Minor formatting.

source/Control_Flow_Statements.rst

@@ -20,11 +20,11 @@ The Fibonacci sequence are the numbers in the following integer sequence:
 
 By definition, the first two numbers in the Fibonacci sequence are 0 and 1, 
 and each subsequent number is the sum of the previous two.
-The fibonacci suite can be defined as following:
+The Fibonacci suite can be defined as following:
 
-|    F\ :sub:`0` = 0, F\ :sub:`1` = 1. 
+|    F\ :sub:`0` = 0, F\ :sub:`1` = 1.
 |    
-|    F\ :sub:`n` = F\ :sub:`n-1` + F\ :sub:`n-2` 
+|    F\ :sub:`n` = F\ :sub:`n-1` + F\ :sub:`n-2`
 
 Write a function which take an integer ``n`` as parameter
 and returns a list containing the ``n`` first number of the Fibonacci sequence. 
@@ -35,7 +35,7 @@ and returns a list containing the ``n`` first number of the Fibonacci sequence.
    :language: python
    
 :download:`fibonacci_iteration.py <_static/code/fibonacci_iteration.py>` .
-We will see another way more elegant to implement the fibonacci suite in :ref:`Advanced Programming Techniques` section.
+We will see another way more elegant to implement the Fibonacci suite in :ref:`Advanced Programming Techniques` section.
 
 
 
@@ -66,7 +66,7 @@ implementation
 
    def my_max(seq):
       """
-      return the maximum value in a sequence 
+      return the maximum value in a sequence
       work only with integer or float
       """
       highest = seq[0]
@@ -75,8 +75,8 @@ implementation
              highest = i
       return highest
 
-   l = [1,2,3,4,58,9]
-   print my_max(l)
+   l = [1, 2, 3, 4, 58, 9]
+   print(my_max(l))
    58
 
 
@@ -85,37 +85,37 @@ implementation
 Exercise
 --------
 
-| We want to establish a restriction map of a sequence. 
-| But we will do this step by step.
-| and reuse the enzymes used in previous chapter: 
+| We want to establish a restriction map of a sequence.
+| But we will do this step by step,
+| and reuse the enzymes used in previous chapter:
 
-* create a function that take a sequence and an enzyme as parameter and return 
-   the position of first binding sites.
-   (write the pseudocode)
+* Create a function that takes a sequence and an enzyme as parameters, and returns
+   the position of the first binding site.
+   (Write the pseudocode.)
+
+**pseudocode**
 
-**pseudocode** 
-   
 | *function one_enz_binding_site(dna, enzyme)*
 |     *if enzyme binding site is substring of dna*
-|          *return of first position of substring in dna* 
- 
+|          *return of first position of substring in dna*
+
 **implementation**
- 
+
 .. literalinclude:: _static/code/restriction.py
    :linenos:
    :lines: 1-14
    :language: python
-   
-* improve the previous function to return all positions of binding sites
+
+* Improve the previous function to return all positions of binding sites.
 
 **pseudocode of first algorithm**
 
 | *function one_enz_binding_sites(dna, enzyme)*
 |     *positions <- empty*
 |     *if enzyme binding site is substring of dna*
-|          *add the position of the first substring in dna in positions* 
+|          *add the position of the first substring in dna in positions*
 |     *positions <- find binding_sites in rest of dna sequence*
-|     *return positions*  
+|     *return positions*
 
 **implementation**
 
@@ -140,21 +140,21 @@ Exercise
    :linenos:
    :lines: 34-55
    :language: python
-   
-   
-search all positions of Ecor1 binding sites in dna_1
+
+
+* Search all positions of Ecor1 binding sites in ``dna_1``.
 
 ::
 
    ecor1 = ("EcoRI", "Ecoli restriction enzime I", "gaattc", 1, "sticky")
-   
+
    dna_1 = """tcgcgcaacgtcgcctacatctcaagattcagcgccgagatccccgggggttgagcgatccccgtcagttggcgtgaattcag
    cagcagcgcaccccgggcgtagaattccagttgcagataatagctgatttagttaacttggatcacagaagcttccaga
    ccaccgtatggatcccaacgcactgttacggatccaattcgtacgtttggggtgatttgattcccgctgcctgccagg"""
-   
-   
-* generalize the binding sites function to take a list of enzymes and return a list of tuple (enzyme name, position) 
-   
+
+
+* Generalize the binding sites function to take a list of enzymes and return a list of tuples (enzyme name, position).
+
 **pseudocode**
 
 | *function binding_sites(dna, set of enzymes)*
@@ -167,14 +167,15 @@ search all positions of Ecor1 binding sites in dna_1
 
 **implementation**
 
-in bonus we can try to sort the list in the order of the position of the binding sites like this:
-[('Sau3aI', 38), ('SmaI', 42), ('Sau3aI', 56), ('EcoRI', 75), ...
+In bonus, we can try to sort the list in the order of the position of the binding sites like this::
+
+    [('Sau3aI', 38), ('SmaI', 42), ('Sau3aI', 56), ('EcoRI', 75), ...
 
 .. literalinclude:: _static/code/restriction.py
    :linenos:
    :lines: 55-
    :language: python
-   
+
 ::
 
    ecor1 = ("EcoRI", "Ecoli restriction enzime I", "gaattc", 1, "sticky")
@@ -187,7 +188,7 @@ in bonus we can try to sort the list in the order of the position of the binding
    hae3 = ("HaeIII", "Haemophilus aegyptius", "ggcc", 2 , "blunt")
    sma1 = ("SmaI", "Serratia marcescens", "cccggg", 3 , "blunt")
 
-and the 2 dna fragments: ::
+and the two dna fragments: ::
 
    dna_1 = """tcgcgcaacgtcgcctacatctcaagattcagcgccgagatccccgggggttgagcgatccccgtcagttggcgtgaattcag
    cagcagcgcaccccgggcgtagaattccagttgcagataatagctgatttagttaacttggatcacagaagcttccaga
@@ -205,7 +206,7 @@ and the 2 dna fragments: ::
    binding_sites(dna_2, enzymes)
    [('EcoRI', 11), ('NotI', 33), ('HaeIII', 35), ('EcoRI', 98), ('SmaI', 106), 
    ('EcoRI', 179), ('HaeIII', 193), ('EcoRV', 225)]
-   
+
 :download:`restriction.py <_static/code/restriction.py>` .
 
 Bonus
@@ -219,23 +220,22 @@ If you prefer the enzyme implemented as namedtuple:
 Exercise
 --------
 
-From a list return a new list without any duplicate, but keeping the order of items. 
-For example: ::
+Write a ``uniqify_with_order`` function that takes a list and returns a new list without any duplicate, but keeping the order of items.
+For instance::
 
-   >>> l = [5,2,3,2,2,3,5,1]
+   >>> l = [5, 2, 3, 2, 2, 3, 5, 1]
    >>> uniqify_with_order(l)
-   >>> [5,2,3,1]  
+   [5, 2, 3, 1]
 
-solution ::
+Solution ::
 
    >>> uniq = []
    >>> for item in l:
    >>>   if item not in uniq:
    >>>      uniq.append(item)
 
-solution ::
+Solution ::
 
    >>> uniq_items = set()
    >>> l_uniq = [x for x in l if x not in uniq_items and not uniq_items.add(x)]
-     
- 
+