From 8f8e84a40797b28e1f90f43d87f8757112c7d5fd Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Bertrand=20N=C3=A9ron?= <bneron@pasteur.fr> Date: Tue, 12 Aug 2014 23:55:33 +0200 Subject: [PATCH] add exercise on seraching restriction enzymes in dna --- source/Control_Flow_Statements.rst | 126 +++++++++++++++++++++++++++++ 1 file changed, 126 insertions(+) diff --git a/source/Control_Flow_Statements.rst b/source/Control_Flow_Statements.rst index 804cfea..aad5bbc 100644 --- a/source/Control_Flow_Statements.rst +++ b/source/Control_Flow_Statements.rst @@ -4,3 +4,129 @@ *********************** Control Flow Statements *********************** + + +Exercise +-------- + +Calculates the 10 first number of the Fibonacci sequence . +The Fibonacci sequence are the numbers in the following integer sequence: + + 0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, ... + +By definition, the first two numbers in the Fibonacci sequence are 0 and 1, +and each subsequent number is the sum of the previous two. +The fibonacci suite can be defined as following: + +| F\ :sub:`0` = 0, F\ :sub:`1` = 1. +| +| F\ :sub:`n` = F\ :sub:`n-1` + F\ :sub:`n-2` + + +:: + + #This program calculates the Fibonacci sequence + a = 0 + b = 1 + count = 0 + max_count = 10 + while count < max_count: + count = count + 1 + print a, + new_number = a + b + #set new a and b for the next iteration + a = b + b = new_number + +We will see another way more elegant to implement the fibonacci suite in next chapter. + + +Exercise +-------- + +let the following enzymes collection: :: + + import collections + RestrictEnzyme = collections.namedtuple("RestrictEnzyme", "name comment sequence cut end") + + ecor1 = RestrictEnzyme("EcoRI", "Ecoli restriction enzime I", "gaattc", 1, "sticky") + ecor5 = RestrictEnzyme("EcoRV", "Ecoli restriction enzime V", "gatatc", 3, "blunt") + bamh1 = RestrictEnzyme("BamHI", "type II restriction endonuclease from Bacillus amyloliquefaciens ", "ggatcc", 1, "sticky") + hind3 = RestrictEnzyme("HindIII", "type II site-specific nuclease from Haemophilus influenzae", "aagctt", 1 , "sticky") + taq1 = RestrictEnzyme("TaqI", "Thermus aquaticus", "tcga", 1 , "sticky") + not1 = RestrictEnzyme("NotI", "Nocardia otitidis", "gcggccgc", 2 , "sticky") + sau3a1 = RestrictEnzyme("Sau3aI", "Staphylococcus aureus", "gatc", 0 , "sticky") + hae3 = RestrictEnzyme("HaeIII", "Haemophilus aegyptius", "ggcc", 2 , "blunt") + sma1 = RestrictEnzyme("SmaI", "Serratia marcescens", "cccggg", 3 , "blunt") + +and the 2 dna fragments: :: + + dna_1 = """tcgcgcaacgtcgcctacatctcaagattcagcgccgagatccccgggggttgagcgatccccgtcagttggcgtgaattcag + cagcagcgcaccccgggcgtagaattccagttgcagataatagctgatttagttaacttggatcacagaagcttccaga + ccaccgtatggatcccaacgcactgttacggatccaattcgtacgtttggggtgatttgattcccgctgcctgccagg""" + + dna_2 = """gagcatgagcggaattctgcatagcgcaagaatgcggccgcttagagcgatgctgccctaaactctatgcagcgggcgtgagg + attcagtggcttcagaattcctcccgggagaagctgaatagtgaaacgattgaggtgttgtggtgaaccgagtaag + agcagcttaaatcggagagaattccatttactggccagggtaagagttttggtaaatatatagtgatatctggcttg""" + +| which enzymes cut the dna_1 get the name of the enzymes and all their positions of binding site? +| do the same for dna_2 +| give the name of the enzymes that cut the dna_1 but not the dna_2? + +:: + + dna_1 = dna_1.replace('\n', '') + dans_2 = dna_2.replace('\n', '') + +We looking for the first a cutting site, then we search again starting at the first nucleotid after the begining of the match +until the end of the the dna, for this we use the start parameter of the find function, and so on. +As we don't know how many loop we need to scan the dna until the end we use a ``while`` loop testing for the presence of a cutting site.:: + + enzymes = [ecor1, ecor5, bamh1, hind3, taq1, not1, sau3a1, hae3, sma1] + digest_1 = [] + for enz in enzymes: + pos = dna_1.find(enz.sequence) + while pos != -1: + digest_1.append(enz) + pos = dna_1.find(enz.sequence, pos + 1) + + digest_2 = [] + for enz in enzymes: + pos = dna_2.find(enz.sequence) + while pos != -1: + digest_2.append(enz) + pos = dna_2.find(enz.sequence, pos + 1) + + cut_dna_1 = set(digest_1) + cut_dna_2 = set(digest_2) + cut_dna_1_not_dna_2 = cut_dna_1 - cut_dna_2 + +but we want also the position, for instance to compute the fragments of dna. :: + + digest_1 = [] + for enz in enzymes: + pos = dna_1.find(enz.sequence) + while pos != -1: + digest_1.append((enz, pos)) + pos = dna_1.find(enz.sequence, pos + 1) + + #if we want to sort the list in function of their positions in the sequence + from operator import itemgetter + digest_1.sort(key=itemgetter(1)) + print [(e.name, pos) for e, pos in digest_1] + + digest_2 = [] + for enz in enzymes: + pos = dna_2.find(enz.sequence) + while pos != -1: + digest_2.append((enz, pos)) + pos = dna_2.find(enz.sequence, pos + 1) + + print "list of all enzymes cutting dna 1 and theirs position in dna1 :", [(e.name, pos) for e, pos in digest_1] + print "list of all enzymes cutting dna 2 and theirs position in dna2 :", [(e.name, pos) for e, pos in digest_2] + + cut_dna_1 = set([e.name for e, pos in digest_1]) + cut_dna_2 = set([e.name for e, pos in digest_2]) + + cut_dna_1_not_dna_2 = cut_dna_1 - cut_dna_2 + \ No newline at end of file -- GitLab