From a8e860064fe48142864d0900bb5f48640c2a16be Mon Sep 17 00:00:00 2001
From: Blaise Li <blaise.li__git@nsup.org>
Date: Wed, 15 Jun 2022 12:18:09 +0200
Subject: [PATCH] Syncing with exercises in the main course support.
---
source/Control_Flow_Statements.rst | 65 +++++++++++++++++++++++++-----
1 file changed, 55 insertions(+), 10 deletions(-)
diff --git a/source/Control_Flow_Statements.rst b/source/Control_Flow_Statements.rst
index a2c3263..c7ead0b 100644
--- a/source/Control_Flow_Statements.rst
+++ b/source/Control_Flow_Statements.rst
@@ -18,7 +18,7 @@ The Fibonacci sequence are the numbers in the following integer sequence:
0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, ...
-By definition, the first two numbers in the Fibonacci sequence are 0 and 1,
+By definition, the first two numbers in the Fibonacci sequence are 0 and 1,
and each subsequent number is the sum of the previous two.
The Fibonacci suite can be defined as following:
@@ -26,8 +26,8 @@ The Fibonacci suite can be defined as following:
|
| F\ :sub:`n` = F\ :sub:`n-1` + F\ :sub:`n-2`
-Write a function which take an integer ``n`` as parameter
-and returns a list containing the ``n`` first number of the Fibonacci sequence.
+Write a function that takes an integer ``n`` as parameter
+and returns a list containing the ``n`` first numbers of the Fibonacci sequence.
.. literalinclude:: _static/code/fibonacci_iteration.py
@@ -42,18 +42,18 @@ We will see another way more elegant to implement the Fibonacci suite in :ref:`A
Exercise
--------
-Reimplement your own function max (my_max).
-This function will take a list or tuple of float or integer and
-returns the largest element?
+Reimplement your own function ``max`` (call it ``my_max``).
+This function will take a list or tuple of floats or integers and
+return the largest element.
-Write the pseudocode before to propose an implementation.
+Write the pseudocode before proposing an implementation.
pseudocode
^^^^^^^^^^
| *function my_max(l)*
| *max <- first elt of l*
-| *for each elts of l*
+| *for each elt of l*
| *if elt is > max*
| *max <- elt*
| *return max*
@@ -80,6 +80,51 @@ implementation
58
+Exercise
+--------
+
+We want to create a "restriction map" of two sequences.
+
+Create the following enzymes::
+
+ ecor1 = ("EcoRI", "Ecoli restriction enzime I", "gaattc", 1, "sticky")
+ ecor5 = ("EcoRV", "Ecoli restriction enzime V", "gatatc", 3, "blunt")
+ bamh1 = ("BamHI", "type II restriction endonuclease from Bacillus amyloliquefaciens", "ggatcc", 1, "sticky")
+ hind3 = ("HindIII", "type II site-specific nuclease from Haemophilus influenzae", "aagctt", 1, "sticky")
+ taq1 = ("TaqI", "Thermus aquaticus", "tcga", 1, "sticky")
+ not1 = ("NotI", "Nocardia otitidis", "gcggccgc", 2, "sticky")
+ sau3a1 = ("Sau3aI", "Staphylococcus aureus", "gatc", 0, "sticky")
+ hae3 = ("HaeIII", "Haemophilus aegyptius", "ggcc", 2, "blunt")
+ sma1 = ("SmaI", "Serratia marcescens", "cccggg", 3, "blunt")
+
+Then create the following two DNA fragments::
+
+ dna_1 = """tcgcgcaacgtcgcctacatctcaagattcagcgccgagatccccgggggtt
+ gagcgatccccgtcagttggcgtgaattcagcagcagcgcaccccgggcgtagaattccagtt
+ gcagataatagctgatttagttaacttggatcacagaagcttccagaccaccgtatggatccc
+ aacgcactgttacggatccaattcgtacgtttggggtgatttgattcccgctgcctgccagg"""
+
+ dna_2 = """gagcatgagcggaattctgcatagcgcaagaatgcggccgcttagagcgatg
+ ctgccctaaactctatgcagcgggcgtgaggattcagtggcttcagaattcctcccgggagaa
+ gctgaatagtgaaacgattgaggtgttgtggtgaaccgagtaagagcagcttaaatcggagag
+ aattccatttactggccagggtaagagttttggtaaatatatagtgatatctggcttg"""
+
+* In a file <my_file.py>
+#. Create a function *one_line_dna* that transforms a multi-line sequence into a single-line DNA sequence.
+#. Create a collection containing all enzymes
+#. Create a function that takes two parameters:
+
+ #. a sequence of DNA
+ #. a list of enzyme
+
+ and returns a collection containing the enzymes which cut the DNA.
+
+Which enzymes cut:
+
+* ``dna_1``?
+* ``dna_2``?
+* ``dna_1`` but not ``dna_2``?
+
.. _enzyme_exercise:
Exercise
@@ -87,7 +132,7 @@ Exercise
| We want to establish a restriction map of a sequence.
| But we will do this step by step,
-| and reuse the enzymes used in previous chapter:
+| and reuse the enzymes used in the previous exercise:
* Create a function that takes a sequence and an enzyme as parameters, and returns
the position of the first binding site.
@@ -97,7 +142,7 @@ Exercise
| *function one_enz_binding_site(dna, enzyme)*
| *if enzyme binding site is substring of dna*
-| *return of first position of substring in dna*
+| *return first position of substring in dna*
**implementation**
--
GitLab