Data_Types.rst 10.1 KB
Newer Older
.. sectnum::
   :start: 4
Bertrand  NÉRON's avatar
Bertrand NÉRON committed
.. _Data_Types:

Data Types



Assume that we execute the following assignment statements: ::

   width = 17
   height = 12.0
   delimiter ='.'

For each of the following expressions, write the value of the expression and the type (of the value of
the expression) and explain. 

 #. width / 2
 #. width / 2.0
 #. height / 3
 #. 1 + 2 * 5
Use the Python interpreter to check your answers. ::

   >>> width = 17
   >>> height = 12.0
   >>> delimiter ='.'
   >>> width / 2
   >>> # both operands are integer so python done an euclidian division and threw out the remainder
   >>> width / 2.0
   >>> height / 3
   >>> # one of the operand is a float (2.0 or height) then python pyhton perform a float division but keep in mind that float numbers are approximation.
   >>> # if you need precision you need to use Decimal. But operations on Decimal are slow and float offer quite enough precision
   >>> # so we use decimal only if wee need great precision
   >>> # Euclidian division
   >>> 2 // 3
   >>> # float division
   >>> 2 / 3



Write a function which take a radius as input and return the volume of a sphere:

The volume of a sphere with radius r is 4/3 πr\ :sup:`3`. 

What is the volume of a sphere with radius 5?

**Hint**: π is in math module, so to access it you need to import the math module 
Place the ``import`` statement at the top fo your file.
after that, you can use ``math.pi`` everywhere in the file like this::
      >>> import math
      >>> #do what you need to do
      >>> math.pi #use math.pi

.. literalinclude:: _static/code/
   :language: python


   python -i 
   >>> vol_of_sphere(5)
:download:` <_static/code/>` .      


Draw what happen in memory when the following statements are executed: ::

   i = 12
   i += 2
.. figure:: _static/figs/augmented_assignment_int.png
   :width: 400px
   :alt: set
   :figclass: align-center

   >>> i = 12
   >>> id(i)
   >>> i += 2
   >>> id(i)

and ::

   s = 'gaa'
   s = s + 'ttc' 
.. figure:: _static/figs/augmented_assignment_string.png
   :width: 400px
   :alt: set
   :figclass: align-center   


   >>> s = 'gaa'
   >>> id(s)
   >>> s = s+ 'ttc'
   >>> s
   >>> id(s)
when an augmented assignment operator is used on an immutable object is that 
#. the operation is performed, 
#. and an object holding the result is created  
#. and then the target object reference is re-bound to refer to the
   result object rather than the object it referred to before. 

So, in the preceding case when the statement ``i += 2`` is encountered, Python computes 1 + 2 , stores
the result in a new int object, and then rebinds ``i`` to refer to this new int . And
if the original object a was referring to has no more object references referring
to it, it will be scheduled for garbage collection. The same mechanism is done with all immutable object included strings.

how to obtain a new sequence which is the 10 times repetition of the this motif : "AGGTCGACCAGATTANTCCG"::
   >>> s10 = s * 10


create a representation in fasta format of following sequence :

.. note::
   A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. 
   The description line is distinguished from the sequence data by a greater-than (">") symbol in the first column. 
   The word following the ">" symbol is the identifier of the sequence, and the rest of the line is the description (optional). 
   There should be no space between the ">" and the first letter of the identifier. 
   The sequence ends if another line starting with a ">" appears; this indicates the start of another sequence. 


Bertrand  NÉRON's avatar
Bertrand NÉRON committed
   name = "sp|P60568|IL2_HUMAN"

   comment = "Interleukin-2 OS=Homo sapiens GN=IL2 PE=1 SV=1"


Blaise Li's avatar
Blaise Li committed
   >>> s = ">" + name + " " + comment + '\n' + sequence
Blaise Li's avatar
Blaise Li committed
   >>> s = ">{name} {comment}\n{sequence}".format(id=id, comment=comment, sequence=sequence)
Bertrand  NÉRON's avatar
Bertrand NÉRON committed
Blaise Li's avatar
Blaise Li committed
   >>> s = f">{name} {comment}\n{sequence}"


For the following exercise use the python file :download:`sv40 in fasta <_static/code/>` which is a python file with the sequence of sv40 in fasta format
already embeded, and use python -i to work.

how long is the sv40 in bp? 
Hint : the fasta header is 61bp long.


write a function ``fasta_to_one_line`` that return a sequence as a string
without header or any non sequence characters


|   *function fasta_to_one_line(seq)*
|      *header_end_at <- find the first return line character*
|      *raw_seq <- remove header from sequence*
|      *raw_seq <- remove non sequence chars*
|      *return raw_seq*

.. literalinclude:: _static/code/
   :language: python

:download:` <_static/code/>` . 


   >>> import sv40_file
   >>> import fasta_to_one_line
   >>> sv40_seq = fasta_to_one_line(sv40_file.sv40_fasta) 
   >>> print len(sv40_seq)

Is that the following enzymes: 

* BamHI (ggatcc), 
* EcorI (gaattc), 
* HindIII (aagctt), 
* SmaI (cccggg) 

have recogition sites in sv40 (just answer by True or False)? ::

   >>> "ggatcc".upper() in sv40_sequence
   >>> "gaattc".upper() in sv40_sequence
   >>> "aagctt".upper() in sv40_sequence
   >>> "cccggg".upper() in sv40_sequence

for the enzymes which have a recognition site can you give their positions? ::

   >>> sv40_sequence = sv40_sequence.lower()
   >>> sv40_sequence.find("ggatcc")
   >>> # remind the string are numbered from 0
   >>> 2532 + 1 = 2533 
   >>> # the recognition motif of BamHI start at 2533
   >>> sv40_sequence.find("gaattc")
   >>> # EcorI -> 1782
   >>> sv40_sequence.find("aagctt")
   >>> # HindIII -> 1046
is there only one site in sv40 per enzyme? 

The ``find`` method give the index of the first occurrence or -1 if the substring is not found.
So we can not determine the occurrences of a site only with the find method.
We can know how many sites are present with the ``count`` method.
We will see how to determine the site of all occurrences when we learn looping and conditions.


We want to perform a PCR on sv40, can you give the length and the sequence of the amplicon?

Write a function which have 3 parameters ``sequence``, ``primer_1`` and ``primer_2``

* *We consider only the cases where primer_1 and primer_2 are present in sequence* 
Bertrand  NÉRON's avatar
Bertrand NÉRON committed
* *to simplify the exercise, the 2 primers can be read directly on the sv40 sequence.*

test you algorithm with the following primers 

Bertrand  NÉRON's avatar
Bertrand NÉRON committed

Write the pseudocode before to implement it.

| *function amplicon_len(sequence primer_1, primer_2)*
|      *pos_1 <- find position of primer_1 in sequence*
|      *pos_2 <- find position of primer_2 in sequence*
|      *amplicon length <- pos_2 + length(primer_2) - pos_1*
|      *return amplicon length* 

.. literalinclude:: _static/code/
   :language: python


   >>> import sv40 
   >>> import fasta_to_one_line
   >>> sequence = fasta_to_one_line(sv40)
   >>> print amplicon_len(sequence, first_primer, second_primer )
:download:` <_static/code/>` . 



reverse the following sequence "TACCTTCTGAGGCGGAAAGA" (don't compute the complement): ::

   >>> l = list(s) 
   # take care reverse() reverse a list in place (the method do a side effect and return None ) 
Bertrand  NÉRON's avatar
Bertrand NÉRON committed
   # so if you don't have a object reference on the list you cannot get the reversed list!
   >>> l.reverse()
   >>> print l
   >>> ''.join(l)
   >>> rev_s  = reversed(s)
 The most efficient way to reverse a string or a list is the way using the slice. 


| The il2_human contains 4 cysteins (C) in positions 9, 78, 125, 145. 
| We want to generate the sequence of a mutatnt were the cysteins 78 and 125 are replaced by serins (S)
| Write the pseudocode, before to propose an implementation:

We have to take care of the string numbered vs sequence numbered:

| C in seq -> in string
|     9 -> 8
|    78 -> 77
|   125 -> 124
|   145 -> 144

| *generate 3 slices from the il2_human*
| *head <- from the begining and cut between the first cytein and the second* 
| *body <- include  the 2nd and 3rd cystein*
| *tail <- cut after the 3rd cystein until the end* 
| *replace body cystein by serin* 
| *make new sequence with head body_mutate tail*
il2_human = 

   head = il2_human[:77]
   body = il2_human[77:125]
   tail = il2_human[126:]
   body_mutate = body.replace('C', 'S')
   il2_mutate = head + body_mutate + tail


Write a function 

Bertrand  NÉRON's avatar
Bertrand NÉRON committed
* which take a sequence as parameter
* compute the GC%
* and return it
* display the results readable for human as a micro report like this:
  'the sv40 is 5243 bp length and have 40.80% gc' 
use sv40 sequence to test your function.

.. literalinclude:: _static/code/
   :language: python


   >>> import sv40 
   >>> import fasta_to_one_line
   >>> import gc_percent
   >>> sequence = fasta_to_one_line(sv40)
   >>> gc_pc = gc_percent(sequence)
   >>> report = "the sv40 is {0} bp length and have {1:.2%} gc".format(len(sequence), gc_pc)
   >>> print report
   'the sv40 is 5243 bp length and have 40.80% gc'
:download:` <_static/code/>` .