Commit 4f476d4e authored by Bertrand  NÉRON's avatar Bertrand NÉRON
Browse files

fix typos

parent e793fb48
......@@ -49,7 +49,7 @@ Exercise
With mutable object like ``list`` when we mutate the object the state of the object is modified.
But the reference to the object is still unchanged.
So in this exemple we have two ways to access to the list [1,2] if we modify the state of the list itself.
So in this example we have two ways to access to the list [1,2] if we modify the state of the list itself.
but not the references to this object, then the 2 variables x and y still reference the list containing
[1,2,3,4].
......@@ -314,7 +314,7 @@ pseudo code 2
say O(n2) and O(n6). Of course, we would prefer an algorithm requiring 1/2 · n2 steps to an algorithm requiring 1000 · n2 steps.
When we write that the running time of an algorithm is O(n2), we technically mean that it does not grow faster than a function with a
leading term of c · n2, for some constant c. Formally, a function f(n) is Big-O of function g(n), or O(g(n)), when f(n) c · g(n) for some
leading term of c · n2, for some constant c. Formally, a function f(n) is Big-O of function g(n), or O(g(n)), when f(n) <= c · g(n) for some
constant c and sufficiently large n.
For more on Big-O notation, see A `http://rob-bell.net/2009/06/a-beginners-guide-to-big-o-notation/Beginner's <Guide to Big-O Notation>`_.
......
......@@ -270,12 +270,12 @@ We want to perform a PCR on sv40, can you give the length and the sequence of th
Write a function which have 3 parameters ``sequence``, ``primer_1`` and ``primer_2``
* *We consider only the cases where primer_1 and primer_2 are present in sequence*
* *to simplify the exercise, the 2 primers can be read directly in the sv40 sequence.*
* *to simplify the exercise, the 2 primers can be read directly on the sv40 sequence.*
test you algorithm with the following primers
| primer_1 : 5' CGGGACTATGGTTGCTGACT 3'
| primre_2 : 5' TCTTTCCGCCTCAGAAGGTA 3'
| primer_2 : 5' TCTTTCCGCCTCAGAAGGTA 3'
Write the pseudocode before to implement it.
......@@ -312,7 +312,7 @@ reverse the following sequence "TACCTTCTGAGGCGGAAAGA" (don't compute the complem
>>> s = "TACCTTCTGAGGCGGAAAGA"
>>> l = list(s)
# take care reverse() reverse a list in place (the method do a side effect and return None )
# so if you don't have a obect reference on the list you cannot get the reversed list!
# so if you don't have a object reference on the list you cannot get the reversed list!
>>> l.reverse()
>>> print l
>>> ''.join(l)
......@@ -361,7 +361,7 @@ Exercise
Write a function
* which take a sequence as paramter
* which take a sequence as parameter
* compute the GC%
* and return it
* display the results readable for human as a micro report like this:
......
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment