From 925831e40bd67e747a3aee7320d83c92e5b6fdc1 Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Bertrand=20N=C3=A9ron?= <bneron@pasteur.fr>
Date: Sat, 30 Aug 2014 03:16:29 +0200
Subject: [PATCH] move exercises from Collection_Data_types to
 Control_flow_statements

and propose new implementation of fibonacci
---
 source/Collection_Data_Types.rst           | 116 +----------------
 source/Control_Flow_Statements.rst         | 144 +++++++++++++++++++++
 source/_static/code/fibonacci_iteration.py |  13 ++
 3 files changed, 158 insertions(+), 115 deletions(-)
 create mode 100644 source/_static/code/fibonacci_iteration.py

diff --git a/source/Collection_Data_Types.rst b/source/Collection_Data_Types.rst
index 7a4e7b7..906c2ed 100644
--- a/source/Collection_Data_Types.rst
+++ b/source/Collection_Data_Types.rst
@@ -165,123 +165,9 @@ solution ::
 
    >>> list(set(l))
 
-               
-
-Exercise
---------
-
-let the following enzymes collection: ::
- 
-   import collections
-   RestrictEnzyme = collections.namedtuple("RestrictEnzyme", "name comment sequence cut end")
-
-   ecor1 = RestrictEnzyme("EcoRI", "Ecoli restriction enzime I", "gaattc", 1, "sticky")
-   ecor5 = RestrictEnzyme("EcoRV", "Ecoli restriction enzime V", "gatatc", 3, "blunt")
-   bamh1 = RestrictEnzyme("BamHI", "type II restriction endonuclease from Bacillus amyloliquefaciens ", "ggatcc", 1, "sticky")
-   hind3 = RestrictEnzyme("HindIII", "type II site-specific nuclease from Haemophilus influenzae", "aagctt", 1 , "sticky")
-   taq1 = RestrictEnzyme("TaqI", "Thermus aquaticus", "tcga", 1 , "sticky")
-   not1 = RestrictEnzyme("NotI", "Nocardia otitidis", "gcggccgc", 2 , "sticky")
-   sau3a1 = RestrictEnzyme("Sau3aI", "Staphylococcus aureus", "gatc", 0 , "sticky")
-   hae3 = RestrictEnzyme("HaeIII", "Haemophilus aegyptius", "ggcc", 2 , "blunt")
-   sma1 =  RestrictEnzyme("SmaI", "Serratia marcescens", "cccggg", 3 , "blunt")
-
-and the 2 dna fragments: ::
-
-   dna_1 = """tcgcgcaacgtcgcctacatctcaagattcagcgccgagatccccgggggttgagcgatccccgtcagttggcgtgaattcag
-   cagcagcgcaccccgggcgtagaattccagttgcagataatagctgatttagttaacttggatcacagaagcttccaga
-   ccaccgtatggatcccaacgcactgttacggatccaattcgtacgtttggggtgatttgattcccgctgcctgccagg"""
-
-   dna_2 = """gagcatgagcggaattctgcatagcgcaagaatgcggccgcttagagcgatgctgccctaaactctatgcagcgggcgtgagg
-   attcagtggcttcagaattcctcccgggagaagctgaatagtgaaacgattgaggtgttgtggtgaaccgagtaag
-   agcagcttaaatcggagagaattccatttactggccagggtaagagttttggtaaatatatagtgatatctggcttg"""
-
-| which enzymes cut the dna_1 ?
-|                  the dna_2 ?
-|                  the dna_1 but not the dna_2?
-
-::
-
-   dna_1 = dna_1.replace('\n', '')
-   dans_2 = dna_2.replace('\n', '')
-   
-   enzymes = [ecor1, ecor5, bamh1, hind3, taq1, not1, sau3a1, hae3, sma1]
-   digest_1 = []
-   for enz in enzymes:
-      pos = dna_1.find(enz.sequence)
-      if pos != -1:
-         digest_1.append(enz)
-
-with this first algorithm we find if an enzyme cut the dna but we cannot find all cuts in the dna for an enzyme.
-If we find a cutting site, we must search again starting at the first nucleotid after the begining of the match 
-until the end of the the dna, for this we use the start parameter of the find function, and so on. 
-As we don't know how many loop we need to scan the dna until the end we use a ``while`` loop testing for the presence of a cutting site.::  
-
-   digest_1 = []
-   for enz in enzymes:
-      pos = dna_1.find(enz.sequence)
-      while pos != -1:
-         digest_1.append(enz)
-         pos = dna_1.find(enz.sequence, pos + 1)
-         
-   digest_2 = []
-   for enz in enzymes:
-      pos = dna_2.find(enz.sequence)
-      while pos != -1:
-         digest_2.append(enz)
-         pos = dna_2.find(enz.sequence, pos + 1)  
-                
-   cut_dna_1 = set(digest_1)
-   cut_dna_2 = set(digest_2)
-   cut_dna_1_not_dna_2 = cut_dna_1 - cut_dna_2
-         
-If we want also the position, for instance to compute the fragments of dna. ::
-
-   digest_1 = []
-   for enz in enzymes:
-      pos = dna_1.find(enz.sequence)
-      while pos != -1:
-         digest_1.append((enz, pos))
-         pos = dna_1.find(enz.sequence, pos + 1)
-    
-   from operator import itemgetter
-   digest_1.sort(key=itemgetter(1))
-   [(e.name, d) for e, d in digest_1]
-   
-   digest_2 = []
-   for enz in enzymes:
-      pos = dna_2.find(enz.sequence)
-      while pos != -1:
-         digest_2.append((enz, pos))
-         pos = dna_2.find(enz.sequence, pos + 1)
-           
-   cut_dna_1 = set([e.name for e in digest_1])
-   cut_dna_2 = set([e.name for e in digest_2])
-   cut_dna_1_not_dna_2 = cut_dna_1 - cut_dna_2
-   
-   
-
-
-Exercise
---------
-From a list return a new list without any duplicate, but keeping the order of items. 
-For example: ::
-
-   >>> l = [5,2,3,2,2,3,5,1]
-   >>> uniqify_with_order(l)
-   >>> [5,2,3,1]  
-
-solution ::
-
-   >>> uniq = []
-   >>> for item in l:
-   >>>   if item not in uniq:
-   >>>      uniq.append(item)
+              
 
-solution ::
 
-   >>> uniq_items = set()
-   >>> l_uniq = [x for x in l if x not in uniq_items and not uniq_items.add(x)]
-   
 Exercise
 --------
 
diff --git a/source/Control_Flow_Statements.rst b/source/Control_Flow_Statements.rst
index 804cfea..6a8852a 100644
--- a/source/Control_Flow_Statements.rst
+++ b/source/Control_Flow_Statements.rst
@@ -1,6 +1,150 @@
+.. sectnum:: 
+   :start: 6
+   
+
 .. _Control_Flow_Statements:
 
 
 ***********************
 Control Flow Statements
 ***********************
+
+Exercises
+=========
+
+Exercise
+--------
+
+Calculates the 10 first number of the Fibonacci sequence .
+The Fibonacci sequence are the numbers in the following integer sequence:
+
+    0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, ...
+
+By definition, the first two numbers in the Fibonacci sequence are 0 and 1, 
+and each subsequent number is the sum of the previous two.
+The fibonacci suite can be defined as following:
+
+|    F\ :sub:`0` = 0, F\ :sub:`1` = 1. 
+|    
+|    F\ :sub:`n` = F\ :sub:`n-1` + F\ :sub:`n-2` 
+
+.. literalinclude:: _static/code/fibonacci_iteration.py
+   :linenos:
+   :language: python
+   
+ 
+Exercise
+--------
+
+let the following enzymes collection: ::
+ 
+   import collections
+   RestrictEnzyme = collections.namedtuple("RestrictEnzyme", "name comment sequence cut end")
+
+   ecor1 = RestrictEnzyme("EcoRI", "Ecoli restriction enzime I", "gaattc", 1, "sticky")
+   ecor5 = RestrictEnzyme("EcoRV", "Ecoli restriction enzime V", "gatatc", 3, "blunt")
+   bamh1 = RestrictEnzyme("BamHI", "type II restriction endonuclease from Bacillus amyloliquefaciens ", "ggatcc", 1, "sticky")
+   hind3 = RestrictEnzyme("HindIII", "type II site-specific nuclease from Haemophilus influenzae", "aagctt", 1 , "sticky")
+   taq1 = RestrictEnzyme("TaqI", "Thermus aquaticus", "tcga", 1 , "sticky")
+   not1 = RestrictEnzyme("NotI", "Nocardia otitidis", "gcggccgc", 2 , "sticky")
+   sau3a1 = RestrictEnzyme("Sau3aI", "Staphylococcus aureus", "gatc", 0 , "sticky")
+   hae3 = RestrictEnzyme("HaeIII", "Haemophilus aegyptius", "ggcc", 2 , "blunt")
+   sma1 =  RestrictEnzyme("SmaI", "Serratia marcescens", "cccggg", 3 , "blunt")
+
+and the 2 dna fragments: ::
+
+   dna_1 = """tcgcgcaacgtcgcctacatctcaagattcagcgccgagatccccgggggttgagcgatccccgtcagttggcgtgaattcag
+   cagcagcgcaccccgggcgtagaattccagttgcagataatagctgatttagttaacttggatcacagaagcttccaga
+   ccaccgtatggatcccaacgcactgttacggatccaattcgtacgtttggggtgatttgattcccgctgcctgccagg"""
+
+   dna_2 = """gagcatgagcggaattctgcatagcgcaagaatgcggccgcttagagcgatgctgccctaaactctatgcagcgggcgtgagg
+   attcagtggcttcagaattcctcccgggagaagctgaatagtgaaacgattgaggtgttgtggtgaaccgagtaag
+   agcagcttaaatcggagagaattccatttactggccagggtaagagttttggtaaatatatagtgatatctggcttg"""
+
+| which enzymes cut the dna_1 ?
+|                  the dna_2 ?
+|                  the dna_1 but not the dna_2?
+
+::
+
+   dna_1 = dna_1.replace('\n', '')
+   dans_2 = dna_2.replace('\n', '')
+   
+   enzymes = [ecor1, ecor5, bamh1, hind3, taq1, not1, sau3a1, hae3, sma1]
+   digest_1 = []
+   for enz in enzymes:
+      pos = dna_1.find(enz.sequence)
+      if pos != -1:
+         digest_1.append(enz)
+
+with this first algorithm we find if an enzyme cut the dna but we cannot find all cuts in the dna for an enzyme.
+If we find a cutting site, we must search again starting at the first nucleotid after the begining of the match 
+until the end of the the dna, for this we use the start parameter of the find function, and so on. 
+As we don't know how many loop we need to scan the dna until the end we use a ``while`` loop testing for the presence of a cutting site.::  
+
+   digest_1 = []
+   for enz in enzymes:
+      pos = dna_1.find(enz.sequence)
+      while pos != -1:
+         digest_1.append(enz)
+         pos = dna_1.find(enz.sequence, pos + 1)
+         
+   digest_2 = []
+   for enz in enzymes:
+      pos = dna_2.find(enz.sequence)
+      while pos != -1:
+         digest_2.append(enz)
+         pos = dna_2.find(enz.sequence, pos + 1)  
+                
+   cut_dna_1 = set(digest_1)
+   cut_dna_2 = set(digest_2)
+   cut_dna_1_not_dna_2 = cut_dna_1 - cut_dna_2
+         
+If we want also the position, for instance to compute the fragments of dna. ::
+
+   digest_1 = []
+   for enz in enzymes:
+      pos = dna_1.find(enz.sequence)
+      while pos != -1:
+         digest_1.append((enz, pos))
+         pos = dna_1.find(enz.sequence, pos + 1)
+    
+   from operator import itemgetter
+   digest_1.sort(key=itemgetter(1))
+   [(e.name, d) for e, d in digest_1]
+   
+   digest_2 = []
+   for enz in enzymes:
+      pos = dna_2.find(enz.sequence)
+      while pos != -1:
+         digest_2.append((enz, pos))
+         pos = dna_2.find(enz.sequence, pos + 1)
+           
+   cut_dna_1 = set([e.name for e in digest_1])
+   cut_dna_2 = set([e.name for e in digest_2])
+   cut_dna_1_not_dna_2 = cut_dna_1 - cut_dna_2
+   
+
+Exercise
+--------
+
+From a list return a new list without any duplicate, but keeping the order of items. 
+For example: ::
+
+   >>> l = [5,2,3,2,2,3,5,1]
+   >>> uniqify_with_order(l)
+   >>> [5,2,3,1]  
+
+solution ::
+
+   >>> uniq = []
+   >>> for item in l:
+   >>>   if item not in uniq:
+   >>>      uniq.append(item)
+
+solution ::
+
+   >>> uniq_items = set()
+   >>> l_uniq = [x for x in l if x not in uniq_items and not uniq_items.add(x)]
+     
+ 
\ No newline at end of file
diff --git a/source/_static/code/fibonacci_iteration.py b/source/_static/code/fibonacci_iteration.py
new file mode 100644
index 0000000..bb8ee8d
--- /dev/null
+++ b/source/_static/code/fibonacci_iteration.py
@@ -0,0 +1,13 @@
+
+fib_suite = []
+n = 0
+while n < 10:
+    if n == 0:
+        fib_suite.append(0)
+    elif n == 1:
+        fib_suite.append(1)
+    else: 
+        res = fib_suite[n-1] + fib_suite[n-2] 
+        fib_suite.append(res)
+    n += 1
+print ', '.join([str(i) for i in fib_suite])
\ No newline at end of file
-- 
GitLab