From 722b9abfe459a4d102e06a1b402181045dc61232 Mon Sep 17 00:00:00 2001
From: Veronique Legrand <vlegrand@pasteur.fr>
Date: Thu, 1 Dec 2016 14:30:33 +0100
Subject: [PATCH] version 1.3 added -q option

---
 Makefile.am                  |   2 +-
 NEWS                         |  15 +-
 configure.ac                 |   6 +-
 src/CountMinSketch.cpp.old   | 111 ++++++++++++++
 src/CountMinSketch.h.old     |  87 +++++++++++
 src/CountMinSketch.hpp       | 269 ++++++++++++++++++++++++++++++++
 src/Filter.hpp               | 175 +++++++++++++++++++++
 src/FqAuxBackend.cpp         |  15 +-
 src/FqAuxBackend.h           |   2 +-
 src/FqBaseBackend.cpp        | 164 ++++++++++++++++----
 src/FqBaseBackend.h          |  45 +++++-
 src/FqMainBackend.cpp        | 148 +++++++++++-------
 src/FqMainBackend.h          |   3 +
 src/ROCKparams.cpp           | 287 +++++++++++++++++++++++++++++++++++
 src/ROCKparams.h             | 139 +++++++++++++++++
 src/ReadProcessor.h          |  14 +-
 src/fqwriter.cpp             |  77 ++++++++++
 src/fqwriter.h               |  15 ++
 src/main_utils.cpp           | 118 ++++++++++++++
 src/main_utils.h             |  29 ++++
 src/rock_commons.h           |  46 ++++++
 src/rock_types.h             |  29 ----
 src/srp_old.h                |  30 ----
 src/unit_test_cms.cpp        |  99 ++++++++++++
 src/unit_test_fqreader.cpp   | 165 +++++++++++++++++---
 src/unit_test_fqwriter.cpp   | 141 +++++++++++++++++
 src/unit_test_main_utils.cpp | 113 ++++++++++++++
 27 files changed, 2157 insertions(+), 187 deletions(-)
 create mode 100644 src/CountMinSketch.cpp.old
 create mode 100644 src/CountMinSketch.h.old
 create mode 100644 src/CountMinSketch.hpp
 create mode 100644 src/Filter.hpp
 create mode 100644 src/ROCKparams.cpp
 create mode 100644 src/ROCKparams.h
 create mode 100644 src/fqwriter.cpp
 create mode 100644 src/fqwriter.h
 create mode 100644 src/main_utils.cpp
 create mode 100644 src/main_utils.h
 create mode 100644 src/rock_commons.h
 delete mode 100644 src/rock_types.h
 delete mode 100644 src/srp_old.h
 create mode 100644 src/unit_test_cms.cpp
 create mode 100644 src/unit_test_fqwriter.cpp
 create mode 100644 src/unit_test_main_utils.cpp

diff --git a/Makefile.am b/Makefile.am
index 1bfdcf4..1bfa999 100644
--- a/Makefile.am
+++ b/Makefile.am
@@ -1 +1 @@
-SUBDIRS=src
+SUBDIRS=. src test doc
diff --git a/NEWS b/NEWS
index 54926a5..4b9d37e 100644
--- a/NEWS
+++ b/NEWS
@@ -1 +1,14 @@
-Sample NEWS file for rock project.
+New in version 1.3
+ * -q option for nucleotique quality score threshold.
+
+New in version 1.2
+ * -v option for verbose mode.
+
+New in version 1.1
+ * input file names can be provided as arguments in command-line. -i option is no more mandatory.
+ * output filenames are generated by ROCK if -o option is not used. -o option is no more mandatory.
+ * fixed compilation warning.
+ * bug fix: output files are now sorted in decreasing order of quality score (versus increasing order in version 1.0).
+ * bug fix: when computig lambda (in the case where nothing is not provided by the user).
+
+Version 1.0 of ROCK
diff --git a/configure.ac b/configure.ac
index f810bdd..cb0ff45 100644
--- a/configure.ac
+++ b/configure.ac
@@ -1,7 +1,7 @@
 dnl Process this file with autoconf to produce a configure script.
 
 AC_PREREQ(2.59)
-AC_INIT(rock, 1.0)
+AC_INIT(rock, 1.3)
 
 
 AC_CANONICAL_SYSTEM
@@ -10,9 +10,9 @@ AM_INIT_AUTOMAKE()
 # Checks for programs.
 AC_PROG_CXX
 AC_PROG_RANLIB
-# AC_CHECK_PROG(POD2MAN, pod2man, pod2man, :)
+AC_CHECK_PROG(POD2MAN, pod2man, pod2man, :)
 
 
-AC_CONFIG_FILES(Makefile src/Makefile)
+AC_CONFIG_FILES(Makefile src/Makefile test/Makefile doc/Makefile)
 AC_OUTPUT
 
diff --git a/src/CountMinSketch.cpp.old b/src/CountMinSketch.cpp.old
new file mode 100644
index 0000000..017079a
--- /dev/null
+++ b/src/CountMinSketch.cpp.old
@@ -0,0 +1,111 @@
+/*
+ * CountMinSketch.cpp
+ *
+ *  Created on: Feb 10, 2016
+ *      Author: vlegrand
+ *      15/02/16 According to benchmark results, will use the hash function implementation that uses the modulo operator. It appears to be a little bit faster.
+ */
+
+#include "CountMinSketch.h"
+
+const int max_pow=30;
+
+/* This method is used to determine if a number is a prime number or not.
+ * It is incomplete. TODO find an effective method to get lamdba prime numbers when we'll be sure whether we use the
+ * "prime number" version of the hash functions. */
+/*int CountMinSketch::isPrime(unsigned int num) {
+    if ((num % 2 ==0) || (num==2)) return 0;
+    if ((num % 3 ==0) || (num==3)) return 0;
+    if ((num % 5 ==0) || (num==5)) return 0;
+    if ((num % 7 ==0) || (num==7)) return 0;
+    return 1;
+}
+
+int CountMinSketch::isMersenne(unsigned int num) {
+    int cur_pow=max_pow;
+    unsigned int mers_nbr=pow(2,cur_pow)-1;
+    while (num!=mers_nbr && cur_pow>=1) {
+        cur_pow-=1;
+        mers_nbr=pow(2,cur_pow)-1;
+    }
+    if (cur_pow==0) return 0;
+    else return 1;
+}
+
+void CountMinSketch::findNonMersPrime() {
+    int i;
+    unsigned int num=pi_j_max;
+    for (i=0;i<lambda;i++) {
+        num-=1;
+        while (!isPrime(num)) num-=1;
+
+    }
+}*/
+
+std::map<int,int> CountMinSketch::getIthArray(int i) {
+    std::map<int,int> tmp;
+    return tmp;
+}
+
+
+void CountMinSketch::addKMer(unsigned long val) {
+    int h,j;
+    short cnt;
+    j=1;
+    std::vector<internal_array>::iterator it_lambda_array;
+    for (it_lambda_array=cms_lambda_array.begin();it_lambda_array!=cms_lambda_array.end();it_lambda_array++) {
+        h=hash64to32(val,j);
+        cnt=(*it_lambda_array)[h];
+        (*it_lambda_array)[h]=(cnt++ & ushortmask);
+        j++;
+    }
+
+}
+
+int CountMinSketch::getEstimatedNbOcc(unsigned long val) {
+    int j,h;
+    int min=0;
+    std::vector<internal_array>::iterator it;
+    for (it=cms_lambda_array.begin();it!=cms_lambda_array.end();it++) {
+        h=hash64to32(val,j);
+        if ((*it)[h]<min) min=(*it)[h];
+        j++;
+    }
+    return min;
+}
+
+/*
+ * Used to determine if a read must be kept or not.
+ * Depending on the case, threshold is kappa or kappa_prime
+ * Computes the number of k-mers for which the number of occurrences is below threshold.
+ * If more than half of the k-mers have a number of occurrences that is less than threshold,
+ * return true; else, return false.
+ */
+int CountMinSketch::isRCovBelowThres(const readNumericValues& read_val,int threshold) {
+    int a=0;
+    int b=0;
+    readNumericValues::const_iterator it;
+    for (it=read_val.begin();it!=read_val.end();it++) {
+        short nb_occ=getEstimatedNbOcc(*it);
+        if (nb_occ<threshold) a+=1;
+        ++b;
+    }
+    return (2*a>b);
+}
+
+int CountMinSketch::addRead(const readNumericValues& read_val) {
+    int keep_r=isRCovBelowThres(read_val,kappa);
+    if (keep_r) {
+        readNumericValues::const_iterator it;
+        for (it=read_val.begin();it!=read_val.end();it++) {
+            addKMer(*it);
+        }
+    }
+    return keep_r;
+}
+
+
+int CountMinSketch::isBeneathMinKappa(const readNumericValues& read_val) {
+    return(isRCovBelowThres(read_val,kappa_prime));
+}
+
diff --git a/src/CountMinSketch.h.old b/src/CountMinSketch.h.old
new file mode 100644
index 0000000..e5fbcdc
--- /dev/null
+++ b/src/CountMinSketch.h.old
@@ -0,0 +1,87 @@
+/*
+ * CountMinSketch.h
+ *
+ *  Created on: Feb 10, 2016
+ *      Author: vlegrand
+ */
+
+#ifndef COUNTMINSKETCH_H_
+#define COUNTMINSKETCH_H_
+
+#include <vector>
+#include <map>
+
+typedef std::vector<unsigned long> readNumericValues; // TODO move this definition to a common include file between ReadProcessor and CountMinSketch.
+
+class CountMinSketch {
+    static const unsigned int pi_j_max=2147483647;
+    static const unsigned long mask1=1;
+    static const unsigned long mask2=2095103;
+    static const unsigned long mask3=1023;
+
+    static const unsigned short ushortmask=32767;
+
+
+    int lambda;
+    int kappa;
+    int kappa_prime;
+
+    typedef std::map<int,short> internal_array;
+    std::vector<internal_array> cms_lambda_array;
+
+    std::vector<int> pi_j_array;
+
+    // void findNonMersPrime(); // fills pi_j_array with lambda non mersenne prime numbers.
+    // int hash64to32(unsigned long,int);
+
+    int hash64to32(unsigned long w,int j) { // bit shift version of hash function to start.
+        unsigned long h_tmp;
+        unsigned long h=~w;
+        h+=w<<18;
+        h_tmp=h>>31;
+        h_tmp&=mask1;
+        h=h^h_tmp;
+        h*=j;
+        h_tmp=h>>11;
+        h_tmp&=mask2;
+        h ^=h_tmp;
+        h+=h<<6;
+        h_tmp=h>>22;
+        h_tmp&=mask3;
+        h^=h_tmp;
+        return (int) (h& 2147483647);
+    }
+
+
+    std::map<int,int> getIthArray(int); // utility method provided for testing only.
+    void addKMer(unsigned long); // inline? TODO: see later if it can help us gain time.
+    int isRCovBelowThres(const readNumericValues& read_val,int threshold) ;
+
+    // for unit tests.
+    friend void test_CMS(int lambda,int kappa,int kappa_prime);
+    /*friend void test_findNonMersPrime(int lambda,int kappa,int kappa_prime);
+    friend void test_hash();*/
+
+public:
+
+    CountMinSketch(int glambda,int gkappa,int gkappa_prime) {
+        lambda=glambda;
+        kappa=gkappa;
+        kappa_prime=gkappa_prime;
+        cms_lambda_array.reserve(lambda);
+        pi_j_array.reserve(lambda);
+        // findNonMersPrime();
+    }
+
+
+
+    int getEstimatedNbOcc(unsigned long);
+    int addRead(const readNumericValues&);
+    int isBeneathMinKappa(const readNumericValues&);
+};
+
+
+
+
+
+#endif /* COUNTMINSKETCH_H_ */
diff --git a/src/CountMinSketch.hpp b/src/CountMinSketch.hpp
new file mode 100644
index 0000000..c913ffc
--- /dev/null
+++ b/src/CountMinSketch.hpp
@@ -0,0 +1,269 @@
+/*
+ * CountMinSketch.h
+ *
+ *  Created on: Feb 10, 2016
+ *      Author: vlegrand
+ */
+
+#ifndef COUNTMINSKETCH_HPP_
+#define COUNTMINSKETCH_HPP_
+
+
+#include <stdlib.h>
+#include <string.h>
+#include "rock_commons.h"
+
+#define BAD_TYPE -1
+
+// Store the non mersenne prime numbers for modulo hashing in this array.
+    const int Pi_js[500]={2147469629, 2147469637, 2147469659, 2147469679, 2147469703, 2147469781, 2147469817, 2147469823, 2147469829, 2147469881,\
+            2147469917, 2147469943, 2147469949, 2147469983, 2147470007, 2147470019, 2147470027, 2147470043, 2147470057, 2147470067,\
+            2147470081, 2147470111, 2147470123, 2147470139, 2147470147, 2147470177, 2147470183, 2147470211, 2147470229, 2147470249,\
+            2147470313, 2147470327, 2147470333, 2147470361, 2147470427, 2147470453, 2147470511, 2147470513, 2147470529, 2147470531,\
+            2147470553, 2147470579, 2147470597, 2147470603, 2147470627, 2147470643, 2147470673, 2147470679, 2147470723, 2147470727,\
+            2147470733, 2147470751, 2147470769, 2147470771,2147483059, 2147483069, 2147483077, 2147483123, 2147483137, 2147483171,\
+            2147473897, 2147473921, 2147473963, 2147474009, 2147474027, 2147474029, 2147474071, 2147474093, 2147474113, 2147474123,\
+            2147474149, 2147474159, 2147474201, 2147474213, 2147474239, 2147474279, 2147474359, 2147474383, 2147474393, 2147474477,\
+            2147474479, 2147474491, 2147474513, 2147474519, 2147474531, 2147474551, 2147474597, 2147474627, 2147474657, 2147474711,\
+            2147474717, 2147474789, 2147474803, 2147474807, 2147474809, 2147474831, 2147474837, 2147474843, 2147474851, 2147474881,\
+            2147474887, 2147474891, 2147474921, 2147474929, 2147474947, 2147474951, 2147474963, 2147475047, 2147475061, 2147475103,\
+            2147475107, 2147475149, 2147475179, 2147475181, 2147475193, 2147475203, 2147475221, 2147475229, 2147475233, 2147475251,\
+            2147475257, 2147475269, 2147475277, 2147475331, 2147475347, 2147475349, 2147475367, 2147475373, 2147475397, 2147475401,\
+            2147475413, 2147475439, 2147475481, 2147475487, 2147475497, 2147475503, 2147475509, 2147475521, 2147475541, 2147475553,\
+            2147475559, 2147475563, 2147475587, 2147475593, 2147475601, 2147475641, 2147475653, 2147475691, 2147475713, 2147475721,\
+            2147475739, 2147475787, 2147475791, 2147475797, 2147475829, 2147475851, 2147475859, 2147475871, 2147475899, 2147475929,\
+            2147475971, 2147475973, 2147475977, 2147475997, 2147476031, 2147476073, 2147476087, 2147476109, 2147476127, 2147476139,\
+            2147476141, 2147476169, 2147476183, 2147476211, 2147476249, 2147476291, 2147476321, 2147476327, 2147476367, 2147476381,\
+            2147476399, 2147476417, 2147476517, 2147476519, 2147476543, 2147476607, 2147476619, 2147476649, 2147476663, 2147476687,\
+            2147476693, 2147476699, 2147476739, 2147476741, 2147476763, 2147476769, 2147476777, 2147476789, 2147476819, 2147476823,\
+            2147476841, 2147476871, 2147476897, 2147476927, 2147476931, 2147476937, 2147476943, 2147476951, 2147476963, 2147476979,\
+            2147477021, 2147477029, 2147477063, 2147477093, 2147477107, 2147477113, 2147477159, 2147477191, 2147477201, 2147477203,\
+            2147477207, 2147477209, 2147477237, 2147477249, 2147477273, 2147477323, 2147477393, 2147477399, 2147477419, 2147477443,\
+            2147477467, 2147477473, 2147477503, 2147477513, 2147477531, 2147477533, 2147477599, 2147477627, 2147477681, 2147477687,\
+            2147477699, 2147477701, 2147477737, 2147477807, 2147477809, 2147477833, 2147477851, 2147477861, 2147477873, 2147477879,\
+            2147477881, 2147477933, 2147477953, 2147477989, 2147478013, 2147478017, 2147478049, 2147478079, 2147478083, 2147483179,\
+            2147478089, 2147478127, 2147478133, 2147478149, 2147478253, 2147478259, 2147478293, 2147478299, 2147478331, 2147478349,\
+            2147478373, 2147478461, 2147478481, 2147478491, 2147478497, 2147478503, 2147478517, 2147478521, 2147478563, 2147478569,\
+            2147478581, 2147478601, 2147478611, 2147478647, 2147478649, 2147478653, 2147478659, 2147478661, 2147478673, 2147478701,\
+            2147478703, 2147478719, 2147478721, 2147478727, 2147478731, 2147478733, 2147478763, 2147478791, 2147478821, 2147478859,\
+            2147478863, 2147478889, 2147478899, 2147478911, 2147478919, 2147478937, 2147478959, 2147478961, 2147478967, 2147478997,\
+            2147479013, 2147479031, 2147479057, 2147479063, 2147479079, 2147479091, 2147479097, 2147479121, 2147479129, 2147479133,\
+            2147479171, 2147479189, 2147479231, 2147479259, 2147479273, 2147479307, 2147479339, 2147479349, 2147479361, 2147479381,\
+            2147479403, 2147479421, 2147479447, 2147479489, 2147479507, 2147479513, 2147479517, 2147479531, 2147479547, 2147479549,\
+            2147479573, 2147479589, 2147479601, 2147479619, 2147479637, 2147479643, 2147479657, 2147479681, 2147479751, 2147479753,\
+            2147479757, 2147479781, 2147479787, 2147479819, 2147479823, 2147479879, 2147479891, 2147479897, 2147479907, 2147479937,\
+            2147479991, 2147480009, 2147480011, 2147480039, 2147480161, 2147480197, 2147480207, 2147480219, 2147480227, 2147480297,\
+            2147480299, 2147480311, 2147480327, 2147480369, 2147480429, 2147480437, 2147480459, 2147480471, 2147480507, 2147480519,\
+            2147480527, 2147480551, 2147480591, 2147480611, 2147480623, 2147480641, 2147480651, 2147480677, 2147480683, 2147480707,\
+            2147480723, 2147480743, 2147480747, 2147480791, 2147480837, 2147480843, 2147480849, 2147480893, 2147480897, 2147480899,\
+            2147480921, 2147480927, 2147480941, 2147480957, 2147480969, 2147480971, 2147480989, 2147481019, 2147481031, 2147481053,\
+            2147481071, 2147481139, 2147481143, 2147481151, 2147481173, 2147481179, 2147481199, 2147481209, 2147481247, 2147481263,\
+            2147481269, 2147481283, 2147481311, 2147481317, 2147481337, 2147481353, 2147481359, 2147481367, 2147481373, 2147481487,\
+            2147481491, 2147481499, 2147481509, 2147481529, 2147481563, 2147481571, 2147481629, 2147481673, 2147481793, 2147481797,\
+            2147481811, 2147481827, 2147481863, 2147481883, 2147481893, 2147481899, 2147481901, 2147481907, 2147481937, 2147481949,\
+            2147481967, 2147481997, 2147482021, 2147482063, 2147482081, 2147482091, 2147482093, 2147482121, 2147482223, 2147482231,\
+            2147482237, 2147482273, 2147482291, 2147482327, 2147482343, 2147482349, 2147482361, 2147482367, 2147482409, 2147482417,\
+            2147482481, 2147482501, 2147482507, 2147482577, 2147482583, 2147482591, 2147482621, 2147482661, 2147482663, 2147482681,\
+            2147482693, 2147482697, 2147482739, 2147482763, 2147482801, 2147482811, 2147482817, 2147482819, 2147482859, 2147482867,\
+            2147482873, 2147482877, 2147482921, 2147482937, 2147482943, 2147482949, 2147482951, 2147483029, 2147483033, 2147483053};
+
+
+typedef struct {
+    int lambda;
+    int kappa;
+    int kappa_prime;
+    int filter_size; // max amount of RAM wanted for the CMS.
+    int nucl_score_threshold; // minimum quality score below which nucleotides are considered in error. 0 by default.
+} CMSparams;
+
+template <typename T>
+struct get_mask {
+    static const int value=BAD_TYPE;
+};
+
+template<>
+struct get_mask<unsigned char> {
+    static const unsigned char value=255;
+};
+
+template<>
+struct get_mask<unsigned short> {
+    static const unsigned short value=65535;
+};
+
+
+template<typename T> class CountMinSketch {
+public:
+    int nucl_score_threshold;
+
+private:
+    static const unsigned long mask1=1; // used only for hash64to32bs
+    static const unsigned long mask2=2095103;
+    static const unsigned long mask3=1023;
+
+    int lambda;
+    int kappa;
+    int kappa_prime;
+
+    T ** cms_lambda_array;
+    T mask;
+
+   inline int hash64to32(const unsigned long& w ,const int& j) {
+       return w % Pi_js[j];
+   }
+
+   // bit shift version of hash function to start. Keep it just in case. Not used because it is very slow.
+  /*  int hash64to32bs(unsigned long w,int j) {
+        unsigned long h_tmp;
+        unsigned long h=~w;
+        h+=w<<18;
+        h_tmp=h>>31;
+        h_tmp&=mask1;
+        h=h^h_tmp;
+        h*=j;
+        h_tmp=h>>11;
+        h_tmp&=mask2;
+        h ^=h_tmp;
+        h+=h<<6;
+        h_tmp=h>>22;
+        h_tmp&=mask3;
+        h^=h_tmp;
+        return (int) (h& 2147483647);
+    }*/
+
+
+
+    inline int isRCovBelowThres(const readNumericValues& read_val, const int& threshold);
+
+    void init(int glambda,int gkappa,int gkappa_prime,int gnucl_score_threshold);
+
+    // for unit tests.
+    friend void test_CMS(int lambda,int kappa,int kappa_prime);
+
+
+public:
+
+    CountMinSketch(int glambda,int gkappa,int gkappa_prime,int gnucl_score_threshold=0) {
+        init(glambda,gkappa,gkappa_prime,gnucl_score_threshold);
+    }
+
+    CountMinSketch(CMSparams parms) {
+        init(parms.lambda,parms.kappa,parms.kappa_prime,parms.nucl_score_threshold);
+    }
+
+    ~CountMinSketch() {
+        int j;
+        for (j=0;j<lambda;j++) {
+            free(cms_lambda_array[j]);
+        }
+        free(cms_lambda_array);
+    }
+
+
+    inline void addKMer(const unsigned long& val1) {
+            int h,j;
+            T cnt;
+            j=lambda;
+            while(--j>=0) {
+                h=hash64to32(val1,j);
+                cnt=cms_lambda_array[j] [h];
+                cnt++;
+                cms_lambda_array[j] [h]=(cnt & mask);
+            }
+        }
+
+    // keep that just for unit testing purpose
+    T getEstimatedNbOcc(const unsigned long& val);
+
+    int addRead(const readNumericValues& read_val);
+
+    int isBeneathMinKappa(const readNumericValues&read_val);
+
+    unsigned long getNbDistinctKMers();
+};
+
+
+template<typename T> inline int CountMinSketch<T>::isRCovBelowThres(const readNumericValues& read_val, const int& threshold) {
+    int a=0,b=0;
+    int j,h;
+    T min;
+    readNumericValues::const_iterator it;
+    for (it=read_val.begin();it!=read_val.end();++it) {
+        j=lambda;
+        min=mask;
+        while (--j>=0 && min>threshold) {
+            h=hash64to32(*it,j);
+            min=cms_lambda_array[j] [h];
+        }
+        (min<threshold)? a+=1:a;
+        ++b;
+    }
+    return (2*a>b);
+}
+
+template<typename T> void CountMinSketch<T>::init(int glambda,int gkappa,int gkappa_prime,int gnucl_score_threshold) {
+    lambda=glambda;
+    kappa=gkappa;
+    kappa_prime=gkappa_prime;
+    nucl_score_threshold=gnucl_score_threshold;
+    int j;
+    mask=get_mask<T>::value;
+    /*if (lambda<ubytemask) mask=ubytemask; // byte implementation
+    else mask=ushortmask;  // short implementation*/
+    cms_lambda_array= (T**) malloc(lambda*sizeof(T*));
+    for (j=0;j<lambda;j++) {
+        cms_lambda_array[j]=(T *) malloc(sizeof(T)*INT_MAX);
+        memset(cms_lambda_array[j],0,INT_MAX);
+    }
+}
+
+// keep that just for unit testing purpose
+template<typename T> T CountMinSketch<T>::getEstimatedNbOcc(const unsigned long& val) {
+    int j,h;
+    T min=mask;
+    // unsigned char min=ubytemask;
+    j=lambda;
+    while(--j>=0 && min>kappa) {
+        h=hash64to32(val,j);
+        min=cms_lambda_array[j] [h];
+    }
+    return min;
+}
+
+template<typename T> int CountMinSketch<T>::addRead(const readNumericValues& read_val) {
+    int keep_r=isRCovBelowThres(read_val,kappa);
+        if (keep_r) {
+            readNumericValues::const_iterator it;
+            for (it=read_val.begin();it!=read_val.end();it++) {
+                this->addKMer(*it);
+            }
+        }
+        return keep_r;
+}
+
+template<typename T> int CountMinSketch<T>::isBeneathMinKappa(const readNumericValues&read_val) {
+    int res=isRCovBelowThres(read_val,kappa_prime);
+    return res;
+}
+
+/*
+ * Go through the arrays of the CMS and returns the number of distinct k_mers (biggest nbr of non-zero counters amongst all arrays)
+ */
+
+template<typename T> unsigned long CountMinSketch<T>::getNbDistinctKMers() {
+    int j,h;
+    unsigned long min=INT_MAX;
+
+    for (j=lambda-1;j>=0;--j) {
+        unsigned long nb_k_mers=0;
+        for (h=INT_MAX-1;h>=0;--h) {
+            //(min<threshold)? a+=1: NULL;
+            (cms_lambda_array[j] [h]>0)?  nb_k_mers+=1: nb_k_mers;
+        }
+        (nb_k_mers<min) ?min=nb_k_mers: min;
+    }
+    return min;
+}
+
+
+#endif /* COUNTMINSKETCH_HPP_ */
diff --git a/src/Filter.hpp b/src/Filter.hpp
new file mode 100644
index 0000000..05e80df
--- /dev/null
+++ b/src/Filter.hpp
@@ -0,0 +1,175 @@
+/*
+ * filter.h
+ *
+ *  Created on: Apr 26, 2016
+ *      Author: vlegrand
+ */
+#ifndef FILTER_HPP_
+#define FILTER_HPP_
+#include <errno.h>
+#include <sys/time.h>
+#include <sys/resource.h>
+
+#include "CountMinSketch.hpp"
+#include "ReadProcessor.h"
+#include "read_utils.h"
+
+
+static const unsigned short ushortmask=65535;
+static const unsigned char ubytemask=255;
+
+typedef CountMinSketch<unsigned char> ByteCountMinSketch;
+typedef CountMinSketch<unsigned short> ShortCountMinSketch;
+
+
+
+// created this class to hide implementation detail (byte versys short) from main program. TODO: refactor it later if I have time.
+class Filter {
+    ByteCountMinSketch * pByteCMS;
+    ShortCountMinSketch * pShortCMS;
+
+#// long CMS_size_in_Bytes;
+    long nb_bytes_before_fill_CMS,nb_bytes_after_fill_CMS;
+
+    void getRSS(int before_fill=0);
+
+
+    template <typename T> void underlyingfillCMS(FqBaseBackend* map_id_backend[],int nb_be, int k, srp* io_sr, CountMinSketch<T>* cms);
+    template <typename T> void underlyinglowFilterCMS(FqBaseBackend* map_id_backend[],int nb_be,int k,srp* io_sr, CountMinSketch<T>* pcms);
+
+public:
+
+    Filter(const CMSparams& parms) {
+        pByteCMS=NULL;
+        pShortCMS=NULL;
+        getRSS();
+        if (parms.kappa<ubytemask) pByteCMS=new ByteCountMinSketch(parms);
+        else pShortCMS=new ShortCountMinSketch(parms);
+        //CMS_size_in_Bytes=0;
+        
+        nb_bytes_after_fill_CMS=0;
+    }
+
+    void fillCMS(FqBaseBackend* map_id_backend[],int nb_be,int k,srp* io_sr);
+    void lowFilterCMS(FqBaseBackend* map_id_backend[],int nb_be,int k, srp* io_sr);
+    unsigned long getApproxNbDistinctKMers();
+    unsigned long getSize();
+};
+
+template <typename T> void Filter::underlyingfillCMS(FqBaseBackend* map_id_backend[],int nb_be, int k, srp* io_sr, CountMinSketch<T>* cms) {
+    int ret;
+    srp::reverse_iterator rit;
+    i_dim::iterator it_offs;
+    k_dim::iterator it_struct;
+    // const unsigned char masque=0x0F; // to retrieve 2nd file identifier.
+    ReadProcessor read_p(k);
+    readNumericValues nbrKmerDecompo;
+
+    // 1rst step, open files before fetching reads in them
+    int i;
+    for (i=0;i<nb_be;i++){
+        map_id_backend[i]->openInputFile();
+    }
+
+    for (rit=io_sr->rbegin(); rit!=io_sr->rend(); ++rit) { //process map in reverse order (by decreasing scores).
+        //cout << "score="<<rit->first<<endl;
+        // unsigned long score=rit->first;
+        for (it_offs=rit->second.begin();it_offs!=rit->second.end();it_offs++) {
+            unsigned long j=it_offs->first;
+            for (it_struct=it_offs->second.begin();it_struct!=it_offs->second.end();it_struct++) {
+                // read dna string corresponding to fast qrecord
+                DnaSeqStr a_seqs[2];
+                init_DnaSeqStr(&a_seqs[0]);
+                init_DnaSeqStr(&a_seqs[1]);
+                getDNASeqstr(map_id_backend,*it_struct,j,a_seqs,cms->nucl_score_threshold);
+                // debug stuff only.
+              /*if (strstr(a_seqs->fq_record_buf,"@SRR1222430.37")!=NULL) {
+                printf("coucou");
+              }*/
+                // decompose dna string into k-mers and turn k_mers into numbers.
+                decomposeReadInKMerNums(read_p, nbrKmerDecompo,k,a_seqs);
+                // insert k-mers into CMS if overall read satisfies kappa condition.
+                ret=cms->addRead(nbrKmerDecompo);
+                if (!ret) {
+                    // read is rejected, update rpos structure accordingly.
+                    it_struct->fileid=0; // TODO Benchmark: Wouldn't rit->second.erase(++it_struct) be more efficient (reduce size of CMS in memory then 2nd parsing for kappa_prime filtering and third parsing for writing output files would be faster?
+                }
+                nbrKmerDecompo.clear();
+            }
+        }
+    }
+    // last step, close fq files. TODO this step may be moved somewhere else for optimization.
+       for (i=0;i<nb_be;i++){
+                map_id_backend[i]->closeInputFile();
+            }
+}
+
+template <typename T> void Filter::underlyinglowFilterCMS(FqBaseBackend* map_id_backend[],int nb_be,int k,srp* io_sr, CountMinSketch<T>* pcms) { // TODO refactor get k from CMS.
+    srp::iterator it;
+    i_dim::iterator it_offs;
+    k_dim::iterator it_struct;
+    int ret;
+    ReadProcessor read_p(k);
+    readNumericValues nbrKmerDecompo;
+
+    // 1rst step, open files before fetching reads in them
+    int i;
+    for (i=0;i<nb_be;i++){
+        map_id_backend[i]->openInputFile();
+    }
+
+    for (it=io_sr->begin(); it!=io_sr->end(); ++it) {
+        for (it_offs=it->second.begin();it_offs!=it->second.end();it_offs++) {
+            unsigned int j=it_offs->first;
+            for (it_struct=it_offs->second.begin();it_struct!=it_offs->second.end();it_struct++) {
+                // read dna string corresponding to fastq record
+                if (it_struct->fileid) {
+                DnaSeqStr a_seqs[2];
+                init_DnaSeqStr(&a_seqs[0]);
+                init_DnaSeqStr(&a_seqs[1]);
+                getDNASeqstr(map_id_backend,*it_struct,j,a_seqs);
+                // decompose dna string into k-mers and turn k_mers into numbers.
+                decomposeReadInKMerNums(read_p, nbrKmerDecompo,k,a_seqs);
+                ret=pcms->isBeneathMinKappa(nbrKmerDecompo);
+                if (ret) it_struct->fileid=0;
+                nbrKmerDecompo.clear();
+                }
+            }
+        }
+    }
+    for (i=0;i<nb_be;i++){
+        map_id_backend[i]->closeInputFile();
+    }
+}
+
+void Filter::fillCMS(FqBaseBackend* map_id_backend[],int nb_be,int k,srp* io_sr) {
+    if (pByteCMS!=NULL) underlyingfillCMS<unsigned char>(map_id_backend,nb_be, k, io_sr,pByteCMS);
+    else underlyingfillCMS<unsigned short>(map_id_backend,nb_be, k, io_sr,pShortCMS);
+    getRSS(1);
+}
+
+void Filter::lowFilterCMS(FqBaseBackend* map_id_backend[],int nb_be,int k, srp* io_sr) {
+    if (pByteCMS!=NULL) underlyinglowFilterCMS<unsigned char>(map_id_backend,nb_be, k, io_sr,pByteCMS);
+    else underlyinglowFilterCMS<unsigned short>(map_id_backend,nb_be, k, io_sr,pShortCMS);
+}
+
+unsigned long Filter::getApproxNbDistinctKMers() {
+    if (pByteCMS!=NULL) return pByteCMS->getNbDistinctKMers();
+    else return pShortCMS->getNbDistinctKMers();
+}
+
+void Filter::getRSS(int before_fill) {
+    struct rusage usage;
+    int res2=getrusage(RUSAGE_SELF,&usage);
+    if (res2==-1) err(errno,"cannot get resource usage.");
+    if (before_fill==0) nb_bytes_before_fill_CMS=usage.ru_maxrss;
+    else nb_bytes_after_fill_CMS=usage.ru_maxrss;
+}
+
+unsigned long Filter::getSize() {
+    unsigned long cms_size=nb_bytes_after_fill_CMS-nb_bytes_before_fill_CMS;
+    // cms_size/=8; ru_maxrss seems to be already in Bytes.
+    return cms_size;
+}
+
+#endif
diff --git a/src/FqAuxBackend.cpp b/src/FqAuxBackend.cpp
index ef58d76..c237db3 100644
--- a/src/FqAuxBackend.cpp
+++ b/src/FqAuxBackend.cpp
@@ -20,7 +20,7 @@
 #include <iostream>
 using namespace std;
 
-//#define DEBUG
+// #define DEBUG
 
 int FqAuxBackend::getNextRead(rinfo * p_nr) {
     rinfo nr;
@@ -95,7 +95,7 @@ int FqAuxBackend::processBuffer(rinfo * p_nr) {
 #ifdef DEBUG
             store_id:
             { if (is_id==1) {
-                if (*pchar!='\/') current_id[idx_id]=*pchar;
+                if (*pchar!='/' and *pchar!=' ') current_id[idx_id]=*pchar;
                 else current_id[idx_id]='\0';
                 idx_id+=1;
             }
@@ -126,8 +126,9 @@ int FqAuxBackend::processBuffer(rinfo * p_nr) {
 
 
 void FqAuxBackend::readBuffer() {
-    if ((nread=read(f_desc,buf,bufsize))!=0) {
-        cur_offset=ftell(f_stream);
+    if ((nread=read(i_f_desc,buf,bufsize))!=0) {
+        cur_offset=lseek(i_f_desc,0,SEEK_CUR);
+//ftell(f_stream);
         pos_in_buf=0;
     }
 }
@@ -135,7 +136,7 @@ void FqAuxBackend::readBuffer() {
  * Opens file and performs the fist read operation.
  */
 void FqAuxBackend::openFile(char * ficname, unsigned char id) {
-    FqBaseBackend::openFile(ficname,id);
+    FqBaseBackend::openInputFile(ficname,id);
     buf=(char *) malloc(bufsize*sizeof(char));
     if (buf==NULL) {
             err(errno,"cannot allocate memory: %lu bytes.",bufsize);
@@ -144,8 +145,8 @@ void FqAuxBackend::openFile(char * ficname, unsigned char id) {
 }
 
 void FqAuxBackend::closeFile() {
-    if (filename!=NULL) {
-        FqBaseBackend::closeFile();
+    if (i_f_desc!=-1) {
+        FqBaseBackend::closeInputFile();
         free(buf);
         buf=NULL;
     }
diff --git a/src/FqAuxBackend.h b/src/FqAuxBackend.h
index b52805d..1317872 100644
--- a/src/FqAuxBackend.h
+++ b/src/FqAuxBackend.h
@@ -11,7 +11,7 @@
 #include "srp.h"
 #include "FqBaseBackend.h"
 
-const size_t bufsize=6048000; // It seems that I can't have a much bigger value than that or else my objects construction throws exception. Strange.
+
 // const size_t bufsize=500000; //try that in valgrind
 
 class FqAuxBackend:public FqBaseBackend {
diff --git a/src/FqBaseBackend.cpp b/src/FqBaseBackend.cpp
index 73d4ba9..473b0bc 100644
--- a/src/FqBaseBackend.cpp
+++ b/src/FqBaseBackend.cpp
@@ -4,72 +4,170 @@
  *  Created on: Jan 20, 2016
  *      Author: vlegrand
  */
-//#include <stdio.h>
+#include <string>
+#include <stdexcept>
 #include <fcntl.h>
 //#include <stdlib.h>
 #include <unistd.h>
 #include <errno.h>
 #include <err.h>
 
+
+
 #include "FqBaseBackend.h"
 
+//#define DEBUG
+#ifdef DEBUG
+#include <cassert>
+#include <iostream>
+using namespace std;
+#endif
+
 
-void FqBaseBackend::openFile(char * ficname, unsigned char id) {
+void FqBaseBackend::openInputFile(char * ficname, unsigned char id) {
     int st,s;
     // unsigned long cur_offset;
     mode_t mode = S_IRUSR | S_IWUSR | S_IRGRP | S_IROTH;
 
-    closeFile();
-    filename=ficname;
+    closeInputFile();
+    i_filename=ficname;
     f_id=id;
 
-    f_desc=open(filename,O_RDONLY,mode);
-    if (f_desc==-1) {
-        err(errno,"cannot open file: %s.",filename);
+    i_f_desc=open(i_filename,O_RDONLY,mode);
+    if (i_f_desc==-1) {
+        err(errno,"cannot open file: %s.",i_filename);
     }
 
-    f_stream=fdopen(f_desc,"r");
+    f_stream=fdopen(i_f_desc,"r");
     if (f_stream==NULL) {
-        err(errno,"cannot open file: %s.",filename);
+        err(errno,"cannot open file: %s.",i_filename);
     }
 }
 
-void FqBaseBackend::closeFile() {
-    if (filename!=NULL) {
-        close(f_desc);
-        filename=NULL;
-        f_desc=-1;
+void FqBaseBackend::closeInputFile() {
+    if (i_f_desc!=-1) {
+        close(i_f_desc);
+        // filename=NULL;
+        i_f_desc=-1;
         f_stream=NULL;
-        /*free(buf);
-        buf=NULL;*/
     }
 }
 
+void FqBaseBackend::setOutputFile(char * ofilename) {
+    o_filename=ofilename;
+}
+
+
+void FqBaseBackend::openInputFile() {
+    if (i_filename==NULL || f_id==0) throw std::runtime_error("No file currently associated to this backend");
+    if (i_f_desc!=-1) {
+        std::string err_msg("file: ");
+        err_msg+=i_filename;
+        err_msg+=" is already open!";
+        throw std::runtime_error(err_msg);
+    }
+    openInputFile(i_filename,f_id);
+}
+
+
+void FqBaseBackend::openOutputFile(){
+    mode_t mode = S_IRUSR | S_IWUSR | S_IRGRP | S_IROTH;
+    if (o_filename==NULL) throw std::runtime_error("No output file currently associated to this backend");
+    if (o_f_desc!=-1) {
+        std::string err_msg("file: ");
+        err_msg+=o_filename;
+        err_msg+=" is already open!";
+        throw std::runtime_error(err_msg);
+    }
+    o_f_desc=open(o_filename,O_WRONLY|O_CREAT|O_TRUNC,mode);
+    if (o_f_desc==-1) {
+        err(errno,"cannot open file: %s.",o_filename);
+    }
+}
+
+
+void FqBaseBackend::closeOutputFile() {
+    if (pos_in_w_buf!=o_buf) { // check if some fq records remains in buffer before closing file, if so, flush.
+        if (write(o_f_desc, o_buf, pos_in_w_buf-o_buf)==-1) err(errno,"cannot write in file: %s.",o_filename);
+        pos_in_w_buf=o_buf;
+    }
+    if (o_f_desc!=-1) {
+        if (close(o_f_desc)==-1) err(errno,"cannot close file: %s.",o_filename);
+        o_f_desc=-1;
+    }
+}
+
+void FqBaseBackend::writeToOutput(const unsigned long& offset) {
+    // static char * pos_in_w_buf;
+    if (o_buf==NULL) {
+        o_buf=(char *) malloc(FqBaseBackend::bufsize*sizeof(char));
+        pos_in_w_buf=o_buf;
+    }
+    if (o_buf+FqBaseBackend::bufsize-pos_in_w_buf<MAX_FQ_RECORD_LENGTH) {
+        // may not have enough place in buffer to store another fq record.
+        // => flush buffer into output file.
+        if (write(o_f_desc, o_buf, pos_in_w_buf-o_buf)==-1) err(errno,"cannot write in file: %s.",o_filename);
+        pos_in_w_buf=o_buf;
+    }
+
+    int fq_rec_size=getRead(offset,pos_in_w_buf); // here aim is to avoid multiple strcpy into buffer: read directly at the right place in the buffer.
+#ifdef DEBUG
+    cout<<"read "<<fq_rec_size<<" char from offset: "<<offset<<" and stored them in o_buf at position: "<<pos_in_w_buf<<endl;
+    cout<<"last char read: "<<*(pos_in_w_buf+fq_rec_size-1)<<endl;
+    assert(*(pos_in_w_buf+fq_rec_size-1)=='\n');
+    assert(*(pos_in_w_buf)=='@');
+#endif
+    pos_in_w_buf+=fq_rec_size;
+    *pos_in_w_buf='\0';
+#ifdef DEBUG
+    cout<<o_buf;
+#endif
+}
+
 /*
  * use C style char* rather than std::string for a matter of performance.
  * use read instead of fread for the same reason.
  *
  * Note: It is up to the caller to determine where the end of the record is (5th \n character in the fq_record string).
  */
-void FqBaseBackend::getRead(const long& offset, char * fq_record) {
+int FqBaseBackend::getRead(const unsigned long& offset, char * fq_record) {
 
-
-    //char fq_record[MAX_FQ_RECORD_LENGTH];
-
-    int nread,i,nb_lines;
+    int nread,i,nb_lines,fq_rec_size;
     char * pchar;
 
-    if (f_desc==-1) err(0,"No open file currently associated to this backend");
-    // if (f_stream==NULL) err(0,"No open file currently associated to this backend");
-
-    int res=lseek(f_desc,offset,SEEK_SET);
-    if (res==-1) err(errno,"fseek problem when trying to retrieve dna string.");
-    nread=read(f_desc,fq_record,MAX_FQ_RECORD_LENGTH);
-/*
-    i=0;
+    if (i_f_desc==-1) throw std::runtime_error("No open file currently associated to this backend");
+#ifdef DEBUG
+    cout<<"going to read record at offset: "<<offset<<endl;
+#endif
+    int res=lseek(i_f_desc,offset,SEEK_SET);
+    if (res==-1) {
+#ifdef DEBUG
+        cout<<"Couldn't get read at offset: "<<offset<<endl;
+#endif
+        throw errno;
+    }
+    nread=read(i_f_desc,fq_record,MAX_FQ_RECORD_LENGTH);
+#ifdef DEBUG
+    assert(nread<=MAX_FQ_RECORD_LENGTH);
+    assert(*(fq_record)=='@');
+    cout<<"read: "<<nread<<" char from input file"<<endl;
+#endif
+    nb_lines=0;
+    i=1;
     pchar=fq_record;
-    while (i<=nread-1) {
-
-    }*/
-
+    while(i<=nread) {
+        if (*pchar=='\n') {
+            nb_lines++;
+            if (nb_lines==4) {
+                fq_rec_size=i;
+                break;
+            }
+        }
+        pchar++;
+        i++;
+    }
+#ifdef DEBUG
+    cout<<"found that fq record size is : "<<fq_rec_size<<endl;
+#endif
+    return fq_rec_size;
 }
diff --git a/src/FqBaseBackend.h b/src/FqBaseBackend.h
index a5bec4a..29f7b2a 100644
--- a/src/FqBaseBackend.h
+++ b/src/FqBaseBackend.h
@@ -8,6 +8,9 @@
 #ifndef FQBASEBACKEND_H_
 #define FQBASEBACKEND_H_
 
+#include <cstdio>
+#include <stdlib.h>
+
 #include "FqConstants.h"
 #include "srp.h"
 
@@ -17,25 +20,53 @@
 class FqBaseBackend {
 
     // TODO: this class will also be associated to writing output "filtered" fastq files.
+    // TODO Refactor FqBackends. Surely there is no need to keep f_stream member since I don't call ftell anymore + should even be able to get rid of lseek system call to get position in file.
+    // I could compute offset myself since I am reading caracters from a text file...
 
 protected:
-    char * filename;
+    static const size_t bufsize=6048000; // It seems that I can't have a much bigger value than that or else my objects construction throws exception. Strange.
+    char * i_filename;
     unsigned char f_id;
-    int f_desc; // for calling read
+    int i_f_desc; // for calling read
     FILE * f_stream; // for calling ftell
 
+    // for writing output (filtered reads)
+    char * o_filename;
+    int o_f_desc;
+    char * o_buf;
+    char * pos_in_w_buf;
+
+    friend void test_processInputFiles();
+    friend void test_write_PE();
+
 public:
 
     FqBaseBackend() {
-        filename=NULL;
-        f_desc=-1;
+        i_filename=NULL;
+        i_f_desc=-1;
         f_stream=NULL;
         f_id=0;
+        o_f_desc=-1;
+        o_filename=NULL;
+        o_buf=NULL;
+        pos_in_w_buf=NULL;
+    }
+
+    ~FqBaseBackend() {
+        if (o_buf!=NULL) {
+            free(o_buf);
+            o_buf=NULL;
+        }
     }
 
-    void openFile(char * ficname, unsigned char id);
-    void closeFile();
-    void getRead(const long&,char *);
+    void openInputFile(char * ficname, unsigned char id);
+    void openInputFile();
+    void closeInputFile();
+    int getRead(const unsigned long&,char *);
+    void setOutputFile(char * ofilename);
+    void openOutputFile();
+    void writeToOutput(const unsigned long&);
+    void closeOutputFile();
 };
 
 
diff --git a/src/FqMainBackend.cpp b/src/FqMainBackend.cpp
index d79f22d..af0faa9 100644
--- a/src/FqMainBackend.cpp
+++ b/src/FqMainBackend.cpp
@@ -14,10 +14,17 @@
 #include <limits.h>
 #include <assert.h>
 #include <stdlib.h>
+#include <stdexcept>
+#include <sstream>
+#include <string>
+#include <iostream>
+
+#define _FILE_OFFSET_BITS 64 // for portability reasons on 32bits systems.
 
 //#define DEBUG
 
 #ifdef DEBUG
+#include <string.h>
 #include <iostream>
 using namespace std;
 #endif
@@ -26,7 +33,7 @@ using namespace std;
 #include "srp.h"
 
 
-FqMainBackend::FqMainBackend(srp * io_sr) {
+FqMainBackend::FqMainBackend(srp * io_sr):FqBaseBackend() {
     p_auxFqProcessor=NULL;
     p_scoreReadStruct=io_sr;
 }
@@ -37,10 +44,12 @@ void FqMainBackend::processFile(char * filename,unsigned char f_id) {
     int st,s;
     int cnt,nread;
     long cur_offset;
-    int nb_read_oper=0;
+    // int nb_read_oper=0;
     mode_t mode = S_IRUSR | S_IWUSR | S_IRGRP | S_IROTH;
     //cout<<"INT_MAX="<<INT_MAX<<endl;
     // cout<<filename<<endl;
+    this->i_filename=filename;
+    this->f_id=f_id;
     
     int f_single=open(filename,O_RDONLY,mode);
     if (f_single==-1) {
@@ -51,17 +60,20 @@ void FqMainBackend::processFile(char * filename,unsigned char f_id) {
     if (fp==NULL) {
         err(errno,"cannot open file: %s.",filename);
     }
-    cur_offset=ftell(fp);
-    char* buf=(char *) malloc(bufsize*sizeof(char));
+    //cur_offset=ftell(fp);
+    //cout<<"cur_offset="<<cur_offset<<endl;
+    char* buf=(char *) malloc(FqBaseBackend::bufsize*sizeof(char));
     if (buf==NULL) {
         err(errno,"cannot allocate memory: %lu bytes.",bufsize);
     }
     /* for each read, we want : offset, filenb, total quality score. */
-    while ((nread=read(f_single,buf,bufsize))!=0) {
-        nb_read_oper++;
+    while ((nread=read(f_single,buf,FqBaseBackend::bufsize))!=0) {
+        // nb_read_oper++;
         //cout<<"BE1: read operation nbr: "<<nb_read_oper<<endl;
         //printf("going to call ftell on : %p \n",fp);
-        cur_offset=ftell(fp);
+        //cur_offset=ftell(fp); // don't know why but it seems that this doesn't work under linux; always returns 0...
+        cur_offset = lseek(f_single, 0, SEEK_CUR);
+        //cout<<"cur_offset="<<cur_offset<<endl;
         processBuf((char *)buf,nread,f_id,cur_offset);
     }
     close(f_single);
@@ -69,16 +81,18 @@ void FqMainBackend::processFile(char * filename,unsigned char f_id) {
 }
 
 
-
-void FqMainBackend::processBuf(char * buf,int nread,unsigned char f_id,unsigned long cur_offset) {
-    int cnt=0;
-    unsigned int s;
-    static unsigned int st;
-    static int num_l_in_rec; /* counter to know on which line inside the fastq record we are */
-    static int qual_score=0;
-    static unsigned long rstart_offset;
 #ifdef DEBUG
-    static int nb_start;
+
+#define init_debug 1
+#define on_record_new 2
+#define on_record_end 3
+#define on_buf_end 4
+#define on_line_end 5
+#define on_store_read_id 6
+#define on_record_end_pe 7
+
+void FqMainBackend::debug_processBuf(int evt,int& cnt,int& nread,char * pchar,unsigned long& rstart_offset) { // put all the bebug stuff in a separate method so that processBuf is shorter and more "lisible".
+    static int nb_start; // number of fq record start and stop found in current buffer.
     static int nb_stop;
     static int tot_nb_stop=0;
     static int tot_nb_start=0;
@@ -88,6 +102,58 @@ void FqMainBackend::processBuf(char * buf,int nread,unsigned char f_id,unsigned
         nb_start=0;
         nb_stop=0;
     }
+
+    switch(evt) {
+        case on_record_new:
+            cout<<"nread="<<nread<<endl;
+            cout<<"cnt="<<cnt<<endl;
+            cout<<"rstart_offset="<<rstart_offset<<endl;
+            is_id=1;
+            idx_id=0;
+            nb_start++;
+            break;
+        case on_line_end:
+            is_id=0;
+            break;
+        case on_record_end:
+            nb_stop++;
+            cout<<"just finished processing : "<<endl;
+            cout<<current_id<<endl;
+            cout<<"j obttained: rstart_offset/UINT_MAX="<<rstart_offset/UINT_MAX<<endl;
+            break;
+        case on_store_read_id:
+            if (is_id==1) {
+                if (*pchar!='/' and *pchar !=' ') current_id[idx_id]=*pchar;
+                else current_id[idx_id]='\0';
+                idx_id+=1;
+            }
+            break;
+        case on_buf_end:
+            std::cout<<" Main BE position in buffer "<<cnt<<endl;
+            assert(cnt==nread);
+            cout<<"Main BE Found "<<nb_start<<" and "<<nb_stop<<" start/stop of record in this buffer."<<endl;
+            tot_nb_start+=nb_start;
+            tot_nb_stop+=nb_stop;
+            cout<<"Main BE Total cumulated number of start: "<<tot_nb_start<<" Total number of stop: "<<tot_nb_stop<<endl;
+            break;
+        case on_record_end_pe:
+            cout<<p_auxFqProcessor->current_id<<endl;
+            assert(strcmp(current_id,p_auxFqProcessor->current_id)==0);
+            break;
+        }
+    }
+#endif
+
+
+void FqMainBackend::processBuf(char * buf,int nread,unsigned char f_id,unsigned long cur_offset) {
+    int cnt=0;
+    unsigned int s;
+    static unsigned int st;
+    static int num_l_in_rec; /* counter to know on which line inside the fastq record we are */
+    static int qual_score=0;
+    static unsigned long rstart_offset;
+#ifdef DEBUG
+    debug_processBuf(init_debug,cnt,nread,NULL,rstart_offset);
 #endif
     char * pchar=buf;
     while (cnt<=nread-1) {
@@ -95,60 +161,46 @@ void FqMainBackend::processBuf(char * buf,int nread,unsigned char f_id,unsigned
             case k_read_id_start:
                 if (qual_score) goto inc_score;
                 else {
+                    rstart_offset=cur_offset-nread+cnt;
 #ifdef DEBUG
-                is_id=1;
-                idx_id=0;
-                nb_start++;
+    debug_processBuf(on_record_new,cnt,nread,NULL,rstart_offset);
 #endif
-                rstart_offset=cur_offset-nread+cnt;
-                num_l_in_rec=1; }
-                break;
+                    num_l_in_rec=1; }
+                    break;
             case k_read_qual_start:
                 qual_score=1;
                 st=0;
                 break;
             case '\n':
 #ifdef DEBUG
-                is_id=0;
+    debug_processBuf(on_line_end,cnt,nread,pchar,rstart_offset);
 #endif
                 num_l_in_rec+=1;
                 if (num_l_in_rec==5) {
-                    // std::cout<<"BE1 position in buffer "<<cnt+1<<endl; //add 1 to compare value with BE2.
                     qual_score=0;/* end of fastq record */
                     rpos rp=init_rpos(f_id,rstart_offset);
                     if (p_auxFqProcessor!=NULL) {
                         rinfo pe2info;
                         int eof=p_auxFqProcessor->getNextRead(&pe2info);
                         assert(!eof); // There should be the same number of reads in both PE files.
-
-                        // if (eof) cout<<"warning, reached eof in file PE2 after: "<<nb_read_PE1<<" reads in PE1"<<endl;
                         st+=pe2info.score;
-                        unsigned long j=rstart_offset/INT_MAX;
+                        unsigned long j=rstart_offset/UINT_MAX;
                         update_rpos(pe2info.f_id,pe2info.rstart_offset,j,&rp);
 #ifdef DEBUG
-                    nb_stop++;
-                    cout<<"Just processed : "<<endl;
-                        if (strcmp(current_id,"NS500443:42:H3MH2AFXX:1:11208:4026:13258")==0) {
-                            cout<<"put breakpoint here"<<endl;
-                        }
-                    cout<<current_id<<endl;
-                    cout<<p_auxFqProcessor->current_id<<endl;
-                    assert(strcmp(current_id,p_auxFqProcessor->current_id)==0);
+    debug_processBuf(on_record_end_pe,cnt,nread,pchar,rstart_offset);
 #endif
                     }
                     i_dim& ref_i_dim=(*p_scoreReadStruct)[st/K_SCORE_NORM_FACTOR];
-                    k_dim& ref_k_dim=ref_i_dim[rstart_offset/INT_MAX];
-                    ref_k_dim.push_back(rp); }
+                    k_dim& ref_k_dim=ref_i_dim[rstart_offset/UINT_MAX];
+#ifdef DEBUG
+    debug_processBuf(on_record_end,cnt,nread,pchar,rstart_offset);
+#endif
+                    ref_k_dim.push_back(rp);
+                 }
                 break;
             default:
 #ifdef DEBUG
-            store_id:
-            { if (is_id==1) {
-                if (*pchar!='\/') current_id[idx_id]=*pchar;
-                else current_id[idx_id]='\0';
-                idx_id+=1;
-            }
-            }
+            store_id: debug_processBuf(on_store_read_id,cnt,nread,pchar,rstart_offset);
 #endif
             inc_score:
                 { if (qual_score==1) {
@@ -163,13 +215,7 @@ void FqMainBackend::processBuf(char * buf,int nread,unsigned char f_id,unsigned
         cnt++;
     }
 #ifdef DEBUG
-    std::cout<<"BE1 position in buffer "<<cnt<<endl;
-    if (cnt==nread) {
-        cout<<"BE1 Found "<<nb_start<<" and "<<nb_stop<<" start/stop of record in this buffer."<<endl;
-        tot_nb_start+=nb_start;
-        tot_nb_stop+=nb_stop;
-        cout<<"BE1 Total cumulated number of start: "<<tot_nb_start<<" Total number of stop: "<<tot_nb_stop<<endl;  
-    }
+    debug_processBuf(on_buf_end,cnt,nread,pchar,rstart_offset);
 #endif
 }
 
diff --git a/src/FqMainBackend.h b/src/FqMainBackend.h
index c8b2b1a..db7414e 100644
--- a/src/FqMainBackend.h
+++ b/src/FqMainBackend.h
@@ -21,6 +21,9 @@ class FqMainBackend : public FqBaseBackend {
     srp * p_scoreReadStruct; /* Where we store information about the reads. */
     char current_id[50];
 
+    void debug_processBuf(int evt,int& cnt,int& nread,char * pchar, unsigned long &);
+
+    friend void test_processInputFiles();
 public:
     
     FqMainBackend(srp*);
diff --git a/src/ROCKparams.cpp b/src/ROCKparams.cpp
new file mode 100644
index 0000000..a863b2e
--- /dev/null
+++ b/src/ROCKparams.cpp
@@ -0,0 +1,287 @@
+/*
+ * ROCKparams.cpp
+ *
+ *  Created on: Jul 25, 2016
+ *      Author: vlegrand
+ */
+#include <iostream>
+#include <fstream>
+#include <string>
+#include <vector>
+#include <cmath>
+#include "ROCKparams.h"
+using namespace std;
+
+
+void ROCKparams::computeLambda() {
+    unsigned long tmp=parms.filter_size;
+    tmp*=1073741824; // this is in fact 1024*1024*1024.
+    parms.lambda=tmp/INT_MAX;
+    if (parms.kappa>get_mask<unsigned char>::value) parms.lambda=parms.lambda/sizeof(unsigned short);
+}
+
+
+void ROCKparams::processMainArgs(int optind, const int argc, char ** argv,std::vector<string>& v_input_lines) {
+            if (optind==argc) return; // no arguments
+            while (optind<argc) { // otherwise, only arguments expected are names of files to filter.
+                string iline=argv[optind];
+                v_input_lines.push_back(iline);
+                optind++;
+            }
+        }
+
+
+void ROCKparams::optArgConsistency(const string& input_file,const string& output_file,
+                                   const int& g,CMSparams& parms,const int& nb_k_mers,
+                                   const std::vector<string>& v_input_lines) {
+    if (input_file.empty() && v_input_lines.empty()) {
+        std::cout<<"You must provide filename via -i or arguments to indicate ROCK what to filter." <<std::endl;
+        usage(EXIT_FAILURE);
+    }
+    if (!input_file.empty() && !v_input_lines.empty()) {
+        std::cout<<"files to filter are provided via the -i option or as arguments. It cannot be both." <<std::endl;
+        usage(EXIT_FAILURE);
+    }
+    if (g!=0 and parms.lambda!=0) {// user set both lambda and cms size=> inconsistency.
+        cout<<"-l and -g options are mutually exclusive."<<endl;
+        usage(EXIT_FAILURE);
+    }
+    if (nb_k_mers!=0 and parms.lambda!=0) {// user set both lambda and number of k-mers=> inconsistency.
+        cout<<"-l and -n options are mutually exclusive."<<endl;
+        usage(EXIT_FAILURE);
+    }
+    float avail_mem=getNodePhysMemory()-defaultGRPMAXSize;
+    // cout<<avail_mem;
+    if (g>avail_mem) {
+        std::cout<<"This machine only has "<<getNodePhysMemory()<<" Gigabytes of RAM. This is not enough to run ROCK with a CMS of size: "<<g<<endl;
+        exit(EXIT_FAILURE);
+    } else if (g!=0) {
+        parms.filter_size=g;
+        computeLambda();
+    }
+    if (nb_k_mers) { // user indicated number of k-mers; use it to minimize parms.lambda
+        parms.lambda=getBestLambdaForN(nb_k_mers,parms.lambda);
+    }
+    if (parms.kappa_prime>=parms.kappa) {
+        cout<<"ERROR lower filter is higher than high filter!"<<endl;
+        exit(EXIT_FAILURE);
+    }
+
+    if (parms.lambda==0) {
+        // This happens when the user doesn't specify lambda nor g nor nb_k_mers.
+        computeLambda();
+        parms.lambda=min(parms.lambda,proposedLambda);
+        if (parms.lambda==0) {
+            cout<<"Not enough RAM on the machine. TotalRAM -1GB must be bigger than INT_MAX to allow at least 1 array in the CMS."<<endl;
+            exit(EXIT_FAILURE);
+        }
+    }
+#ifdef DEBUG
+    cout<<"parms.lambda="<<parms.lambda<<" INT_MAX="<<INT_MAX<<endl;
+#endif
+    unsigned long cms_size=INT_MAX;
+    cms_size*=parms.lambda;
+    //cout<<"minimum cms size:"<<cms_size<<endl;
+    if (parms.kappa>get_mask<unsigned char>::value) cms_size=cms_size*sizeof(unsigned short);
+    //cout<<"cms_size in B="<<cms_size<<endl;
+    cms_size=ceil(cms_size/1024.0/1024/1024); // convert to gigabytes.
+    //cout<<"cms_size in GB="<<cms_size<<endl;
+    if (cms_size>getNodePhysMemory()-defaultGRPMAXSize) {
+        cout<<"Not enough RAM on the machine to run rock with a CMS of size:"<<cms_size<<" GB."<<endl;
+        exit(EXIT_FAILURE);
+    }
+}
+
+
+/*
+ * Loads the content of a text file (containing input fastq file names to be filtered or names of files that ROCK must generate).
+ */
+int ROCKparams::loadFileArgs(const std::string& afile,std::vector<string>& v_lines) {
+    ifstream infiles_names(afile.c_str());
+    if (!infiles_names) cout<<"couldn't open file: "<<afile<<endl;
+    while (infiles_names) {
+       string iline;
+       if (!getline(infiles_names,iline)) break;
+       v_lines.push_back(iline);
+   }
+   if (!infiles_names.eof())
+   {
+       std::cout<<"error while reading input or output file"<<std::endl;
+       return EXIT_FAILURE;
+   }
+   return EXIT_SUCCESS;
+}
+
+/*
+ * Reads the names of input and output fastq files that ROCK must process from text files whose names are passed as
+ * argument of the -i/-o options. Fills the appropriate structures.
+ * orresponding output files are supposed to be in the same order as input files. No checking here. It is ut to the user to give something correct in input.
+ */
+int ROCKparams::loadInOutFileArgs(const std::string& input_file,const std::string& output_file,std::vector<string>& v_input_lines,std::vector<string>& v_output_lines) {
+    int reti=EXIT_SUCCESS;
+    int reto=EXIT_SUCCESS;
+    if (!input_file.empty()) {
+        reti=loadFileArgs(input_file,v_input_lines);
+    }
+    if (!output_file.empty()) {
+        reto=loadFileArgs(output_file,v_output_lines);
+    }
+    if (reti==EXIT_SUCCESS && reto==EXIT_SUCCESS) return EXIT_SUCCESS;
+    else return EXIT_FAILURE;
+}
+
+void ROCKparams::removePathfromFName(string& FName) {
+    std::size_t i_found2 =FName.find_last_of(path_sep); // remove path from filename.
+    if (i_found2!=std::string::npos) {
+        FName=FName.substr(i_found2+1);
+    }
+}
+
+void ROCKparams::changeExtension(string& FName) { // changes .fq into .rock.fq or adds .rock.fq
+    std::size_t o_found = FName.find_last_of(k_ext);
+    if (o_found!=std::string::npos) FName.replace(o_found,1,".rock.");
+    else FName.append(".rock.fq");
+}
+
+void ROCKparams::genOutFilenames(const std::vector<string>& v_input_lines,std::vector<string>& v_output_lines) {
+    std::vector<string>::const_iterator it_in;
+    string o_line;
+    for (it_in=v_input_lines.begin();it_in!=v_input_lines.end();++it_in) {
+        std::size_t i_found = (*it_in).find_first_of(k_sep_pair_end);
+        if (i_found!=std::string::npos) {// PE files are separared by a ','
+            string i_name_PE1=(*it_in).substr(0,i_found);
+            removePathfromFName(i_name_PE1);
+            string i_name_PE2=(*it_in).substr(i_found+1);
+            removePathfromFName(i_name_PE2);
+            changeExtension(i_name_PE1);
+            changeExtension(i_name_PE2);
+            o_line=i_name_PE1;
+            o_line+=k_sep_pair_end;
+            o_line.append(i_name_PE2);
+
+        } else {
+            o_line=*it_in;
+            removePathfromFName(o_line);
+            changeExtension(o_line);
+        }
+        v_output_lines.push_back(o_line);
+    }
+}
+
+int ROCKparams::processInOutFileArgs(const std::vector<string>& v_input_lines,std::vector<string>& v_output_lines,std::vector<IO_fq_files>& single_files,vector<PE_files>& v_PE_files,int& f_id) {
+    if (v_output_lines.empty())  {
+        // in that case, generate output filenames from input filenames
+        genOutFilenames(v_input_lines,v_output_lines);
+    }
+    if (v_input_lines.size()!=v_output_lines.size()) {
+        cout<< "Inconsistency between input and output files lists!"<<endl;
+        return EXIT_FAILURE;
+    } else {
+        std::vector<string>::const_iterator it_in;
+        std::vector<string>::const_iterator it_out;
+        it_in=v_input_lines.begin();
+        it_out=v_output_lines.begin();
+        while (it_in!=v_input_lines.end()) {
+            std::size_t i_found = (*it_in).find_first_of(k_sep_pair_end);
+            if (i_found!=std::string::npos) {
+                // this is PE
+                f_id+=2;
+                string i_name_PE1=(*it_in).substr(0,i_found);
+                string i_name_PE2=(*it_in).substr(i_found+1);
+                std::size_t o_found = (*it_out).find_first_of(k_sep_pair_end);
+                if (o_found==std::string::npos) {
+                    cout<< "Inconsistency between input and output files lists!"<<endl;
+                    return EXIT_FAILURE;
+                }
+                string o_name_PE1=(*it_out).substr(0,o_found);
+                checkDirExists(o_name_PE1);
+                string o_name_PE2=(*it_out).substr(o_found+1);
+                //cout<<o_name_PE2<<endl;
+                checkDirExists(o_name_PE2);
+                PE_files pe;
+                pe.PE1.in_fq_file=i_name_PE1;
+                pe.PE1.out_fq_file=o_name_PE1;
+                pe.PE2.in_fq_file=i_name_PE2;
+                pe.PE2.out_fq_file=o_name_PE2;
+                v_PE_files.push_back(pe);
+
+            } else {
+                // this is single.
+                f_id+=1;
+                IO_fq_files p;
+                p.in_fq_file=*it_in;
+                checkDirExists(*it_out);
+                p.out_fq_file=*it_out;
+                single_files.push_back(p);
+            }
+            ++it_in;
+            ++it_out;
+        }
+        if (f_id>k_max_input_files) {
+           cout<<"ROCK cannot handle more than "<<k_max_input_files<<" input files."<<endl;
+           return EXIT_FAILURE;
+        }
+    }
+    return EXIT_SUCCESS;
+}
+
+void ROCKparams::initFromMainOptsArgs(int argc,char ** argv) {
+        int i;
+        std::vector<string> v_input_lines;
+        std::vector<string> v_output_lines;
+
+        while((i = getopt(argc, argv, "i:o:l:k:c:C:g:n:vq:")) != -1) {
+          //printf("found option: %c\n",i);
+            switch(i) {
+                case 'i':
+                    input_file=optarg;break;
+                case 'c':
+                    parms.kappa_prime=atoi(optarg);break;
+                case 'h':
+                    usage(EXIT_SUCCESS); break;
+                case 'o':
+                    output_file=optarg; break;
+                case 'C':
+                    parms.kappa=atoi(optarg);
+                    if (parms.kappa<=0 || parms.kappa>get_mask<unsigned short>::value) {
+                        cout<<"Bad value for kappa. Must choose kappa so that 0<kappa<="<<get_mask<unsigned short>::value<<endl;
+                        usage(EXIT_FAILURE);
+                    }
+                    break;
+                case 'l':
+                    parms.lambda = atoi(optarg);
+                    if (parms.lambda<=0) {
+                        cout<<"Bad value for lambda. Choose a value that is >0 or let ROCK choose for you."<<endl;
+                        usage(EXIT_FAILURE);
+                    }
+                    break;
+                case 'k':
+                    k=atoi(optarg);
+                    if (k<=0 || k>32) {
+                        cout<<"Bad value for k. Must choose k so that 0<k<=32."<<endl;
+                        usage(EXIT_FAILURE);
+                    }
+                    break;
+                case 'n':
+                    nb_k_mers=atoi(optarg);break; // number of distinct k-mers
+                case 'g':
+                    // cout<<optarg<<endl;
+                    g=atoi(optarg);
+                    break;
+                case 'v':
+                    verbose_mode=1;
+                    break;
+                case 'q':
+                    parms.nucl_score_threshold=atoi(optarg);
+                    break;
+                default:
+                    usage(EXIT_FAILURE); break; }
+            }
+            processMainArgs(optind, argc, argv,v_input_lines);
+            optArgConsistency(input_file,output_file,g,parms,nb_k_mers,v_input_lines);
+            if (nb_k_mers) {
+                expected_collision_proba=getCollisionProba(nb_k_mers,parms.lambda);
+            }
+            if ((v_input_lines.empty() || v_output_lines.empty()) && (loadInOutFileArgs(input_file,output_file,v_input_lines,v_output_lines)==EXIT_FAILURE)) throw EXIT_FAILURE;
+            if (processInOutFileArgs(v_input_lines,v_output_lines,single_files,v_PE_files,f_id)!=EXIT_SUCCESS) throw EXIT_FAILURE;
+        }
diff --git a/src/ROCKparams.h b/src/ROCKparams.h
new file mode 100644
index 0000000..5aea5c9
--- /dev/null
+++ b/src/ROCKparams.h
@@ -0,0 +1,139 @@
+/*
+ * ROCKparams.h
+ *
+ *  Created on: Jul 25, 2016
+ *      Author: vlegrand
+ */
+
+#ifndef ROCKPARAMS_H_
+#define ROCKPARAMS_H_
+
+
+#include <cstdlib>
+#include <string>
+#include <vector>
+#include <getopt.h>
+#include "CountMinSketch.hpp"
+#include "main_utils.h"
+
+#define defaultGRPMAXSize 1 //(in gigabytes) Default maximum size of srp structure but of course this size depends of the number of reads we are processing.
+                            // 1 GB is enough to store approx 82 millions of reads (must take into account memory needed for stl containers).
+                            // This constant is used only if you use rock's default behavior (use 90% of the machine's RAM).
+                            // If you specify a lambda, it is possible to use more memory for storing more reads and less memory for the CMS.
+
+#define proposedLambda 4
+
+using namespace std;
+
+
+class ROCKparams{
+    CMSparams parms;
+    int g; // max RAM to use for the CMS if specified by the user.
+    int nb_k_mers; // expected number of k-mers in input data if specified by the user.
+    int k; // size of the k-mers
+    int verbose_mode;
+    std::string input_file,output_file;
+    //int nucl_score_threshold;
+
+    std::vector<IO_fq_files> single_files;
+    vector<PE_files> v_PE_files;
+    int f_id;
+    unsigned long cms_size;
+    float expected_collision_proba;
+
+
+    void computeLambda();
+    void processMainArgs(int optind, int argc, char ** argv,std::vector<string>& v_input_lines);
+    int loadInOutFileArgs(const std::string& input_file,const std::string& output_file,std::vector<string>& v_input_lines,std::vector<string>& v_output_lines);
+    int loadFileArgs(const std::string& afile,std::vector<string>& v_lines);
+    void removePathfromFName(string& FName);
+    void changeExtension(string& FName);
+    void genOutFilenames(const std::vector<string>& v_input_lines,std::vector<string>& v_output_lines);
+    int processInOutFileArgs(const std::vector<string>& v_input_lines,std::vector<string>& v_output_lines,std::vector<IO_fq_files>& single_files,vector<PE_files>& v_PE_files,int& f_id);
+
+    /*
+     * Checks options and arguments consistency (ex kappa_prime not superior to kappa; output file directory exists and so on...)
+     * Also set some CMS parameters depending on value of other options.
+    */
+    void optArgConsistency(const string& input_file,const string& output_file,
+                           const int& g,CMSparams& parms,const int& nb_k_mers,
+                           const std::vector<string>& v_input_lines);
+
+    friend void test_processIOFileArgs();
+
+public:
+
+    ROCKparams() {
+        f_id=0; // to generate id of input/output fastq files. +1=total number of files.
+        g=0;
+        k=30;
+        nb_k_mers=0;
+        parms.kappa=50;
+        parms.kappa_prime=0;
+        parms.lambda=0;
+        verbose_mode=0;
+        cms_size=0;
+        expected_collision_proba=0.0;
+        //nucl_score_threshold=0;
+        parms.filter_size=getNodePhysMemory()/100.0*90-defaultGRPMAXSize; // Prefer not to use all the machine's memory
+        if (parms.filter_size==0) throw EXIT_FAILURE;
+    }
+
+
+
+    void initFromMainOptsArgs(int argc,char ** argv);
+
+    CMSparams getCMSparams() {
+        return parms;
+    }
+
+    int get_f_id() {
+        return f_id;
+    }
+
+    std::vector<IO_fq_files> get_single_files() {
+        return single_files;
+    }
+
+    vector<PE_files> get_PE_files() {
+        return v_PE_files;
+    }
+
+    int get_k() {
+        return k;
+    }
+
+    void printVerboseInfo() {
+        std::vector<IO_fq_files>::iterator it_s;
+        vector<PE_files>::iterator it_pe;
+        cout<<"Input files: "<<endl;
+        cout<<"single:"<<endl;
+        for (it_s=single_files.begin();it_s!=single_files.end();it_s++) {
+            cout<<"    "<<it_s->in_fq_file<<endl;
+        }
+        cout<<"pair-end:"<<endl;
+        for (it_pe=v_PE_files.begin();it_pe!=v_PE_files.end();it_pe++) {
+            cout<<"    "<<it_pe->PE1.in_fq_file<<" "<<it_pe->PE2.in_fq_file<<endl;
+        }
+        cout<<endl;
+        cout<<"k="<<k<<endl;
+        cout<<"kappa="<<parms.kappa<<endl;
+        cout<<"kappa prime="<<parms.kappa_prime;
+        cout<<endl;
+        cout<<"CMS size="<<cms_size<<" Bytes for "<<parms.lambda<<" arrays."<<endl;
+        cout<<endl;
+        if (nb_k_mers!=0) cout<<"expected probability of collision was: "<<expected_collision_proba<<endl;
+    }
+
+    void setFilterSize(unsigned long fsize) {
+        cms_size=fsize;
+    }
+
+    int is_verbose() {
+        return verbose_mode;
+    }
+
+};
+
+
+#endif /* ROCKPARAMS_H_ */
diff --git a/src/ReadProcessor.h b/src/ReadProcessor.h
index d5a26c5..be4d4de 100644
--- a/src/ReadProcessor.h
+++ b/src/ReadProcessor.h
@@ -8,6 +8,11 @@
 #include <vector>
 #include <math.h>
 
+//#define DEBUG
+#ifdef DEBUG
+#include <iostream>
+using namespace std;
+#endif
 
 class ReadProcessor {
 
@@ -33,7 +38,7 @@ class ReadProcessor {
 
     friend void testDNAToNumberSimple();
 
-    inline unsigned long nucleoToNumber(char s) {
+    unsigned long nucleoToNumber(char s) {
         unsigned long nbr;
         switch(s)
         {
@@ -53,13 +58,16 @@ class ReadProcessor {
                 nbr=0;
                 break;
             default:
+#ifdef DEBUG
+cout<<"found unexpected character in DNA string: "<<s<<endl;
+#endif
                 throw -1; // TODO Benchmark this inside try catch statement to see if try catch+exception really costs so long.
                           // throw an integer for the moment. An exception object may not be the most optimal choice in terms of performance.
         }
         return nbr;
     }
 
-    inline unsigned long nucleoToNumberReverse(char s,int i) {
+    unsigned long nucleoToNumberReverse(char s,int i) {
         unsigned long nbr=0;
         char cpl=nucleo_rev_cpl[s];
         nbr=nucleoToNumber(cpl);
@@ -82,8 +90,6 @@ public:
     unsigned long kMerToNumberReverse(char * k_m,unsigned long * p_prev);
 
 
-
-
     unsigned long kMerToNumber(char * k_m,unsigned long * p_prev);
 
 
diff --git a/src/fqwriter.cpp b/src/fqwriter.cpp
new file mode 100644
index 0000000..6ca2278
--- /dev/null
+++ b/src/fqwriter.cpp
@@ -0,0 +1,77 @@
+/*
+ * fqwriter.cpp
+ *
+ *  Created on: Mar 15, 2016
+ *      Author: vlegrand
+ *      Here gather functions to write filtered fastq records to output files
+ */
+
+#include <map>
+#include "srp.h"
+#include "FqBaseBackend.h"
+
+//#define DEBUG
+#ifdef DEBUG
+#include <iostream>
+using namespace std;
+#endif
+
+
+// TODO this looks a little bit like getDnaStr in read_utils.cpp. Some refactoring could be useful. Think about
+// classes to encapsulate that without decreasing perfs.
+void writeFilteredFastq(FqBaseBackend* map_id_backend[],int nb_be, const srp& io_sr){
+    srp::const_reverse_iterator it;
+    i_dim::const_iterator it_offs;
+    k_dim::const_iterator it_struct;
+
+    unsigned char f_id1;
+    unsigned char f_id2;
+    unsigned char fid_stored;
+
+    // 1rst step, open files before fetching/writing reads from/to them
+    int i;
+    for (i=0;i<nb_be;i++){
+         map_id_backend[i]->openInputFile();
+         map_id_backend[i]->openOutputFile();
+    }
+
+    for (it=io_sr.rbegin(); it!=io_sr.rend(); ++it) {
+        for (it_offs=it->second.begin();it_offs!=it->second.end();it_offs++) {
+            unsigned long j=it_offs->first;
+            for (it_struct=it_offs->second.begin();it_struct!=it_offs->second.end();it_struct++) {
+                if (it_struct->fileid) {
+                    fid_stored=it_struct->fileid;
+                    f_id1=fid_stored >>4;
+                    f_id2=fid_stored &mask_fid;
+                    unsigned long offset1=j*UINT_MAX+it_struct->read_a1;
+#ifdef DEBUG
+     cout<<"going to output record with: j="<<j<<"read_a1="<<it_struct->read_a1<<endl;
+     cout<<"j*UINT_MAX+it_struct->read_a1 = "<<j*UINT_MAX+it_struct->read_a1<<endl;
+     cout<<"offset1="<<offset1<<endl;
+     cout<<"f_id1-1="<<f_id1-1<<endl;
+#endif
+                    FqBaseBackend * be=map_id_backend[f_id1-1];
+                    be->writeToOutput(offset1);
+                    if (f_id2!=0) { // case of PE reads.
+                        unsigned long offset2=it_struct->read_a2+offset1;
+#ifdef DEBUG
+    cout<<"f_id2-1="<<f_id2-1<<endl;
+    cout<<"offset2="<<offset2<<endl;
+#endif
+                        map_id_backend[f_id2-1]->writeToOutput(offset2);
+                    }
+                }
+            }
+        }
+    }
+
+    // last step, close files.
+    for (i=0;i<nb_be;i++){
+         map_id_backend[i]->closeInputFile();
+         map_id_backend[i]->closeOutputFile();
+    }
+}
+
+
+
+
diff --git a/src/fqwriter.h b/src/fqwriter.h
new file mode 100644
index 0000000..97d90b4
--- /dev/null
+++ b/src/fqwriter.h
@@ -0,0 +1,15 @@
+/*
+ * fqwriter.h
+ *
+ *  Created on: Mar 15, 2016
+ *      Author: vlegrand
+ */
+
+#ifndef FQWRITER_H_
+#define FQWRITER_H_
+
+void writeFilteredFastq(FqBaseBackend* map_id_backend[],int nb_be, const srp& io_sr);
+
+
+
+#endif /* FQWRITER_H_ */
diff --git a/src/main_utils.cpp b/src/main_utils.cpp
new file mode 100644
index 0000000..dc1ba44
--- /dev/null
+++ b/src/main_utils.cpp
@@ -0,0 +1,118 @@
+/*
+ * main_utils.cpp
+ *
+ *  Created on: May 9, 2016
+ *      Author: vlegrand
+ */
+#include <stdint.h>
+#include <unistd.h>
+#include <sys/types.h>
+#include <sys/sysctl.h>
+#include <sys/stat.h>
+#include <string.h>
+#include <iostream>
+#include <fstream>
+#include <cmath>
+#include "main_utils.h"
+
+using namespace std;
+
+/*
+ * Use this function to get the amount of RAM in GB on the machine (used or not).
+ * Aim is to make sure that ROCK can run on the current machine with the requirements that the user gave.
+ */
+unsigned long getNodePhysMemory() {
+    uint64_t mem = 0;
+
+#if defined(_SC_PHYS_PAGES) && defined(_SC_PAGESIZE)
+    mem = sysconf(_SC_PHYS_PAGES);
+    mem *= sysconf(_SC_PAGESIZE);
+    mem /=  1 * 1024 * 1024 * 1024;
+#elif __APPLE__
+    size_t len = sizeof(mem);
+    int ret=sysctlbyname("hw.memsize", (void*) &mem, &len, NULL,0);
+    if (ret==-1) {
+        cout<<"Couldn't determine how much RAM is usable on your system."<<errno<<endl;
+	mem=0;
+    }
+    mem /=  1 * 1024 * 1024 * 1024;
+#else
+    cout<<"ROCK has not been tested on this operating system, please contact author."<<endl;
+#endif
+
+    return (unsigned long)mem;
+}
+
+
+/*
+ * Given a filename (including full path), determine if parent directory exists.
+ * If is doesn't, display error message and exit.
+ */
+void checkDirExists(const string o_file) {
+    std::size_t o_found = o_file.find_last_of("/");
+    if (o_found!=string::npos) {
+        string parent_dir=o_file.substr(0,o_found);
+        // cout<<parent_dir<<endl;
+        struct stat info;
+        if (stat(parent_dir.c_str(),&info)!=0) {
+            cout<<"parent directory for output files: "<<parent_dir<<" doesn't exist."<<endl;
+            exit(EXIT_FAILURE);
+        }
+    }
+}
+
+
+/*
+ * Minimize lambda for a given number of k-mers.
+ * We want p<=0.01,
+ * so choose smallest lambda so that [1-(1-1/m)exp n] exp lambda<=0.01
+ */
+int getBestLambdaForN(const unsigned long& nb_k_mers,int lambda_max) {
+    int lambda=2;
+    int min_lambda=lambda;
+    if (lambda_max==0) { // no upper bound specified by the user via the -g option
+        lambda_max=500;
+    }
+    long double tmp=1.0/INT_MAX;
+    tmp=1.0-tmp;
+    tmp=pow(tmp,nb_k_mers);
+    tmp=1.0-tmp;
+    while (lambda<=lambda_max) {
+        min_lambda=lambda;
+        long double p=pow(tmp,lambda);
+        if (p<=0.01) break;
+        lambda+=1;
+    }
+    return min_lambda;
+}
+
+/*
+ * Compute collision probability
+ */
+float getCollisionProba(const unsigned long& nb_k_mers,const int& lambda) {
+    long double tmp=1.0/INT_MAX;
+    tmp=1.0-tmp;
+    tmp=pow(tmp,nb_k_mers);
+    tmp=1.0-tmp;
+    long double p=pow(tmp,lambda);
+    if (p<0.0001) p=0;
+    // rounding
+    p=p*1000+0.5;
+    return floor(p)/1000;
+    //return p;
+}
+
+void usage(int status) {
+  cout<<"usage: rock [options] [args]"<<endl<<endl;
+  cout<<"    -i <file>      .... file name containing the list of the FASTQ files to process."<<endl;
+  cout<<"    -o <file>      .... file name containing the list of the output FASTQ file names."<<endl;
+  cout<<"    -h             .... Print this message and exit."<<endl;
+  cout<<"    -k <int>       .... k-mer size. (default 30)."<<endl;
+  cout<<"    -c <int>       .... lower coverage threshold (default: 0)."<<endl;
+  cout<<"    -C <int>       .... upper coverage threshold (default: 50; max: 65535)."<<endl;
+  cout<<"    -l <int>       .... size of the count min sketch (default: at most 4, depending on the available RAM)"<<endl;
+  cout<<"    -n <int>       .... (expected) number of distinct k-mers within the processed reads."<<endl;
+  cout<<"    -g <int>       .... maximum RAM to use (in Gb) for the CMS."<<endl;
+  cout<<"    -v             .... verbose"<<endl;
+  exit(status); }
+
diff --git a/src/main_utils.h b/src/main_utils.h
new file mode 100644
index 0000000..ed50a9c
--- /dev/null
+++ b/src/main_utils.h
@@ -0,0 +1,29 @@
+/*
+ * main_utils.h
+ *
+ *  Created on: May 9, 2016
+ *      Author: vlegrand
+ */
+
+#ifndef MAIN_UTILS_H_
+#define MAIN_UTILS_H_
+
+#define k_max_input_files 15
+#define k_sep_pair_end ','
+#define k_ext '.'
+#define path_sep '/'
+
+#include <string>
+#include <vector>
+#include "rock_commons.h"
+
+unsigned long getNodePhysMemory();
+void checkDirExists(const std::string o_file);
+/*int loadInOutFileArgs(const std::string& input_file,const std::string& output_file,std::vector<std::string>& v_input_lines,std::vector<std::string>& v_output_lines);
+int processInOutFileArgs(const std::vector<std::string>& v_input_lines,std::vector<std::string>& v_output_lines,std::vector<IO_fq_files>& single_files,std::vector<PE_files>& v_PE_files,int& f_id);*/
+int getBestLambdaForN(const unsigned long& nb_k_mers,int lambda_max);
+float getCollisionProba(const unsigned long& nb_k_mers,const int& lambda);
+void usage(int status);
+
+
+#endif /* MAIN_UTILS_H_ */
diff --git a/src/rock_commons.h b/src/rock_commons.h
new file mode 100644
index 0000000..e27fa05
--- /dev/null
+++ b/src/rock_commons.h
@@ -0,0 +1,46 @@
+/*
+ * rock_types2.h
+ *
+ *  Created on: Jan 20, 2016
+ *      Author: vlegrand
+ *      Gather here typedefs and structures useful for the main program and "inter-modules" data exchange.
+ *      I divided rock into 4 "modules":
+ *      1- fqreader (parses fastq and fills 3D array of structures representing all reads).
+ *      2- read-utils (utility functions for DNA reads processing)
+ *      3- CMS (fill and use).
+ *      4- fqwriter (writes fq filtered by CMS).
+ */
+
+#ifndef ROCK_COMMONS_H_
+#define ROCK_COMMONS_H_
+
+#include <string>
+#include <vector>
+#include "rock_commons.h"
+#include "FqBaseBackend.h"
+
+/*
+ * Gather here type and constants definitions that are common to some of the 4 different modules in ROCK
+ * (fqreader, read processing, CMS filling, result writing) and to the main program.
+ *
+ */
+
+#define k_max_input_files 15
+
+typedef struct {
+    std::string in_fq_file;
+    std::string out_fq_file;
+} IO_fq_files;
+
+typedef struct {
+    IO_fq_files PE1;
+    IO_fq_files PE2;
+}PE_files;
+
+
+typedef std::vector<unsigned long> readNumericValues;
+
+
+
+
+#endif /* ROCK_COMMONS_H_ */
diff --git a/src/rock_types.h b/src/rock_types.h
deleted file mode 100644
index fe80bac..0000000
--- a/src/rock_types.h
+++ /dev/null
@@ -1,29 +0,0 @@
-/*
- * rock_types2.h
- *
- *  Created on: Jan 20, 2016
- *      Author: vlegrand
- *      Gather here typedefs and structures useful for the main program and "inter-modules" data exchange.
- *      I divided rock into 4 "modules":
- *      1- fqreader (parses fastq and fills 3D array of structures reprensenting all reads).
- *      2- read-utils (utility functions for DNA reads processing)
- *      3- CMS (fill and use).
- *      4- fqwriter (writes fq filtered by CMS).
- */
-
-#ifndef ROCK_TYPES_H_
-#define ROCK_TYPES_H_
-
-#include <map>
-#include "FqBaseBackend.h"
-
-/*typedef struct {
-    FqBaseBackend& fq_be;
-
-}fq_io;*/
-
-// typedef std::map<unsigned char,FqBaseBackend&> fq_file_map;
-
-#define k_max_input_files 15
-
-#endif /* ROCK_TYPES_H_ */
diff --git a/src/srp_old.h b/src/srp_old.h
deleted file mode 100644
index 89f06b6..0000000
--- a/src/srp_old.h
+++ /dev/null
@@ -1,30 +0,0 @@
-/*
- * srp.h
- *
- *  Created on: Dec 8, 2015
- *      Author: vlegrand
- *
- *      SRP stands for score-read position. Indeed, this structure assoiates a score with a read's position inthe input fq file.
- */
-
-#ifndef SRP_H_
-#define SRP_H_
-
-typedef struct { /* Here store read offset in file whose id is fileid.*/
-    char fileid;
-    unsigned long read_a1;
-}rpos;
-
-char ** l_files; /* array of filenames; indexed on fileid */
-
-typedef rpos *** srp;
-
-/*
- * Physically, srp is :
- *  An array indexed on read total score (Arr1).
- *  Arr1 contains pointers to other other arrays (Arr2).
- *  Arr2 is indexed on something that is deduced from offset (read position in a file).
- *  Arr2 contains pointers to array of rpos structures.
- */
-
-#endif /* SRP_H_ */
diff --git a/src/unit_test_cms.cpp b/src/unit_test_cms.cpp
new file mode 100644
index 0000000..3ae712c
--- /dev/null
+++ b/src/unit_test_cms.cpp
@@ -0,0 +1,99 @@
+/*
+ * unit_test_cms.cpp
+ *
+ *  Created on: Feb 9, 2016
+ *      Author: vlegrand
+ *
+ *  Here, gather the tests for the ROCK's main component: the CMS.
+ */
+#include <iostream>
+#include <assert.h>
+#include <climits>
+
+using namespace std;
+#include "CountMinSketch.hpp"
+#include "main_utils.h"
+
+
+void test_CMS(int lambda,int kappa,int kappa_prime) {
+    CountMinSketch<unsigned char> cms(lambda,kappa,kappa_prime);
+    int i;
+    cout<<"size of the CMS component: "<<sizeof(cms)<<endl;
+    int num=100*lambda;
+    int rej_expected=0;
+    int ret;
+    for (i=0;i<num;i++) {
+        cms.addKMer(num);
+    }
+    // Now, check that our k-mer is present in the CMS.
+    int min=cms.getEstimatedNbOcc(num);
+    std::cout<<"min="<<min<<endl;
+    assert((min==num) || (min==num-get_mask<unsigned char>::value-1)); // addKmer doesn't check kappa.
+    
+    unsigned long nb_distinct_k_mers=cms.getNbDistinctKMers();
+    assert(nb_distinct_k_mers==1);
+
+    // mimic a read (as given by part 2 output).
+    readNumericValues read_values;
+    for (i=1;i<=400;i++) {
+        read_values.push_back(i*1000-1);
+    }
+    ret=cms.addRead(read_values); // read should be accepted since none of the values that it contains is equal to those I inserted previously.
+    assert(ret!=rej_expected);
+
+    nb_distinct_k_mers=cms.getNbDistinctKMers();
+    assert(nb_distinct_k_mers==401);
+
+    // mimic a vector that contains a lot of k_mers already present in the CMS and check that it is rejected.
+    readNumericValues read_values2;
+    for (i=1;i<=199;i++) {
+        read_values2.push_back(i*1000-1);
+    }
+    for (i=200;i<=400;i++) {
+        read_values2.push_back(num);
+    }
+    ret=cms.addRead(read_values2);
+    assert(ret==rej_expected);
+
+    nb_distinct_k_mers=cms.getNbDistinctKMers();
+    assert(nb_distinct_k_mers==401);
+
+    // test that reads with median cov<kappa_prime are rejected.
+    ret=cms.isBeneathMinKappa(read_values);
+    assert(ret>0);
+}
+
+
+
+int main(int argc, char **argv) {
+    int lambda=2;
+    int kappa=50;
+    int kappa_prime=20;
+    cout<<"INT_MAX="<<INT_MAX<<endl;
+    cout<<"UINT_MAX="<<UINT_MAX<<endl;
+    cout<<"LONG_MAX="<<LONG_MAX<<endl;
+    cout<<"ULONG_MAX="<<ULONG_MAX<<endl;
+    cout<<"ULONG_MAX/UINT_MAX="<<ULONG_MAX/UINT_MAX<<endl; // max value for j
+    cout<<"ULONG_MAX%UINT_MAX="<<(ULONG_MAX-1)%UINT_MAX<<endl;
+    cout<<"sizeof(short)="<<sizeof(short)<<endl;
+    cout<<"sizeof(int)="<<sizeof(int)<<endl;
+    cout<<"sizeof(long)="<<sizeof(long)<<endl;
+
+    cout<<"checking that your machine has enough RAM to run test"<<endl;
+    unsigned long ram=getNodePhysMemory();
+    cout<<"machine has: "<<ram<<" GB of RAM"<<endl;
+
+    if (ram<5) {
+        cout<<"!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!"<<endl;
+        cout<<" WARNING: skipping this test, it requires at least 4 gigabytes of RAM to run."<<endl;
+        cout<<"!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!"<<endl;
+        return -1;
+    }
+    
+    if (argc==1) {
+        cout<<"testing CMS with lambda="<<lambda<<endl;
+        test_CMS(lambda,kappa,kappa_prime); // Finally using C arrays (maps implied storing hash keys : 4 Bytes per k_mer overhead) but each array is of size INT_MAX...
+        cout<<"done"<<endl;
+    }
+    return 0;
+}
diff --git a/src/unit_test_fqreader.cpp b/src/unit_test_fqreader.cpp
index cca5adf..786de57 100644
--- a/src/unit_test_fqreader.cpp
+++ b/src/unit_test_fqreader.cpp
@@ -7,12 +7,15 @@
  *      Keep using assert for the moment, don't want to add a dependency on boost (or any other test framework) just for the tests.
  */
 #include <stdio.h>
+#include <string.h>
 #include <iostream>
 #include <limits.h>
 #include <assert.h>
 #include <stdlib.h>
+#include "rock_commons.h"
 #include "FqConstants.h"
 #include "srp.h"
+#include "FqMainBackend.h"
 #include "fqreader.h"
 
 // TODO : Add test case where @ character is inside quality score.
@@ -23,7 +26,7 @@ void test_processSingleFile() {
     //printf("MAX_UINT=%u \n",UINT_MAX);
     srp sr;
     unsigned char f_id=1;
-    processSingleFile((char *) "../data/test_single.fq",f_id,&sr);
+    processSingleFile((char *) "../test/data/unit/test_single.fq",f_id,&sr);
     srp::reverse_iterator rit;
     i_dim::iterator it_offs;
     k_dim::iterator it_struct;
@@ -36,7 +39,8 @@ void test_processSingleFile() {
         assert(score==5);
         for (it_offs=rit->second.begin();it_offs!=rit->second.end();it_offs++) {
             unsigned long offset_quotient=it_offs->first;
-            assert(offset_quotient==0);
+            cout<<"offset_quotient="<<offset_quotient<<endl;
+	    assert(offset_quotient==0);
             for (it_struct=it_offs->second.begin();it_struct!=it_offs->second.end();it_struct++) {
                 unsigned char fid_stored=it_struct->fileid;
                 assert(fid_stored >>4==f_id);
@@ -55,9 +59,73 @@ void test_processSingleFile() {
     assert(cnt_read==6);
 }
 
+/*
+ * Test case with other data than those I had until here.
+ * Quality score contains '@'caracter (usually start of fastq record),
+ * reads are longer,
+ * id and '+' line contain additional information.
+ */
+void test_processPEfilesWithA() {
+
+    char * fq_3_test=(char *) "../test/data/unit/klebsiella_PE1.fq";
+    char * fq_4_test=(char *) "../test/data/unit/klebsiella_PE2.fq";
+
+    unsigned char f_id3=3;
+    unsigned char f_id4=4;
+
+    srp sr;
+    processPEFiles(fq_3_test, f_id3,fq_4_test, f_id4,&sr);
+    srp::reverse_iterator rit;
+    i_dim::iterator it_offs;
+    k_dim::iterator it_struct;
+    int cnt_read=0;
+
+    unsigned char masque=0x0F;
+
+    for (rit=sr.rbegin(); rit!=sr.rend(); ++rit) { //process map in reverse order (by decreasing scores).
+        cout << "score="<<rit->first<<endl;
+        unsigned long score=rit->first;
+        /*if (cnt_read==0 || cnt_read==1) assert(score==10);
+        if (cnt_read==2) assert(score==9);*/
+        for (it_offs=rit->second.begin();it_offs!=rit->second.end();it_offs++) {
+            unsigned long offset_quotient=it_offs->first;
+            assert(offset_quotient==0);
+            for (it_struct=it_offs->second.begin();it_struct!=it_offs->second.end();it_struct++) {
+                unsigned char fid_stored=it_struct->fileid;
+                assert(fid_stored >>4==f_id3);
+                assert((fid_stored &masque)==f_id4);
+                if (cnt_read==0) {
+                    assert(it_struct->read_a1==0);
+                    assert(it_struct->read_a1==0);
+                }
+                if (cnt_read==6) {
+                    // std::cout<<it_struct->read_a1<<" "<<it_struct->read_a2;
+                    assert(score==18);
+                    assert(it_struct->read_a1==558);
+                    assert(it_struct->read_a2==-2);
+                }
+                if (cnt_read==3) {
+                    // std::cout<<it_struct->read_a1<<" "<<it_struct->read_a2;
+                    assert(score==19);
+                    assert(it_struct->read_a1==1114);
+                    assert(it_struct->read_a2==0);
+                }
+                cnt_read++;
+
+                int tmp1=fid_stored >>4;
+                int tmp2=fid_stored &masque;
+                cout<<" fileid1="<<tmp1<<" read_a1="<<it_struct->read_a1<<endl;
+                cout<<" fileid2="<<tmp2<<" read_a2="<<it_struct->read_a2<<endl;
+            }
+        }
+    }
+    assert(cnt_read==10);
+
+}
+
 void test_processPEFiles() {
-    char * fq_1_test=(char *) "../data/test_PE1.fq";
-    char * fq_2_test=(char *) "../data/test_PE2.fq";
+    char * fq_1_test=(char *) "../test/data/unit/test_PE1.fq";
+    char * fq_2_test=(char *) "../test/data/unit/test_PE2.fq";
 
     unsigned char f_id1=1;
     unsigned char f_id2=2;
@@ -91,12 +159,12 @@ void test_processPEFiles() {
                 if (cnt_read==1) {
                     std::cout<<it_struct->read_a1<<" "<<it_struct->read_a2;
                     assert(it_struct->read_a1==349);
-                    assert(it_struct->read_a2==349);
+                    assert(it_struct->read_a2==0);
                 }
                 if (cnt_read==2) {
                     std::cout<<it_struct->read_a1<<" "<<it_struct->read_a2;
                     assert(it_struct->read_a1==698);
-                    assert(it_struct->read_a2==698);
+                    assert(it_struct->read_a2==0);
                 }
                 cnt_read++;
                 
@@ -110,25 +178,12 @@ void test_processPEFiles() {
     assert(cnt_read==3);
 }
 
-void test_processAllFiles() {
-    char * fq_1_test=(char *) "../data/test_PE1.fq";
-    char * fq_2_test=(char *) "../data/test_PE2.fq";
-    char * fq_single=(char *) "../data/test_single.fq";
-
-    unsigned char f_id1=1;
-    unsigned char f_id2=2;
-    unsigned char f_single=3;
-
-    srp sr;
-
-    processPEFiles(fq_1_test, f_id1,fq_2_test, f_id2,&sr);
-    processSingleFile(fq_single,f_single,&sr);
 
+void check_processAIFilesResults(srp& sr) {
     srp::reverse_iterator rit;
     i_dim::iterator it_offs;
     k_dim::iterator it_struct;
     int cnt_read=0;
-
     for (rit=sr.rbegin(); rit!=sr.rend(); ++rit) { //process map in reverse order (by decreasing scores).
         //cout << "score="<<rit->first<<endl;
         unsigned long score=rit->first;
@@ -149,6 +204,71 @@ void test_processAllFiles() {
     assert(cnt_read==9);
 }
 
+void test_processAllFiles() {
+    char * fq_1_test=(char *) "../test/data/unit/test_PE1.fq";
+    char * fq_2_test=(char *) "../test/data/unit/test_PE2.fq";
+    char * fq_single=(char *) "../test/data/unit/test_single.fq";
+
+    unsigned char f_id1=1;
+    unsigned char f_id2=2;
+    unsigned char f_single=3;
+
+    srp sr;
+
+    processPEFiles(fq_1_test, f_id1,fq_2_test, f_id2,&sr);
+    processSingleFile(fq_single,f_single,&sr);
+
+    check_processAIFilesResults(sr);
+}
+
+
+void test_processInputFiles() {
+    char * fq_1_test=(char *) "../test/data/unit/test_PE1.fq";
+    char * fq_2_test=(char *) "../test/data/unit/test_PE2.fq";
+    char * fq_single=(char *) "../test/data/unit/test_single.fq";
+
+    IO_fq_files s;
+    s.in_fq_file=fq_single;
+
+    vector<IO_fq_files> v_single;
+    v_single.push_back(s);
+
+    PE_files pe;
+    pe.PE1.in_fq_file=fq_1_test;
+    pe.PE2.in_fq_file=fq_2_test;
+    vector<PE_files> v_pe;
+    v_pe.push_back(pe);
+
+    srp sr;
+    
+    FqBaseBackend * array_be[k_max_input_files];
+    processInputFiles(v_single,v_pe,array_be,&sr);
+
+    // check that result is correct in sr.
+    check_processAIFilesResults(sr);
+
+    // check that the 3 backends are correct
+    FqMainBackend * pbe=(FqMainBackend *) array_be[0]; // TODO see if one can use check_case, static_cast or one of them if they are not in boost.
+    FqAuxBackend * pbe2=(FqAuxBackend *) array_be[2];
+    FqMainBackend * pbe3=(FqMainBackend *) array_be[1];
+    
+    assert(strcmp(pbe->i_filename,fq_single)==0);
+    assert(pbe->f_id==1);
+    assert(pbe->p_auxFqProcessor==NULL);
+
+    assert(pbe3->p_auxFqProcessor==pbe2);
+    assert(strcmp(pbe3->i_filename,fq_1_test)==0);
+    assert(pbe3->f_id==2);
+
+    assert(strcmp(pbe2->i_filename,fq_2_test)==0);
+    assert(pbe2->f_id==3);
+
+
+    int i;
+    for (i=0;i<3;i++) delete array_be[i];
+    //free(array_be);
+
+}
 
 
 int main(int argc, char **argv) {
@@ -156,6 +276,11 @@ int main(int argc, char **argv) {
     test_processSingleFile();
     cout<<"test for PE files"<<endl;
     test_processPEFiles();
+    cout<<"test the case of records that contain @ character in quality score"<<endl;
+    test_processPEfilesWithA();
     cout<<"test for both single and PE files"<<endl;
     test_processAllFiles(); /* mix PE together with single; nearly as in real life.*/
+    cout<<"testing higher level function processInputFiles"<<endl;
+    test_processInputFiles();
+    cout<<"done"<<endl;
 }
diff --git a/src/unit_test_fqwriter.cpp b/src/unit_test_fqwriter.cpp
new file mode 100644
index 0000000..69d107f
--- /dev/null
+++ b/src/unit_test_fqwriter.cpp
@@ -0,0 +1,141 @@
+/*
+ * unit_test_fqwriter.cpp
+ *
+ *  Created on: Mar 14, 2016
+ *      Author: vlegrand
+ */
+#include <cstdio>
+#include <cassert>
+#include <unistd.h>
+#include <fcntl.h>
+#include <string.h>
+#include "rock_commons.h"
+#include "FqConstants.h"
+#include "srp.h"
+#include "FqMainBackend.h"
+#include "fqwriter.h"
+
+#include <iostream>
+using namespace std;
+
+#define DEBUG
+
+
+char expected_content_PE1 []="@SRR1222430.3 3 length=236\n\
+CAAACACCTGACGCGGTTCCAGCAGGTACTCCTGCACGCCAATTTCCGGGCGGGCAGTAAAGCGCTGTTTGCAGCCCGTCTGGTGCAGGCGCCCCAGATAGCGGCCAACCCATTCCATCTGATCAAGGTTATCCGCTTCGAACTGACGACCGCCAAGGCTTGGGAAAACGGCAAAGTAGAATCCCTGATGCTGATGAAGCGTGCTGTCATTAAATAAGAGCGGCGCAGCAACGGGC\n\
++SRR1222430.3 3 length=236\n\
+CCCCCFFCFFFFGGGGGGGGGGHHHHHFGHHHHHHHHGGGGGHHHHHGGGGGGGGGGHHHHHHGGGGGHHHHHHHHGGGGHGHGHHGGHGGGGGGGGHHHHHGGGGGHGGGGHHHHGHHHHHHHHHHHHHHHHHGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFFFFABF\n\
+@SRR1222430.2 2 length=250\n\
+AGAAATTCGCCATCAGAATAAAAACCTCATATGCACATTTTCTTGTTATTGCACAGCCTGTGCCACTTTAGCGCCAGCCTCTCCGGCAATCGTGGAGAAATTAAGGAGATAGTGTAATTTATCATGTTGCTTTTGCCGTATCGTAAAGAAACCTCGAGCTTTCCTGCCAGCAGGTAGCGAGTCTGCTTCGTCACCGCAGACCGGCGCATTATCCCTTGCCGGTGTGAAACCTCATTTCATTTAAGTCAAA\n\
++SRR1222430.2 2 length=250\n\
+BBBBBFFFBBBBFGGGGGGGGGHHGGHHHHHHHHGFGHHHHHHHHGHHHFFFHHFHHHHHHEHGFHHHFGFGFGGGEGGFH@@HGCGGGHHGHHGGHFAFHHHEGFHHGGHHFHFHHHHHEHHHHHHHHHHHGHHHGGGGHHGHFGGFDGFGFHGEGFCDHGGHHHHHHHGHHEHHGHGGGGHGFHHEHGHGGGGDFGGGHHGADA?DBGGGGGGFFFFBBFFFFFFFFFFFFFFFFFBFFFFFFFFF/B\n\
+@SRR1222430.1 1 length=251\n\
+GCCCGCGAAGCGGAGCTGGCCGCCTGCAAAGGCCGTTCGCGCTCGCTGTCGCTGGATCTGTACGCCCAGTGGCGCTGCATGGAGGACAACCACGGCAAGTGGCGCTTCACCTCGCCGACCCATACCGTGCTGGCCTTCGCCCAGGCGCTGAAAGAGCTGGCGCAGGAGGGCGGCGTCAGCGCTCGCCATCAGCGCTACCGCAACAATCAGCGCCGTCTGGTGGCAGGGATGCGCGCGCTCGGCTTCCGGCC\n\
++SRR1222430.1 1 length=251\n\
+CCCCCCCCCBBCGGCGGGGG@GGGGGHHHGHBHH@GGHGGGGGGGGG@GHGHGGGHHHHHHHHHGGGGGHHHFCGGGGHHHGHHGGHHHHGGGGCCGGGGHFFGGGGGHHHHHGGGGGGCGHHHHGGGGGGGGGGGGGGGGGGAEGGFFFFFFFFFFFFFFAFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEDFFFFFFFFFFF:DA;CCFFBBFDAFFFAFFFFFFFFA-9A>DFFFFFBFFB\n\
+";
+
+
+char expected_content_PE2[]="@SRR1222430.3 3 length=236\n\
+GCCCGTTGCTGCGCCGCTCTTATTTAATGACAGCACGCTTCATCAGCATCAGGGATTCTACTTTGCCGTTTTCCCAAGCCTTGGCGGTCGTCAGTTCGAAGCGGATAACCTTGATCAGATGGAATGGGTTGGCCGCTATCTGGGGCGCCTGCACCAGACGGGCTGCAAACAGCGCTTTACTGCCCGCCCGGAAATTGGCGTGCAGGAGTACCTGCTGGAACCGCGTCAGGTGTTTG\n\
++SRR1222430.3 3 length=236\n\
+?BBABBFBBFFFGGGGGGGGGGHHHHHHHHHHFHHHGGGGGHHHHHHHGHHHHHGHGHHHHHHHGHFEGGHGHHHHHHGGHHHHHGGGEGGGHGHHHGHHGGCGGGDHHHHHHHHGHHGHGHHHHHHFHGGGHFGGGGGHHHHEFGGCFGHHHHGGFGGGGGGGGGGGGGGGGGFFFEFFFFFFFBFFFFF=;ABFF/FA:DB;BF.9.BFFFFFFF/AFFFFFABDFFB/9BD.;\n\
+@SRR1222430.2 2 length=251\n\
+AGAAATTCGCCAGGGTGATCAACGTCTCATCGTCGGCGAGGGTCAGCGCCTGCGCGGGACAGTTTTCCACACAGGCCGGCCCCGCCTCGCGGCCCTGGCATAGATCGCACTTGTGCGCGCTGGCTTTCACCAGGCCTGCGGCCTGCGGCGTCACCACCACCTGCATCACCCCGAACGGGCAGGCCACCATGCAGGATTTACAGCCAATGCATTTCTCCTGACGGACCTGAACGCTGTCGCCGGACTGGGCG\n\
++SRR1222430.2 2 length=251\n\
+>1>AAFFF@11AEGGFFCGGGGGFGHFH2FF1F00EEE/@AEE0FGGFGEGGHGGCGC?EEFHEFEEHDF1EECHEFE/@@/BCCCFGAC@CC@C.CEGFHFHGHFHCEC?FH;CC?CG@@?-AF.BB0BFGF?E./EF;@?;AFF@<-@@??BFF?F-:A?BF999BBBF@@?@@@F-;@B@FF-A-9FF/BFFE/F//B/BBEFBFFFFF/BFFFFFFFEB?-@=B-/BBF--:;/A-B>--;>?EFE9\n\
+@SRR1222430.1 1 length=250\n\
+CGATGCTGCGCTGCATCAATAAGCTGGAAGAGATCACCAGCGGCGATCTGATTGTCGATGGTCTGAAGGTCAACGACCCGAAGGTGGACGAACGTCTGATTCGTCAGGAAGCCGGGATGGTTTTCCAGCAGTTTTATCTGTTCCCGCACCTCACGGCGCTGGAAAACGTGATGTTTGGCCCGCTGCGGGTACGCGGCGCCAGCAAGCAGGCGGCGAGTGCAGGCTATCGTCGAGCAGCGGCCGGAAGCCG\n\
++SRR1222430.1 1 length=250\n\
+CCCCCCFFFCCCGGGGGGGGGGHHHHHHHHGHHHHHHHHHHGGGGGGGGHHGHHHHGHGHGHHHHHHHHHFHHHGGGGGGGGGGBFFHHGGGGGGHHGGHHHGHGGGHHHHHHGGGGGGGFGHGHHHHHHHHHGHHHFHHHHHHDFGGGGHHHHHGGAGGGGGGGGGGGGGGGFGGGFFFFFFFFFFFA=@FDF-BFFFFFFFFFFFFFEDFBDFFF-:FFFFFF/BFFFEFFFFFFFFFFF;--:DEFF\n\
+";
+
+
+
+void test_write_PE() {
+    srp sr;
+    srp::reverse_iterator rit;
+    i_dim::iterator it_offs;
+    k_dim::iterator it_struct;
+
+    // step 1 : fill srp with fake data
+    rpos rp=init_rpos(1,1114);
+    update_rpos(2,1114,0,&rp);
+
+    rpos rp2=init_rpos(1,558);
+    update_rpos(2,556,0,&rp2);
+
+    rpos rp3=init_rpos(1,0);
+    update_rpos(2,0,0,&rp3);
+
+    i_dim& ref_i_dim=sr[600];
+    k_dim& ref_k_dim=ref_i_dim[0];
+    ref_k_dim.push_back(rp);
+
+    i_dim& ref_i_dim2=sr[500];
+    k_dim& ref_k_dim2=ref_i_dim2[0];
+    ref_k_dim2.push_back(rp2);
+
+    i_dim& ref_i_dim3=sr[450];
+    k_dim& ref_k_dim3=ref_i_dim3[0];
+    ref_k_dim3.push_back(rp3);
+
+    // step2 : create the backends
+    FqBaseBackend * map_id_backend[k_max_input_files];
+    FqMainBackend * be_fq1=new FqMainBackend(&sr);
+    unsigned char f_id1=1;
+    FqAuxBackend * be_fq2=new FqAuxBackend();
+    map_id_backend[0]=be_fq1;
+    map_id_backend[1]=be_fq2;
+
+    be_fq1->i_filename=(char *) "../test/data/unit/klebsiella_PE1.fq";
+    be_fq1->f_id=1;
+    be_fq2->f_id=2;
+    be_fq2->i_filename=(char *) "../test/data/unit/klebsiella_PE2.fq";
+    be_fq1->setOutputFile((char *) "../test/data/unit/klebsiella_PE1_filtered.fq");
+    be_fq2->setOutputFile((char *) "../test/data/unit/klebsiella_PE2_filtered.fq");
+
+    writeFilteredFastq(map_id_backend,2, sr);
+    
+    // step 4 : re-read output files and check their content.
+    mode_t mode = S_IRUSR | S_IWUSR | S_IRGRP | S_IROTH;
+    int f_pe1=open((char *) "../test/data/unit/klebsiella_PE1_filtered.fq",O_RDONLY,mode);
+    assert(f_pe1!=-1);
+    char* buf=(char *) malloc(FqBaseBackend::bufsize*sizeof(char)); // test files are very small, bufsize is  enough to read them entirely.
+    assert(buf!=NULL);
+    int nread=read(f_pe1,buf,FqBaseBackend::bufsize);
+    assert(nread<FqBaseBackend::bufsize);
+    // std::cout<<buf;
+#ifdef DEBUG
+    int i;
+    for (i=0;i<nread;i++) {
+        if (buf[i]!=expected_content_PE1[i]) cout<<" character at position"<<i<<" differs: "<<buf[i]<<"!="<<expected_content_PE1[i]<<endl;
+    }
+#endif
+    assert(strcmp(buf,expected_content_PE1)==0);
+    int f_pe2=open((char *) "../test/data/unit/klebsiella_PE2_filtered.fq",O_RDONLY,mode);
+    assert(f_pe2!=-1);
+    nread=read(f_pe2,buf,FqBaseBackend::bufsize);
+    assert(nread<FqBaseBackend::bufsize);
+#ifdef DEBUG
+    for (i=0;i<nread;i++) {
+        if (buf[i]!=expected_content_PE2[i]) cout<<" character at position"<<i<<" differs: "<<buf[i]<<"!="<<expected_content_PE1[i]<<endl;
+    }
+#endif
+    assert(strcmp(buf,expected_content_PE2)==0);
+    free(buf);
+
+
+    // step5 : remove output files from disk
+    
+    assert(remove((char *) "../test/data/unit/klebsiella_PE1_filtered.fq")==0);
+    assert(remove((char *) "../test/data/unit/klebsiella_PE2_filtered.fq")==0);
+
+}
+
+int main(int argc, char **argv) {
+    test_write_PE();
+
+}
+
+
diff --git a/src/unit_test_main_utils.cpp b/src/unit_test_main_utils.cpp
new file mode 100644
index 0000000..5d05fa1
--- /dev/null
+++ b/src/unit_test_main_utils.cpp
@@ -0,0 +1,113 @@
+/*
+ * test_main_utils.cpp
+ *
+ *  Created on: May 25, 2016
+ *      Author: vlegrand
+ */
+
+#include <iostream>
+#include <cassert>
+#include <string>
+#include <cmath>
+
+
+using namespace std;
+
+#include "rock_commons.h"
+#include "main_utils.h"
+#include "ROCKparams.h"
+
+void test_processIOFileArgs() {
+    std::vector<IO_fq_files> single_files;
+    vector<PE_files> v_PE_files;
+    std::vector<string> v_input_lines;
+    std::vector<string> v_output_lines;
+    ROCKparams main_parms;
+    int f_id=0;
+    int ret=main_parms.loadInOutFileArgs("../test/data/unit/list_input1.txt","../test/data/unit/list_output1.txt",v_input_lines,v_output_lines);
+    assert(ret==EXIT_SUCCESS);
+    ret=main_parms.processInOutFileArgs(v_input_lines,v_output_lines,single_files,v_PE_files,f_id);
+    assert(ret==EXIT_FAILURE);
+    f_id=0;
+    v_PE_files.clear();
+    single_files.clear();
+    v_input_lines.clear();
+    v_output_lines.clear();
+    ret=main_parms.loadInOutFileArgs("../test/data/unit/list_input2.txt","../test/data/unit/list_output2.txt",v_input_lines,v_output_lines);
+    ret=main_parms.processInOutFileArgs(v_input_lines,v_output_lines,single_files,v_PE_files,f_id);
+    assert(ret==EXIT_FAILURE);
+    f_id=0;
+    v_PE_files.clear();
+    single_files.clear();
+    v_input_lines.clear();
+    v_output_lines.clear();
+    ret=main_parms.loadInOutFileArgs("../test/data/unit/list_input3.txt","../test/data/unit/list_output3.txt",v_input_lines,v_output_lines);
+    ret=main_parms.processInOutFileArgs(v_input_lines,v_output_lines,single_files,v_PE_files,f_id);
+    assert(ret==EXIT_SUCCESS);
+    assert(f_id==14);
+    assert(single_files.size()==2);
+    assert(v_PE_files.size()==6);
+    IO_fq_files s=single_files[0];
+    assert(s.in_fq_file.compare("fifi")==0);
+    assert(s.out_fq_file.compare("ofifi")==0);
+    PE_files s2=v_PE_files[5];
+    assert(s2.PE2.in_fq_file.compare("nono")==0);
+    assert(s2.PE2.out_fq_file.compare("onono")==0);
+
+    v_output_lines.clear();
+    v_input_lines.clear();
+    v_PE_files.clear();
+    single_files.clear();
+    ret=main_parms.loadInOutFileArgs("../test/data/unit/list_input3.txt","",v_input_lines,v_output_lines);
+    ret=main_parms.processInOutFileArgs(v_input_lines,v_output_lines,single_files,v_PE_files,f_id);
+    s=single_files[0];
+    assert(s.out_fq_file.compare("fifi.rock.fq")==0);
+    s2=v_PE_files[5];
+    assert(s2.PE2.out_fq_file.compare("nono.rock.fq")==0);
+
+}
+
+
+void test_getBestLambdaForN() {
+    int lambda_max=10;
+    unsigned long nb_k_mer=200000000;
+    int best=getBestLambdaForN(nb_k_mer,lambda_max);
+    assert(best==2);
+    nb_k_mer=600000000;
+       best=getBestLambdaForN(nb_k_mer,lambda_max);
+    assert(best==4);
+    nb_k_mer=2000000000;
+    best=getBestLambdaForN(nb_k_mer,lambda_max);
+    // cout<<best<<endl;
+    assert(best==10);
+    nb_k_mer=10000000000;
+    best=getBestLambdaForN(nb_k_mer,lambda_max);
+    assert(best==lambda_max);
+}
+
+void test_getCollisionProba() {
+    float p =getCollisionProba(1,2);
+    // cout<<p<<endl;
+    assert(p==0.0);
+    p =getCollisionProba(1000000000,2);
+    // cout<<p<<endl;
+    assert(floor(p*1000+0.5)==139);
+    p =getCollisionProba(1000000000,4);
+    assert(floor(p*1000+0.5)==19);
+    p =getCollisionProba(20000000000,10);
+    assert(floor(p*1000+0.5)==999);
+}
+
+
+int main() {
+    cout<<"testing main_utils"<<endl;
+    cout<<"testing processing of IOFile arguments ( following 2 error messages are what is expected; don't worry)."<<endl;
+    test_processIOFileArgs();
+    cout<<"test computation of the bast lambda value depending on nb distinct k-mers."<<endl;
+    test_getBestLambdaForN();
+    cout<<"testing computation of collision probability."<<endl;
+    test_getCollisionProba();
+    cout<<"done"<<endl;
+}
+
+
-- 
GitLab