Commit aae01b33 authored by Bertrand Néron's avatar Bertrand Néron
Browse files

add solutions for OOP

parent da8f74f1
......@@ -8,19 +8,145 @@
Object Oriented Programming
Modelize a sequence with few attributes and methods
.. literalinclude:: _static/code/
:language: python
:download:` <_static/code/>` .
Instanciate 2 sequences using your Sequence class, and draw schema representing the namespaces
.. image:: _static/figs/sequence_namespace.png
:alt: sequence namespace
:align: left
:height: 400px
.. container:: clearer
.. image :: _static/figs/spacer.png
Can you explain this result (draw namespaces to explain) ?
how to modify the class variable *class_attr*
.. literalinclude:: _static/code/
:language: python
:download:` <_static/code/>` .
Write the definition of a Point class. Objects from this class should have a
* a method **show** to display the coordinates of the point
* a method **move** to change these coordinates.
* a method **dist** that computes the distance between 2 points.
.. note::
the distance between 2 points A(x0, y0) and B(x1, y1) can be compute
.. math::
d(AB) = \sqrt{(x1-x0))^2 + (y1-y0)^2}
The following python code provides an example of the expected behaviour of objects belonging to this class: ::
>>> p1 = Point(2, 3)
>>> p2 = Point(3, 3)
(2, 3)
(3, 3)
>>> p1.move(10, -10)
(12, -7)
(3, 3)
>>> p1.dist(p2)
.. literalinclude:: _static/code/
:language: python
:download:` <_static/code/>` .
Use OOP to modelize restriction enzyme, and sequences.
the sequence must implement the following methods
* enzyme_filter which take as a list of enzymes as argument and return a **new** list containing the enzymes which have
binding site in sequence
the restriction enzyme must implements the following methods
* binds which take a sequence as argument and return True if the sequence contains a binding site, False otherwise.
solve the exercise :ref:`enzyme_exercise` using this new implementation.
.. literalinclude:: _static/code/
:language: python
:download:` <_static/code/>` .
refactor your code of :ref:`matrix_exercise` in OOP style programming. implements only
* **size**: return the number of rows, and number of columns
* **get_cell**: that take the number of rows, the number of columns as parameters,
and returns the content of cell corresponding to row number col number
* **set_cell**: that take the number of rows, the number of columns as parameters, and a value
and set the value val in cell specified by row number x column number
* **to_str**: return a string representation of the matrix
* **mult**: that take a scalar and return a new matrix which is the scalar product of matrix x val
you can change the name of the methods to be more pythonic
.. literalinclude:: _static/code/
:language: python
:download:` <_static/code/>` .
Use the code to read multiple sequences fasta file in procedural style and refactor it in OOP style.
use the file :download:`abcd.fasta <_static/data/abcd.fasta>` to test your code.
What is the benefit to use oop style instead of procedural style?
.. literalinclude:: _static/code/
:language: python
:download:` <_static/code/>` .
\ No newline at end of file
class MyClass(object):
class_attr = 'foo'
def __init__(self, val):
self.inst_attr = val
a = MyClass(1)
b = MyClass(2)
print a.inst_attr
print b.inst_attr
print a.class_attr == b.class_attr
print a.class_attr is b.class_attr
b.class_attr = 4
print a.class_attr
del a.class_attr
MyClass.class_attr = 4
\ No newline at end of file
......@@ -31,12 +31,15 @@ class Sequence(object):
class RestrictionEnzyme(object):
def __init__(self, name, binding, cut, end, comment=''): = name
self.binding = binding
self.cut = cut
self.end = end
self.comment = comment
self._name = name
self._binding = binding
self._cut = cut
self._end = end
self._comment = comment
def name(self):
return self._name
def binds(self, seq):
class Sequence(object):
def __init__(self, identifier, comment, seq): = identifier
self.comment = comment
self.seq = self._clean(seq)
def _clean(self, seq):
remove newline from the string representing the sequence
:param seq: the string to clean
:return: the string without '\n'
:rtype: string
return seq.replace('\n')
def gc_percent(self):
:return: the gc ratio
:rtype: float
seq = self.seq.upper()
return float(seq.count('G') + seq.count('C')) / len(seq)
dna1 = Sequence('gi214', 'the first sequence', 'tcgcgcaacgtcgcctacatctcaagattca')
dna2 = Sequence('gi3421', 'the second sequence', 'gagcatgagcggaattctgcatagcgcaagaatgcggc')
\ No newline at end of file
......@@ -17,7 +17,7 @@ Contents:
Indices and tables
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment