diff --git a/source/Object_Oriented_Programming.rst b/source/Object_Oriented_Programming.rst
index 1e76016b67c8300c91b54a9392411ef9f418e0ef..a35c32c2ac97621ff9935d8dbd9874b60370b389 100644
--- a/source/Object_Oriented_Programming.rst
+++ b/source/Object_Oriented_Programming.rst
@@ -8,19 +8,145 @@
Object Oriented Programming
***************************
+
Exercises
=========
+Exercise
+--------
+
+Modelize a sequence with few attributes and methods
+
+.. literalinclude:: _static/code/sequence.py
+ :linenos:
+ :language: python
+
+:download:`sequence.py <_static/code/sequence.py>` .
+
Exercise
--------
+Instanciate 2 sequences using your Sequence class, and draw schema representing the namespaces
+
+.. image:: _static/figs/sequence_namespace.png
+ :alt: sequence namespace
+ :align: left
+ :height: 400px
+
+
+.. container:: clearer
+
+ .. image :: _static/figs/spacer.png
+
Exercise
--------
+Can you explain this result (draw namespaces to explain) ?
+how to modify the class variable *class_attr*
+
+.. literalinclude:: _static/code/class_attribute.py
+ :linenos:
+ :language: python
+
+:download:`class_attribute.py <_static/code/class_attribute.py>` .
+
Exercise
--------
+Write the definition of a Point class. Objects from this class should have a
+
+ * a method **show** to display the coordinates of the point
+ * a method **move** to change these coordinates.
+ * a method **dist** that computes the distance between 2 points.
+
+.. note::
+ the distance between 2 points A(x0, y0) and B(x1, y1) can be compute
+
+
+ .. math::
+ d(AB) = \sqrt{(x1-x0))^2 + (y1-y0)^2}
+
+ (http://www.mathwarehouse.com/algebra/distance_formula/index.php)
+
+
+The following python code provides an example of the expected behaviour of objects belonging to this class: ::
+
+ >>> p1 = Point(2, 3)
+ >>> p2 = Point(3, 3)
+ >>> p1.show()
+ (2, 3)
+ >>> p2.show()
+ (3, 3)
+ >>> p1.move(10, -10)
+ >>> p1.show()
+ (12, -7)
+ >>> p2.show()
+ (3, 3)
+ >>> p1.dist(p2)
+ 1.0
+
+
+.. literalinclude:: _static/code/point.py
+ :linenos:
+ :language: python
+
+:download:`point.py <_static/code/point.py>` .
Exercise
---------
\ No newline at end of file
+--------
+
+Use OOP to modelize restriction enzyme, and sequences.
+
+the sequence must implement the following methods
+
+ * enzyme_filter which take as a list of enzymes as argument and return a **new** list containing the enzymes which have
+ binding site in sequence
+
+the restriction enzyme must implements the following methods
+
+ * binds which take a sequence as argument and return True if the sequence contains a binding site, False otherwise.
+
+solve the exercise :ref:`enzyme_exercise` using this new implementation.
+
+
+.. literalinclude:: _static/code/enzyme.py
+ :linenos:
+ :language: python
+
+:download:`enzyme.py <_static/code/enzyme.py>` .
+
+Exercise
+--------
+
+refactor your code of :ref:`matrix_exercise` in OOP style programming. implements only
+
+ * **size**: return the number of rows, and number of columns
+ * **get_cell**: that take the number of rows, the number of columns as parameters,
+ and returns the content of cell corresponding to row number col number
+ * **set_cell**: that take the number of rows, the number of columns as parameters, and a value
+ and set the value val in cell specified by row number x column number
+ * **to_str**: return a string representation of the matrix
+ * **mult**: that take a scalar and return a new matrix which is the scalar product of matrix x val
+
+you can change the name of the methods to be more pythonic
+
+.. literalinclude:: _static/code/matrix_obj.py
+ :linenos:
+ :language: python
+
+:download:`matrix_obj.py <_static/code/matrix_obj.py>` .
+
+Exercise
+--------
+
+Use the code to read multiple sequences fasta file in procedural style and refactor it in OOP style.
+use the file :download:`abcd.fasta <_static/data/abcd.fasta>` to test your code.
+
+What is the benefit to use oop style instead of procedural style?
+
+.. literalinclude:: _static/code/fasta_object.py
+ :linenos:
+ :language: python
+
+:download:`fasta_object.py <_static/code/fasta_object.py>` .
\ No newline at end of file
diff --git a/source/_static/code/class_attribute.py b/source/_static/code/class_attribute.py
new file mode 100644
index 0000000000000000000000000000000000000000..02b38fc4202c1112ea5cd6b7b738ae58efc1ef42
--- /dev/null
+++ b/source/_static/code/class_attribute.py
@@ -0,0 +1,30 @@
+class MyClass(object):
+
+ class_attr = 'foo'
+
+ def __init__(self, val):
+ self.inst_attr = val
+
+
+
+
+a = MyClass(1)
+b = MyClass(2)
+
+print a.inst_attr
+1
+print b.inst_attr
+2
+
+print a.class_attr == b.class_attr
+True
+print a.class_attr is b.class_attr
+True
+
+b.class_attr = 4
+
+print a.class_attr
+4
+del a.class_attr
+
+MyClass.class_attr = 4
\ No newline at end of file
diff --git a/source/_static/code/enzyme.py b/source/_static/code/enzyme.py
index ea839f4da832e9f71fdb16c67909bb1896c29c38..c104537dc89b3a033c259825a2cbf0a4b70611a1 100644
--- a/source/_static/code/enzyme.py
+++ b/source/_static/code/enzyme.py
@@ -31,12 +31,15 @@ class Sequence(object):
class RestrictionEnzyme(object):
def __init__(self, name, binding, cut, end, comment=''):
- self.name = name
- self.binding = binding
- self.cut = cut
- self.end = end
- self.comment = comment
-
+ self._name = name
+ self._binding = binding
+ self._cut = cut
+ self._end = end
+ self._comment = comment
+
+ @property
+ def name(self):
+ return self._name
def binds(self, seq):
"""
diff --git a/source/_static/code/sequence.py b/source/_static/code/sequence.py
new file mode 100644
index 0000000000000000000000000000000000000000..06017f983c241a03af4d9907435a920814ff1fb4
--- /dev/null
+++ b/source/_static/code/sequence.py
@@ -0,0 +1,31 @@
+class Sequence(object):
+
+ def __init__(self, identifier, comment, seq):
+ self.id = identifier
+ self.comment = comment
+ self.seq = self._clean(seq)
+
+
+ def _clean(self, seq):
+ """
+ remove newline from the string representing the sequence
+ :param seq: the string to clean
+ :return: the string without '\n'
+ :rtype: string
+ """
+ return seq.replace('\n')
+
+
+ def gc_percent(self):
+ """
+ :return: the gc ratio
+ :rtype: float
+ """
+ seq = self.seq.upper()
+ return float(seq.count('G') + seq.count('C')) / len(seq)
+
+
+
+
+dna1 = Sequence('gi214', 'the first sequence', 'tcgcgcaacgtcgcctacatctcaagattca')
+dna2 = Sequence('gi3421', 'the second sequence', 'gagcatgagcggaattctgcatagcgcaagaatgcggc')
\ No newline at end of file
diff --git a/source/_static/figs/sequence_namespace.png b/source/_static/figs/sequence_namespace.png
new file mode 100644
index 0000000000000000000000000000000000000000..c49265792c1fa3de974ae409e804973214e7502d
Binary files /dev/null and b/source/_static/figs/sequence_namespace.png differ
diff --git a/source/index.rst b/source/index.rst
index 76f715f18f537bfdcac830d69ae0cf167b766be1..c16bd97902f646b5a07d3268923fef7871c2470b 100644
--- a/source/index.rst
+++ b/source/index.rst
@@ -17,7 +17,7 @@ Contents:
Dive_into_Functions
Modules_and_Packages
Input_Output
-
+ Object_Oriented_Programming
Indices and tables
==================