Unverified Commit c62da517 authored by Bertrand  NÉRON's avatar Bertrand NÉRON
Browse files

namedtuple => tuple in examples

parent c06a126c
Pipeline #57949 passed with stages
in 17 seconds
...@@ -146,9 +146,6 @@ search all positions of Ecor1 binding sites in dna_1 ...@@ -146,9 +146,6 @@ search all positions of Ecor1 binding sites in dna_1
:: ::
import collections
RestrictEnzyme = collections.namedtuple("RestrictEnzyme", "name comment sequence cut end")
ecor1 = ("EcoRI", "Ecoli restriction enzime I", "gaattc", 1, "sticky") ecor1 = ("EcoRI", "Ecoli restriction enzime I", "gaattc", 1, "sticky")
dna_1 = """tcgcgcaacgtcgcctacatctcaagattcagcgccgagatccccgggggttgagcgatccccgtcagttggcgtgaattcag dna_1 = """tcgcgcaacgtcgcctacatctcaagattcagcgccgagatccccgggggttgagcgatccccgtcagttggcgtgaattcag
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment