
+16 1799422
+0 1799539
+16 1802545
+16 1802545
+0 1803085
+16 1803356
+16 1803749
+16 1806288
+0 1811568
+0 1818174
+0 1825261
+16 1827081
+16 1827081
+16 1827081
+16 1827081
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1827089
+0 1830367
+0 1833203
+0 1851615
+0 1852822
+16 1855965
+16 1858289
+16 1858289
+0 1859710
+0 1860613
+0 1860613
+0 1860613
+0 1864085
+0 1872761
+0 1872761
+0 1872761
+0 1872761
+0 1872761
+16 1873059
+16 1873059
+0 1874278
+0 1874278
+0 1874278
+0 1874278
+0 1874278
+0 1874278
+0 1875367
+16 1878676
+0 1880377
+0 1880377
+0 1880377
+0 1880377
+16 1882180
+16 1883440
+16 1883440
+16 1883440
+16 1886721
+0 1890225
+0 1891280
+16 1897534
+16 1897534
+16 1899481
+16 1900837
+0 1902078
+16 1905566
+0 1906191
+0 1907086
+0 1908727
+0 1909319
+0 1910691
+0 1910691
+16 1911691
+16 1911691
+16 1911691
+0 1915305
+0 1915305
+0 1916019
+16 1917728
+0 1921342
+16 1923878
+16 1923878
+0 1923886
+16 1926714
+16 1926714
+0 1926723
+0 1926723
+16 1929104
+16 1929104
+0 1931317
+0 1931439
+16 1934022
+16 1934022
+16 1934022
+0 1934031
+0 1934031
+0 1934031
+0 1935366
+16 1936850
+16 1937074
+16 1937578
+16 1937578
+16 1937578
+16 1937578
+16 1937578
+0 1937587
+16 1939412
+0 1945685
+0 1945685
+0 1945685
+16 1947257
+16 1947379
+16 1947469
+16 1947469
+16 1955533
+16 1955533
+16 1955533
+0 1955529
+16 1955871
+0 1955879
+16 1957307
+16 1957870
+16 1958088
+16 1959295
+0 1959304
+16 1959655
+16 1959737
+16 1959737
+0 1960596
+0 1961858
+0 1962802
+0 1963305
+0 1963305
+0 1963305
+16 1964302
+0 1965734
+0 1965968
+16 1967897
+16 1971271
+0 1973789
+16 1974903
+16 1981788
+16 1981841
+16 1981841
+16 1981841
+16 1981841
+16 1981841
+16 1981841
+16 1981841
+16 1981841
+16 1981841
+16 1981841
+16 1981841
+0 1984379
+0 1984379
+0 1984551
+16 1985123
+16 1985123
+16 1985123
+16 1985123
+16 1985123
+16 1985123
+16 1985123
+16 1985123
+16 1985123
+16 1985123
+16 1985123
+16 1985123
+16 1985123
+16 1985123
+0 1985248
+0 1985248
+0 1985500
+0 1986443
+0 1987689
+0 1989077
+16 1991257
+0 1992127
+0 1992170
+0 1999775
+16 2000940
+0 2004422
+0 2004422
+0 2004422
+0 2004422
+0 2004847
+16 2005849
+16 2007380
+0 2009280
+16 2009542
+0 2009547
+0 2009547
+16 2010780
+16 2010780
+16 2010780
+16 2011901
+0 2012476
+0 2012476
+0 2012590
+16 2013292
+16 2021477
+16 2021572
+0 2022060
+0 2022090
+0 2022090
+0 2024740
+16 2030358
+16 2034832
+16 2035539
+16 2039379
+0 2039387
+16 2041275
+16 2044084
+16 2044084
+16 2055389
+16 2055389
+0 2061145
+0 2063435
+0 2063435
+0 2063435
+0 2063435
+0 2063435
+0 2063435
+0 2063435
+0 2068696
+16 2070616
+16 2070616
+16 2070616
+0 2071795
+16 2075042
+16 2077419
+0 2077454
+16 2077842
+16 2077842
+16 2078274
+0 2081890
+16 2083634
+16 2085229
+0 2085318
+0 2085318
+16 2085393
+16 2087169
+0 2087177
+0 2087177
+16 2087583
+0 2088520
+0 2088520
+0 2088520
+0 2088520
+0 2088520
+16 2089104
+0 2089753
+16 2090805
+0 2092898
+16 2093825
+16 2094102
+0 2096856
+16 2099447
+0 2099596
+0 2099596
+0 2103203
+0 2105433
+16 2108581
+16 2108581
+0 2114293
+0 2120915
+16 2121372
+16 2121372
+16 2121372
+0 2123386
+16 2129364
+0 2129611
+16 2133463
+16 2133463
+16 2133463
+16 2133463
+0 2134199
+0 2141692
+0 2146543
+16 2148774
+0 2150401
+16 2151507
+0 2151599
+16 2153893
+16 2155652
+16 2155652
+16 2155652
+0 2156820
+16 2164889
+16 2165059
+0 2167128
+0 2167354
+0 2167354
+16 2167817
+16 2167817
+0 2168497
+16 2168931
+16 2169616
+16 2172302
+0 2172244
+0 2172244
+0 2172244
+0 2173223
+0 2173223
+0 2173223
+16 2177224
+16 2177224
+16 2177224
+16 2180301
+16 2185635
+16 2205267
+0 2205639
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+16 2210751
+0 2213753
+0 2213753
+0 2213848
+16 2214323
+0 2216168
+0 2221247
+16 2221618
+16 2221618
+16 2224349
+0 2224750
+16 2224991
+16 2225147
+16 2225391
+16 2225391
+0 2225815
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+16 2225996
+0 2227374
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+16 2227678
+0 2230818
+16 2237392
+16 2237392
+16 2237367
+0 2245420
+0 2245420
+0 2245420
+0 2245906
+16 2246581
+16 2247983
+0 2250986
+16 2252126
+0 2252203
+0 2253478
+0 2253733
+0 2255636
+16 2260289
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2261858
+0 2262383
+0 2262383
+0 2262383
+0 2262383
+0 2262383
+0 2262383
+0 2262383
+0 2262383
+0 2262383
+0 2262383
+0 2262383
+0 2262383
+0 2262383
+0 2262383
+0 2262383
+16 2264430
+16 2264939
+0 2267473
+0 2267581
+0 2267581
+16 2268160
+0 2269653
+0 2270391
+16 2271895
+0 2275269
+16 2281939
+16 2281939
+16 2286078
+16 2289870
+16 2289870
+0 2290388
+0 2291530
+0 2292654
+0 2292654
+0 2293799
+0 2303560
+0 2303815
+0 2313369
+0 2317257
+0 2320713
+0 2321413
+0 2324113
+16 2324508
+16 2324508
+16 2327776
+16 2331238
+16 2332118
+16 2332118
+16 2332191
+16 2332191
+0 2333301
+16 2333673
+16 2333673
+16 2333673
+0 2333715
+0 2333963
+0 2334508
+0 2334508
+0 2334556
+16 2335573
+0 2335537
+16 2336464
+16 2343021
+16 2343021
+16 2343021
+16 2345096
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+16 2349156
+0 2352634
+16 2352945
+16 2352945
+16 2352945
+16 2353039
+0 2354530
+0 2354530
+0 2354530
+0 2354530
+16 2355516
+0 2355736
+0 2355736
+0 2358418
+0 2359610
+0 2359756
+0 2360723
+16 2361120
+16 2361120
+16 2361120
+16 2361120
+16 2361120
+16 2361120
+16 2361120
+16 2361120
+16 2361120
+16 2361120
+16 2361120
+16 2364046
+16 2364432
+0 2364312
+0 2364440
+16 2365702
+0 2366325
+0 2367411
+0 2369182
+0 2370478
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+16 2378819
+0 2378827
+0 2379933
+16 2382541
+16 2382543
+16 2382543
+16 2382543
+16 2382543
+16 2382543
+16 2382543
+16 2382543
+16 2382543
+0 2382551
+0 2393329
+16 2394256
+16 2396411
+0 2399357
+16 2399745
+16 2401118
+0 2404481
+0 2404481
+16 2406336
+16 2406789
+16 2408742
+16 2413106
+16 2413095
+16 2413596
+16 2413695
+16 2413695
+0 2417345
+0 2417345
+0 2417345
+16 2419342
+16 2419342
+0 2419632
+16 2422747
+16 2424167
+0 2424042
+16 2424912
+0 2425883
+16 2427894
+16 2428843
+16 2429029
+16 2435989
+16 2443021
+16 2444063
+16 2444063
+16 2447560
+16 2451142
+0 2462259
+16 2462874
+16 2463077
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+16 2470531
+0 2475128
+16 2486805
+0 2489116
+0 2491406
+16 2498573
+0 2500923
+16 2501160
+16 2513137
+0 2513207
+0 2513207
+0 2515985
+0 2515985
+16 2518487
+16 2519070
+16 2519070
+16 2519070
+0 2519131
+16 2522162
+16 2524008
+0 2524016
+16 2524160
+0 2526627
+16 2528748
+0 2528680
+16 2528922
+16 2532004
+0 2532048
+0 2532048
+0 2532048
+0 2532048
+0 2532048
+16 2532298
+16 2532298
+0 2533071
+0 2533615
+16 2534843
+16 2534843
+16 2534843
+0 2534851
+0 2534851
+16 2535445
+0 2539656
+16 2540263
+16 2544389
+16 2544389
+16 2544389
+16 2544389
+16 2544389
+16 2545117
+16 2545117
+0 2548269
+16 2551054
+16 2551193
+0 2551197
+16 2551381
+16 2551586
+0 2552776
+16 2553963
+16 2553963
+16 2553963
+16 2553963
+16 2553963
+16 2553963
+16 2553963
+16 2553963
+16 2553963
+16 2553963
+16 2553963
+0 2558059
+0 2560106
+0 2588233
+0 2588796
+16 2589717
+0 2591285
+0 2591285
+16 2591876
+16 2592089
+0 2598507
+0 2599625
+16 2613260
+0 2613808
+0 2613808
+0 2613808
+0 2613808
+16 2614799
+16 2618211
+16 2619994
+0 2621862
+0 2624242
+16 2626945
+16 2628203
+16 2628203
+16 2629822
+16 2632768
+16 2632768
+16 2632784
+16 2632784
+16 2632784
+16 2632768
+16 2632768
+16 2632768
+16 2632768
+0 2634182
+0 2635235
+16 2635594
+0 2635603
+0 2635603
+16 2636255
+16 2636255
+0 2637555
+0 2637826
+0 2638050
+0 2642092
+16 2643603
+16 2643615
+0 2647468
+16 2667233
+16 2667317
+0 2667548
+16 2667852
+0 2678543
+16 2680246
+0 2684908
+0 2688713
+0 2689615
+16 2690110
+16 2697728
+0 2703258
+0 2709840
+0 2712664
+0 2715494
+0 2715494
+0 2715494
+0 2715494
+0 2715494
+0 2715494
+16 2718582
+16 2719278
+16 2725864
+16 2726509
+16 2732351
+16 2738509
+16 2738509
+0 2749888
+0 2750501
+16 2751983
+0 2755891
+0 2759064
+0 2762106
+16 2763222
+16 2764813
+0 2765329
+0 2765329
+16 2769579
+0 2774237
+0 2775199
+0 2775199
+0 2775199
+16 2776718
+16 2776718
+16 2776718
+16 2776718
+16 2776718
+16 2776718
+16 2776718
+16 2776718
+16 2776718
+16 2776796
+16 2776718
+0 2781973
+0 2782321
+0 2783167
+0 2783167
+0 2788779
+16 2789426
+16 2791592
+16 2792078
+16 2792078
+16 2794852
+16 2795375
+0 2798634
+0 2798904
+0 2798904
+16 2799445
+16 2801519
+16 2802407
+16 2802549
+16 2809104
+0 2809112
+0 2809112
+0 2809112
+0 2809112
+16 2811306
+16 2811306
+16 2811306
+16 2811306
+0 2816421
+0 2818007
+16 2818280
+16 2818280
+0 2819001
+16 2819212
+16 2819212
+16 2819212
+16 2819212
+16 2819212
+16 2819212
+16 2819212
+16 2819212
+16 2821456
+0 2826377
+16 2827595
+16 2828131
+0 2828136
+16 2829461
+16 2830062
+16 2830062
+0 2830071
+0 2830071
+0 2830071
+0 2830631
+0 2834733
+0 2834733
+0 2836082
+16 2840950
+0 2841630
+16 2842282
+16 2842956
+16 2842956
+16 2842956
+16 2842956
+16 2842956
+0 2842964
+0 2842964
+16 2848089
+16 2848113
+16 2850303
+0 2853229
+0 2853229
+0 2853525
+0 2853525
+0 2857108
+0 2857655
+16 2863797
+0 2879830
+0 2879830
+0 2879830
+0 2879830
+0 2892060
+0 2894649
+16 2896017
+0 2896824
+16 2902212
+16 2905236
+16 2905261
+16 2907645
+0 2907653
+0 2907653
+0 2915008
+16 2919440
+16 2919440
+16 2919440
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+0 2919449
+16 2923282
+16 2924272
+0 2925913
+16 2929206
+16 2929206
+16 2929206
+16 2942366
+16 2943399
+16 2947445
+16 2947463
+16 2949329
+16 2957319
+16 2961040
+16 2964195
+16 2964596
+16 2964596
+16 2964596
+16 2964596
+16 2964596
+16 2964596
+0 2964605
+0 2964605
+0 2964605
+0 2964605
+0 2964605
+16 2968548
+16 2971309
+0 2977079
+0 2977079
+16 2978968
+0 2981650
+0 2987658
+0 2993211
+0 2994989
+0 2998638
+16 3000692
+16 3003277
+0 3008251
+16 3009289
+16 3009290
+16 3014633
+0 3015313
+0 3016526
+0 3016526
+0 3019036
+16 3020543
+16 3024242
+0 3024250
+16 3025928
+0 3036279
+16 3038726
+16 3043209
+16 3043209
+16 3044831
+0 3044839
+16 3052003
+0 3056282
+16 3064394
+16 3064501
+16 3071321
+16 3071321
+16 3071321
+16 3076987
+16 3082181
+0 3082826
+0 3090753
+0 3097689
+0 3097930
+0 3097942
+0 3097942
+0 3097942
+16 3098165
+16 3098275
+16 3098275
+0 3098173
+0 3098173
+0 3098173
+16 3107053
+16 3107076
+16 3107076
+16 3107076
+16 3107780
+16 3107780
+16 3107780
+16 3107780
+16 3107780
+16 3107780
+16 3107780
+0 3107661
+0 3107661
+0 3107661
+0 3107661
+0 3107661
+0 3107661
+0 3107661
+0 3107661
+0 3107661
+0 3107661
+0 3107661
+0 3107661
+16 3107780
+0 3116763
+16 3119408
+16 3121239
+16 3125052
+16 3125716
+16 3125789
+0 3127302
+16 3147611
+0 3151322
+16 3156319
+16 3166934
+16 3200322
+0 3200889
+0 3201416
+16 3203966
+16 3205074
+16 3205650
+16 3205650
+16 3205650
+0 3206164
+0 3206164
+0 3206164
+16 3209472
+16 3209472
+16 3218373
+16 3218373
+16 3230082
+16 3252283
+16 3253553
+16 3258803
+0 3266061
+0 3268970
+0 3270034
+16 3272982
+16 3281734
+0 3285561
+0 3285561
+0 3285561
+0 3285561
+0 3286434
+0 3286677
+0 3291234
+16 3294212
+16 3310136
+0 3310131
+16 3314852
+16 3315187
+16 3326148
+16 3339933
+0 3343662
+0 3343662
+0 3343662
+0 3343662
+0 3345426
+0 3345426
+16 3360469
+16 3360469
+16 3360469
+0 3362630
+16 3366735
+16 3366735
+16 3366735
+16 3366735
+16 3366735
+16 3366735
+16 3366735
+16 3366735
+16 3366735
+16 3367962
+16 3387228
+16 3390786
+16 3390786
+16 3390786
+16 3392698
+0 3392951
+0 3392951
+0 3401796
+0 3402483
+16 3403026
+16 3403026
+16 3403764
+16 3408385
+16 3408385
+16 3408385
+0 3414428
+16 3414998
+16 3427008
+16 3428279
+16 3430318
+16 3430318
+16 3430318
+16 3430318
+16 3439910
+0 3445272
+0 3446251
+0 3446471
+16 3455630
+16 3456680
+16 3457539
+16 3474153
+16 3481255
+0 3482634
+0 3482634
+0 3482634
+0 3482634
+0 3482634
+0 3486027
+0 3492096
+0 3492096
+16 3493217
+16 3493217
+0 3494985
+0 3497943
+0 3500534
+16 3500920
+16 3505748
+16 3508254
+0 3513978
+0 3513978
+0 3516243
+0 3516383
+0 3521046
+16 3522565
+16 3524471
+16 3525824
+16 3527242
+16 3534646
+0 3534654
+0 3540745
+0 3548251
+0 3548251
+0 3548251
+16 3569581
+0 3577007
+0 3598349
+0 3628570
+0 3629251
+16 3629654
+16 3630799
+16 3631269
+16 3636688
+16 3639720
+0 3642838
+0 3642838
+16 3643871
+16 3644641
+0 3647139
+0 3659745
+0 3661156
+16 3663156
+0 3680681
+0 3680681
+0 3681519
+16 3685060
+16 3694803
+16 3694803
+16 3694803
+16 3694803
+16 3694803
+16 3695230
+0 3695237
+0 3706384
+0 3734548
+16 3745583
+0 3745757
+16 3749277
+16 3752231
+0 3756458
+0 3761565
+0 3761565
+0 3761565
+0 3761699
+0 3761699
+0 3761786
+0 3761786
+0 3761786
+0 3763688
+16 3776434
+16 3776434
+16 3776434
+16 3776434
+16 3776434
+16 3778584
+0 3785822
+16 3785868
+16 3794340
+0 3800256
+0 3800537
+16 3819187
+16 3826889
+16 3827627
+0 3830340
+16 3833113
+0 3834485
+0 3842721
+16 3847317
+16 3856976
+16 3856976
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859545
+0 3859559
+0 3871794
+0 3872965
+16 3874713
+16 3875034
+16 3884164
+0 3897952
+0 3897952
+0 3902320
+0 3902320
+16 3903921
+0 3906837
+16 3912832
+0 3913810
+16 3924347
+16 3924347
+16 3924347
+16 3924347
+16 3924347
+16 3924347
+16 3924347
+16 3924347
+16 3924347
+0 3924316
+0 3924316
+0 3924316
+0 3924878
+0 3932131
+16 3932866
+16 3932866
+16 3933798
+16 3933798
+16 3933798
+16 3933798
+16 3933798
+16 3933798
+16 3933798
+16 3933798
+16 3933798
+16 3933798
+16 3933798
+16 3933798
+16 3933798
+16 3933798
+0 3942565
+0 3947484
+0 3948286
+0 3948501
+16 3951402
+16 3981065
+16 3981065
+16 3981856
+16 3997164
+16 3997164
+0 3997172
+0 4010858
+0 4030366
+0 4030366
+0 4030366
+16 4048969
+0 4064190
+0 4065028
+0 4065028
+0 4071647
+0 4078684
+0 4078684
+16 4079141
+16 4080493
+0 4097407
+16 4106961
+0 4111551
+0 4118945
+0 4144618
+16 4148918
+16 4170392
+16 4170392
+16 4170392
+16 4176262
+16 4181240
+0 4196103
+16 4197036
+0 4197786
+0 4197786
+16 4200647
+0 4208537
+16 4223594
+16 4240174
+16 4265216
+0 4269389
+0 4271501
+0 4278384
+0 4278384
+16 4278620
+16 4280733
+16 4285376
+16 4289745
+0 4310696
+0 4324725
+0 4355381
+16 4361420
+16 4361420
+16 4361420
+16 4361420
+0 4361428
+0 4361428
+0 4361428
+0 4385808
+0 4385808
+16 4391768
+16 4409592
+16 4410594
+0 4412766
+0 4416387
+0 4416387
+0 4421730
+0 4425130
+0 4437756
+0 4437756
+0 4438293
+0 4438293
+16 4469009
+16 4503913
+0 4504336
+0 4505826
+16 4534045
+16 4536334
+0 4545225
+16 4577530
+16 4587532
+0 4592008
+16 4597616
+16 4606050
+16 4606471
+0 4629826
+0 4629826
+0 4629826
+16 4639089
diff --git a/main.nf b/main.nf
index f15bc2c070a03220aa99b97b70e7e0d33e20eec9..7362ada6e2513c1e948c7d4cee30612c0b8186d2 100755
--- a/main.nf
+++ b/main.nf
@@ -29,11 +29,18 @@ file_name = file("${in_path}/${fastq_file}").baseName
ref_name = file("${ref_path}/${ref_file}").baseName
primer = file(primer_fasta)
ref = file("${ref_path}/${ref_file}")
+if(ref_file =~ /Coli|coli|COLI/){
+ tss = "${ref_path}/${tss_file}"
+ ess = "${ref_path}/${ess_file}"
+ cds = "${ref_path}/${cds_file}"
+}
sum_of_2_nb = fivep_seq_nb.toInteger()+added_nb.toInteger()
if(system_exec == 'slurm'){
k2db = file("${kraken_db}")
}
+
+
// end from the nextflow.config file
// from parameters
@@ -48,6 +55,11 @@ modules = params.modules // remove the dot -> can be used in bash scripts
fastq_ch_test = file("${in_path}/${fastq_file}") // to test if exist below
primer_ch_test = file("${primer_fasta}") // to test if exist below
ref_ch_test = file("${ref_path}/${ref_file}") // to test if exist below
+if(ref_file =~ /Coli|coli|COLI/){
+ tss_ch_test = file("${ref_path}/${tss_file}")
+ ess_ch_test = file("${ref_path}/${ess_file}")
+ cds_ch_test = file("${ref_path}/${cds_file}")
+}
if(system_exec == 'slurm'){
k2db_ch_test = file("${kraken_db}") // to test if exist below
}
@@ -65,7 +77,7 @@ grep_pattern_ch = Channel.from("LEADING_0", "LEADING_16", "LAGGING_0", "LAGGING_
//////// Checks
-if(system_exec == 'local' || system_exec == 'slurm'){
+if(system_exec == 'local' || system_exec == 'slurm' || system_exec == 'slurm_local'){
def file_exists1 = fastq_ch_test.exists()
if( ! file_exists1){
error "\n\n========\n\nERROR IN NEXTFLOW EXECUTION\n\nINVALID in_path AND fastq_file PARAMETERS IN nextflow.config FILE: ${in_path}/${fastq_file}\n\nIF POINTING TO A DISTANT SERVER, CHECK THAT IT IS MOUNTED\n\n========\n\n"
@@ -78,14 +90,28 @@ if(system_exec == 'local' || system_exec == 'slurm'){
if( ! file_exists3){
error "\n\n========\n\nERROR IN NEXTFLOW EXECUTION\n\nINVALID ref_path: ${ref_path}\nOR ref_file: ${ref_file}\nPARAMETER IN nextflow.config FILE\n\nIF POINTING TO A DISTANT SERVER, CHECK THAT IT IS MOUNTED\n\n========\n\n"
}
- if(system_exec == 'slurm'){
- def file_exists4 = k2db_ch_test.exists()
+ if(ref_file =~ /Coli|coli|COLI/){
+ def file_exists4 = tss_ch_test.exists()
if( ! file_exists4){
+ error "\n\n========\n\nERROR IN NEXTFLOW EXECUTION\n\nINVALID ref_path: ${ref_path}\nOR tss_file: ${tss_file}\nPARAMETER IN nextflow.config FILE\n\nIF POINTING TO A DISTANT SERVER, CHECK THAT IT IS MOUNTED\n\n========\n\n"
+ }
+ def file_exists5 = ess_ch_test.exists()
+ if( ! file_exists5){
+ error "\n\n========\n\nERROR IN NEXTFLOW EXECUTION\n\nINVALID ref_path: ${ref_path}\nOR ess_file: ${ess_file}\nPARAMETER IN nextflow.config FILE\n\nIF POINTING TO A DISTANT SERVER, CHECK THAT IT IS MOUNTED\n\n========\n\n"
+ }
+ def file_exists6 = cds_ch_test.exists()
+ if( ! file_exists6){
+ error "\n\n========\n\nERROR IN NEXTFLOW EXECUTION\n\nINVALID ref_path: ${ref_path}\nOR cds_file: ${cds_file}\nPARAMETER IN nextflow.config FILE\n\nIF POINTING TO A DISTANT SERVER, CHECK THAT IT IS MOUNTED\n\n========\n\n"
+ }
+ }
+ if(system_exec == 'slurm'){
+ def file_exists7 = k2db_ch_test.exists()
+ if( ! file_exists7){
error "\n\n========\n\nERROR IN NEXTFLOW EXECUTION\n\nINVALID kraken_db ${kraken_db}\nPARAMETER IN nextflow.config FILE\n\nIF POINTING TO A DISTANT SERVER, CHECK THAT IT IS MOUNTED\n\n========\n\n"
}
}
}else{
- error "\n\n========\n\nERROR IN NEXTFLOW EXECUTION\n\nINVALID system_exec PARAMETER IN nextflow.config FILE: ${system_exec}\n\n========\n\n"
+ error "\n\n========\n\nERROR IN NEXTFLOW EXECUTION\n\nINVALID system_exec PARAMETER IN nextflow.config FILE: ${system_exec}\nTHE ONLY POSSIBLE VALUES ARE local, slurm OR slurm_local\n\n========\n\n"
}
//////// end Checks
@@ -239,7 +265,7 @@ process fivep_filtering { // section 8.6 to 8.13 of the labbook 20200520. Instea
echo "
\\`\\`\\`{r, echo = FALSE}
tempo <- read.table('./files/${file_name}_5pAttc_1-${sum_of_2_nb}.stat', header = TRUE, row.names = 1, colClasses = 'character', sep = '\\t', check.names = FALSE) ;
-kableExtra::kable_styling(knitr::kable(head(tempo), row.names = TRUE, digits = 2, caption = NULL, format='html'), c('striped', 'bordered', 'responsive', 'condensed'), font_size=10, full_width = FALSE, position = 'left')
+kableExtra::kable_styling(knitr::kable(tempo, row.names = TRUE, digits = 2, caption = NULL, format='html'), c('striped', 'bordered', 'responsive', 'condensed'), font_size=10, full_width = FALSE, position = 'left')
\\`\\`\\`
\n\n
" >> report.rmd
@@ -441,7 +467,7 @@ process Q20 { // section 24.2 of the labbook 20200707
file bam from bowtie2_ch1
output:
- file "${file_name}_q20.bam" into q20_ch1, q20_ch2, q20_ch3
+ file "${file_name}_q20.bam" into q20_ch1, q20_ch2, q20_ch3, q20_ch4
file "read_nb_before" into bow_read_nb_ch
file "read_nb_after" into q20_read_nb_ch
file "q20_report.txt"
@@ -547,7 +573,7 @@ process coverage { // section 24.5 of the labbook 20200707. Warning: USING 5' AN
// file ref from ref_ch3 // not required because bedtools genomecov-g ${ref} not required when inputs are bam files
output:
- file "*_mini.cov" into cov_ch // warning: several files
+ file "*_mini.cov" into cov_ch // warning: 3 files
// file "*.cov" // coverage per base if ever required but long process
file "cov_report.txt" into cov_report_ch
@@ -573,7 +599,7 @@ process plot_coverage { // section 24.6 of the labbook 20200707
input:
val file_name
- file cov from cov_ch // warning: several files
+ file cov from cov_ch // warning: 3 files
file read_nb from bow_read_nb_ch.concat(q20_read_nb_ch, dup_read_nb_ch)
val ori_coord
val ter_coord
@@ -593,97 +619,146 @@ process plot_coverage { // section 24.6 of the labbook 20200707
}
-plot_cov_report_ch.collectFile(name: "plot_cov_report.txt").subscribe{it -> it.copyTo("${out_path}/reports")} // concatenate all the cov_report.txt files in channel cov_report_ch into a single file published into
-
+plot_cov_report_ch.collectFile(name: "plot_cov_report.txt").subscribe{it -> it.copyTo("${out_path}/reports")} // concatenate all the cov_report.txt files in channel cov_report_ch into a single file published into ${out_path}/reports
+// From here, treatment of the bam with and without duplicates
process insertion { // section 24.7 of the labbook 20200707
label 'samtools' // see the withLabel: bash in the nextflow config file
- publishDir "${out_path}/reports", mode: 'copy', pattern: "insertion_report.txt", overwrite: false
+ // publishDir "${out_path}/reports", mode: 'copy', pattern: "*_insertion_report.txt", overwrite: false
publishDir "${out_path}/files", mode: 'copy', pattern: "${file_name}.pos", overwrite: false //
cache 'true'
input:
val file_name
- file bam from dup_ch2
+ file bam from dup_ch2.concat(q20_ch4) // warning: 2 files (no duplication and duplications) -> parallelization
output:
- file "${file_name}.pos" into orient_ch1, orient_ch2
- file "insertion_report.txt"
- file "report.rmd" into log_ch15
+ file "${bam.baseName}.pos" into orient_ch1 // warning: 2 files (no duplication and duplications)
+ file "insertion_report.txt" into insertion_report_ch // warning: several files
+ file "report.rmd" optional true into log_ch15 // single file
+ // optional true: report.rmd send into a channel only the process that has generated a report.rmd. Of note, if("${bam}" == "${file_name}_q20_nodup.bam"){file "report.rmd" into log_ch15} does not work
script:
"""
- echo -e "\\n\\n<br /><br />\\n\\n### Insertion positions\\n\\n" > report.rmd
- echo -e "\\n\\nOne of the step is to correct insertion site read extremity for the reverse reads. It consist in the redefinition of POS according to FLAG in the bam file. See the [insertion_report.txt](./reports/insertion_report.txt) file in the reports folders for details\\n\\n" >> report.rmd
- # extraction of bam column 2, 4 and 10, i.e., FALG, POS and SEQ
+ if [[ ${bam} == "${file_name}_q20_nodup.bam" ]] ; then
+ echo -e "\\n\\n<br /><br />\\n\\n### Insertion positions\\n\\n" > report.rmd
+ echo -e "\\n\\nOne of the step is to correct insertion site read extremity for the reverse reads. It consist in the redefinition of POS according to FLAG in the bam file. See the [insertion_report.txt](./reports/insertion_report.txt) file in the reports folders for details\\n\\n" >> report.rmd
+ fi
+
+ # extraction of bam column 2, 4 and 10, i.e., FLAG, POS and SEQ
samtools view ${bam} | awk 'BEGIN{FS="\\t" ; OFS="" ; ORS=""}{print ">"\$2"\\t"\$4"\\n"\$10"\\n" }' > tempo
# Of note, samtools fasta \$DIR/\$SAMPLE_NAME > \${OUTPUT}.fasta # convert bam into fasta
- echo -e "\\n\\nExtraction of the FLAG (containing the read orientation) the POS and the SEQ of the bams\\nHeader is the 1) sens of insersion (0 or 16) and 2) insertion site position\\n\\n" >> insertion_report.txt
+ echo -e "\\n\\n######## ${bam} file\n\nExtraction of the FLAG (containing the read orientation) the POS and the SEQ of the bams\\nHeader is the 1) sens of insersion (0 or 16) and 2) insertion site position\\n\\n" >> insertion_report.txt
cat tempo | head -60 | tail -20 >> insertion_report.txt
# redefinition of POS according to FLAG
awk 'BEGIN{FS="\t" ; OFS="" ; ORS=""}{lineKind=(NR-1)%2}lineKind==0{orient=(\$1~">16") ; if(orient){var1 = \$1 ; var2 = \$2}else{print \$0"\\n"}}lineKind==1{if(orient){var3 = length(\$0) ; var4 = var2 + var3 - 1 ; print var1"\\t"var4"\\n"\$0"\\n"}else{print \$0"\\n"}}' tempo > ${file_name}_reorient.fasta
echo -e "\\n\\nFinal fasta file\\n\\n" >> insertion_report.txt
cat ${file_name}_reorient.fasta | head -60 | tail -20 >> insertion_report.txt
- awk '{lineKind=(NR-1)%2}lineKind==0{gsub(/>/, "", \$1) ; print \$0}' ${file_name}_reorient.fasta > ${file_name}.pos
+ awk '{lineKind=(NR-1)%2}lineKind==0{gsub(/>/, "", \$1) ; print \$0}' ${file_name}_reorient.fasta > ${bam.baseName}.pos
echo -e "\\n\\nFinal pos file\\n\\n" >> insertion_report.txt
- cat ${file_name}.pos | head -60 | tail -20 >> insertion_report.txt
+ cat ${bam.baseName}.pos | head -60 | tail -20 >> insertion_report.txt
read_nb_before=\$(samtools view ${bam} | wc -l | cut -f1 -d' ') # -h to add the header. Thus do not put here
- read_nb_after=\$(wc -l ${file_name}.pos | cut -f1 -d' ')
- echo -e "\\n\\nNumber of reads used for insertion computation: \$(printf "%'d" \${read_nb_before})\\n" >> report.rmd
- echo -e "\\n\\nNumber of insertions: \$(printf "%'d" \${read_nb_after})\\n" >> report.rmd
- echo -e "Ratio: " >> report.rmd
- echo -e \$(printf "%.2f\n" \$(echo \$" \$read_nb_after / \$read_nb_before " | bc -l)) >> report.rmd # the number in '%.2f\\n' is the number of decimals
- echo -e "\\n\\n" >> report.rmd
+ read_nb_after=\$(wc -l ${bam.baseName}.pos | cut -f1 -d' ')
+ if [[ ${bam} == "${file_name}_q20_nodup.bam" ]] ; then
+ echo -e "\\n\\nNumber of reads used for insertion computation: \$(printf "%'d" \${read_nb_before})\\n" >> report.rmd
+ echo -e "\\n\\nNumber of insertions: \$(printf "%'d" \${read_nb_after})\\n" >> report.rmd
+ echo -e "Ratio: " >> report.rmd
+ echo -e \$(printf "%.2f\n" \$(echo \$" \$read_nb_after / \$read_nb_before " | bc -l)) >> report.rmd # the number in '%.2f\\n' is the number of decimals
+ echo -e "\\n\\n" >> report.rmd
+ fi
"""
}
+insertion_report_ch.collectFile(name: "insertion_report.txt").subscribe{it -> it.copyTo("${out_path}/reports")} // concatenate all the cov_report.txt files in channel cov_report_ch into a single file published into ${out_path}/reports
+
+
+process final_insertion_files { // 44.1 of the labbook 20201210. Also select the nb_max_insertion_sites most frequent sites in the duplicated file
+ label 'r_ext' // see the withLabel: bash in the nextflow config file
+ publishDir "${out_path}/files", mode: 'copy', pattern: "{*.pos,*.freq}", overwrite: false
+ cache 'true'
+
+ input:
+ file pos from orient_ch1 // warning: 2 files
+ val ori_coord
+ val ter_coord
+ val cute_path
+ val nb_max_insertion_sites
+
+ output:
+ file "${pos.baseName}.pos" into pos_ch // warning: 2 files
+ file "${pos.baseName}_annot.pos" into pos_annot_ch // warning: 2 files
+ file "${pos.baseName}_annot.freq" into freq_ch // warning: 2 files
+ file "final_insertion_files_report.txt" into final_insertion_files_report_ch // warning: several files
+
+ script:
+ """
+ final_insertion_files.R "${pos}" "${ori_coord}" "${ter_coord}" "${nb_max_insertion_sites}" "${pos.baseName}" "${cute_path}" "final_insertion_files_report.txt"
+ """
+}
+
+pos_annot_ch.branch{
+ nodup: it.getName() =~ /nodup/
+ dup: true
+}.set{tempo_ch2}
+tempo_ch2.nodup.into{pos_nodup_ch1 ; pos_nodup_ch2}
+tempo_ch2.dup.set{pos_dup_ch1}
+
+freq_ch.branch{
+ nodup: it.getName() =~ /nodup/
+ dup: true
+}.set{tempo_ch2}
+// tempo_ch2.nodup.set{freq_nodup_ch1} // warning: 1 file now
+tempo_ch2.dup.set{freq_dup_ch1} // warning: 1 file now
+
+final_insertion_files_report_ch.collectFile(name: "final_insertion_files_report.txt").subscribe{it -> it.copyTo("${out_path}/reports")}
process seq_around_insertion { // sections 24.9.1 of the labbook 20200707
label 'r_ext' // see the withLabel: bash in the nextflow config file
publishDir "${out_path}/files", mode: 'copy', pattern: "{*.bed}", overwrite: false
- publishDir "${out_path}/reports", mode: 'copy', pattern: "seq_around_insertion_report.txt", overwrite: false
+ // publishDir "${out_path}/reports", mode: 'copy', pattern: "seq_around_insertion_report.txt", overwrite: false
cache 'true'
input:
val file_name
- file pos from orient_ch2
+ file pos from pos_ch // warning: 2 files
val ori_coord
val ter_coord
val insertion_dist
output:
- file "${file_name}_around_insertion.bed" into around_insertion_bed_ch1
- file "seq_around_insertion_report.txt"
+ file "${pos.baseName}_around_insertion.bed" into around_insertion_bed_ch // warning: 2 files
+ file "seq_around_insertion_report.txt" into seq_around_insertion_report_ch // warning: 2 files
script:
"""
- seq_around_insertion.R "${pos}" "${ori_coord}" "${ter_coord}" "${insertion_dist}" "${file_name}" "${cute_path}" "seq_around_insertion_report.txt"
+ seq_around_insertion.R "${pos}" "${ori_coord}" "${ter_coord}" "${insertion_dist}" "${pos.baseName}" "${cute_path}" "seq_around_insertion_report.txt"
"""
// single quotes required because of the !
}
-
+seq_around_insertion_report_ch.collectFile(name: "seq_around_insertion_report").subscribe{it -> it.copyTo("${out_path}/reports")} // concatenate all the cov_report.txt files in channel cov_report_ch into a single file published into ${out_path}/reports
process extract_seq { // section 24.9.2 of the labbook 20200707
// Warning: the fasta is always taken on the watson (top) strand. The -s option need a special bed file. See https://bedtools.readthedocs.io/en/latest/content/tools/getfasta.html
label 'bedtools'
publishDir "${out_path}/files", mode: 'copy', pattern: "${bed.baseName}.fasta", overwrite: false
- publishDir "${out_path}/reports", mode: 'copy', pattern: "extract_seq_report.txt"
+ // publishDir "${out_path}/reports", mode: 'copy', pattern: "extract_seq_report.txt"
cache 'true'
input:
- file bed from around_insertion_bed_ch1
+ file bed from around_insertion_bed_ch // warning: 2 files
file ref
output:
- file "${bed.baseName}.fasta" into extract_seq_ch
- file "extract_seq_report.txt"
+ file "${bed.baseName}.fasta" into extract_seq_ch // warning: 8 files
+ file "extract_seq_report.txt" into extract_seq_report_ch // warning: 2 files
script:
"""
+ echo -e "\n\n######## ${bed} file\n\n" > extract_seq_report.txt
# make a bed file from the reference genome
echo ">ref" > tempo.ref.fasta
awk '{lineKind=(NR-1)%2}lineKind==1{print \$0}' ${ref} >> tempo.ref.fasta |& tee extract_seq_report.txt
@@ -693,24 +768,36 @@ process extract_seq { // section 24.9.2 of the labbook 20200707
"""
}
+// splitting of the base_freq_stat_ch channel
+extract_seq_ch.branch{
+ nodup: it.getName() =~ /nodup/
+ dup: true
+}.set{tempo_ch1}
+tempo_ch1.nodup.set{extract_seq_nodup_ch1} // warning: 4 files
+tempo_ch1.dup.set{extract_seq_dup_ch1} // warning: 4 files
+ // the 8 files in channel base_freq_stat_ch are splitted into two sub channel nodup and dup, according to nodup regex present in the name of the 8 files. See https://www.nextflow.io/docs/latest/operator.html?highlight=branch
+// end splitting of the base_freq_stat_ch channel
+
+extract_seq_report_ch.collectFile(name: "extract_seq_report.txt").subscribe{it -> it.copyTo("${out_path}/reports")} // concatenate all the cov_report.txt files in channel cov_report_ch into a single file published into ${out_path}/reports
+
process base_freq { // section 24.9.2 of the labbook 20200707
// parallelization, i.e., computed for each forward, reverse, leadding or lagging seq from the fasta file
label 'bash'
publishDir "${out_path}/files", mode: 'copy', pattern: "{*.seq,*.stat}", overwrite: false
- publishDir "${out_path}/reports", mode: 'copy', pattern: "base_freq_report.txt"
+ // publishDir "${out_path}/reports", mode: 'copy', pattern: "base_freq_report.txt"
cache 'true'
input:
val file_name
- val grep_pattern from grep_pattern_ch
- file fasta from extract_seq_ch.first()
+ tuple val(grep_pattern), file(fasta) from grep_pattern_ch.combine(extract_seq_nodup_ch1.concat(extract_seq_dup_ch1)) // warning: 4 values and 2 files respectively -> 8 parall expected
+ //file fasta from extract_seq_ch // warning: several files
file ref
output:
- file "${file_name}_${grep_pattern}.seq" into base_freq_seq_ch
- file "${file_name}_${grep_pattern}.stat" into base_freq_stat_ch1, base_freq_stat_ch2, base_freq_stat_ch3
- file "base_freq_report.txt"
+ file "${fasta.baseName}_${grep_pattern}.seq"
+ file "${fasta.baseName}_${grep_pattern}.stat" into base_freq_stat_ch // warning: 8 files
+ file "base_freq_report.txt" into base_freq_report_ch
script:
"""
@@ -719,7 +806,7 @@ process base_freq { // section 24.9.2 of the labbook 20200707
{lineKind=(NR-1)%2}
lineKind==0{toGet=(\$0 ~ ">" var1) ; next}
lineKind==1{if(toGet){print \$0}}
- ' ${fasta} > ${file_name}_${grep_pattern}.seq |& tee base_freq_report.txt
+ ' ${fasta} > ${fasta.baseName}_${grep_pattern}.seq |& tee base_freq_report.txt
# ATGC contingency
gawk '{
L=length(\$0);
@@ -741,17 +828,29 @@ process base_freq { // section 24.9.2 of the labbook 20200707
}
printf("\\n");
}
- }' ${file_name}_${grep_pattern}.seq > ${file_name}_${grep_pattern}.stat |& tee base_freq_report.txt
+ }' ${fasta.baseName}_${grep_pattern}.seq > ${fasta.baseName}_${grep_pattern}.stat |& tee base_freq_report.txt
"""
}
+// splitting of the base_freq_stat_ch channel
+base_freq_stat_ch.branch{
+ nodup: it.getName() =~ /nodup/
+ dup: true
+}.set{tempo_ch1}
+tempo_ch1.nodup.into{base_freq_stat_nodup_ch1 ; base_freq_stat_nodup_ch2 ; base_freq_stat_nodup_ch3} // warning: 4 files
+tempo_ch1.dup.set{base_freq_stat_dup_ch1} // warning: 4 files
+ // the 8 files in channel base_freq_stat_ch are splitted into two sub channel nodup and dup, according to nodup regex present in the name of the 8 files. See https://www.nextflow.io/docs/latest/operator.html?highlight=branch
+// end splitting of the base_freq_stat_ch channel
+
+base_freq_report_ch.collectFile(name: "base_freq_report.txt").subscribe{it -> it.copyTo("${out_path}/reports")} // concatenate all the cov_report.txt files in channel cov_report_ch into a single file published into ${out_path}/reports
+
process report2 {
label 'bash'
cache 'false'
input:
- val files from base_freq_stat_ch1.collect() // warning: 4 files
+ val files from base_freq_stat_nodup_ch1.collect() // warning: 4 files. Collect() prevent the parallelization
val insertion_dist
output:
@@ -763,7 +862,7 @@ process report2 {
\\n\\n<br /><br />\\n\\n### Logos\\n\\n
\\n\\nIn each sequence of length \$((${insertion_dist} * 2)) <br />position \$((${insertion_dist} + 1)) corresponds to the first nucleotide of the reference genome part of the read
" > report.rmd
- count=0
+ count=0 # always goes to 4 because 4 figures, one for each forward/reverse leading/lagging
for i in \$(echo ${files.baseName} | sed 's/^\\[//' | sed 's/\\]\$//' | sed 's/,//g') ; do
echo -e '
\\n\\n<br /><br />\\n\\n</center>\\n\\n
@@ -772,6 +871,11 @@ process report2 {
' >> report.rmd
count=\$((count + 1))
done
+ echo -e '
+\\n\\n<br /><br />\\n\\n</center>\\n\\n
+{width=600}
+\\n\\n</center>\\n\\n
+ ' >> report.rmd
"""
}
@@ -783,7 +887,7 @@ process logo { // 24.9.3 of the labbook 20200707
cache 'true'
input:
- file freq from base_freq_stat_ch2
+ file freq from base_freq_stat_nodup_ch2 // warning: 4 files
val insertion_dist
val cute_path
@@ -799,7 +903,6 @@ process logo { // 24.9.3 of the labbook 20200707
}
process global_logo { // 24.9.3 of the labbook 20200707
- // also fusion the 4 lead / lag / 0 / 16 insertions files
label 'r_ext' // see the withLabel: bash in the nextflow config file
publishDir "${out_path}/figures", mode: 'copy', pattern: "{*.png}", overwrite: false
publishDir "${out_path}/reports", mode: 'copy', pattern: "{global_logo_report.txt}", overwrite: false //
@@ -807,59 +910,48 @@ process global_logo { // 24.9.3 of the labbook 20200707
input:
val file_name
- file freq from base_freq_stat_ch3.collect() // warning: several files
+ file freq from base_freq_stat_nodup_ch3.collect().concat(base_freq_stat_dup_ch1.collect()) // warning: 4 files. Collect() prevent the parallelization and concat() associate -> 2 parallelization expected
val insertion_dist
val cute_path
output:
- file "global_logo_${file_name}.png" into fig_ch5
+ file "*.png" into fig_ch5 // 2 files
file "global_logo_report.txt"
- file "report.rmd" into log_ch17
script:
"""
global_logo.R "${freq}" ${file_name} ${insertion_dist} "${cute_path}" "global_logo_report.txt"
- echo -e '
-\\n\\n<br /><br />\\n\\n</center>\\n\\n
-{width=600}
-\\n\\n</center>\\n\\n
- ' >> report.rmd
"""
// single quotes required because of the !
}
-process final_insertion_files { // 44.1 of the labbook 20201210
- label 'r_ext' // see the withLabel: bash in the nextflow config file
- publishDir "${out_path}/files", mode: 'copy', pattern: "{*.pos,*.freq}", overwrite: false
- publishDir "${out_path}/reports", mode: 'copy', pattern: "final_insertion_files_report.txt", overwrite: false
- cache 'true'
+
+process report3 {
+ label 'bash'
+ cache 'false'
input:
- val file_name
- file pos from orient_ch1
- val ori_coord
- val ter_coord
- val cute_path
+ file pos from pos_nodup_ch1
output:
- file "${file_name}_annot.pos" into pos_ch1
- file "${file_name}_annot_insertion.freq"
- file "final_insertion_files_report.txt"
- file "report.rmd" into log_ch18
+ file "report.rmd" into log_ch17
script:
"""
+
echo -e "\\n\\n<br /><br />\\n\\n### Final insertion site files\\n\\n" > report.rmd
- echo -e "\\n\\nSee the [${file_name}_annot.pos](./files/${file_name}_annot.pos) and [${file_name}_annot.freq](./files/${file_name}_annot.freq) files\\n\\n" >> report.rmd
- final_insertion_files.R "${pos}" "${ori_coord}" "${ter_coord}" "${file_name}" "${cute_path}" "final_insertion_files_report.txt"
- pos_nb=\$(wc -l ${file_name}_annot.pos | cut -f1 -d' ')
+ echo -e "\\n\\nSee the [${pos.baseName}_annot.pos](./files/${pos.baseName}_annot.pos) and [${pos.baseName}_annot.freq](./files/${pos.baseName}_annot.freq) files\\n\\n" >> report.rmd
+ pos_nb=\$(wc -l ${pos.baseName}_annot.pos | cut -f1 -d' ')
echo -e "\\n\\nNumber of different positions: \$(printf "%'d" \${pos_nb})\\n" >> report.rmd
"""
}
+
+
process motif { // 43 of the labbook 20201209
+ // for random insertions
label 'r_ext' // see the withLabel: bash in the nextflow config file
publishDir "${out_path}/files", mode: 'copy', pattern: "motif_sites.pos", overwrite: false
publishDir "${out_path}/reports", mode: 'copy', pattern: "motif_report.txt", overwrite: false
@@ -878,7 +970,7 @@ process motif { // 43 of the labbook 20201209
file "motif_sites.pos" into motif_ch
file "motif_report.txt"
file "{head,table}*.txt" into motif_table_ch // warning: several files
- file "report.rmd" into log_ch19
+ file "report.rmd" into log_ch18
script:
"""
@@ -908,7 +1000,7 @@ process random_insertion { // sections 44 of the labbook 20201210
input:
val file_name
- file pos from pos_ch1
+ file pos from pos_nodup_ch2 // a single file now here
file motif_pos from motif_ch
val ori_coord
val ter_coord
@@ -921,7 +1013,7 @@ process random_insertion { // sections 44 of the labbook 20201210
file "obs_rd_insertions.pos" into obs_rd_insertions_pos_ch1
file "obs_rd_insertions.freq" into obs_rd_insertions_freq_ch1
file "random_insertion_report.txt"
- file "report.rmd" into log_ch20
+ file "report.rmd" into log_ch19
script:
"""
@@ -954,7 +1046,7 @@ process random_insertion { // sections 44 of the labbook 20201210
}
-process plot_insertion { // sections 24.7.2 and 45 of the labbook 20200520
+process plot_insertion { // sections 24.7.2 and 45 of the labbook 20200520, for TSS, section 47 20201211, for CDS section 48 20201211
label 'r_ext' // see the withLabel: bash in the nextflow config file
publishDir "${out_path}/figures", mode: 'copy', pattern: "{*.png}", overwrite: false // https://docs.oracle.com/javase/tutorial/essential/io/fileOps.html#glob
publishDir "${out_path}/reports", mode: 'copy', pattern: "{plot_insertion_report.txt}", overwrite: false //
@@ -964,10 +1056,15 @@ process plot_insertion { // sections 24.7.2 and 45 of the labbook 20200520
val file_name
file pos from obs_rd_insertions_pos_ch1
file freq from obs_rd_insertions_freq_ch1
+ val tss
+ val ess
+ val cds
val ori_coord
val ter_coord
val xlab
val genome_size
+ val prop_coding_genome
+ val prop_ess_coding_genome
val window_size
val step
val cute_path
@@ -975,12 +1072,12 @@ process plot_insertion { // sections 24.7.2 and 45 of the labbook 20200520
output:
file "*.png" into fig_ch7 // warning: several files
file "plot_insertion_report.txt"
- file "report.rmd" into log_ch21
+ file "report.rmd" into log_ch20
script:
"""
echo -e "\\n\\n<br /><br />\\n\\n### Insertion plots\\n\\n" > report.rmd
- plot_insertion.R "${pos}" "${freq}" "${ori_coord}" "${ter_coord}" "${xlab}" "${genome_size}" "${window_size}" "${step}" "${file_name}" "${cute_path}" "plot_insertion_report.txt"
+ plot_insertion.R "${pos}" "${freq}" "$tss" "$ess" "$cds" "${ori_coord}" "${ter_coord}" "${xlab}" "${genome_size}" "${prop_coding_genome}" "${prop_ess_coding_genome}" "${window_size}" "${step}" "${file_name}" "${cute_path}" "plot_insertion_report.txt"
echo -e "\\n\\n#### Histograms\\n\\n" >> report.rmd
echo -e '
\\n\\n</center>\\n\\n
@@ -1016,12 +1113,95 @@ process plot_insertion { // sections 24.7.2 and 45 of the labbook 20200520
' >> report.rmd
count=\$((count + 1))
done
+ if [[ ${tss} != "NULL" ]] ; then
+ echo -e "\\n\\n<br /><br />\\n\\n### Transcription start site (TSS) plots\\n\\n" >> report.rmd
+ echo -e "\\n\\nSee the CL Labbook section 48.3 to to get the theoretical proportion of the codant/non codant essential/non essential genome\\n" >> report.rmd
+ echo -e '
+\\n\\n</center>\\n\\n<br /><br />\\n\\n
+{width=400}
+\\n\\n</center>\\n\\n<br /><br />\\n\\n
+{width=600}
+\\n\\n</center>\\n\\n<br /><br />\\n\\n
+{width=600}
+\\n\\n</center>\\n\\n<br /><br />\\n\\n
+{width=600}
+\\n\\n</center>\\n\\n<br /><br />\\n\\n
+{width=600}
+\\n\\n</center>\\n\\n<br /><br />\\n\\n
+ \\n\\n<br /><br />\\n\\n### Coding sequences (CDS) plots\\n\\n
+\\n\\n</center>\\n\\n<br /><br />\\n\\n
+{width=600}
+\\n\\n</center>\\n\\n<br /><br />\\n\\n
+{width=600}
+\\n\\n</center>\\n\\n<br /><br />\\n\\n
+{width=600}
+\\n\\n</center>\\n\\n<br /><br />\\n\\n
+{width=600}
+\\n\\n</center>\\n\\n<br /><br />\\n\\n
+{width=600}
+\\n\\n</center>\\n\\n<br /><br />\\n\\n
+{width=600}
+\\n\\n</center>\\n\\n<br /><br />\\n\\n
+ ' >> report.rmd
+ fi
"""
// single quotes required because of the !
}
+process dup_insertion_and_logo { // 52-53 of labbbok 20211115 and section 27 of labbook 20200907
+ // warning: global logo png file already made above in the global_logo process
+ // also fusion the 4 lead / lag / 0 / 16 insertions files
+ label 'r_ext' // see the withLabel: bash in the nextflow config file
+ publishDir "${out_path}/figures", mode: 'copy', pattern: "{*.png}", overwrite: false
+ publishDir "${out_path}/reports", mode: 'copy', pattern: "{dup_insertion_and_logo_report.txt}", overwrite: false //
+ cache 'true'
+
+ input:
+ val file_name
+ val tss
+ val window_size
+ file freq from freq_dup_ch1
+ file pos from pos_dup_ch1 // just for the line number computation
+ val ori_coord
+ val ter_coord
+ val genome_size
+ val xlab
+ val insertion_dist
+ val nb_max_insertion_sites
+ val cute_path
+
+ output:
+ file "*.png" into fig_ch8 // single file
+ file "dup_insertion_and_logo_report.txt"
+ file "report.rmd" into log_ch21
+
+ script:
+ """
+ echo -e "\\n\\n<br /><br />\\n\\n### Analysis with duplicates\\n\\n" > report.rmd
+ dup_insertion_and_logo.R "${freq}" "${ori_coord}" "${ter_coord}" "${genome_size}" "${xlab}" "${file_name}" "dup" "${nb_max_insertion_sites}" "${insertion_dist}" "${cute_path}" "dup_insertion_and_logo_report.txt" # logo
+ echo -e "\\n\\nSee the [${pos.baseName}_annot.pos](./files/${pos.baseName}_annot.pos) and [${freq.baseName}_annot.freq](./files/${freq.baseName}_annot.freq) files\\n\\n" >> report.rmd
+ pos_nb=\$(wc -l ${pos.baseName}_annot.pos | cut -f1 -d' ')
+ echo -e "\\n\\nNumber of different positions: \$(printf "%'d" \${pos_nb})\\n" >> report.rmd
+
+ TEMPO=(${window_size})
+ FIG_NB_BEFORE=\$((\$(echo \${#TEMPO[@]}) * 2)) # nb of elements in the window size * nb of figure plotted
+ if [[ ${tss} != "NULL" ]] ; then
+ FIG_NB=\$(( 34 + \$FIG_NB_BEFORE + 1 + 1)) # 2 * because two figures
+ else
+ FIG_NB=\$(( 24 + \$FIG_NB_BEFORE + 1 + 1))
+ fi
+ echo -e '
+\\n\\n<br /><br />\\n\\n</center>\\n\\n
+{width=600}
+\\n\\n</center>\\n\\n
+{width=600}
+\\n\\n</center>\\n\\n
+ ' >> report.rmd
+ """
+ // single quotes required because of the !
+}
@@ -1107,7 +1287,6 @@ process print_report { // section 8.8 of the labbook 20200520
cache 'false'
input:
- val file_name
val cute_path
file report from log_ch0.concat(log_ch1,log_ch2, log_ch3, log_ch4, log_ch5, log_ch6, log_ch7, log_ch8, log_ch9, log_ch10, log_ch11, log_ch12, log_ch13, log_ch14, log_ch15, log_ch16, log_ch17, log_ch18, log_ch19, log_ch20, log_ch21, log_ch22, log_ch23).collectFile(name: 'report.rmd', sort: false)
tuple val ("stat_tempo_name"), file ("stat_tempo") from stat_fastq_5p_filter_ch2
@@ -1116,9 +1295,10 @@ process print_report { // section 8.8 of the labbook 20200520
file png2 from fig_ch2.collect() // warning: several files
file png3 from fig_ch3.collect() // warning: several files
file png4 from fig_ch4.collect() // warning: several files
- file png5 from fig_ch5
+ file png5 from fig_ch5.collect() // warning: several files
file png6 from fig_ch6.collect() // warning: several files
file png7 from fig_ch7.collect() // warning: several files
+ file png8 from fig_ch8
file html from multiqc_ch
output:
@@ -1134,9 +1314,9 @@ process print_report { // section 8.8 of the labbook 20200520
mkdir reports
cat ${stat_tempo} > ./files/${stat_tempo_name} # this is to get hard files, not symlinks
cp ${table} ./files/ # this is to get hard files, not symlinks
- cp ${png1} ${png2} ${png3} ${png4} ${png5} ${png6} ${png7} ./figures/ # Warning several files
+ cp ${png1} ${png2} ${png3} ${png4} ${png5} ${png6} ${png7} ${png8} ./figures/ # Warning several files
cp ${png1} ./reports/nf_dag.png # trick to delude the knitting during the print report
- cp ${html} ./reports/ # this is to get hard files, not symlinks
+ cp ${html} ./reports/ # this is to get hard files from html from multiqc_ch, not symlinks
print_report.R "${cute_path}" "report_file.rmd" "print_report.txt"
"""
}
diff --git a/nextflow.config b/nextflow.config
index 1354d0397f9f90bd27ca1086919b398ceb67ee9d..f7267957bc96f0c7ac5641a81a029b9d8ff5ed2c 100755
--- a/nextflow.config
+++ b/nextflow.config
@@ -33,7 +33,6 @@ env {
primer_fasta="$baseDir/dataset/20200520_adapters_TruSeq_B2699_14985_CL.fasta" // list of primers used for the library and used by Alien trimmer to trim the raw reads
//primer_fasta="/mnt/share/14985_loot/results/20200520_res_CL14985_newtrim_align/20200520_adapters_TruSeq_B2699_14985_CL.fasta"
//// end path and files
-
//// alientrimmer
alientrimmer_l_param=30 // L parameter of alienTrimmer
//// end alientrimmer
@@ -52,17 +51,24 @@ env {
ref_path="$baseDir/dataset/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/" // path of the reference genome
//ref_path="/pasteur/zeus/projets/p01/BioIT/gmillot/reference_genomes/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/" // path of the reference genome
ref_file="Ecoli-K12-MG1655_ORI_CENTERED.fasta" // name of the the reference genome fasta file
+ tss_file="TSS_compatible_essential.txt" // Ecoli list of Transcription starting sites. Same as Z:\reference_genomes\coli_K12_MG1655_NC_000913.3\tss.txt but genome centered on the OriC. Write "NULL" if ref_file is not Ecoli
+ ess_file="Essential_genes_MG1655.tsv" // Ecoli list of essential genes same as Z:\reference_genomes\coli_K12_MG1655_NC_000913.3. Just used here to know which are essential genes. Coordinates not used. Thus, no need to center according to Ori. Wrtie "NULL" if ref_file is not Ecoli
+ cds_file="cds_ORI_CENTERED.txt" // Ecoli list of cds same as Z:\reference_genomes\coli_K12_MG1655_NC_000913.3_ORI_CENTERED. Write "NULL" if ref_file is not Ecoli
ori_coord="2320711 2320942" // [2320711, 2320942] // Ecoli centered coordinates
ter_coord="4627368 4627400" //[4627368, 4627400] // Ecoli centered coordinates
color_coverage="5" // three integers for the color of the three coverage plots[1, 2, 5]
xlab="Ecoli Genome (bp)" // name of the reference genome for graphics
genome_size="4641652" // in bp
+ prop_coding_genome = "0.88" // proportion of genome covered by CDS. See 20200922 section 30.5.1
+ prop_ess_coding_genome = "0.08" // proportion of the genome covered by essential CDS. See 20200922 section 30.5.1
insertion_dist="20" // nb of bases upstream and downstream of insertions sites on the ref genome to define a consensus sequence
motif_fw='G[AT]T' // regex indicating the sequence motif to use for random insertions. "NULL" means completely random. Must be 5' -> 3'
motif_rev='A[AT]C' // the antiparallel of motif_fw
- window_size = "50000" // written as R vector, width of the sliding window on the reference genome in bp
- step=100 // steps of the sliding window on the reference genome in bp
- cute_path="https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v11.0.0/cute_little_R_functions.R" // single character string indicating the file (and absolute pathway) of the required cute_little_R_functions toolbox. With ethernet connection available, this can also be used: "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/raw/v5.1.0/cute_little_R_functions.R" or local "C:\\Users\\Gael\\Documents\\Git_projects\\cute_little_R_functions\\cute_little_R_functions.R"
+ window_size = "50000" // width of the sliding window on the reference genome in bp. A single space between the number between double quotes. Example: "50000 200000"
+ step = 100 // steps of the sliding window on the reference genome in bp
+ nb_max_insertion_sites = "6" // nb of higest sites used for insertion in data without duplicates removal
+
+ cute_path="https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v11.2.0/cute_little_R_functions.R" // single character string indicating the file (and absolute pathway) of the required cute_little_R_functions toolbox. With ethernet connection available, this can also be used: "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/raw/v5.1.0/cute_little_R_functions.R" or local "C:\\Users\\Gael\\Documents\\Git_projects\\cute_little_R_functions\\cute_little_R_functions.R"
}
//////// end variables that will be used only in the main.nf
@@ -221,7 +227,7 @@ process {
}
withLabel: r_ext {
- container='gmillot/r_v4.0.5_extended_v2.0:gitlab_v6.4'
+ container='gmillot/r_v4.1.2_extended_v2.0:gitlab_v8.2'
cpus=1 // only used when name = "local" in the executor part above
memory='64G' // only used when name = "local" in the executor part above
}