Commit 83a55278 authored by Bertrand  NÉRON's avatar Bertrand NÉRON
Browse files

rename sv40 to avoid misunderstanding between module and variable sv40

parent 597466f5
sv40 = """>gi|965480|gb|J02400.1|SV4CG Simian virus 40 complete genome
sv40_fasta = """>gi|965480|gb|J02400.1|SV4CG Simian virus 40 complete genome
GCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGCCATGGGGCGGAGAATGGGCGGAACTGGGCGGAG
TTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCAT
ACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTTGCTGACTAATTGAGATGCATGCTTTGC
......
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment