diff --git a/configure b/configure
deleted file mode 100755
index 6eb122b1cafc9d13e738295e60405f1e27c063fb..0000000000000000000000000000000000000000
--- a/configure
+++ /dev/null
@@ -1,4664 +0,0 @@
-#! /bin/sh
-# Guess values for system-dependent variables and create Makefiles.
-# Generated by GNU Autoconf 2.69 for rock 1.9.5.
-#
-#
-# Copyright (C) 1992-1996, 1998-2012 Free Software Foundation, Inc.
-#
-#
-# This configure script is free software; the Free Software Foundation
-# gives unlimited permission to copy, distribute and modify it.
-## -------------------- ##
-## M4sh Initialization. ##
-## -------------------- ##
-
-# Be more Bourne compatible
-DUALCASE=1; export DUALCASE # for MKS sh
-if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then :
-  emulate sh
-  NULLCMD=:
-  # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which
-  # is contrary to our usage.  Disable this feature.
-  alias -g '${1+"$@"}'='"$@"'
-  setopt NO_GLOB_SUBST
-else
-  case `(set -o) 2>/dev/null` in #(
-  *posix*) :
-    set -o posix ;; #(
-  *) :
-     ;;
-esac
-fi
-
-
-as_nl='
-'
-export as_nl
-# Printing a long string crashes Solaris 7 /usr/bin/printf.
-as_echo='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\'
-as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo
-as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo$as_echo
-# Prefer a ksh shell builtin over an external printf program on Solaris,
-# but without wasting forks for bash or zsh.
-if test -z "$BASH_VERSION$ZSH_VERSION" \
-    && (test "X`print -r -- $as_echo`" = "X$as_echo") 2>/dev/null; then
-  as_echo='print -r --'
-  as_echo_n='print -rn --'
-elif (test "X`printf %s $as_echo`" = "X$as_echo") 2>/dev/null; then
-  as_echo='printf %s\n'
-  as_echo_n='printf %s'
-else
-  if test "X`(/usr/ucb/echo -n -n $as_echo) 2>/dev/null`" = "X-n $as_echo"; then
-    as_echo_body='eval /usr/ucb/echo -n "$1$as_nl"'
-    as_echo_n='/usr/ucb/echo -n'
-  else
-    as_echo_body='eval expr "X$1" : "X\\(.*\\)"'
-    as_echo_n_body='eval
-      arg=$1;
-      case $arg in #(
-      *"$as_nl"*)
-	expr "X$arg" : "X\\(.*\\)$as_nl";
-	arg=`expr "X$arg" : ".*$as_nl\\(.*\\)"`;;
-      esac;
-      expr "X$arg" : "X\\(.*\\)" | tr -d "$as_nl"
-    '
-    export as_echo_n_body
-    as_echo_n='sh -c $as_echo_n_body as_echo'
-  fi
-  export as_echo_body
-  as_echo='sh -c $as_echo_body as_echo'
-fi
-
-# The user is always right.
-if test "${PATH_SEPARATOR+set}" != set; then
-  PATH_SEPARATOR=:
-  (PATH='/bin;/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 && {
-    (PATH='/bin:/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 ||
-      PATH_SEPARATOR=';'
-  }
-fi
-
-
-# IFS
-# We need space, tab and new line, in precisely that order.  Quoting is
-# there to prevent editors from complaining about space-tab.
-# (If _AS_PATH_WALK were called with IFS unset, it would disable word
-# splitting by setting IFS to empty value.)
-IFS=" ""	$as_nl"
-
-# Find who we are.  Look in the path if we contain no directory separator.
-as_myself=
-case $0 in #((
-  *[\\/]* ) as_myself=$0 ;;
-  *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-    test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break
-  done
-IFS=$as_save_IFS
-
-     ;;
-esac
-# We did not find ourselves, most probably we were run as `sh COMMAND'
-# in which case we are not to be found in the path.
-if test "x$as_myself" = x; then
-  as_myself=$0
-fi
-if test ! -f "$as_myself"; then
-  $as_echo "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2
-  exit 1
-fi
-
-# Unset variables that we do not need and which cause bugs (e.g. in
-# pre-3.0 UWIN ksh).  But do not cause bugs in bash 2.01; the "|| exit 1"
-# suppresses any "Segmentation fault" message there.  '((' could
-# trigger a bug in pdksh 5.2.14.
-for as_var in BASH_ENV ENV MAIL MAILPATH
-do eval test x\${$as_var+set} = xset \
-  && ( (unset $as_var) || exit 1) >/dev/null 2>&1 && unset $as_var || :
-done
-PS1='$ '
-PS2='> '
-PS4='+ '
-
-# NLS nuisances.
-LC_ALL=C
-export LC_ALL
-LANGUAGE=C
-export LANGUAGE
-
-# CDPATH.
-(unset CDPATH) >/dev/null 2>&1 && unset CDPATH
-
-# Use a proper internal environment variable to ensure we don't fall
-  # into an infinite loop, continuously re-executing ourselves.
-  if test x"${_as_can_reexec}" != xno && test "x$CONFIG_SHELL" != x; then
-    _as_can_reexec=no; export _as_can_reexec;
-    # We cannot yet assume a decent shell, so we have to provide a
-# neutralization value for shells without unset; and this also
-# works around shells that cannot unset nonexistent variables.
-# Preserve -v and -x to the replacement shell.
-BASH_ENV=/dev/null
-ENV=/dev/null
-(unset BASH_ENV) >/dev/null 2>&1 && unset BASH_ENV ENV
-case $- in # ((((
-  *v*x* | *x*v* ) as_opts=-vx ;;
-  *v* ) as_opts=-v ;;
-  *x* ) as_opts=-x ;;
-  * ) as_opts= ;;
-esac
-exec $CONFIG_SHELL $as_opts "$as_myself" ${1+"$@"}
-# Admittedly, this is quite paranoid, since all the known shells bail
-# out after a failed `exec'.
-$as_echo "$0: could not re-execute with $CONFIG_SHELL" >&2
-as_fn_exit 255
-  fi
-  # We don't want this to propagate to other subprocesses.
-          { _as_can_reexec=; unset _as_can_reexec;}
-if test "x$CONFIG_SHELL" = x; then
-  as_bourne_compatible="if test -n \"\${ZSH_VERSION+set}\" && (emulate sh) >/dev/null 2>&1; then :
-  emulate sh
-  NULLCMD=:
-  # Pre-4.2 versions of Zsh do word splitting on \${1+\"\$@\"}, which
-  # is contrary to our usage.  Disable this feature.
-  alias -g '\${1+\"\$@\"}'='\"\$@\"'
-  setopt NO_GLOB_SUBST
-else
-  case \`(set -o) 2>/dev/null\` in #(
-  *posix*) :
-    set -o posix ;; #(
-  *) :
-     ;;
-esac
-fi
-"
-  as_required="as_fn_return () { (exit \$1); }
-as_fn_success () { as_fn_return 0; }
-as_fn_failure () { as_fn_return 1; }
-as_fn_ret_success () { return 0; }
-as_fn_ret_failure () { return 1; }
-
-exitcode=0
-as_fn_success || { exitcode=1; echo as_fn_success failed.; }
-as_fn_failure && { exitcode=1; echo as_fn_failure succeeded.; }
-as_fn_ret_success || { exitcode=1; echo as_fn_ret_success failed.; }
-as_fn_ret_failure && { exitcode=1; echo as_fn_ret_failure succeeded.; }
-if ( set x; as_fn_ret_success y && test x = \"\$1\" ); then :
-
-else
-  exitcode=1; echo positional parameters were not saved.
-fi
-test x\$exitcode = x0 || exit 1
-test -x / || exit 1"
-  as_suggested="  as_lineno_1=";as_suggested=$as_suggested$LINENO;as_suggested=$as_suggested" as_lineno_1a=\$LINENO
-  as_lineno_2=";as_suggested=$as_suggested$LINENO;as_suggested=$as_suggested" as_lineno_2a=\$LINENO
-  eval 'test \"x\$as_lineno_1'\$as_run'\" != \"x\$as_lineno_2'\$as_run'\" &&
-  test \"x\`expr \$as_lineno_1'\$as_run' + 1\`\" = \"x\$as_lineno_2'\$as_run'\"' || exit 1"
-  if (eval "$as_required") 2>/dev/null; then :
-  as_have_required=yes
-else
-  as_have_required=no
-fi
-  if test x$as_have_required = xyes && (eval "$as_suggested") 2>/dev/null; then :
-
-else
-  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-as_found=false
-for as_dir in /bin$PATH_SEPARATOR/usr/bin$PATH_SEPARATOR$PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  as_found=:
-  case $as_dir in #(
-	 /*)
-	   for as_base in sh bash ksh sh5; do
-	     # Try only shells that exist, to save several forks.
-	     as_shell=$as_dir/$as_base
-	     if { test -f "$as_shell" || test -f "$as_shell.exe"; } &&
-		    { $as_echo "$as_bourne_compatible""$as_required" | as_run=a "$as_shell"; } 2>/dev/null; then :
-  CONFIG_SHELL=$as_shell as_have_required=yes
-		   if { $as_echo "$as_bourne_compatible""$as_suggested" | as_run=a "$as_shell"; } 2>/dev/null; then :
-  break 2
-fi
-fi
-	   done;;
-       esac
-  as_found=false
-done
-$as_found || { if { test -f "$SHELL" || test -f "$SHELL.exe"; } &&
-	      { $as_echo "$as_bourne_compatible""$as_required" | as_run=a "$SHELL"; } 2>/dev/null; then :
-  CONFIG_SHELL=$SHELL as_have_required=yes
-fi; }
-IFS=$as_save_IFS
-
-
-      if test "x$CONFIG_SHELL" != x; then :
-  export CONFIG_SHELL
-             # We cannot yet assume a decent shell, so we have to provide a
-# neutralization value for shells without unset; and this also
-# works around shells that cannot unset nonexistent variables.
-# Preserve -v and -x to the replacement shell.
-BASH_ENV=/dev/null
-ENV=/dev/null
-(unset BASH_ENV) >/dev/null 2>&1 && unset BASH_ENV ENV
-case $- in # ((((
-  *v*x* | *x*v* ) as_opts=-vx ;;
-  *v* ) as_opts=-v ;;
-  *x* ) as_opts=-x ;;
-  * ) as_opts= ;;
-esac
-exec $CONFIG_SHELL $as_opts "$as_myself" ${1+"$@"}
-# Admittedly, this is quite paranoid, since all the known shells bail
-# out after a failed `exec'.
-$as_echo "$0: could not re-execute with $CONFIG_SHELL" >&2
-exit 255
-fi
-
-    if test x$as_have_required = xno; then :
-  $as_echo "$0: This script requires a shell more modern than all"
-  $as_echo "$0: the shells that I found on your system."
-  if test x${ZSH_VERSION+set} = xset ; then
-    $as_echo "$0: In particular, zsh $ZSH_VERSION has bugs and should"
-    $as_echo "$0: be upgraded to zsh 4.3.4 or later."
-  else
-    $as_echo "$0: Please tell bug-autoconf@gnu.org about your system,
-$0: including any error possibly output before this
-$0: message. Then install a modern shell, or manually run
-$0: the script under such a shell if you do have one."
-  fi
-  exit 1
-fi
-fi
-fi
-SHELL=${CONFIG_SHELL-/bin/sh}
-export SHELL
-# Unset more variables known to interfere with behavior of common tools.
-CLICOLOR_FORCE= GREP_OPTIONS=
-unset CLICOLOR_FORCE GREP_OPTIONS
-
-## --------------------- ##
-## M4sh Shell Functions. ##
-## --------------------- ##
-# as_fn_unset VAR
-# ---------------
-# Portably unset VAR.
-as_fn_unset ()
-{
-  { eval $1=; unset $1;}
-}
-as_unset=as_fn_unset
-
-# as_fn_set_status STATUS
-# -----------------------
-# Set $? to STATUS, without forking.
-as_fn_set_status ()
-{
-  return $1
-} # as_fn_set_status
-
-# as_fn_exit STATUS
-# -----------------
-# Exit the shell with STATUS, even in a "trap 0" or "set -e" context.
-as_fn_exit ()
-{
-  set +e
-  as_fn_set_status $1
-  exit $1
-} # as_fn_exit
-
-# as_fn_mkdir_p
-# -------------
-# Create "$as_dir" as a directory, including parents if necessary.
-as_fn_mkdir_p ()
-{
-
-  case $as_dir in #(
-  -*) as_dir=./$as_dir;;
-  esac
-  test -d "$as_dir" || eval $as_mkdir_p || {
-    as_dirs=
-    while :; do
-      case $as_dir in #(
-      *\'*) as_qdir=`$as_echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'(
-      *) as_qdir=$as_dir;;
-      esac
-      as_dirs="'$as_qdir' $as_dirs"
-      as_dir=`$as_dirname -- "$as_dir" ||
-$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
-	 X"$as_dir" : 'X\(//\)[^/]' \| \
-	 X"$as_dir" : 'X\(//\)$' \| \
-	 X"$as_dir" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$as_dir" |
-    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)[^/].*/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\).*/{
-	    s//\1/
-	    q
-	  }
-	  s/.*/./; q'`
-      test -d "$as_dir" && break
-    done
-    test -z "$as_dirs" || eval "mkdir $as_dirs"
-  } || test -d "$as_dir" || as_fn_error $? "cannot create directory $as_dir"
-
-
-} # as_fn_mkdir_p
-
-# as_fn_executable_p FILE
-# -----------------------
-# Test if FILE is an executable regular file.
-as_fn_executable_p ()
-{
-  test -f "$1" && test -x "$1"
-} # as_fn_executable_p
-# as_fn_append VAR VALUE
-# ----------------------
-# Append the text in VALUE to the end of the definition contained in VAR. Take
-# advantage of any shell optimizations that allow amortized linear growth over
-# repeated appends, instead of the typical quadratic growth present in naive
-# implementations.
-if (eval "as_var=1; as_var+=2; test x\$as_var = x12") 2>/dev/null; then :
-  eval 'as_fn_append ()
-  {
-    eval $1+=\$2
-  }'
-else
-  as_fn_append ()
-  {
-    eval $1=\$$1\$2
-  }
-fi # as_fn_append
-
-# as_fn_arith ARG...
-# ------------------
-# Perform arithmetic evaluation on the ARGs, and store the result in the
-# global $as_val. Take advantage of shells that can avoid forks. The arguments
-# must be portable across $(()) and expr.
-if (eval "test \$(( 1 + 1 )) = 2") 2>/dev/null; then :
-  eval 'as_fn_arith ()
-  {
-    as_val=$(( $* ))
-  }'
-else
-  as_fn_arith ()
-  {
-    as_val=`expr "$@" || test $? -eq 1`
-  }
-fi # as_fn_arith
-
-
-# as_fn_error STATUS ERROR [LINENO LOG_FD]
-# ----------------------------------------
-# Output "`basename $0`: error: ERROR" to stderr. If LINENO and LOG_FD are
-# provided, also output the error to LOG_FD, referencing LINENO. Then exit the
-# script with STATUS, using 1 if that was 0.
-as_fn_error ()
-{
-  as_status=$1; test $as_status -eq 0 && as_status=1
-  if test "$4"; then
-    as_lineno=${as_lineno-"$3"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
-    $as_echo "$as_me:${as_lineno-$LINENO}: error: $2" >&$4
-  fi
-  $as_echo "$as_me: error: $2" >&2
-  as_fn_exit $as_status
-} # as_fn_error
-
-if expr a : '\(a\)' >/dev/null 2>&1 &&
-   test "X`expr 00001 : '.*\(...\)'`" = X001; then
-  as_expr=expr
-else
-  as_expr=false
-fi
-
-if (basename -- /) >/dev/null 2>&1 && test "X`basename -- / 2>&1`" = "X/"; then
-  as_basename=basename
-else
-  as_basename=false
-fi
-
-if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then
-  as_dirname=dirname
-else
-  as_dirname=false
-fi
-
-as_me=`$as_basename -- "$0" ||
-$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \
-	 X"$0" : 'X\(//\)$' \| \
-	 X"$0" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X/"$0" |
-    sed '/^.*\/\([^/][^/]*\)\/*$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\/\(\/\/\)$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\/\(\/\).*/{
-	    s//\1/
-	    q
-	  }
-	  s/.*/./; q'`
-
-# Avoid depending upon Character Ranges.
-as_cr_letters='abcdefghijklmnopqrstuvwxyz'
-as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
-as_cr_Letters=$as_cr_letters$as_cr_LETTERS
-as_cr_digits='0123456789'
-as_cr_alnum=$as_cr_Letters$as_cr_digits
-
-
-  as_lineno_1=$LINENO as_lineno_1a=$LINENO
-  as_lineno_2=$LINENO as_lineno_2a=$LINENO
-  eval 'test "x$as_lineno_1'$as_run'" != "x$as_lineno_2'$as_run'" &&
-  test "x`expr $as_lineno_1'$as_run' + 1`" = "x$as_lineno_2'$as_run'"' || {
-  # Blame Lee E. McMahon (1931-1989) for sed's syntax.  :-)
-  sed -n '
-    p
-    /[$]LINENO/=
-  ' <$as_myself |
-    sed '
-      s/[$]LINENO.*/&-/
-      t lineno
-      b
-      :lineno
-      N
-      :loop
-      s/[$]LINENO\([^'$as_cr_alnum'_].*\n\)\(.*\)/\2\1\2/
-      t loop
-      s/-\n.*//
-    ' >$as_me.lineno &&
-  chmod +x "$as_me.lineno" ||
-    { $as_echo "$as_me: error: cannot create $as_me.lineno; rerun with a POSIX shell" >&2; as_fn_exit 1; }
-
-  # If we had to re-execute with $CONFIG_SHELL, we're ensured to have
-  # already done that, so ensure we don't try to do so again and fall
-  # in an infinite loop.  This has already happened in practice.
-  _as_can_reexec=no; export _as_can_reexec
-  # Don't try to exec as it changes $[0], causing all sort of problems
-  # (the dirname of $[0] is not the place where we might find the
-  # original and so on.  Autoconf is especially sensitive to this).
-  . "./$as_me.lineno"
-  # Exit status is that of the last command.
-  exit
-}
-
-ECHO_C= ECHO_N= ECHO_T=
-case `echo -n x` in #(((((
--n*)
-  case `echo 'xy\c'` in
-  *c*) ECHO_T='	';;	# ECHO_T is single tab character.
-  xy)  ECHO_C='\c';;
-  *)   echo `echo ksh88 bug on AIX 6.1` > /dev/null
-       ECHO_T='	';;
-  esac;;
-*)
-  ECHO_N='-n';;
-esac
-
-rm -f conf$$ conf$$.exe conf$$.file
-if test -d conf$$.dir; then
-  rm -f conf$$.dir/conf$$.file
-else
-  rm -f conf$$.dir
-  mkdir conf$$.dir 2>/dev/null
-fi
-if (echo >conf$$.file) 2>/dev/null; then
-  if ln -s conf$$.file conf$$ 2>/dev/null; then
-    as_ln_s='ln -s'
-    # ... but there are two gotchas:
-    # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail.
-    # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable.
-    # In both cases, we have to default to `cp -pR'.
-    ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe ||
-      as_ln_s='cp -pR'
-  elif ln conf$$.file conf$$ 2>/dev/null; then
-    as_ln_s=ln
-  else
-    as_ln_s='cp -pR'
-  fi
-else
-  as_ln_s='cp -pR'
-fi
-rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file
-rmdir conf$$.dir 2>/dev/null
-
-if mkdir -p . 2>/dev/null; then
-  as_mkdir_p='mkdir -p "$as_dir"'
-else
-  test -d ./-p && rmdir ./-p
-  as_mkdir_p=false
-fi
-
-as_test_x='test -x'
-as_executable_p=as_fn_executable_p
-
-# Sed expression to map a string onto a valid CPP name.
-as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'"
-
-# Sed expression to map a string onto a valid variable name.
-as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'"
-
-
-test -n "$DJDIR" || exec 7<&0 </dev/null
-exec 6>&1
-
-# Name of the host.
-# hostname on some systems (SVR3.2, old GNU/Linux) returns a bogus exit status,
-# so uname gets run too.
-ac_hostname=`(hostname || uname -n) 2>/dev/null | sed 1q`
-
-#
-# Initializations.
-#
-ac_default_prefix=/usr/local
-ac_clean_files=
-ac_config_libobj_dir=.
-LIBOBJS=
-cross_compiling=no
-subdirs=
-MFLAGS=
-MAKEFLAGS=
-
-# Identity of this package.
-PACKAGE_NAME='rock'
-PACKAGE_TARNAME='rock'
-PACKAGE_VERSION='1.9.5'
-PACKAGE_STRING='rock 1.9.5'
-PACKAGE_BUGREPORT=''
-PACKAGE_URL=''
-
-ac_subst_vars='am__EXEEXT_FALSE
-am__EXEEXT_TRUE
-LTLIBOBJS
-LIBOBJS
-POD2MAN
-RANLIB
-am__fastdepCXX_FALSE
-am__fastdepCXX_TRUE
-CXXDEPMODE
-am__nodep
-AMDEPBACKSLASH
-AMDEP_FALSE
-AMDEP_TRUE
-am__quote
-am__include
-DEPDIR
-OBJEXT
-EXEEXT
-ac_ct_CXX
-CPPFLAGS
-LDFLAGS
-CXXFLAGS
-CXX
-AM_BACKSLASH
-AM_DEFAULT_VERBOSITY
-AM_DEFAULT_V
-AM_V
-am__untar
-am__tar
-AMTAR
-am__leading_dot
-SET_MAKE
-AWK
-mkdir_p
-MKDIR_P
-INSTALL_STRIP_PROGRAM
-STRIP
-install_sh
-MAKEINFO
-AUTOHEADER
-AUTOMAKE
-AUTOCONF
-ACLOCAL
-VERSION
-PACKAGE
-CYGPATH_W
-am__isrc
-INSTALL_DATA
-INSTALL_SCRIPT
-INSTALL_PROGRAM
-target_os
-target_vendor
-target_cpu
-target
-host_os
-host_vendor
-host_cpu
-host
-build_os
-build_vendor
-build_cpu
-build
-target_alias
-host_alias
-build_alias
-LIBS
-ECHO_T
-ECHO_N
-ECHO_C
-DEFS
-mandir
-localedir
-libdir
-psdir
-pdfdir
-dvidir
-htmldir
-infodir
-docdir
-oldincludedir
-includedir
-localstatedir
-sharedstatedir
-sysconfdir
-datadir
-datarootdir
-libexecdir
-sbindir
-bindir
-program_transform_name
-prefix
-exec_prefix
-PACKAGE_URL
-PACKAGE_BUGREPORT
-PACKAGE_STRING
-PACKAGE_VERSION
-PACKAGE_TARNAME
-PACKAGE_NAME
-PATH_SEPARATOR
-SHELL'
-ac_subst_files=''
-ac_user_opts='
-enable_option_checking
-enable_silent_rules
-enable_dependency_tracking
-'
-      ac_precious_vars='build_alias
-host_alias
-target_alias
-CXX
-CXXFLAGS
-LDFLAGS
-LIBS
-CPPFLAGS
-CCC'
-
-
-# Initialize some variables set by options.
-ac_init_help=
-ac_init_version=false
-ac_unrecognized_opts=
-ac_unrecognized_sep=
-# The variables have the same names as the options, with
-# dashes changed to underlines.
-cache_file=/dev/null
-exec_prefix=NONE
-no_create=
-no_recursion=
-prefix=NONE
-program_prefix=NONE
-program_suffix=NONE
-program_transform_name=s,x,x,
-silent=
-site=
-srcdir=
-verbose=
-x_includes=NONE
-x_libraries=NONE
-
-# Installation directory options.
-# These are left unexpanded so users can "make install exec_prefix=/foo"
-# and all the variables that are supposed to be based on exec_prefix
-# by default will actually change.
-# Use braces instead of parens because sh, perl, etc. also accept them.
-# (The list follows the same order as the GNU Coding Standards.)
-bindir='${exec_prefix}/bin'
-sbindir='${exec_prefix}/sbin'
-libexecdir='${exec_prefix}/libexec'
-datarootdir='${prefix}/share'
-datadir='${datarootdir}'
-sysconfdir='${prefix}/etc'
-sharedstatedir='${prefix}/com'
-localstatedir='${prefix}/var'
-includedir='${prefix}/include'
-oldincludedir='/usr/include'
-docdir='${datarootdir}/doc/${PACKAGE_TARNAME}'
-infodir='${datarootdir}/info'
-htmldir='${docdir}'
-dvidir='${docdir}'
-pdfdir='${docdir}'
-psdir='${docdir}'
-libdir='${exec_prefix}/lib'
-localedir='${datarootdir}/locale'
-mandir='${datarootdir}/man'
-
-ac_prev=
-ac_dashdash=
-for ac_option
-do
-  # If the previous option needs an argument, assign it.
-  if test -n "$ac_prev"; then
-    eval $ac_prev=\$ac_option
-    ac_prev=
-    continue
-  fi
-
-  case $ac_option in
-  *=?*) ac_optarg=`expr "X$ac_option" : '[^=]*=\(.*\)'` ;;
-  *=)   ac_optarg= ;;
-  *)    ac_optarg=yes ;;
-  esac
-
-  # Accept the important Cygnus configure options, so we can diagnose typos.
-
-  case $ac_dashdash$ac_option in
-  --)
-    ac_dashdash=yes ;;
-
-  -bindir | --bindir | --bindi | --bind | --bin | --bi)
-    ac_prev=bindir ;;
-  -bindir=* | --bindir=* | --bindi=* | --bind=* | --bin=* | --bi=*)
-    bindir=$ac_optarg ;;
-
-  -build | --build | --buil | --bui | --bu)
-    ac_prev=build_alias ;;
-  -build=* | --build=* | --buil=* | --bui=* | --bu=*)
-    build_alias=$ac_optarg ;;
-
-  -cache-file | --cache-file | --cache-fil | --cache-fi \
-  | --cache-f | --cache- | --cache | --cach | --cac | --ca | --c)
-    ac_prev=cache_file ;;
-  -cache-file=* | --cache-file=* | --cache-fil=* | --cache-fi=* \
-  | --cache-f=* | --cache-=* | --cache=* | --cach=* | --cac=* | --ca=* | --c=*)
-    cache_file=$ac_optarg ;;
-
-  --config-cache | -C)
-    cache_file=config.cache ;;
-
-  -datadir | --datadir | --datadi | --datad)
-    ac_prev=datadir ;;
-  -datadir=* | --datadir=* | --datadi=* | --datad=*)
-    datadir=$ac_optarg ;;
-
-  -datarootdir | --datarootdir | --datarootdi | --datarootd | --dataroot \
-  | --dataroo | --dataro | --datar)
-    ac_prev=datarootdir ;;
-  -datarootdir=* | --datarootdir=* | --datarootdi=* | --datarootd=* \
-  | --dataroot=* | --dataroo=* | --dataro=* | --datar=*)
-    datarootdir=$ac_optarg ;;
-
-  -disable-* | --disable-*)
-    ac_useropt=`expr "x$ac_option" : 'x-*disable-\(.*\)'`
-    # Reject names that are not valid shell variable names.
-    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
-      as_fn_error $? "invalid feature name: $ac_useropt"
-    ac_useropt_orig=$ac_useropt
-    ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
-    case $ac_user_opts in
-      *"
-"enable_$ac_useropt"
-"*) ;;
-      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--disable-$ac_useropt_orig"
-	 ac_unrecognized_sep=', ';;
-    esac
-    eval enable_$ac_useropt=no ;;
-
-  -docdir | --docdir | --docdi | --doc | --do)
-    ac_prev=docdir ;;
-  -docdir=* | --docdir=* | --docdi=* | --doc=* | --do=*)
-    docdir=$ac_optarg ;;
-
-  -dvidir | --dvidir | --dvidi | --dvid | --dvi | --dv)
-    ac_prev=dvidir ;;
-  -dvidir=* | --dvidir=* | --dvidi=* | --dvid=* | --dvi=* | --dv=*)
-    dvidir=$ac_optarg ;;
-
-  -enable-* | --enable-*)
-    ac_useropt=`expr "x$ac_option" : 'x-*enable-\([^=]*\)'`
-    # Reject names that are not valid shell variable names.
-    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
-      as_fn_error $? "invalid feature name: $ac_useropt"
-    ac_useropt_orig=$ac_useropt
-    ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
-    case $ac_user_opts in
-      *"
-"enable_$ac_useropt"
-"*) ;;
-      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--enable-$ac_useropt_orig"
-	 ac_unrecognized_sep=', ';;
-    esac
-    eval enable_$ac_useropt=\$ac_optarg ;;
-
-  -exec-prefix | --exec_prefix | --exec-prefix | --exec-prefi \
-  | --exec-pref | --exec-pre | --exec-pr | --exec-p | --exec- \
-  | --exec | --exe | --ex)
-    ac_prev=exec_prefix ;;
-  -exec-prefix=* | --exec_prefix=* | --exec-prefix=* | --exec-prefi=* \
-  | --exec-pref=* | --exec-pre=* | --exec-pr=* | --exec-p=* | --exec-=* \
-  | --exec=* | --exe=* | --ex=*)
-    exec_prefix=$ac_optarg ;;
-
-  -gas | --gas | --ga | --g)
-    # Obsolete; use --with-gas.
-    with_gas=yes ;;
-
-  -help | --help | --hel | --he | -h)
-    ac_init_help=long ;;
-  -help=r* | --help=r* | --hel=r* | --he=r* | -hr*)
-    ac_init_help=recursive ;;
-  -help=s* | --help=s* | --hel=s* | --he=s* | -hs*)
-    ac_init_help=short ;;
-
-  -host | --host | --hos | --ho)
-    ac_prev=host_alias ;;
-  -host=* | --host=* | --hos=* | --ho=*)
-    host_alias=$ac_optarg ;;
-
-  -htmldir | --htmldir | --htmldi | --htmld | --html | --htm | --ht)
-    ac_prev=htmldir ;;
-  -htmldir=* | --htmldir=* | --htmldi=* | --htmld=* | --html=* | --htm=* \
-  | --ht=*)
-    htmldir=$ac_optarg ;;
-
-  -includedir | --includedir | --includedi | --included | --include \
-  | --includ | --inclu | --incl | --inc)
-    ac_prev=includedir ;;
-  -includedir=* | --includedir=* | --includedi=* | --included=* | --include=* \
-  | --includ=* | --inclu=* | --incl=* | --inc=*)
-    includedir=$ac_optarg ;;
-
-  -infodir | --infodir | --infodi | --infod | --info | --inf)
-    ac_prev=infodir ;;
-  -infodir=* | --infodir=* | --infodi=* | --infod=* | --info=* | --inf=*)
-    infodir=$ac_optarg ;;
-
-  -libdir | --libdir | --libdi | --libd)
-    ac_prev=libdir ;;
-  -libdir=* | --libdir=* | --libdi=* | --libd=*)
-    libdir=$ac_optarg ;;
-
-  -libexecdir | --libexecdir | --libexecdi | --libexecd | --libexec \
-  | --libexe | --libex | --libe)
-    ac_prev=libexecdir ;;
-  -libexecdir=* | --libexecdir=* | --libexecdi=* | --libexecd=* | --libexec=* \
-  | --libexe=* | --libex=* | --libe=*)
-    libexecdir=$ac_optarg ;;
-
-  -localedir | --localedir | --localedi | --localed | --locale)
-    ac_prev=localedir ;;
-  -localedir=* | --localedir=* | --localedi=* | --localed=* | --locale=*)
-    localedir=$ac_optarg ;;
-
-  -localstatedir | --localstatedir | --localstatedi | --localstated \
-  | --localstate | --localstat | --localsta | --localst | --locals)
-    ac_prev=localstatedir ;;
-  -localstatedir=* | --localstatedir=* | --localstatedi=* | --localstated=* \
-  | --localstate=* | --localstat=* | --localsta=* | --localst=* | --locals=*)
-    localstatedir=$ac_optarg ;;
-
-  -mandir | --mandir | --mandi | --mand | --man | --ma | --m)
-    ac_prev=mandir ;;
-  -mandir=* | --mandir=* | --mandi=* | --mand=* | --man=* | --ma=* | --m=*)
-    mandir=$ac_optarg ;;
-
-  -nfp | --nfp | --nf)
-    # Obsolete; use --without-fp.
-    with_fp=no ;;
-
-  -no-create | --no-create | --no-creat | --no-crea | --no-cre \
-  | --no-cr | --no-c | -n)
-    no_create=yes ;;
-
-  -no-recursion | --no-recursion | --no-recursio | --no-recursi \
-  | --no-recurs | --no-recur | --no-recu | --no-rec | --no-re | --no-r)
-    no_recursion=yes ;;
-
-  -oldincludedir | --oldincludedir | --oldincludedi | --oldincluded \
-  | --oldinclude | --oldinclud | --oldinclu | --oldincl | --oldinc \
-  | --oldin | --oldi | --old | --ol | --o)
-    ac_prev=oldincludedir ;;
-  -oldincludedir=* | --oldincludedir=* | --oldincludedi=* | --oldincluded=* \
-  | --oldinclude=* | --oldinclud=* | --oldinclu=* | --oldincl=* | --oldinc=* \
-  | --oldin=* | --oldi=* | --old=* | --ol=* | --o=*)
-    oldincludedir=$ac_optarg ;;
-
-  -prefix | --prefix | --prefi | --pref | --pre | --pr | --p)
-    ac_prev=prefix ;;
-  -prefix=* | --prefix=* | --prefi=* | --pref=* | --pre=* | --pr=* | --p=*)
-    prefix=$ac_optarg ;;
-
-  -program-prefix | --program-prefix | --program-prefi | --program-pref \
-  | --program-pre | --program-pr | --program-p)
-    ac_prev=program_prefix ;;
-  -program-prefix=* | --program-prefix=* | --program-prefi=* \
-  | --program-pref=* | --program-pre=* | --program-pr=* | --program-p=*)
-    program_prefix=$ac_optarg ;;
-
-  -program-suffix | --program-suffix | --program-suffi | --program-suff \
-  | --program-suf | --program-su | --program-s)
-    ac_prev=program_suffix ;;
-  -program-suffix=* | --program-suffix=* | --program-suffi=* \
-  | --program-suff=* | --program-suf=* | --program-su=* | --program-s=*)
-    program_suffix=$ac_optarg ;;
-
-  -program-transform-name | --program-transform-name \
-  | --program-transform-nam | --program-transform-na \
-  | --program-transform-n | --program-transform- \
-  | --program-transform | --program-transfor \
-  | --program-transfo | --program-transf \
-  | --program-trans | --program-tran \
-  | --progr-tra | --program-tr | --program-t)
-    ac_prev=program_transform_name ;;
-  -program-transform-name=* | --program-transform-name=* \
-  | --program-transform-nam=* | --program-transform-na=* \
-  | --program-transform-n=* | --program-transform-=* \
-  | --program-transform=* | --program-transfor=* \
-  | --program-transfo=* | --program-transf=* \
-  | --program-trans=* | --program-tran=* \
-  | --progr-tra=* | --program-tr=* | --program-t=*)
-    program_transform_name=$ac_optarg ;;
-
-  -pdfdir | --pdfdir | --pdfdi | --pdfd | --pdf | --pd)
-    ac_prev=pdfdir ;;
-  -pdfdir=* | --pdfdir=* | --pdfdi=* | --pdfd=* | --pdf=* | --pd=*)
-    pdfdir=$ac_optarg ;;
-
-  -psdir | --psdir | --psdi | --psd | --ps)
-    ac_prev=psdir ;;
-  -psdir=* | --psdir=* | --psdi=* | --psd=* | --ps=*)
-    psdir=$ac_optarg ;;
-
-  -q | -quiet | --quiet | --quie | --qui | --qu | --q \
-  | -silent | --silent | --silen | --sile | --sil)
-    silent=yes ;;
-
-  -sbindir | --sbindir | --sbindi | --sbind | --sbin | --sbi | --sb)
-    ac_prev=sbindir ;;
-  -sbindir=* | --sbindir=* | --sbindi=* | --sbind=* | --sbin=* \
-  | --sbi=* | --sb=*)
-    sbindir=$ac_optarg ;;
-
-  -sharedstatedir | --sharedstatedir | --sharedstatedi \
-  | --sharedstated | --sharedstate | --sharedstat | --sharedsta \
-  | --sharedst | --shareds | --shared | --share | --shar \
-  | --sha | --sh)
-    ac_prev=sharedstatedir ;;
-  -sharedstatedir=* | --sharedstatedir=* | --sharedstatedi=* \
-  | --sharedstated=* | --sharedstate=* | --sharedstat=* | --sharedsta=* \
-  | --sharedst=* | --shareds=* | --shared=* | --share=* | --shar=* \
-  | --sha=* | --sh=*)
-    sharedstatedir=$ac_optarg ;;
-
-  -site | --site | --sit)
-    ac_prev=site ;;
-  -site=* | --site=* | --sit=*)
-    site=$ac_optarg ;;
-
-  -srcdir | --srcdir | --srcdi | --srcd | --src | --sr)
-    ac_prev=srcdir ;;
-  -srcdir=* | --srcdir=* | --srcdi=* | --srcd=* | --src=* | --sr=*)
-    srcdir=$ac_optarg ;;
-
-  -sysconfdir | --sysconfdir | --sysconfdi | --sysconfd | --sysconf \
-  | --syscon | --sysco | --sysc | --sys | --sy)
-    ac_prev=sysconfdir ;;
-  -sysconfdir=* | --sysconfdir=* | --sysconfdi=* | --sysconfd=* | --sysconf=* \
-  | --syscon=* | --sysco=* | --sysc=* | --sys=* | --sy=*)
-    sysconfdir=$ac_optarg ;;
-
-  -target | --target | --targe | --targ | --tar | --ta | --t)
-    ac_prev=target_alias ;;
-  -target=* | --target=* | --targe=* | --targ=* | --tar=* | --ta=* | --t=*)
-    target_alias=$ac_optarg ;;
-
-  -v | -verbose | --verbose | --verbos | --verbo | --verb)
-    verbose=yes ;;
-
-  -version | --version | --versio | --versi | --vers | -V)
-    ac_init_version=: ;;
-
-  -with-* | --with-*)
-    ac_useropt=`expr "x$ac_option" : 'x-*with-\([^=]*\)'`
-    # Reject names that are not valid shell variable names.
-    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
-      as_fn_error $? "invalid package name: $ac_useropt"
-    ac_useropt_orig=$ac_useropt
-    ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
-    case $ac_user_opts in
-      *"
-"with_$ac_useropt"
-"*) ;;
-      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--with-$ac_useropt_orig"
-	 ac_unrecognized_sep=', ';;
-    esac
-    eval with_$ac_useropt=\$ac_optarg ;;
-
-  -without-* | --without-*)
-    ac_useropt=`expr "x$ac_option" : 'x-*without-\(.*\)'`
-    # Reject names that are not valid shell variable names.
-    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
-      as_fn_error $? "invalid package name: $ac_useropt"
-    ac_useropt_orig=$ac_useropt
-    ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
-    case $ac_user_opts in
-      *"
-"with_$ac_useropt"
-"*) ;;
-      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--without-$ac_useropt_orig"
-	 ac_unrecognized_sep=', ';;
-    esac
-    eval with_$ac_useropt=no ;;
-
-  --x)
-    # Obsolete; use --with-x.
-    with_x=yes ;;
-
-  -x-includes | --x-includes | --x-include | --x-includ | --x-inclu \
-  | --x-incl | --x-inc | --x-in | --x-i)
-    ac_prev=x_includes ;;
-  -x-includes=* | --x-includes=* | --x-include=* | --x-includ=* | --x-inclu=* \
-  | --x-incl=* | --x-inc=* | --x-in=* | --x-i=*)
-    x_includes=$ac_optarg ;;
-
-  -x-libraries | --x-libraries | --x-librarie | --x-librari \
-  | --x-librar | --x-libra | --x-libr | --x-lib | --x-li | --x-l)
-    ac_prev=x_libraries ;;
-  -x-libraries=* | --x-libraries=* | --x-librarie=* | --x-librari=* \
-  | --x-librar=* | --x-libra=* | --x-libr=* | --x-lib=* | --x-li=* | --x-l=*)
-    x_libraries=$ac_optarg ;;
-
-  -*) as_fn_error $? "unrecognized option: \`$ac_option'
-Try \`$0 --help' for more information"
-    ;;
-
-  *=*)
-    ac_envvar=`expr "x$ac_option" : 'x\([^=]*\)='`
-    # Reject names that are not valid shell variable names.
-    case $ac_envvar in #(
-      '' | [0-9]* | *[!_$as_cr_alnum]* )
-      as_fn_error $? "invalid variable name: \`$ac_envvar'" ;;
-    esac
-    eval $ac_envvar=\$ac_optarg
-    export $ac_envvar ;;
-
-  *)
-    # FIXME: should be removed in autoconf 3.0.
-    $as_echo "$as_me: WARNING: you should use --build, --host, --target" >&2
-    expr "x$ac_option" : ".*[^-._$as_cr_alnum]" >/dev/null &&
-      $as_echo "$as_me: WARNING: invalid host type: $ac_option" >&2
-    : "${build_alias=$ac_option} ${host_alias=$ac_option} ${target_alias=$ac_option}"
-    ;;
-
-  esac
-done
-
-if test -n "$ac_prev"; then
-  ac_option=--`echo $ac_prev | sed 's/_/-/g'`
-  as_fn_error $? "missing argument to $ac_option"
-fi
-
-if test -n "$ac_unrecognized_opts"; then
-  case $enable_option_checking in
-    no) ;;
-    fatal) as_fn_error $? "unrecognized options: $ac_unrecognized_opts" ;;
-    *)     $as_echo "$as_me: WARNING: unrecognized options: $ac_unrecognized_opts" >&2 ;;
-  esac
-fi
-
-# Check all directory arguments for consistency.
-for ac_var in	exec_prefix prefix bindir sbindir libexecdir datarootdir \
-		datadir sysconfdir sharedstatedir localstatedir includedir \
-		oldincludedir docdir infodir htmldir dvidir pdfdir psdir \
-		libdir localedir mandir
-do
-  eval ac_val=\$$ac_var
-  # Remove trailing slashes.
-  case $ac_val in
-    */ )
-      ac_val=`expr "X$ac_val" : 'X\(.*[^/]\)' \| "X$ac_val" : 'X\(.*\)'`
-      eval $ac_var=\$ac_val;;
-  esac
-  # Be sure to have absolute directory names.
-  case $ac_val in
-    [\\/$]* | ?:[\\/]* )  continue;;
-    NONE | '' ) case $ac_var in *prefix ) continue;; esac;;
-  esac
-  as_fn_error $? "expected an absolute directory name for --$ac_var: $ac_val"
-done
-
-# There might be people who depend on the old broken behavior: `$host'
-# used to hold the argument of --host etc.
-# FIXME: To remove some day.
-build=$build_alias
-host=$host_alias
-target=$target_alias
-
-# FIXME: To remove some day.
-if test "x$host_alias" != x; then
-  if test "x$build_alias" = x; then
-    cross_compiling=maybe
-  elif test "x$build_alias" != "x$host_alias"; then
-    cross_compiling=yes
-  fi
-fi
-
-ac_tool_prefix=
-test -n "$host_alias" && ac_tool_prefix=$host_alias-
-
-test "$silent" = yes && exec 6>/dev/null
-
-
-ac_pwd=`pwd` && test -n "$ac_pwd" &&
-ac_ls_di=`ls -di .` &&
-ac_pwd_ls_di=`cd "$ac_pwd" && ls -di .` ||
-  as_fn_error $? "working directory cannot be determined"
-test "X$ac_ls_di" = "X$ac_pwd_ls_di" ||
-  as_fn_error $? "pwd does not report name of working directory"
-
-
-# Find the source files, if location was not specified.
-if test -z "$srcdir"; then
-  ac_srcdir_defaulted=yes
-  # Try the directory containing this script, then the parent directory.
-  ac_confdir=`$as_dirname -- "$as_myself" ||
-$as_expr X"$as_myself" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
-	 X"$as_myself" : 'X\(//\)[^/]' \| \
-	 X"$as_myself" : 'X\(//\)$' \| \
-	 X"$as_myself" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$as_myself" |
-    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)[^/].*/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\).*/{
-	    s//\1/
-	    q
-	  }
-	  s/.*/./; q'`
-  srcdir=$ac_confdir
-  if test ! -r "$srcdir/$ac_unique_file"; then
-    srcdir=..
-  fi
-else
-  ac_srcdir_defaulted=no
-fi
-if test ! -r "$srcdir/$ac_unique_file"; then
-  test "$ac_srcdir_defaulted" = yes && srcdir="$ac_confdir or .."
-  as_fn_error $? "cannot find sources ($ac_unique_file) in $srcdir"
-fi
-ac_msg="sources are in $srcdir, but \`cd $srcdir' does not work"
-ac_abs_confdir=`(
-	cd "$srcdir" && test -r "./$ac_unique_file" || as_fn_error $? "$ac_msg"
-	pwd)`
-# When building in place, set srcdir=.
-if test "$ac_abs_confdir" = "$ac_pwd"; then
-  srcdir=.
-fi
-# Remove unnecessary trailing slashes from srcdir.
-# Double slashes in file names in object file debugging info
-# mess up M-x gdb in Emacs.
-case $srcdir in
-*/) srcdir=`expr "X$srcdir" : 'X\(.*[^/]\)' \| "X$srcdir" : 'X\(.*\)'`;;
-esac
-for ac_var in $ac_precious_vars; do
-  eval ac_env_${ac_var}_set=\${${ac_var}+set}
-  eval ac_env_${ac_var}_value=\$${ac_var}
-  eval ac_cv_env_${ac_var}_set=\${${ac_var}+set}
-  eval ac_cv_env_${ac_var}_value=\$${ac_var}
-done
-
-#
-# Report the --help message.
-#
-if test "$ac_init_help" = "long"; then
-  # Omit some internal or obsolete options to make the list less imposing.
-  # This message is too long to be a string in the A/UX 3.1 sh.
-  cat <<_ACEOF
-\`configure' configures rock 1.9.5 to adapt to many kinds of systems.
-
-Usage: $0 [OPTION]... [VAR=VALUE]...
-
-To assign environment variables (e.g., CC, CFLAGS...), specify them as
-VAR=VALUE.  See below for descriptions of some of the useful variables.
-
-Defaults for the options are specified in brackets.
-
-Configuration:
-  -h, --help              display this help and exit
-      --help=short        display options specific to this package
-      --help=recursive    display the short help of all the included packages
-  -V, --version           display version information and exit
-  -q, --quiet, --silent   do not print \`checking ...' messages
-      --cache-file=FILE   cache test results in FILE [disabled]
-  -C, --config-cache      alias for \`--cache-file=config.cache'
-  -n, --no-create         do not create output files
-      --srcdir=DIR        find the sources in DIR [configure dir or \`..']
-
-Installation directories:
-  --prefix=PREFIX         install architecture-independent files in PREFIX
-                          [$ac_default_prefix]
-  --exec-prefix=EPREFIX   install architecture-dependent files in EPREFIX
-                          [PREFIX]
-
-By default, \`make install' will install all the files in
-\`$ac_default_prefix/bin', \`$ac_default_prefix/lib' etc.  You can specify
-an installation prefix other than \`$ac_default_prefix' using \`--prefix',
-for instance \`--prefix=\$HOME'.
-
-For better control, use the options below.
-
-Fine tuning of the installation directories:
-  --bindir=DIR            user executables [EPREFIX/bin]
-  --sbindir=DIR           system admin executables [EPREFIX/sbin]
-  --libexecdir=DIR        program executables [EPREFIX/libexec]
-  --sysconfdir=DIR        read-only single-machine data [PREFIX/etc]
-  --sharedstatedir=DIR    modifiable architecture-independent data [PREFIX/com]
-  --localstatedir=DIR     modifiable single-machine data [PREFIX/var]
-  --libdir=DIR            object code libraries [EPREFIX/lib]
-  --includedir=DIR        C header files [PREFIX/include]
-  --oldincludedir=DIR     C header files for non-gcc [/usr/include]
-  --datarootdir=DIR       read-only arch.-independent data root [PREFIX/share]
-  --datadir=DIR           read-only architecture-independent data [DATAROOTDIR]
-  --infodir=DIR           info documentation [DATAROOTDIR/info]
-  --localedir=DIR         locale-dependent data [DATAROOTDIR/locale]
-  --mandir=DIR            man documentation [DATAROOTDIR/man]
-  --docdir=DIR            documentation root [DATAROOTDIR/doc/rock]
-  --htmldir=DIR           html documentation [DOCDIR]
-  --dvidir=DIR            dvi documentation [DOCDIR]
-  --pdfdir=DIR            pdf documentation [DOCDIR]
-  --psdir=DIR             ps documentation [DOCDIR]
-_ACEOF
-
-  cat <<\_ACEOF
-
-Program names:
-  --program-prefix=PREFIX            prepend PREFIX to installed program names
-  --program-suffix=SUFFIX            append SUFFIX to installed program names
-  --program-transform-name=PROGRAM   run sed PROGRAM on installed program names
-
-System types:
-  --build=BUILD     configure for building on BUILD [guessed]
-  --host=HOST       cross-compile to build programs to run on HOST [BUILD]
-  --target=TARGET   configure for building compilers for TARGET [HOST]
-_ACEOF
-fi
-
-if test -n "$ac_init_help"; then
-  case $ac_init_help in
-     short | recursive ) echo "Configuration of rock 1.9.5:";;
-   esac
-  cat <<\_ACEOF
-
-Optional Features:
-  --disable-option-checking  ignore unrecognized --enable/--with options
-  --disable-FEATURE       do not include FEATURE (same as --enable-FEATURE=no)
-  --enable-FEATURE[=ARG]  include FEATURE [ARG=yes]
-  --enable-silent-rules   less verbose build output (undo: "make V=1")
-  --disable-silent-rules  verbose build output (undo: "make V=0")
-  --enable-dependency-tracking
-                          do not reject slow dependency extractors
-  --disable-dependency-tracking
-                          speeds up one-time build
-
-Some influential environment variables:
-  CXX         C++ compiler command
-  CXXFLAGS    C++ compiler flags
-  LDFLAGS     linker flags, e.g. -L<lib dir> if you have libraries in a
-              nonstandard directory <lib dir>
-  LIBS        libraries to pass to the linker, e.g. -l<library>
-  CPPFLAGS    (Objective) C/C++ preprocessor flags, e.g. -I<include dir> if
-              you have headers in a nonstandard directory <include dir>
-
-Use these variables to override the choices made by `configure' or to help
-it to find libraries and programs with nonstandard names/locations.
-
-Report bugs to the package provider.
-_ACEOF
-ac_status=$?
-fi
-
-if test "$ac_init_help" = "recursive"; then
-  # If there are subdirs, report their specific --help.
-  for ac_dir in : $ac_subdirs_all; do test "x$ac_dir" = x: && continue
-    test -d "$ac_dir" ||
-      { cd "$srcdir" && ac_pwd=`pwd` && srcdir=. && test -d "$ac_dir"; } ||
-      continue
-    ac_builddir=.
-
-case "$ac_dir" in
-.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;;
-*)
-  ac_dir_suffix=/`$as_echo "$ac_dir" | sed 's|^\.[\\/]||'`
-  # A ".." for each directory in $ac_dir_suffix.
-  ac_top_builddir_sub=`$as_echo "$ac_dir_suffix" | sed 's|/[^\\/]*|/..|g;s|/||'`
-  case $ac_top_builddir_sub in
-  "") ac_top_builddir_sub=. ac_top_build_prefix= ;;
-  *)  ac_top_build_prefix=$ac_top_builddir_sub/ ;;
-  esac ;;
-esac
-ac_abs_top_builddir=$ac_pwd
-ac_abs_builddir=$ac_pwd$ac_dir_suffix
-# for backward compatibility:
-ac_top_builddir=$ac_top_build_prefix
-
-case $srcdir in
-  .)  # We are building in place.
-    ac_srcdir=.
-    ac_top_srcdir=$ac_top_builddir_sub
-    ac_abs_top_srcdir=$ac_pwd ;;
-  [\\/]* | ?:[\\/]* )  # Absolute name.
-    ac_srcdir=$srcdir$ac_dir_suffix;
-    ac_top_srcdir=$srcdir
-    ac_abs_top_srcdir=$srcdir ;;
-  *) # Relative name.
-    ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix
-    ac_top_srcdir=$ac_top_build_prefix$srcdir
-    ac_abs_top_srcdir=$ac_pwd/$srcdir ;;
-esac
-ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix
-
-    cd "$ac_dir" || { ac_status=$?; continue; }
-    # Check for guested configure.
-    if test -f "$ac_srcdir/configure.gnu"; then
-      echo &&
-      $SHELL "$ac_srcdir/configure.gnu" --help=recursive
-    elif test -f "$ac_srcdir/configure"; then
-      echo &&
-      $SHELL "$ac_srcdir/configure" --help=recursive
-    else
-      $as_echo "$as_me: WARNING: no configuration information is in $ac_dir" >&2
-    fi || ac_status=$?
-    cd "$ac_pwd" || { ac_status=$?; break; }
-  done
-fi
-
-test -n "$ac_init_help" && exit $ac_status
-if $ac_init_version; then
-  cat <<\_ACEOF
-rock configure 1.9.5
-generated by GNU Autoconf 2.69
-
-Copyright (C) 2012 Free Software Foundation, Inc.
-This configure script is free software; the Free Software Foundation
-gives unlimited permission to copy, distribute and modify it.
-_ACEOF
-  exit
-fi
-
-## ------------------------ ##
-## Autoconf initialization. ##
-## ------------------------ ##
-
-# ac_fn_cxx_try_compile LINENO
-# ----------------------------
-# Try to compile conftest.$ac_ext, and return whether this succeeded.
-ac_fn_cxx_try_compile ()
-{
-  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
-  rm -f conftest.$ac_objext
-  if { { ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
-  (eval "$ac_compile") 2>conftest.err
-  ac_status=$?
-  if test -s conftest.err; then
-    grep -v '^ *+' conftest.err >conftest.er1
-    cat conftest.er1 >&5
-    mv -f conftest.er1 conftest.err
-  fi
-  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
-  test $ac_status = 0; } && {
-	 test -z "$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then :
-  ac_retval=0
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_retval=1
-fi
-  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
-  as_fn_set_status $ac_retval
-
-} # ac_fn_cxx_try_compile
-cat >config.log <<_ACEOF
-This file contains any messages produced by compilers while
-running configure, to aid debugging if configure makes a mistake.
-
-It was created by rock $as_me 1.9.5, which was
-generated by GNU Autoconf 2.69.  Invocation command line was
-
-  $ $0 $@
-
-_ACEOF
-exec 5>>config.log
-{
-cat <<_ASUNAME
-## --------- ##
-## Platform. ##
-## --------- ##
-
-hostname = `(hostname || uname -n) 2>/dev/null | sed 1q`
-uname -m = `(uname -m) 2>/dev/null || echo unknown`
-uname -r = `(uname -r) 2>/dev/null || echo unknown`
-uname -s = `(uname -s) 2>/dev/null || echo unknown`
-uname -v = `(uname -v) 2>/dev/null || echo unknown`
-
-/usr/bin/uname -p = `(/usr/bin/uname -p) 2>/dev/null || echo unknown`
-/bin/uname -X     = `(/bin/uname -X) 2>/dev/null     || echo unknown`
-
-/bin/arch              = `(/bin/arch) 2>/dev/null              || echo unknown`
-/usr/bin/arch -k       = `(/usr/bin/arch -k) 2>/dev/null       || echo unknown`
-/usr/convex/getsysinfo = `(/usr/convex/getsysinfo) 2>/dev/null || echo unknown`
-/usr/bin/hostinfo      = `(/usr/bin/hostinfo) 2>/dev/null      || echo unknown`
-/bin/machine           = `(/bin/machine) 2>/dev/null           || echo unknown`
-/usr/bin/oslevel       = `(/usr/bin/oslevel) 2>/dev/null       || echo unknown`
-/bin/universe          = `(/bin/universe) 2>/dev/null          || echo unknown`
-
-_ASUNAME
-
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-    $as_echo "PATH: $as_dir"
-  done
-IFS=$as_save_IFS
-
-} >&5
-
-cat >&5 <<_ACEOF
-
-
-## ----------- ##
-## Core tests. ##
-## ----------- ##
-
-_ACEOF
-
-
-# Keep a trace of the command line.
-# Strip out --no-create and --no-recursion so they do not pile up.
-# Strip out --silent because we don't want to record it for future runs.
-# Also quote any args containing shell meta-characters.
-# Make two passes to allow for proper duplicate-argument suppression.
-ac_configure_args=
-ac_configure_args0=
-ac_configure_args1=
-ac_must_keep_next=false
-for ac_pass in 1 2
-do
-  for ac_arg
-  do
-    case $ac_arg in
-    -no-create | --no-c* | -n | -no-recursion | --no-r*) continue ;;
-    -q | -quiet | --quiet | --quie | --qui | --qu | --q \
-    | -silent | --silent | --silen | --sile | --sil)
-      continue ;;
-    *\'*)
-      ac_arg=`$as_echo "$ac_arg" | sed "s/'/'\\\\\\\\''/g"` ;;
-    esac
-    case $ac_pass in
-    1) as_fn_append ac_configure_args0 " '$ac_arg'" ;;
-    2)
-      as_fn_append ac_configure_args1 " '$ac_arg'"
-      if test $ac_must_keep_next = true; then
-	ac_must_keep_next=false # Got value, back to normal.
-      else
-	case $ac_arg in
-	  *=* | --config-cache | -C | -disable-* | --disable-* \
-	  | -enable-* | --enable-* | -gas | --g* | -nfp | --nf* \
-	  | -q | -quiet | --q* | -silent | --sil* | -v | -verb* \
-	  | -with-* | --with-* | -without-* | --without-* | --x)
-	    case "$ac_configure_args0 " in
-	      "$ac_configure_args1"*" '$ac_arg' "* ) continue ;;
-	    esac
-	    ;;
-	  -* ) ac_must_keep_next=true ;;
-	esac
-      fi
-      as_fn_append ac_configure_args " '$ac_arg'"
-      ;;
-    esac
-  done
-done
-{ ac_configure_args0=; unset ac_configure_args0;}
-{ ac_configure_args1=; unset ac_configure_args1;}
-
-# When interrupted or exit'd, cleanup temporary files, and complete
-# config.log.  We remove comments because anyway the quotes in there
-# would cause problems or look ugly.
-# WARNING: Use '\'' to represent an apostrophe within the trap.
-# WARNING: Do not start the trap code with a newline, due to a FreeBSD 4.0 bug.
-trap 'exit_status=$?
-  # Save into config.log some information that might help in debugging.
-  {
-    echo
-
-    $as_echo "## ---------------- ##
-## Cache variables. ##
-## ---------------- ##"
-    echo
-    # The following way of writing the cache mishandles newlines in values,
-(
-  for ac_var in `(set) 2>&1 | sed -n '\''s/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'\''`; do
-    eval ac_val=\$$ac_var
-    case $ac_val in #(
-    *${as_nl}*)
-      case $ac_var in #(
-      *_cv_*) { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: cache variable $ac_var contains a newline" >&5
-$as_echo "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;;
-      esac
-      case $ac_var in #(
-      _ | IFS | as_nl) ;; #(
-      BASH_ARGV | BASH_SOURCE) eval $ac_var= ;; #(
-      *) { eval $ac_var=; unset $ac_var;} ;;
-      esac ;;
-    esac
-  done
-  (set) 2>&1 |
-    case $as_nl`(ac_space='\'' '\''; set) 2>&1` in #(
-    *${as_nl}ac_space=\ *)
-      sed -n \
-	"s/'\''/'\''\\\\'\'''\''/g;
-	  s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\''\\2'\''/p"
-      ;; #(
-    *)
-      sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p"
-      ;;
-    esac |
-    sort
-)
-    echo
-
-    $as_echo "## ----------------- ##
-## Output variables. ##
-## ----------------- ##"
-    echo
-    for ac_var in $ac_subst_vars
-    do
-      eval ac_val=\$$ac_var
-      case $ac_val in
-      *\'\''*) ac_val=`$as_echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;;
-      esac
-      $as_echo "$ac_var='\''$ac_val'\''"
-    done | sort
-    echo
-
-    if test -n "$ac_subst_files"; then
-      $as_echo "## ------------------- ##
-## File substitutions. ##
-## ------------------- ##"
-      echo
-      for ac_var in $ac_subst_files
-      do
-	eval ac_val=\$$ac_var
-	case $ac_val in
-	*\'\''*) ac_val=`$as_echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;;
-	esac
-	$as_echo "$ac_var='\''$ac_val'\''"
-      done | sort
-      echo
-    fi
-
-    if test -s confdefs.h; then
-      $as_echo "## ----------- ##
-## confdefs.h. ##
-## ----------- ##"
-      echo
-      cat confdefs.h
-      echo
-    fi
-    test "$ac_signal" != 0 &&
-      $as_echo "$as_me: caught signal $ac_signal"
-    $as_echo "$as_me: exit $exit_status"
-  } >&5
-  rm -f core *.core core.conftest.* &&
-    rm -f -r conftest* confdefs* conf$$* $ac_clean_files &&
-    exit $exit_status
-' 0
-for ac_signal in 1 2 13 15; do
-  trap 'ac_signal='$ac_signal'; as_fn_exit 1' $ac_signal
-done
-ac_signal=0
-
-# confdefs.h avoids OS command line length limits that DEFS can exceed.
-rm -f -r conftest* confdefs.h
-
-$as_echo "/* confdefs.h */" > confdefs.h
-
-# Predefined preprocessor variables.
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_NAME "$PACKAGE_NAME"
-_ACEOF
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_TARNAME "$PACKAGE_TARNAME"
-_ACEOF
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_VERSION "$PACKAGE_VERSION"
-_ACEOF
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_STRING "$PACKAGE_STRING"
-_ACEOF
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_BUGREPORT "$PACKAGE_BUGREPORT"
-_ACEOF
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_URL "$PACKAGE_URL"
-_ACEOF
-
-
-# Let the site file select an alternate cache file if it wants to.
-# Prefer an explicitly selected file to automatically selected ones.
-ac_site_file1=NONE
-ac_site_file2=NONE
-if test -n "$CONFIG_SITE"; then
-  # We do not want a PATH search for config.site.
-  case $CONFIG_SITE in #((
-    -*)  ac_site_file1=./$CONFIG_SITE;;
-    */*) ac_site_file1=$CONFIG_SITE;;
-    *)   ac_site_file1=./$CONFIG_SITE;;
-  esac
-elif test "x$prefix" != xNONE; then
-  ac_site_file1=$prefix/share/config.site
-  ac_site_file2=$prefix/etc/config.site
-else
-  ac_site_file1=$ac_default_prefix/share/config.site
-  ac_site_file2=$ac_default_prefix/etc/config.site
-fi
-for ac_site_file in "$ac_site_file1" "$ac_site_file2"
-do
-  test "x$ac_site_file" = xNONE && continue
-  if test /dev/null != "$ac_site_file" && test -r "$ac_site_file"; then
-    { $as_echo "$as_me:${as_lineno-$LINENO}: loading site script $ac_site_file" >&5
-$as_echo "$as_me: loading site script $ac_site_file" >&6;}
-    sed 's/^/| /' "$ac_site_file" >&5
-    . "$ac_site_file" \
-      || { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-as_fn_error $? "failed to load site script $ac_site_file
-See \`config.log' for more details" "$LINENO" 5; }
-  fi
-done
-
-if test -r "$cache_file"; then
-  # Some versions of bash will fail to source /dev/null (special files
-  # actually), so we avoid doing that.  DJGPP emulates it as a regular file.
-  if test /dev/null != "$cache_file" && test -f "$cache_file"; then
-    { $as_echo "$as_me:${as_lineno-$LINENO}: loading cache $cache_file" >&5
-$as_echo "$as_me: loading cache $cache_file" >&6;}
-    case $cache_file in
-      [\\/]* | ?:[\\/]* ) . "$cache_file";;
-      *)                      . "./$cache_file";;
-    esac
-  fi
-else
-  { $as_echo "$as_me:${as_lineno-$LINENO}: creating cache $cache_file" >&5
-$as_echo "$as_me: creating cache $cache_file" >&6;}
-  >$cache_file
-fi
-
-# Check that the precious variables saved in the cache have kept the same
-# value.
-ac_cache_corrupted=false
-for ac_var in $ac_precious_vars; do
-  eval ac_old_set=\$ac_cv_env_${ac_var}_set
-  eval ac_new_set=\$ac_env_${ac_var}_set
-  eval ac_old_val=\$ac_cv_env_${ac_var}_value
-  eval ac_new_val=\$ac_env_${ac_var}_value
-  case $ac_old_set,$ac_new_set in
-    set,)
-      { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&5
-$as_echo "$as_me: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&2;}
-      ac_cache_corrupted=: ;;
-    ,set)
-      { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' was not set in the previous run" >&5
-$as_echo "$as_me: error: \`$ac_var' was not set in the previous run" >&2;}
-      ac_cache_corrupted=: ;;
-    ,);;
-    *)
-      if test "x$ac_old_val" != "x$ac_new_val"; then
-	# differences in whitespace do not lead to failure.
-	ac_old_val_w=`echo x $ac_old_val`
-	ac_new_val_w=`echo x $ac_new_val`
-	if test "$ac_old_val_w" != "$ac_new_val_w"; then
-	  { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' has changed since the previous run:" >&5
-$as_echo "$as_me: error: \`$ac_var' has changed since the previous run:" >&2;}
-	  ac_cache_corrupted=:
-	else
-	  { $as_echo "$as_me:${as_lineno-$LINENO}: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&5
-$as_echo "$as_me: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&2;}
-	  eval $ac_var=\$ac_old_val
-	fi
-	{ $as_echo "$as_me:${as_lineno-$LINENO}:   former value:  \`$ac_old_val'" >&5
-$as_echo "$as_me:   former value:  \`$ac_old_val'" >&2;}
-	{ $as_echo "$as_me:${as_lineno-$LINENO}:   current value: \`$ac_new_val'" >&5
-$as_echo "$as_me:   current value: \`$ac_new_val'" >&2;}
-      fi;;
-  esac
-  # Pass precious variables to config.status.
-  if test "$ac_new_set" = set; then
-    case $ac_new_val in
-    *\'*) ac_arg=$ac_var=`$as_echo "$ac_new_val" | sed "s/'/'\\\\\\\\''/g"` ;;
-    *) ac_arg=$ac_var=$ac_new_val ;;
-    esac
-    case " $ac_configure_args " in
-      *" '$ac_arg' "*) ;; # Avoid dups.  Use of quotes ensures accuracy.
-      *) as_fn_append ac_configure_args " '$ac_arg'" ;;
-    esac
-  fi
-done
-if $ac_cache_corrupted; then
-  { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-  { $as_echo "$as_me:${as_lineno-$LINENO}: error: changes in the environment can compromise the build" >&5
-$as_echo "$as_me: error: changes in the environment can compromise the build" >&2;}
-  as_fn_error $? "run \`make distclean' and/or \`rm $cache_file' and start over" "$LINENO" 5
-fi
-## -------------------- ##
-## Main body of script. ##
-## -------------------- ##
-
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-
-
-
-
-ac_aux_dir=
-for ac_dir in "$srcdir" "$srcdir/.." "$srcdir/../.."; do
-  if test -f "$ac_dir/install-sh"; then
-    ac_aux_dir=$ac_dir
-    ac_install_sh="$ac_aux_dir/install-sh -c"
-    break
-  elif test -f "$ac_dir/install.sh"; then
-    ac_aux_dir=$ac_dir
-    ac_install_sh="$ac_aux_dir/install.sh -c"
-    break
-  elif test -f "$ac_dir/shtool"; then
-    ac_aux_dir=$ac_dir
-    ac_install_sh="$ac_aux_dir/shtool install -c"
-    break
-  fi
-done
-if test -z "$ac_aux_dir"; then
-  as_fn_error $? "cannot find install-sh, install.sh, or shtool in \"$srcdir\" \"$srcdir/..\" \"$srcdir/../..\"" "$LINENO" 5
-fi
-
-# These three variables are undocumented and unsupported,
-# and are intended to be withdrawn in a future Autoconf release.
-# They can cause serious problems if a builder's source tree is in a directory
-# whose full name contains unusual characters.
-ac_config_guess="$SHELL $ac_aux_dir/config.guess"  # Please don't use this var.
-ac_config_sub="$SHELL $ac_aux_dir/config.sub"  # Please don't use this var.
-ac_configure="$SHELL $ac_aux_dir/configure"  # Please don't use this var.
-
-
-# Make sure we can run config.sub.
-$SHELL "$ac_aux_dir/config.sub" sun4 >/dev/null 2>&1 ||
-  as_fn_error $? "cannot run $SHELL $ac_aux_dir/config.sub" "$LINENO" 5
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking build system type" >&5
-$as_echo_n "checking build system type... " >&6; }
-if ${ac_cv_build+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  ac_build_alias=$build_alias
-test "x$ac_build_alias" = x &&
-  ac_build_alias=`$SHELL "$ac_aux_dir/config.guess"`
-test "x$ac_build_alias" = x &&
-  as_fn_error $? "cannot guess build type; you must specify one" "$LINENO" 5
-ac_cv_build=`$SHELL "$ac_aux_dir/config.sub" $ac_build_alias` ||
-  as_fn_error $? "$SHELL $ac_aux_dir/config.sub $ac_build_alias failed" "$LINENO" 5
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_build" >&5
-$as_echo "$ac_cv_build" >&6; }
-case $ac_cv_build in
-*-*-*) ;;
-*) as_fn_error $? "invalid value of canonical build" "$LINENO" 5;;
-esac
-build=$ac_cv_build
-ac_save_IFS=$IFS; IFS='-'
-set x $ac_cv_build
-shift
-build_cpu=$1
-build_vendor=$2
-shift; shift
-# Remember, the first character of IFS is used to create $*,
-# except with old shells:
-build_os=$*
-IFS=$ac_save_IFS
-case $build_os in *\ *) build_os=`echo "$build_os" | sed 's/ /-/g'`;; esac
-
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking host system type" >&5
-$as_echo_n "checking host system type... " >&6; }
-if ${ac_cv_host+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  if test "x$host_alias" = x; then
-  ac_cv_host=$ac_cv_build
-else
-  ac_cv_host=`$SHELL "$ac_aux_dir/config.sub" $host_alias` ||
-    as_fn_error $? "$SHELL $ac_aux_dir/config.sub $host_alias failed" "$LINENO" 5
-fi
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_host" >&5
-$as_echo "$ac_cv_host" >&6; }
-case $ac_cv_host in
-*-*-*) ;;
-*) as_fn_error $? "invalid value of canonical host" "$LINENO" 5;;
-esac
-host=$ac_cv_host
-ac_save_IFS=$IFS; IFS='-'
-set x $ac_cv_host
-shift
-host_cpu=$1
-host_vendor=$2
-shift; shift
-# Remember, the first character of IFS is used to create $*,
-# except with old shells:
-host_os=$*
-IFS=$ac_save_IFS
-case $host_os in *\ *) host_os=`echo "$host_os" | sed 's/ /-/g'`;; esac
-
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking target system type" >&5
-$as_echo_n "checking target system type... " >&6; }
-if ${ac_cv_target+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  if test "x$target_alias" = x; then
-  ac_cv_target=$ac_cv_host
-else
-  ac_cv_target=`$SHELL "$ac_aux_dir/config.sub" $target_alias` ||
-    as_fn_error $? "$SHELL $ac_aux_dir/config.sub $target_alias failed" "$LINENO" 5
-fi
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_target" >&5
-$as_echo "$ac_cv_target" >&6; }
-case $ac_cv_target in
-*-*-*) ;;
-*) as_fn_error $? "invalid value of canonical target" "$LINENO" 5;;
-esac
-target=$ac_cv_target
-ac_save_IFS=$IFS; IFS='-'
-set x $ac_cv_target
-shift
-target_cpu=$1
-target_vendor=$2
-shift; shift
-# Remember, the first character of IFS is used to create $*,
-# except with old shells:
-target_os=$*
-IFS=$ac_save_IFS
-case $target_os in *\ *) target_os=`echo "$target_os" | sed 's/ /-/g'`;; esac
-
-
-# The aliases save the names the user supplied, while $host etc.
-# will get canonicalized.
-test -n "$target_alias" &&
-  test "$program_prefix$program_suffix$program_transform_name" = \
-    NONENONEs,x,x, &&
-  program_prefix=${target_alias}-
-
-am__api_version='1.15'
-
-# Find a good install program.  We prefer a C program (faster),
-# so one script is as good as another.  But avoid the broken or
-# incompatible versions:
-# SysV /etc/install, /usr/sbin/install
-# SunOS /usr/etc/install
-# IRIX /sbin/install
-# AIX /bin/install
-# AmigaOS /C/install, which installs bootblocks on floppy discs
-# AIX 4 /usr/bin/installbsd, which doesn't work without a -g flag
-# AFS /usr/afsws/bin/install, which mishandles nonexistent args
-# SVR4 /usr/ucb/install, which tries to use the nonexistent group "staff"
-# OS/2's system install, which has a completely different semantic
-# ./install, which can be erroneously created by make from ./install.sh.
-# Reject install programs that cannot install multiple files.
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for a BSD-compatible install" >&5
-$as_echo_n "checking for a BSD-compatible install... " >&6; }
-if test -z "$INSTALL"; then
-if ${ac_cv_path_install+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-    # Account for people who put trailing slashes in PATH elements.
-case $as_dir/ in #((
-  ./ | .// | /[cC]/* | \
-  /etc/* | /usr/sbin/* | /usr/etc/* | /sbin/* | /usr/afsws/bin/* | \
-  ?:[\\/]os2[\\/]install[\\/]* | ?:[\\/]OS2[\\/]INSTALL[\\/]* | \
-  /usr/ucb/* ) ;;
-  *)
-    # OSF1 and SCO ODT 3.0 have their own names for install.
-    # Don't use installbsd from OSF since it installs stuff as root
-    # by default.
-    for ac_prog in ginstall scoinst install; do
-      for ac_exec_ext in '' $ac_executable_extensions; do
-	if as_fn_executable_p "$as_dir/$ac_prog$ac_exec_ext"; then
-	  if test $ac_prog = install &&
-	    grep dspmsg "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
-	    # AIX install.  It has an incompatible calling convention.
-	    :
-	  elif test $ac_prog = install &&
-	    grep pwplus "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
-	    # program-specific install script used by HP pwplus--don't use.
-	    :
-	  else
-	    rm -rf conftest.one conftest.two conftest.dir
-	    echo one > conftest.one
-	    echo two > conftest.two
-	    mkdir conftest.dir
-	    if "$as_dir/$ac_prog$ac_exec_ext" -c conftest.one conftest.two "`pwd`/conftest.dir" &&
-	      test -s conftest.one && test -s conftest.two &&
-	      test -s conftest.dir/conftest.one &&
-	      test -s conftest.dir/conftest.two
-	    then
-	      ac_cv_path_install="$as_dir/$ac_prog$ac_exec_ext -c"
-	      break 3
-	    fi
-	  fi
-	fi
-      done
-    done
-    ;;
-esac
-
-  done
-IFS=$as_save_IFS
-
-rm -rf conftest.one conftest.two conftest.dir
-
-fi
-  if test "${ac_cv_path_install+set}" = set; then
-    INSTALL=$ac_cv_path_install
-  else
-    # As a last resort, use the slow shell script.  Don't cache a
-    # value for INSTALL within a source directory, because that will
-    # break other packages using the cache if that directory is
-    # removed, or if the value is a relative name.
-    INSTALL=$ac_install_sh
-  fi
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $INSTALL" >&5
-$as_echo "$INSTALL" >&6; }
-
-# Use test -z because SunOS4 sh mishandles braces in ${var-val}.
-# It thinks the first close brace ends the variable substitution.
-test -z "$INSTALL_PROGRAM" && INSTALL_PROGRAM='${INSTALL}'
-
-test -z "$INSTALL_SCRIPT" && INSTALL_SCRIPT='${INSTALL}'
-
-test -z "$INSTALL_DATA" && INSTALL_DATA='${INSTALL} -m 644'
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether build environment is sane" >&5
-$as_echo_n "checking whether build environment is sane... " >&6; }
-# Reject unsafe characters in $srcdir or the absolute working directory
-# name.  Accept space and tab only in the latter.
-am_lf='
-'
-case `pwd` in
-  *[\\\"\#\$\&\'\`$am_lf]*)
-    as_fn_error $? "unsafe absolute working directory name" "$LINENO" 5;;
-esac
-case $srcdir in
-  *[\\\"\#\$\&\'\`$am_lf\ \	]*)
-    as_fn_error $? "unsafe srcdir value: '$srcdir'" "$LINENO" 5;;
-esac
-
-# Do 'set' in a subshell so we don't clobber the current shell's
-# arguments.  Must try -L first in case configure is actually a
-# symlink; some systems play weird games with the mod time of symlinks
-# (eg FreeBSD returns the mod time of the symlink's containing
-# directory).
-if (
-   am_has_slept=no
-   for am_try in 1 2; do
-     echo "timestamp, slept: $am_has_slept" > conftest.file
-     set X `ls -Lt "$srcdir/configure" conftest.file 2> /dev/null`
-     if test "$*" = "X"; then
-	# -L didn't work.
-	set X `ls -t "$srcdir/configure" conftest.file`
-     fi
-     if test "$*" != "X $srcdir/configure conftest.file" \
-	&& test "$*" != "X conftest.file $srcdir/configure"; then
-
-	# If neither matched, then we have a broken ls.  This can happen
-	# if, for instance, CONFIG_SHELL is bash and it inherits a
-	# broken ls alias from the environment.  This has actually
-	# happened.  Such a system could not be considered "sane".
-	as_fn_error $? "ls -t appears to fail.  Make sure there is not a broken
-  alias in your environment" "$LINENO" 5
-     fi
-     if test "$2" = conftest.file || test $am_try -eq 2; then
-       break
-     fi
-     # Just in case.
-     sleep 1
-     am_has_slept=yes
-   done
-   test "$2" = conftest.file
-   )
-then
-   # Ok.
-   :
-else
-   as_fn_error $? "newly created file is older than distributed files!
-Check your system clock" "$LINENO" 5
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
-$as_echo "yes" >&6; }
-# If we didn't sleep, we still need to ensure time stamps of config.status and
-# generated files are strictly newer.
-am_sleep_pid=
-if grep 'slept: no' conftest.file >/dev/null 2>&1; then
-  ( sleep 1 ) &
-  am_sleep_pid=$!
-fi
-
-rm -f conftest.file
-
-test "$program_prefix" != NONE &&
-  program_transform_name="s&^&$program_prefix&;$program_transform_name"
-# Use a double $ so make ignores it.
-test "$program_suffix" != NONE &&
-  program_transform_name="s&\$&$program_suffix&;$program_transform_name"
-# Double any \ or $.
-# By default was `s,x,x', remove it if useless.
-ac_script='s/[\\$]/&&/g;s/;s,x,x,$//'
-program_transform_name=`$as_echo "$program_transform_name" | sed "$ac_script"`
-
-# Expand $ac_aux_dir to an absolute path.
-am_aux_dir=`cd "$ac_aux_dir" && pwd`
-
-if test x"${MISSING+set}" != xset; then
-  case $am_aux_dir in
-  *\ * | *\	*)
-    MISSING="\${SHELL} \"$am_aux_dir/missing\"" ;;
-  *)
-    MISSING="\${SHELL} $am_aux_dir/missing" ;;
-  esac
-fi
-# Use eval to expand $SHELL
-if eval "$MISSING --is-lightweight"; then
-  am_missing_run="$MISSING "
-else
-  am_missing_run=
-  { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: 'missing' script is too old or missing" >&5
-$as_echo "$as_me: WARNING: 'missing' script is too old or missing" >&2;}
-fi
-
-if test x"${install_sh+set}" != xset; then
-  case $am_aux_dir in
-  *\ * | *\	*)
-    install_sh="\${SHELL} '$am_aux_dir/install-sh'" ;;
-  *)
-    install_sh="\${SHELL} $am_aux_dir/install-sh"
-  esac
-fi
-
-# Installed binaries are usually stripped using 'strip' when the user
-# run "make install-strip".  However 'strip' might not be the right
-# tool to use in cross-compilation environments, therefore Automake
-# will honor the 'STRIP' environment variable to overrule this program.
-if test "$cross_compiling" != no; then
-  if test -n "$ac_tool_prefix"; then
-  # Extract the first word of "${ac_tool_prefix}strip", so it can be a program name with args.
-set dummy ${ac_tool_prefix}strip; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_STRIP+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$STRIP"; then
-  ac_cv_prog_STRIP="$STRIP" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-    for ac_exec_ext in '' $ac_executable_extensions; do
-  if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
-    ac_cv_prog_STRIP="${ac_tool_prefix}strip"
-    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-  done
-IFS=$as_save_IFS
-
-fi
-fi
-STRIP=$ac_cv_prog_STRIP
-if test -n "$STRIP"; then
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $STRIP" >&5
-$as_echo "$STRIP" >&6; }
-else
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
-fi
-if test -z "$ac_cv_prog_STRIP"; then
-  ac_ct_STRIP=$STRIP
-  # Extract the first word of "strip", so it can be a program name with args.
-set dummy strip; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_ac_ct_STRIP+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$ac_ct_STRIP"; then
-  ac_cv_prog_ac_ct_STRIP="$ac_ct_STRIP" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-    for ac_exec_ext in '' $ac_executable_extensions; do
-  if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
-    ac_cv_prog_ac_ct_STRIP="strip"
-    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-  done
-IFS=$as_save_IFS
-
-fi
-fi
-ac_ct_STRIP=$ac_cv_prog_ac_ct_STRIP
-if test -n "$ac_ct_STRIP"; then
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_STRIP" >&5
-$as_echo "$ac_ct_STRIP" >&6; }
-else
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-  if test "x$ac_ct_STRIP" = x; then
-    STRIP=":"
-  else
-    case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
-    STRIP=$ac_ct_STRIP
-  fi
-else
-  STRIP="$ac_cv_prog_STRIP"
-fi
-
-fi
-INSTALL_STRIP_PROGRAM="\$(install_sh) -c -s"
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for a thread-safe mkdir -p" >&5
-$as_echo_n "checking for a thread-safe mkdir -p... " >&6; }
-if test -z "$MKDIR_P"; then
-  if ${ac_cv_path_mkdir+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH$PATH_SEPARATOR/opt/sfw/bin
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-    for ac_prog in mkdir gmkdir; do
-	 for ac_exec_ext in '' $ac_executable_extensions; do
-	   as_fn_executable_p "$as_dir/$ac_prog$ac_exec_ext" || continue
-	   case `"$as_dir/$ac_prog$ac_exec_ext" --version 2>&1` in #(
-	     'mkdir (GNU coreutils) '* | \
-	     'mkdir (coreutils) '* | \
-	     'mkdir (fileutils) '4.1*)
-	       ac_cv_path_mkdir=$as_dir/$ac_prog$ac_exec_ext
-	       break 3;;
-	   esac
-	 done
-       done
-  done
-IFS=$as_save_IFS
-
-fi
-
-  test -d ./--version && rmdir ./--version
-  if test "${ac_cv_path_mkdir+set}" = set; then
-    MKDIR_P="$ac_cv_path_mkdir -p"
-  else
-    # As a last resort, use the slow shell script.  Don't cache a
-    # value for MKDIR_P within a source directory, because that will
-    # break other packages using the cache if that directory is
-    # removed, or if the value is a relative name.
-    MKDIR_P="$ac_install_sh -d"
-  fi
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $MKDIR_P" >&5
-$as_echo "$MKDIR_P" >&6; }
-
-for ac_prog in gawk mawk nawk awk
-do
-  # Extract the first word of "$ac_prog", so it can be a program name with args.
-set dummy $ac_prog; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_AWK+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$AWK"; then
-  ac_cv_prog_AWK="$AWK" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-    for ac_exec_ext in '' $ac_executable_extensions; do
-  if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
-    ac_cv_prog_AWK="$ac_prog"
-    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-  done
-IFS=$as_save_IFS
-
-fi
-fi
-AWK=$ac_cv_prog_AWK
-if test -n "$AWK"; then
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $AWK" >&5
-$as_echo "$AWK" >&6; }
-else
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
-  test -n "$AWK" && break
-done
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether ${MAKE-make} sets \$(MAKE)" >&5
-$as_echo_n "checking whether ${MAKE-make} sets \$(MAKE)... " >&6; }
-set x ${MAKE-make}
-ac_make=`$as_echo "$2" | sed 's/+/p/g; s/[^a-zA-Z0-9_]/_/g'`
-if eval \${ac_cv_prog_make_${ac_make}_set+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  cat >conftest.make <<\_ACEOF
-SHELL = /bin/sh
-all:
-	@echo '@@@%%%=$(MAKE)=@@@%%%'
-_ACEOF
-# GNU make sometimes prints "make[1]: Entering ...", which would confuse us.
-case `${MAKE-make} -f conftest.make 2>/dev/null` in
-  *@@@%%%=?*=@@@%%%*)
-    eval ac_cv_prog_make_${ac_make}_set=yes;;
-  *)
-    eval ac_cv_prog_make_${ac_make}_set=no;;
-esac
-rm -f conftest.make
-fi
-if eval test \$ac_cv_prog_make_${ac_make}_set = yes; then
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
-$as_echo "yes" >&6; }
-  SET_MAKE=
-else
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-  SET_MAKE="MAKE=${MAKE-make}"
-fi
-
-rm -rf .tst 2>/dev/null
-mkdir .tst 2>/dev/null
-if test -d .tst; then
-  am__leading_dot=.
-else
-  am__leading_dot=_
-fi
-rmdir .tst 2>/dev/null
-
-# Check whether --enable-silent-rules was given.
-if test "${enable_silent_rules+set}" = set; then :
-  enableval=$enable_silent_rules;
-fi
-
-case $enable_silent_rules in # (((
-  yes) AM_DEFAULT_VERBOSITY=0;;
-   no) AM_DEFAULT_VERBOSITY=1;;
-    *) AM_DEFAULT_VERBOSITY=1;;
-esac
-am_make=${MAKE-make}
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $am_make supports nested variables" >&5
-$as_echo_n "checking whether $am_make supports nested variables... " >&6; }
-if ${am_cv_make_support_nested_variables+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  if $as_echo 'TRUE=$(BAR$(V))
-BAR0=false
-BAR1=true
-V=1
-am__doit:
-	@$(TRUE)
-.PHONY: am__doit' | $am_make -f - >/dev/null 2>&1; then
-  am_cv_make_support_nested_variables=yes
-else
-  am_cv_make_support_nested_variables=no
-fi
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_make_support_nested_variables" >&5
-$as_echo "$am_cv_make_support_nested_variables" >&6; }
-if test $am_cv_make_support_nested_variables = yes; then
-    AM_V='$(V)'
-  AM_DEFAULT_V='$(AM_DEFAULT_VERBOSITY)'
-else
-  AM_V=$AM_DEFAULT_VERBOSITY
-  AM_DEFAULT_V=$AM_DEFAULT_VERBOSITY
-fi
-AM_BACKSLASH='\'
-
-if test "`cd $srcdir && pwd`" != "`pwd`"; then
-  # Use -I$(srcdir) only when $(srcdir) != ., so that make's output
-  # is not polluted with repeated "-I."
-  am__isrc=' -I$(srcdir)'
-  # test to see if srcdir already configured
-  if test -f $srcdir/config.status; then
-    as_fn_error $? "source directory already configured; run \"make distclean\" there first" "$LINENO" 5
-  fi
-fi
-
-# test whether we have cygpath
-if test -z "$CYGPATH_W"; then
-  if (cygpath --version) >/dev/null 2>/dev/null; then
-    CYGPATH_W='cygpath -w'
-  else
-    CYGPATH_W=echo
-  fi
-fi
-
-
-# Define the identity of the package.
- PACKAGE='rock'
- VERSION='1.9.5'
-
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE "$PACKAGE"
-_ACEOF
-
-
-cat >>confdefs.h <<_ACEOF
-#define VERSION "$VERSION"
-_ACEOF
-
-# Some tools Automake needs.
-
-ACLOCAL=${ACLOCAL-"${am_missing_run}aclocal-${am__api_version}"}
-
-
-AUTOCONF=${AUTOCONF-"${am_missing_run}autoconf"}
-
-
-AUTOMAKE=${AUTOMAKE-"${am_missing_run}automake-${am__api_version}"}
-
-
-AUTOHEADER=${AUTOHEADER-"${am_missing_run}autoheader"}
-
-
-MAKEINFO=${MAKEINFO-"${am_missing_run}makeinfo"}
-
-# For better backward compatibility.  To be removed once Automake 1.9.x
-# dies out for good.  For more background, see:
-# <http://lists.gnu.org/archive/html/automake/2012-07/msg00001.html>
-# <http://lists.gnu.org/archive/html/automake/2012-07/msg00014.html>
-mkdir_p='$(MKDIR_P)'
-
-# We need awk for the "check" target (and possibly the TAP driver).  The
-# system "awk" is bad on some platforms.
-# Always define AMTAR for backward compatibility.  Yes, it's still used
-# in the wild :-(  We should find a proper way to deprecate it ...
-AMTAR='$${TAR-tar}'
-
-
-# We'll loop over all known methods to create a tar archive until one works.
-_am_tools='gnutar  pax cpio none'
-
-am__tar='$${TAR-tar} chof - "$$tardir"' am__untar='$${TAR-tar} xf -'
-
-
-
-
-
-
-# POSIX will say in a future version that running "rm -f" with no argument
-# is OK; and we want to be able to make that assumption in our Makefile
-# recipes.  So use an aggressive probe to check that the usage we want is
-# actually supported "in the wild" to an acceptable degree.
-# See automake bug#10828.
-# To make any issue more visible, cause the running configure to be aborted
-# by default if the 'rm' program in use doesn't match our expectations; the
-# user can still override this though.
-if rm -f && rm -fr && rm -rf; then : OK; else
-  cat >&2 <<'END'
-Oops!
-
-Your 'rm' program seems unable to run without file operands specified
-on the command line, even when the '-f' option is present.  This is contrary
-to the behaviour of most rm programs out there, and not conforming with
-the upcoming POSIX standard: <http://austingroupbugs.net/view.php?id=542>
-
-Please tell bug-automake@gnu.org about your system, including the value
-of your $PATH and any error possibly output before this message.  This
-can help us improve future automake versions.
-
-END
-  if test x"$ACCEPT_INFERIOR_RM_PROGRAM" = x"yes"; then
-    echo 'Configuration will proceed anyway, since you have set the' >&2
-    echo 'ACCEPT_INFERIOR_RM_PROGRAM variable to "yes"' >&2
-    echo >&2
-  else
-    cat >&2 <<'END'
-Aborting the configuration process, to ensure you take notice of the issue.
-
-You can download and install GNU coreutils to get an 'rm' implementation
-that behaves properly: <http://www.gnu.org/software/coreutils/>.
-
-If you want to complete the configuration process using your problematic
-'rm' anyway, export the environment variable ACCEPT_INFERIOR_RM_PROGRAM
-to "yes", and re-run configure.
-
-END
-    as_fn_error $? "Your 'rm' program is bad, sorry." "$LINENO" 5
-  fi
-fi
-
-
-# Checks for programs.
-ac_ext=cpp
-ac_cpp='$CXXCPP $CPPFLAGS'
-ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
-if test -z "$CXX"; then
-  if test -n "$CCC"; then
-    CXX=$CCC
-  else
-    if test -n "$ac_tool_prefix"; then
-  for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC
-  do
-    # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
-set dummy $ac_tool_prefix$ac_prog; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_CXX+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$CXX"; then
-  ac_cv_prog_CXX="$CXX" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-    for ac_exec_ext in '' $ac_executable_extensions; do
-  if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
-    ac_cv_prog_CXX="$ac_tool_prefix$ac_prog"
-    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-  done
-IFS=$as_save_IFS
-
-fi
-fi
-CXX=$ac_cv_prog_CXX
-if test -n "$CXX"; then
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CXX" >&5
-$as_echo "$CXX" >&6; }
-else
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
-    test -n "$CXX" && break
-  done
-fi
-if test -z "$CXX"; then
-  ac_ct_CXX=$CXX
-  for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC
-do
-  # Extract the first word of "$ac_prog", so it can be a program name with args.
-set dummy $ac_prog; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_ac_ct_CXX+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$ac_ct_CXX"; then
-  ac_cv_prog_ac_ct_CXX="$ac_ct_CXX" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-    for ac_exec_ext in '' $ac_executable_extensions; do
-  if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
-    ac_cv_prog_ac_ct_CXX="$ac_prog"
-    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-  done
-IFS=$as_save_IFS
-
-fi
-fi
-ac_ct_CXX=$ac_cv_prog_ac_ct_CXX
-if test -n "$ac_ct_CXX"; then
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CXX" >&5
-$as_echo "$ac_ct_CXX" >&6; }
-else
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
-  test -n "$ac_ct_CXX" && break
-done
-
-  if test "x$ac_ct_CXX" = x; then
-    CXX="g++"
-  else
-    case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
-    CXX=$ac_ct_CXX
-  fi
-fi
-
-  fi
-fi
-# Provide some information about the compiler.
-$as_echo "$as_me:${as_lineno-$LINENO}: checking for C++ compiler version" >&5
-set X $ac_compile
-ac_compiler=$2
-for ac_option in --version -v -V -qversion; do
-  { { ac_try="$ac_compiler $ac_option >&5"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
-  (eval "$ac_compiler $ac_option >&5") 2>conftest.err
-  ac_status=$?
-  if test -s conftest.err; then
-    sed '10a\
-... rest of stderr output deleted ...
-         10q' conftest.err >conftest.er1
-    cat conftest.er1 >&5
-  fi
-  rm -f conftest.er1 conftest.err
-  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
-  test $ac_status = 0; }
-done
-
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h.  */
-
-int
-main ()
-{
-
-  ;
-  return 0;
-}
-_ACEOF
-ac_clean_files_save=$ac_clean_files
-ac_clean_files="$ac_clean_files a.out a.out.dSYM a.exe b.out"
-# Try to create an executable without -o first, disregard a.out.
-# It will help us diagnose broken compilers, and finding out an intuition
-# of exeext.
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether the C++ compiler works" >&5
-$as_echo_n "checking whether the C++ compiler works... " >&6; }
-ac_link_default=`$as_echo "$ac_link" | sed 's/ -o *conftest[^ ]*//'`
-
-# The possible output files:
-ac_files="a.out conftest.exe conftest a.exe a_out.exe b.out conftest.*"
-
-ac_rmfiles=
-for ac_file in $ac_files
-do
-  case $ac_file in
-    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;;
-    * ) ac_rmfiles="$ac_rmfiles $ac_file";;
-  esac
-done
-rm -f $ac_rmfiles
-
-if { { ac_try="$ac_link_default"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
-  (eval "$ac_link_default") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
-  test $ac_status = 0; }; then :
-  # Autoconf-2.13 could set the ac_cv_exeext variable to `no'.
-# So ignore a value of `no', otherwise this would lead to `EXEEXT = no'
-# in a Makefile.  We should not override ac_cv_exeext if it was cached,
-# so that the user can short-circuit this test for compilers unknown to
-# Autoconf.
-for ac_file in $ac_files ''
-do
-  test -f "$ac_file" || continue
-  case $ac_file in
-    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj )
-	;;
-    [ab].out )
-	# We found the default executable, but exeext='' is most
-	# certainly right.
-	break;;
-    *.* )
-	if test "${ac_cv_exeext+set}" = set && test "$ac_cv_exeext" != no;
-	then :; else
-	   ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
-	fi
-	# We set ac_cv_exeext here because the later test for it is not
-	# safe: cross compilers may not add the suffix if given an `-o'
-	# argument, so we may need to know it at that point already.
-	# Even if this section looks crufty: it has the advantage of
-	# actually working.
-	break;;
-    * )
-	break;;
-  esac
-done
-test "$ac_cv_exeext" = no && ac_cv_exeext=
-
-else
-  ac_file=''
-fi
-if test -z "$ac_file"; then :
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-$as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-{ { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-as_fn_error 77 "C++ compiler cannot create executables
-See \`config.log' for more details" "$LINENO" 5; }
-else
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
-$as_echo "yes" >&6; }
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for C++ compiler default output file name" >&5
-$as_echo_n "checking for C++ compiler default output file name... " >&6; }
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_file" >&5
-$as_echo "$ac_file" >&6; }
-ac_exeext=$ac_cv_exeext
-
-rm -f -r a.out a.out.dSYM a.exe conftest$ac_cv_exeext b.out
-ac_clean_files=$ac_clean_files_save
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for suffix of executables" >&5
-$as_echo_n "checking for suffix of executables... " >&6; }
-if { { ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
-  (eval "$ac_link") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
-  test $ac_status = 0; }; then :
-  # If both `conftest.exe' and `conftest' are `present' (well, observable)
-# catch `conftest.exe'.  For instance with Cygwin, `ls conftest' will
-# work properly (i.e., refer to `conftest.exe'), while it won't with
-# `rm'.
-for ac_file in conftest.exe conftest conftest.*; do
-  test -f "$ac_file" || continue
-  case $ac_file in
-    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;;
-    *.* ) ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
-	  break;;
-    * ) break;;
-  esac
-done
-else
-  { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-as_fn_error $? "cannot compute suffix of executables: cannot compile and link
-See \`config.log' for more details" "$LINENO" 5; }
-fi
-rm -f conftest conftest$ac_cv_exeext
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_exeext" >&5
-$as_echo "$ac_cv_exeext" >&6; }
-
-rm -f conftest.$ac_ext
-EXEEXT=$ac_cv_exeext
-ac_exeext=$EXEEXT
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h.  */
-#include <stdio.h>
-int
-main ()
-{
-FILE *f = fopen ("conftest.out", "w");
- return ferror (f) || fclose (f) != 0;
-
-  ;
-  return 0;
-}
-_ACEOF
-ac_clean_files="$ac_clean_files conftest.out"
-# Check that the compiler produces executables we can run.  If not, either
-# the compiler is broken, or we cross compile.
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether we are cross compiling" >&5
-$as_echo_n "checking whether we are cross compiling... " >&6; }
-if test "$cross_compiling" != yes; then
-  { { ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
-  (eval "$ac_link") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
-  test $ac_status = 0; }
-  if { ac_try='./conftest$ac_cv_exeext'
-  { { case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
-  (eval "$ac_try") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
-  test $ac_status = 0; }; }; then
-    cross_compiling=no
-  else
-    if test "$cross_compiling" = maybe; then
-	cross_compiling=yes
-    else
-	{ { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-as_fn_error $? "cannot run C++ compiled programs.
-If you meant to cross compile, use \`--host'.
-See \`config.log' for more details" "$LINENO" 5; }
-    fi
-  fi
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $cross_compiling" >&5
-$as_echo "$cross_compiling" >&6; }
-
-rm -f conftest.$ac_ext conftest$ac_cv_exeext conftest.out
-ac_clean_files=$ac_clean_files_save
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for suffix of object files" >&5
-$as_echo_n "checking for suffix of object files... " >&6; }
-if ${ac_cv_objext+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h.  */
-
-int
-main ()
-{
-
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.o conftest.obj
-if { { ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
-  (eval "$ac_compile") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
-  test $ac_status = 0; }; then :
-  for ac_file in conftest.o conftest.obj conftest.*; do
-  test -f "$ac_file" || continue;
-  case $ac_file in
-    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM ) ;;
-    *) ac_cv_objext=`expr "$ac_file" : '.*\.\(.*\)'`
-       break;;
-  esac
-done
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-{ { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-as_fn_error $? "cannot compute suffix of object files: cannot compile
-See \`config.log' for more details" "$LINENO" 5; }
-fi
-rm -f conftest.$ac_cv_objext conftest.$ac_ext
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_objext" >&5
-$as_echo "$ac_cv_objext" >&6; }
-OBJEXT=$ac_cv_objext
-ac_objext=$OBJEXT
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether we are using the GNU C++ compiler" >&5
-$as_echo_n "checking whether we are using the GNU C++ compiler... " >&6; }
-if ${ac_cv_cxx_compiler_gnu+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h.  */
-
-int
-main ()
-{
-#ifndef __GNUC__
-       choke me
-#endif
-
-  ;
-  return 0;
-}
-_ACEOF
-if ac_fn_cxx_try_compile "$LINENO"; then :
-  ac_compiler_gnu=yes
-else
-  ac_compiler_gnu=no
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-ac_cv_cxx_compiler_gnu=$ac_compiler_gnu
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_cxx_compiler_gnu" >&5
-$as_echo "$ac_cv_cxx_compiler_gnu" >&6; }
-if test $ac_compiler_gnu = yes; then
-  GXX=yes
-else
-  GXX=
-fi
-ac_test_CXXFLAGS=${CXXFLAGS+set}
-ac_save_CXXFLAGS=$CXXFLAGS
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CXX accepts -g" >&5
-$as_echo_n "checking whether $CXX accepts -g... " >&6; }
-if ${ac_cv_prog_cxx_g+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  ac_save_cxx_werror_flag=$ac_cxx_werror_flag
-   ac_cxx_werror_flag=yes
-   ac_cv_prog_cxx_g=no
-   CXXFLAGS="-g"
-   cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h.  */
-
-int
-main ()
-{
-
-  ;
-  return 0;
-}
-_ACEOF
-if ac_fn_cxx_try_compile "$LINENO"; then :
-  ac_cv_prog_cxx_g=yes
-else
-  CXXFLAGS=""
-      cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h.  */
-
-int
-main ()
-{
-
-  ;
-  return 0;
-}
-_ACEOF
-if ac_fn_cxx_try_compile "$LINENO"; then :
-
-else
-  ac_cxx_werror_flag=$ac_save_cxx_werror_flag
-	 CXXFLAGS="-g"
-	 cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h.  */
-
-int
-main ()
-{
-
-  ;
-  return 0;
-}
-_ACEOF
-if ac_fn_cxx_try_compile "$LINENO"; then :
-  ac_cv_prog_cxx_g=yes
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-   ac_cxx_werror_flag=$ac_save_cxx_werror_flag
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cxx_g" >&5
-$as_echo "$ac_cv_prog_cxx_g" >&6; }
-if test "$ac_test_CXXFLAGS" = set; then
-  CXXFLAGS=$ac_save_CXXFLAGS
-elif test $ac_cv_prog_cxx_g = yes; then
-  if test "$GXX" = yes; then
-    CXXFLAGS="-g -O2"
-  else
-    CXXFLAGS="-g"
-  fi
-else
-  if test "$GXX" = yes; then
-    CXXFLAGS="-O2"
-  else
-    CXXFLAGS=
-  fi
-fi
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-DEPDIR="${am__leading_dot}deps"
-
-ac_config_commands="$ac_config_commands depfiles"
-
-
-am_make=${MAKE-make}
-cat > confinc << 'END'
-am__doit:
-	@echo this is the am__doit target
-.PHONY: am__doit
-END
-# If we don't find an include directive, just comment out the code.
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for style of include used by $am_make" >&5
-$as_echo_n "checking for style of include used by $am_make... " >&6; }
-am__include="#"
-am__quote=
-_am_result=none
-# First try GNU make style include.
-echo "include confinc" > confmf
-# Ignore all kinds of additional output from 'make'.
-case `$am_make -s -f confmf 2> /dev/null` in #(
-*the\ am__doit\ target*)
-  am__include=include
-  am__quote=
-  _am_result=GNU
-  ;;
-esac
-# Now try BSD make style include.
-if test "$am__include" = "#"; then
-   echo '.include "confinc"' > confmf
-   case `$am_make -s -f confmf 2> /dev/null` in #(
-   *the\ am__doit\ target*)
-     am__include=.include
-     am__quote="\""
-     _am_result=BSD
-     ;;
-   esac
-fi
-
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $_am_result" >&5
-$as_echo "$_am_result" >&6; }
-rm -f confinc confmf
-
-# Check whether --enable-dependency-tracking was given.
-if test "${enable_dependency_tracking+set}" = set; then :
-  enableval=$enable_dependency_tracking;
-fi
-
-if test "x$enable_dependency_tracking" != xno; then
-  am_depcomp="$ac_aux_dir/depcomp"
-  AMDEPBACKSLASH='\'
-  am__nodep='_no'
-fi
- if test "x$enable_dependency_tracking" != xno; then
-  AMDEP_TRUE=
-  AMDEP_FALSE='#'
-else
-  AMDEP_TRUE='#'
-  AMDEP_FALSE=
-fi
-
-
-
-depcc="$CXX"  am_compiler_list=
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking dependency style of $depcc" >&5
-$as_echo_n "checking dependency style of $depcc... " >&6; }
-if ${am_cv_CXX_dependencies_compiler_type+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
-  # We make a subdir and do the tests there.  Otherwise we can end up
-  # making bogus files that we don't know about and never remove.  For
-  # instance it was reported that on HP-UX the gcc test will end up
-  # making a dummy file named 'D' -- because '-MD' means "put the output
-  # in D".
-  rm -rf conftest.dir
-  mkdir conftest.dir
-  # Copy depcomp to subdir because otherwise we won't find it if we're
-  # using a relative directory.
-  cp "$am_depcomp" conftest.dir
-  cd conftest.dir
-  # We will build objects and dependencies in a subdirectory because
-  # it helps to detect inapplicable dependency modes.  For instance
-  # both Tru64's cc and ICC support -MD to output dependencies as a
-  # side effect of compilation, but ICC will put the dependencies in
-  # the current directory while Tru64 will put them in the object
-  # directory.
-  mkdir sub
-
-  am_cv_CXX_dependencies_compiler_type=none
-  if test "$am_compiler_list" = ""; then
-     am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp`
-  fi
-  am__universal=false
-  case " $depcc " in #(
-     *\ -arch\ *\ -arch\ *) am__universal=true ;;
-     esac
-
-  for depmode in $am_compiler_list; do
-    # Setup a source with many dependencies, because some compilers
-    # like to wrap large dependency lists on column 80 (with \), and
-    # we should not choose a depcomp mode which is confused by this.
-    #
-    # We need to recreate these files for each test, as the compiler may
-    # overwrite some of them when testing with obscure command lines.
-    # This happens at least with the AIX C compiler.
-    : > sub/conftest.c
-    for i in 1 2 3 4 5 6; do
-      echo '#include "conftst'$i'.h"' >> sub/conftest.c
-      # Using ": > sub/conftst$i.h" creates only sub/conftst1.h with
-      # Solaris 10 /bin/sh.
-      echo '/* dummy */' > sub/conftst$i.h
-    done
-    echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
-
-    # We check with '-c' and '-o' for the sake of the "dashmstdout"
-    # mode.  It turns out that the SunPro C++ compiler does not properly
-    # handle '-M -o', and we need to detect this.  Also, some Intel
-    # versions had trouble with output in subdirs.
-    am__obj=sub/conftest.${OBJEXT-o}
-    am__minus_obj="-o $am__obj"
-    case $depmode in
-    gcc)
-      # This depmode causes a compiler race in universal mode.
-      test "$am__universal" = false || continue
-      ;;
-    nosideeffect)
-      # After this tag, mechanisms are not by side-effect, so they'll
-      # only be used when explicitly requested.
-      if test "x$enable_dependency_tracking" = xyes; then
-	continue
-      else
-	break
-      fi
-      ;;
-    msvc7 | msvc7msys | msvisualcpp | msvcmsys)
-      # This compiler won't grok '-c -o', but also, the minuso test has
-      # not run yet.  These depmodes are late enough in the game, and
-      # so weak that their functioning should not be impacted.
-      am__obj=conftest.${OBJEXT-o}
-      am__minus_obj=
-      ;;
-    none) break ;;
-    esac
-    if depmode=$depmode \
-       source=sub/conftest.c object=$am__obj \
-       depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
-       $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
-         >/dev/null 2>conftest.err &&
-       grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
-       grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
-       grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
-       ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
-      # icc doesn't choke on unknown options, it will just issue warnings
-      # or remarks (even with -Werror).  So we grep stderr for any message
-      # that says an option was ignored or not supported.
-      # When given -MP, icc 7.0 and 7.1 complain thusly:
-      #   icc: Command line warning: ignoring option '-M'; no argument required
-      # The diagnosis changed in icc 8.0:
-      #   icc: Command line remark: option '-MP' not supported
-      if (grep 'ignoring option' conftest.err ||
-          grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
-        am_cv_CXX_dependencies_compiler_type=$depmode
-        break
-      fi
-    fi
-  done
-
-  cd ..
-  rm -rf conftest.dir
-else
-  am_cv_CXX_dependencies_compiler_type=none
-fi
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_CXX_dependencies_compiler_type" >&5
-$as_echo "$am_cv_CXX_dependencies_compiler_type" >&6; }
-CXXDEPMODE=depmode=$am_cv_CXX_dependencies_compiler_type
-
- if
-  test "x$enable_dependency_tracking" != xno \
-  && test "$am_cv_CXX_dependencies_compiler_type" = gcc3; then
-  am__fastdepCXX_TRUE=
-  am__fastdepCXX_FALSE='#'
-else
-  am__fastdepCXX_TRUE='#'
-  am__fastdepCXX_FALSE=
-fi
-
-
-if test -n "$ac_tool_prefix"; then
-  # Extract the first word of "${ac_tool_prefix}ranlib", so it can be a program name with args.
-set dummy ${ac_tool_prefix}ranlib; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_RANLIB+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$RANLIB"; then
-  ac_cv_prog_RANLIB="$RANLIB" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-    for ac_exec_ext in '' $ac_executable_extensions; do
-  if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
-    ac_cv_prog_RANLIB="${ac_tool_prefix}ranlib"
-    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-  done
-IFS=$as_save_IFS
-
-fi
-fi
-RANLIB=$ac_cv_prog_RANLIB
-if test -n "$RANLIB"; then
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $RANLIB" >&5
-$as_echo "$RANLIB" >&6; }
-else
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
-fi
-if test -z "$ac_cv_prog_RANLIB"; then
-  ac_ct_RANLIB=$RANLIB
-  # Extract the first word of "ranlib", so it can be a program name with args.
-set dummy ranlib; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_ac_ct_RANLIB+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$ac_ct_RANLIB"; then
-  ac_cv_prog_ac_ct_RANLIB="$ac_ct_RANLIB" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-    for ac_exec_ext in '' $ac_executable_extensions; do
-  if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
-    ac_cv_prog_ac_ct_RANLIB="ranlib"
-    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-  done
-IFS=$as_save_IFS
-
-fi
-fi
-ac_ct_RANLIB=$ac_cv_prog_ac_ct_RANLIB
-if test -n "$ac_ct_RANLIB"; then
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_RANLIB" >&5
-$as_echo "$ac_ct_RANLIB" >&6; }
-else
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-  if test "x$ac_ct_RANLIB" = x; then
-    RANLIB=":"
-  else
-    case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
-    RANLIB=$ac_ct_RANLIB
-  fi
-else
-  RANLIB="$ac_cv_prog_RANLIB"
-fi
-
-# Extract the first word of "pod2man", so it can be a program name with args.
-set dummy pod2man; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_POD2MAN+:} false; then :
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$POD2MAN"; then
-  ac_cv_prog_POD2MAN="$POD2MAN" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-    for ac_exec_ext in '' $ac_executable_extensions; do
-  if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
-    ac_cv_prog_POD2MAN="pod2man"
-    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-  done
-IFS=$as_save_IFS
-
-  test -z "$ac_cv_prog_POD2MAN" && ac_cv_prog_POD2MAN=":"
-fi
-fi
-POD2MAN=$ac_cv_prog_POD2MAN
-if test -n "$POD2MAN"; then
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $POD2MAN" >&5
-$as_echo "$POD2MAN" >&6; }
-else
-  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
-
-
-ac_config_files="$ac_config_files Makefile src/Makefile test/Makefile doc/Makefile"
-
-cat >confcache <<\_ACEOF
-# This file is a shell script that caches the results of configure
-# tests run on this system so they can be shared between configure
-# scripts and configure runs, see configure's option --config-cache.
-# It is not useful on other systems.  If it contains results you don't
-# want to keep, you may remove or edit it.
-#
-# config.status only pays attention to the cache file if you give it
-# the --recheck option to rerun configure.
-#
-# `ac_cv_env_foo' variables (set or unset) will be overridden when
-# loading this file, other *unset* `ac_cv_foo' will be assigned the
-# following values.
-
-_ACEOF
-
-# The following way of writing the cache mishandles newlines in values,
-# but we know of no workaround that is simple, portable, and efficient.
-# So, we kill variables containing newlines.
-# Ultrix sh set writes to stderr and can't be redirected directly,
-# and sets the high bit in the cache file unless we assign to the vars.
-(
-  for ac_var in `(set) 2>&1 | sed -n 's/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'`; do
-    eval ac_val=\$$ac_var
-    case $ac_val in #(
-    *${as_nl}*)
-      case $ac_var in #(
-      *_cv_*) { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: cache variable $ac_var contains a newline" >&5
-$as_echo "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;;
-      esac
-      case $ac_var in #(
-      _ | IFS | as_nl) ;; #(
-      BASH_ARGV | BASH_SOURCE) eval $ac_var= ;; #(
-      *) { eval $ac_var=; unset $ac_var;} ;;
-      esac ;;
-    esac
-  done
-
-  (set) 2>&1 |
-    case $as_nl`(ac_space=' '; set) 2>&1` in #(
-    *${as_nl}ac_space=\ *)
-      # `set' does not quote correctly, so add quotes: double-quote
-      # substitution turns \\\\ into \\, and sed turns \\ into \.
-      sed -n \
-	"s/'/'\\\\''/g;
-	  s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\\2'/p"
-      ;; #(
-    *)
-      # `set' quotes correctly as required by POSIX, so do not add quotes.
-      sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p"
-      ;;
-    esac |
-    sort
-) |
-  sed '
-     /^ac_cv_env_/b end
-     t clear
-     :clear
-     s/^\([^=]*\)=\(.*[{}].*\)$/test "${\1+set}" = set || &/
-     t end
-     s/^\([^=]*\)=\(.*\)$/\1=${\1=\2}/
-     :end' >>confcache
-if diff "$cache_file" confcache >/dev/null 2>&1; then :; else
-  if test -w "$cache_file"; then
-    if test "x$cache_file" != "x/dev/null"; then
-      { $as_echo "$as_me:${as_lineno-$LINENO}: updating cache $cache_file" >&5
-$as_echo "$as_me: updating cache $cache_file" >&6;}
-      if test ! -f "$cache_file" || test -h "$cache_file"; then
-	cat confcache >"$cache_file"
-      else
-        case $cache_file in #(
-        */* | ?:*)
-	  mv -f confcache "$cache_file"$$ &&
-	  mv -f "$cache_file"$$ "$cache_file" ;; #(
-        *)
-	  mv -f confcache "$cache_file" ;;
-	esac
-      fi
-    fi
-  else
-    { $as_echo "$as_me:${as_lineno-$LINENO}: not updating unwritable cache $cache_file" >&5
-$as_echo "$as_me: not updating unwritable cache $cache_file" >&6;}
-  fi
-fi
-rm -f confcache
-
-test "x$prefix" = xNONE && prefix=$ac_default_prefix
-# Let make expand exec_prefix.
-test "x$exec_prefix" = xNONE && exec_prefix='${prefix}'
-
-# Transform confdefs.h into DEFS.
-# Protect against shell expansion while executing Makefile rules.
-# Protect against Makefile macro expansion.
-#
-# If the first sed substitution is executed (which looks for macros that
-# take arguments), then branch to the quote section.  Otherwise,
-# look for a macro that doesn't take arguments.
-ac_script='
-:mline
-/\\$/{
- N
- s,\\\n,,
- b mline
-}
-t clear
-:clear
-s/^[	 ]*#[	 ]*define[	 ][	 ]*\([^	 (][^	 (]*([^)]*)\)[	 ]*\(.*\)/-D\1=\2/g
-t quote
-s/^[	 ]*#[	 ]*define[	 ][	 ]*\([^	 ][^	 ]*\)[	 ]*\(.*\)/-D\1=\2/g
-t quote
-b any
-:quote
-s/[	 `~#$^&*(){}\\|;'\''"<>?]/\\&/g
-s/\[/\\&/g
-s/\]/\\&/g
-s/\$/$$/g
-H
-:any
-${
-	g
-	s/^\n//
-	s/\n/ /g
-	p
-}
-'
-DEFS=`sed -n "$ac_script" confdefs.h`
-
-
-ac_libobjs=
-ac_ltlibobjs=
-U=
-for ac_i in : $LIBOBJS; do test "x$ac_i" = x: && continue
-  # 1. Remove the extension, and $U if already installed.
-  ac_script='s/\$U\././;s/\.o$//;s/\.obj$//'
-  ac_i=`$as_echo "$ac_i" | sed "$ac_script"`
-  # 2. Prepend LIBOBJDIR.  When used with automake>=1.10 LIBOBJDIR
-  #    will be set to the directory where LIBOBJS objects are built.
-  as_fn_append ac_libobjs " \${LIBOBJDIR}$ac_i\$U.$ac_objext"
-  as_fn_append ac_ltlibobjs " \${LIBOBJDIR}$ac_i"'$U.lo'
-done
-LIBOBJS=$ac_libobjs
-
-LTLIBOBJS=$ac_ltlibobjs
-
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking that generated files are newer than configure" >&5
-$as_echo_n "checking that generated files are newer than configure... " >&6; }
-   if test -n "$am_sleep_pid"; then
-     # Hide warnings about reused PIDs.
-     wait $am_sleep_pid 2>/dev/null
-   fi
-   { $as_echo "$as_me:${as_lineno-$LINENO}: result: done" >&5
-$as_echo "done" >&6; }
- if test -n "$EXEEXT"; then
-  am__EXEEXT_TRUE=
-  am__EXEEXT_FALSE='#'
-else
-  am__EXEEXT_TRUE='#'
-  am__EXEEXT_FALSE=
-fi
-
-if test -z "${AMDEP_TRUE}" && test -z "${AMDEP_FALSE}"; then
-  as_fn_error $? "conditional \"AMDEP\" was never defined.
-Usually this means the macro was only invoked conditionally." "$LINENO" 5
-fi
-if test -z "${am__fastdepCXX_TRUE}" && test -z "${am__fastdepCXX_FALSE}"; then
-  as_fn_error $? "conditional \"am__fastdepCXX\" was never defined.
-Usually this means the macro was only invoked conditionally." "$LINENO" 5
-fi
-
-: "${CONFIG_STATUS=./config.status}"
-ac_write_fail=0
-ac_clean_files_save=$ac_clean_files
-ac_clean_files="$ac_clean_files $CONFIG_STATUS"
-{ $as_echo "$as_me:${as_lineno-$LINENO}: creating $CONFIG_STATUS" >&5
-$as_echo "$as_me: creating $CONFIG_STATUS" >&6;}
-as_write_fail=0
-cat >$CONFIG_STATUS <<_ASEOF || as_write_fail=1
-#! $SHELL
-# Generated by $as_me.
-# Run this file to recreate the current configuration.
-# Compiler output produced by configure, useful for debugging
-# configure, is in config.log if it exists.
-
-debug=false
-ac_cs_recheck=false
-ac_cs_silent=false
-
-SHELL=\${CONFIG_SHELL-$SHELL}
-export SHELL
-_ASEOF
-cat >>$CONFIG_STATUS <<\_ASEOF || as_write_fail=1
-## -------------------- ##
-## M4sh Initialization. ##
-## -------------------- ##
-
-# Be more Bourne compatible
-DUALCASE=1; export DUALCASE # for MKS sh
-if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then :
-  emulate sh
-  NULLCMD=:
-  # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which
-  # is contrary to our usage.  Disable this feature.
-  alias -g '${1+"$@"}'='"$@"'
-  setopt NO_GLOB_SUBST
-else
-  case `(set -o) 2>/dev/null` in #(
-  *posix*) :
-    set -o posix ;; #(
-  *) :
-     ;;
-esac
-fi
-
-
-as_nl='
-'
-export as_nl
-# Printing a long string crashes Solaris 7 /usr/bin/printf.
-as_echo='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\'
-as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo
-as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo$as_echo
-# Prefer a ksh shell builtin over an external printf program on Solaris,
-# but without wasting forks for bash or zsh.
-if test -z "$BASH_VERSION$ZSH_VERSION" \
-    && (test "X`print -r -- $as_echo`" = "X$as_echo") 2>/dev/null; then
-  as_echo='print -r --'
-  as_echo_n='print -rn --'
-elif (test "X`printf %s $as_echo`" = "X$as_echo") 2>/dev/null; then
-  as_echo='printf %s\n'
-  as_echo_n='printf %s'
-else
-  if test "X`(/usr/ucb/echo -n -n $as_echo) 2>/dev/null`" = "X-n $as_echo"; then
-    as_echo_body='eval /usr/ucb/echo -n "$1$as_nl"'
-    as_echo_n='/usr/ucb/echo -n'
-  else
-    as_echo_body='eval expr "X$1" : "X\\(.*\\)"'
-    as_echo_n_body='eval
-      arg=$1;
-      case $arg in #(
-      *"$as_nl"*)
-	expr "X$arg" : "X\\(.*\\)$as_nl";
-	arg=`expr "X$arg" : ".*$as_nl\\(.*\\)"`;;
-      esac;
-      expr "X$arg" : "X\\(.*\\)" | tr -d "$as_nl"
-    '
-    export as_echo_n_body
-    as_echo_n='sh -c $as_echo_n_body as_echo'
-  fi
-  export as_echo_body
-  as_echo='sh -c $as_echo_body as_echo'
-fi
-
-# The user is always right.
-if test "${PATH_SEPARATOR+set}" != set; then
-  PATH_SEPARATOR=:
-  (PATH='/bin;/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 && {
-    (PATH='/bin:/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 ||
-      PATH_SEPARATOR=';'
-  }
-fi
-
-
-# IFS
-# We need space, tab and new line, in precisely that order.  Quoting is
-# there to prevent editors from complaining about space-tab.
-# (If _AS_PATH_WALK were called with IFS unset, it would disable word
-# splitting by setting IFS to empty value.)
-IFS=" ""	$as_nl"
-
-# Find who we are.  Look in the path if we contain no directory separator.
-as_myself=
-case $0 in #((
-  *[\\/]* ) as_myself=$0 ;;
-  *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-    test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break
-  done
-IFS=$as_save_IFS
-
-     ;;
-esac
-# We did not find ourselves, most probably we were run as `sh COMMAND'
-# in which case we are not to be found in the path.
-if test "x$as_myself" = x; then
-  as_myself=$0
-fi
-if test ! -f "$as_myself"; then
-  $as_echo "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2
-  exit 1
-fi
-
-# Unset variables that we do not need and which cause bugs (e.g. in
-# pre-3.0 UWIN ksh).  But do not cause bugs in bash 2.01; the "|| exit 1"
-# suppresses any "Segmentation fault" message there.  '((' could
-# trigger a bug in pdksh 5.2.14.
-for as_var in BASH_ENV ENV MAIL MAILPATH
-do eval test x\${$as_var+set} = xset \
-  && ( (unset $as_var) || exit 1) >/dev/null 2>&1 && unset $as_var || :
-done
-PS1='$ '
-PS2='> '
-PS4='+ '
-
-# NLS nuisances.
-LC_ALL=C
-export LC_ALL
-LANGUAGE=C
-export LANGUAGE
-
-# CDPATH.
-(unset CDPATH) >/dev/null 2>&1 && unset CDPATH
-
-
-# as_fn_error STATUS ERROR [LINENO LOG_FD]
-# ----------------------------------------
-# Output "`basename $0`: error: ERROR" to stderr. If LINENO and LOG_FD are
-# provided, also output the error to LOG_FD, referencing LINENO. Then exit the
-# script with STATUS, using 1 if that was 0.
-as_fn_error ()
-{
-  as_status=$1; test $as_status -eq 0 && as_status=1
-  if test "$4"; then
-    as_lineno=${as_lineno-"$3"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
-    $as_echo "$as_me:${as_lineno-$LINENO}: error: $2" >&$4
-  fi
-  $as_echo "$as_me: error: $2" >&2
-  as_fn_exit $as_status
-} # as_fn_error
-
-
-# as_fn_set_status STATUS
-# -----------------------
-# Set $? to STATUS, without forking.
-as_fn_set_status ()
-{
-  return $1
-} # as_fn_set_status
-
-# as_fn_exit STATUS
-# -----------------
-# Exit the shell with STATUS, even in a "trap 0" or "set -e" context.
-as_fn_exit ()
-{
-  set +e
-  as_fn_set_status $1
-  exit $1
-} # as_fn_exit
-
-# as_fn_unset VAR
-# ---------------
-# Portably unset VAR.
-as_fn_unset ()
-{
-  { eval $1=; unset $1;}
-}
-as_unset=as_fn_unset
-# as_fn_append VAR VALUE
-# ----------------------
-# Append the text in VALUE to the end of the definition contained in VAR. Take
-# advantage of any shell optimizations that allow amortized linear growth over
-# repeated appends, instead of the typical quadratic growth present in naive
-# implementations.
-if (eval "as_var=1; as_var+=2; test x\$as_var = x12") 2>/dev/null; then :
-  eval 'as_fn_append ()
-  {
-    eval $1+=\$2
-  }'
-else
-  as_fn_append ()
-  {
-    eval $1=\$$1\$2
-  }
-fi # as_fn_append
-
-# as_fn_arith ARG...
-# ------------------
-# Perform arithmetic evaluation on the ARGs, and store the result in the
-# global $as_val. Take advantage of shells that can avoid forks. The arguments
-# must be portable across $(()) and expr.
-if (eval "test \$(( 1 + 1 )) = 2") 2>/dev/null; then :
-  eval 'as_fn_arith ()
-  {
-    as_val=$(( $* ))
-  }'
-else
-  as_fn_arith ()
-  {
-    as_val=`expr "$@" || test $? -eq 1`
-  }
-fi # as_fn_arith
-
-
-if expr a : '\(a\)' >/dev/null 2>&1 &&
-   test "X`expr 00001 : '.*\(...\)'`" = X001; then
-  as_expr=expr
-else
-  as_expr=false
-fi
-
-if (basename -- /) >/dev/null 2>&1 && test "X`basename -- / 2>&1`" = "X/"; then
-  as_basename=basename
-else
-  as_basename=false
-fi
-
-if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then
-  as_dirname=dirname
-else
-  as_dirname=false
-fi
-
-as_me=`$as_basename -- "$0" ||
-$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \
-	 X"$0" : 'X\(//\)$' \| \
-	 X"$0" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X/"$0" |
-    sed '/^.*\/\([^/][^/]*\)\/*$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\/\(\/\/\)$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\/\(\/\).*/{
-	    s//\1/
-	    q
-	  }
-	  s/.*/./; q'`
-
-# Avoid depending upon Character Ranges.
-as_cr_letters='abcdefghijklmnopqrstuvwxyz'
-as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
-as_cr_Letters=$as_cr_letters$as_cr_LETTERS
-as_cr_digits='0123456789'
-as_cr_alnum=$as_cr_Letters$as_cr_digits
-
-ECHO_C= ECHO_N= ECHO_T=
-case `echo -n x` in #(((((
--n*)
-  case `echo 'xy\c'` in
-  *c*) ECHO_T='	';;	# ECHO_T is single tab character.
-  xy)  ECHO_C='\c';;
-  *)   echo `echo ksh88 bug on AIX 6.1` > /dev/null
-       ECHO_T='	';;
-  esac;;
-*)
-  ECHO_N='-n';;
-esac
-
-rm -f conf$$ conf$$.exe conf$$.file
-if test -d conf$$.dir; then
-  rm -f conf$$.dir/conf$$.file
-else
-  rm -f conf$$.dir
-  mkdir conf$$.dir 2>/dev/null
-fi
-if (echo >conf$$.file) 2>/dev/null; then
-  if ln -s conf$$.file conf$$ 2>/dev/null; then
-    as_ln_s='ln -s'
-    # ... but there are two gotchas:
-    # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail.
-    # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable.
-    # In both cases, we have to default to `cp -pR'.
-    ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe ||
-      as_ln_s='cp -pR'
-  elif ln conf$$.file conf$$ 2>/dev/null; then
-    as_ln_s=ln
-  else
-    as_ln_s='cp -pR'
-  fi
-else
-  as_ln_s='cp -pR'
-fi
-rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file
-rmdir conf$$.dir 2>/dev/null
-
-
-# as_fn_mkdir_p
-# -------------
-# Create "$as_dir" as a directory, including parents if necessary.
-as_fn_mkdir_p ()
-{
-
-  case $as_dir in #(
-  -*) as_dir=./$as_dir;;
-  esac
-  test -d "$as_dir" || eval $as_mkdir_p || {
-    as_dirs=
-    while :; do
-      case $as_dir in #(
-      *\'*) as_qdir=`$as_echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'(
-      *) as_qdir=$as_dir;;
-      esac
-      as_dirs="'$as_qdir' $as_dirs"
-      as_dir=`$as_dirname -- "$as_dir" ||
-$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
-	 X"$as_dir" : 'X\(//\)[^/]' \| \
-	 X"$as_dir" : 'X\(//\)$' \| \
-	 X"$as_dir" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$as_dir" |
-    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)[^/].*/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\).*/{
-	    s//\1/
-	    q
-	  }
-	  s/.*/./; q'`
-      test -d "$as_dir" && break
-    done
-    test -z "$as_dirs" || eval "mkdir $as_dirs"
-  } || test -d "$as_dir" || as_fn_error $? "cannot create directory $as_dir"
-
-
-} # as_fn_mkdir_p
-if mkdir -p . 2>/dev/null; then
-  as_mkdir_p='mkdir -p "$as_dir"'
-else
-  test -d ./-p && rmdir ./-p
-  as_mkdir_p=false
-fi
-
-
-# as_fn_executable_p FILE
-# -----------------------
-# Test if FILE is an executable regular file.
-as_fn_executable_p ()
-{
-  test -f "$1" && test -x "$1"
-} # as_fn_executable_p
-as_test_x='test -x'
-as_executable_p=as_fn_executable_p
-
-# Sed expression to map a string onto a valid CPP name.
-as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'"
-
-# Sed expression to map a string onto a valid variable name.
-as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'"
-
-
-exec 6>&1
-## ----------------------------------- ##
-## Main body of $CONFIG_STATUS script. ##
-## ----------------------------------- ##
-_ASEOF
-test $as_write_fail = 0 && chmod +x $CONFIG_STATUS || ac_write_fail=1
-
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-# Save the log message, to keep $0 and so on meaningful, and to
-# report actual input values of CONFIG_FILES etc. instead of their
-# values after options handling.
-ac_log="
-This file was extended by rock $as_me 1.9.5, which was
-generated by GNU Autoconf 2.69.  Invocation command line was
-
-  CONFIG_FILES    = $CONFIG_FILES
-  CONFIG_HEADERS  = $CONFIG_HEADERS
-  CONFIG_LINKS    = $CONFIG_LINKS
-  CONFIG_COMMANDS = $CONFIG_COMMANDS
-  $ $0 $@
-
-on `(hostname || uname -n) 2>/dev/null | sed 1q`
-"
-
-_ACEOF
-
-case $ac_config_files in *"
-"*) set x $ac_config_files; shift; ac_config_files=$*;;
-esac
-
-
-
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-# Files that config.status was made for.
-config_files="$ac_config_files"
-config_commands="$ac_config_commands"
-
-_ACEOF
-
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-ac_cs_usage="\
-\`$as_me' instantiates files and other configuration actions
-from templates according to the current configuration.  Unless the files
-and actions are specified as TAGs, all are instantiated by default.
-
-Usage: $0 [OPTION]... [TAG]...
-
-  -h, --help       print this help, then exit
-  -V, --version    print version number and configuration settings, then exit
-      --config     print configuration, then exit
-  -q, --quiet, --silent
-                   do not print progress messages
-  -d, --debug      don't remove temporary files
-      --recheck    update $as_me by reconfiguring in the same conditions
-      --file=FILE[:TEMPLATE]
-                   instantiate the configuration file FILE
-
-Configuration files:
-$config_files
-
-Configuration commands:
-$config_commands
-
-Report bugs to the package provider."
-
-_ACEOF
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-ac_cs_config="`$as_echo "$ac_configure_args" | sed 's/^ //; s/[\\""\`\$]/\\\\&/g'`"
-ac_cs_version="\\
-rock config.status 1.9.5
-configured by $0, generated by GNU Autoconf 2.69,
-  with options \\"\$ac_cs_config\\"
-
-Copyright (C) 2012 Free Software Foundation, Inc.
-This config.status script is free software; the Free Software Foundation
-gives unlimited permission to copy, distribute and modify it."
-
-ac_pwd='$ac_pwd'
-srcdir='$srcdir'
-INSTALL='$INSTALL'
-MKDIR_P='$MKDIR_P'
-AWK='$AWK'
-test -n "\$AWK" || AWK=awk
-_ACEOF
-
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-# The default lists apply if the user does not specify any file.
-ac_need_defaults=:
-while test $# != 0
-do
-  case $1 in
-  --*=?*)
-    ac_option=`expr "X$1" : 'X\([^=]*\)='`
-    ac_optarg=`expr "X$1" : 'X[^=]*=\(.*\)'`
-    ac_shift=:
-    ;;
-  --*=)
-    ac_option=`expr "X$1" : 'X\([^=]*\)='`
-    ac_optarg=
-    ac_shift=:
-    ;;
-  *)
-    ac_option=$1
-    ac_optarg=$2
-    ac_shift=shift
-    ;;
-  esac
-
-  case $ac_option in
-  # Handling of the options.
-  -recheck | --recheck | --rechec | --reche | --rech | --rec | --re | --r)
-    ac_cs_recheck=: ;;
-  --version | --versio | --versi | --vers | --ver | --ve | --v | -V )
-    $as_echo "$ac_cs_version"; exit ;;
-  --config | --confi | --conf | --con | --co | --c )
-    $as_echo "$ac_cs_config"; exit ;;
-  --debug | --debu | --deb | --de | --d | -d )
-    debug=: ;;
-  --file | --fil | --fi | --f )
-    $ac_shift
-    case $ac_optarg in
-    *\'*) ac_optarg=`$as_echo "$ac_optarg" | sed "s/'/'\\\\\\\\''/g"` ;;
-    '') as_fn_error $? "missing file argument" ;;
-    esac
-    as_fn_append CONFIG_FILES " '$ac_optarg'"
-    ac_need_defaults=false;;
-  --he | --h |  --help | --hel | -h )
-    $as_echo "$ac_cs_usage"; exit ;;
-  -q | -quiet | --quiet | --quie | --qui | --qu | --q \
-  | -silent | --silent | --silen | --sile | --sil | --si | --s)
-    ac_cs_silent=: ;;
-
-  # This is an error.
-  -*) as_fn_error $? "unrecognized option: \`$1'
-Try \`$0 --help' for more information." ;;
-
-  *) as_fn_append ac_config_targets " $1"
-     ac_need_defaults=false ;;
-
-  esac
-  shift
-done
-
-ac_configure_extra_args=
-
-if $ac_cs_silent; then
-  exec 6>/dev/null
-  ac_configure_extra_args="$ac_configure_extra_args --silent"
-fi
-
-_ACEOF
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-if \$ac_cs_recheck; then
-  set X $SHELL '$0' $ac_configure_args \$ac_configure_extra_args --no-create --no-recursion
-  shift
-  \$as_echo "running CONFIG_SHELL=$SHELL \$*" >&6
-  CONFIG_SHELL='$SHELL'
-  export CONFIG_SHELL
-  exec "\$@"
-fi
-
-_ACEOF
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-exec 5>>config.log
-{
-  echo
-  sed 'h;s/./-/g;s/^.../## /;s/...$/ ##/;p;x;p;x' <<_ASBOX
-## Running $as_me. ##
-_ASBOX
-  $as_echo "$ac_log"
-} >&5
-
-_ACEOF
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-#
-# INIT-COMMANDS
-#
-AMDEP_TRUE="$AMDEP_TRUE" ac_aux_dir="$ac_aux_dir"
-
-_ACEOF
-
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-
-# Handling of arguments.
-for ac_config_target in $ac_config_targets
-do
-  case $ac_config_target in
-    "depfiles") CONFIG_COMMANDS="$CONFIG_COMMANDS depfiles" ;;
-    "Makefile") CONFIG_FILES="$CONFIG_FILES Makefile" ;;
-    "src/Makefile") CONFIG_FILES="$CONFIG_FILES src/Makefile" ;;
-    "test/Makefile") CONFIG_FILES="$CONFIG_FILES test/Makefile" ;;
-    "doc/Makefile") CONFIG_FILES="$CONFIG_FILES doc/Makefile" ;;
-
-  *) as_fn_error $? "invalid argument: \`$ac_config_target'" "$LINENO" 5;;
-  esac
-done
-
-
-# If the user did not use the arguments to specify the items to instantiate,
-# then the envvar interface is used.  Set only those that are not.
-# We use the long form for the default assignment because of an extremely
-# bizarre bug on SunOS 4.1.3.
-if $ac_need_defaults; then
-  test "${CONFIG_FILES+set}" = set || CONFIG_FILES=$config_files
-  test "${CONFIG_COMMANDS+set}" = set || CONFIG_COMMANDS=$config_commands
-fi
-
-# Have a temporary directory for convenience.  Make it in the build tree
-# simply because there is no reason against having it here, and in addition,
-# creating and moving files from /tmp can sometimes cause problems.
-# Hook for its removal unless debugging.
-# Note that there is a small window in which the directory will not be cleaned:
-# after its creation but before its name has been assigned to `$tmp'.
-$debug ||
-{
-  tmp= ac_tmp=
-  trap 'exit_status=$?
-  : "${ac_tmp:=$tmp}"
-  { test ! -d "$ac_tmp" || rm -fr "$ac_tmp"; } && exit $exit_status
-' 0
-  trap 'as_fn_exit 1' 1 2 13 15
-}
-# Create a (secure) tmp directory for tmp files.
-
-{
-  tmp=`(umask 077 && mktemp -d "./confXXXXXX") 2>/dev/null` &&
-  test -d "$tmp"
-}  ||
-{
-  tmp=./conf$$-$RANDOM
-  (umask 077 && mkdir "$tmp")
-} || as_fn_error $? "cannot create a temporary directory in ." "$LINENO" 5
-ac_tmp=$tmp
-
-# Set up the scripts for CONFIG_FILES section.
-# No need to generate them if there are no CONFIG_FILES.
-# This happens for instance with `./config.status config.h'.
-if test -n "$CONFIG_FILES"; then
-
-
-ac_cr=`echo X | tr X '\015'`
-# On cygwin, bash can eat \r inside `` if the user requested igncr.
-# But we know of no other shell where ac_cr would be empty at this
-# point, so we can use a bashism as a fallback.
-if test "x$ac_cr" = x; then
-  eval ac_cr=\$\'\\r\'
-fi
-ac_cs_awk_cr=`$AWK 'BEGIN { print "a\rb" }' </dev/null 2>/dev/null`
-if test "$ac_cs_awk_cr" = "a${ac_cr}b"; then
-  ac_cs_awk_cr='\\r'
-else
-  ac_cs_awk_cr=$ac_cr
-fi
-
-echo 'BEGIN {' >"$ac_tmp/subs1.awk" &&
-_ACEOF
-
-
-{
-  echo "cat >conf$$subs.awk <<_ACEOF" &&
-  echo "$ac_subst_vars" | sed 's/.*/&!$&$ac_delim/' &&
-  echo "_ACEOF"
-} >conf$$subs.sh ||
-  as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
-ac_delim_num=`echo "$ac_subst_vars" | grep -c '^'`
-ac_delim='%!_!# '
-for ac_last_try in false false false false false :; do
-  . ./conf$$subs.sh ||
-    as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
-
-  ac_delim_n=`sed -n "s/.*$ac_delim\$/X/p" conf$$subs.awk | grep -c X`
-  if test $ac_delim_n = $ac_delim_num; then
-    break
-  elif $ac_last_try; then
-    as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
-  else
-    ac_delim="$ac_delim!$ac_delim _$ac_delim!! "
-  fi
-done
-rm -f conf$$subs.sh
-
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-cat >>"\$ac_tmp/subs1.awk" <<\\_ACAWK &&
-_ACEOF
-sed -n '
-h
-s/^/S["/; s/!.*/"]=/
-p
-g
-s/^[^!]*!//
-:repl
-t repl
-s/'"$ac_delim"'$//
-t delim
-:nl
-h
-s/\(.\{148\}\)..*/\1/
-t more1
-s/["\\]/\\&/g; s/^/"/; s/$/\\n"\\/
-p
-n
-b repl
-:more1
-s/["\\]/\\&/g; s/^/"/; s/$/"\\/
-p
-g
-s/.\{148\}//
-t nl
-:delim
-h
-s/\(.\{148\}\)..*/\1/
-t more2
-s/["\\]/\\&/g; s/^/"/; s/$/"/
-p
-b
-:more2
-s/["\\]/\\&/g; s/^/"/; s/$/"\\/
-p
-g
-s/.\{148\}//
-t delim
-' <conf$$subs.awk | sed '
-/^[^""]/{
-  N
-  s/\n//
-}
-' >>$CONFIG_STATUS || ac_write_fail=1
-rm -f conf$$subs.awk
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-_ACAWK
-cat >>"\$ac_tmp/subs1.awk" <<_ACAWK &&
-  for (key in S) S_is_set[key] = 1
-  FS = ""
-
-}
-{
-  line = $ 0
-  nfields = split(line, field, "@")
-  substed = 0
-  len = length(field[1])
-  for (i = 2; i < nfields; i++) {
-    key = field[i]
-    keylen = length(key)
-    if (S_is_set[key]) {
-      value = S[key]
-      line = substr(line, 1, len) "" value "" substr(line, len + keylen + 3)
-      len += length(value) + length(field[++i])
-      substed = 1
-    } else
-      len += 1 + keylen
-  }
-
-  print line
-}
-
-_ACAWK
-_ACEOF
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-if sed "s/$ac_cr//" < /dev/null > /dev/null 2>&1; then
-  sed "s/$ac_cr\$//; s/$ac_cr/$ac_cs_awk_cr/g"
-else
-  cat
-fi < "$ac_tmp/subs1.awk" > "$ac_tmp/subs.awk" \
-  || as_fn_error $? "could not setup config files machinery" "$LINENO" 5
-_ACEOF
-
-# VPATH may cause trouble with some makes, so we remove sole $(srcdir),
-# ${srcdir} and @srcdir@ entries from VPATH if srcdir is ".", strip leading and
-# trailing colons and then remove the whole line if VPATH becomes empty
-# (actually we leave an empty line to preserve line numbers).
-if test "x$srcdir" = x.; then
-  ac_vpsub='/^[	 ]*VPATH[	 ]*=[	 ]*/{
-h
-s///
-s/^/:/
-s/[	 ]*$/:/
-s/:\$(srcdir):/:/g
-s/:\${srcdir}:/:/g
-s/:@srcdir@:/:/g
-s/^:*//
-s/:*$//
-x
-s/\(=[	 ]*\).*/\1/
-G
-s/\n//
-s/^[^=]*=[	 ]*$//
-}'
-fi
-
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-fi # test -n "$CONFIG_FILES"
-
-
-eval set X "  :F $CONFIG_FILES      :C $CONFIG_COMMANDS"
-shift
-for ac_tag
-do
-  case $ac_tag in
-  :[FHLC]) ac_mode=$ac_tag; continue;;
-  esac
-  case $ac_mode$ac_tag in
-  :[FHL]*:*);;
-  :L* | :C*:*) as_fn_error $? "invalid tag \`$ac_tag'" "$LINENO" 5;;
-  :[FH]-) ac_tag=-:-;;
-  :[FH]*) ac_tag=$ac_tag:$ac_tag.in;;
-  esac
-  ac_save_IFS=$IFS
-  IFS=:
-  set x $ac_tag
-  IFS=$ac_save_IFS
-  shift
-  ac_file=$1
-  shift
-
-  case $ac_mode in
-  :L) ac_source=$1;;
-  :[FH])
-    ac_file_inputs=
-    for ac_f
-    do
-      case $ac_f in
-      -) ac_f="$ac_tmp/stdin";;
-      *) # Look for the file first in the build tree, then in the source tree
-	 # (if the path is not absolute).  The absolute path cannot be DOS-style,
-	 # because $ac_f cannot contain `:'.
-	 test -f "$ac_f" ||
-	   case $ac_f in
-	   [\\/$]*) false;;
-	   *) test -f "$srcdir/$ac_f" && ac_f="$srcdir/$ac_f";;
-	   esac ||
-	   as_fn_error 1 "cannot find input file: \`$ac_f'" "$LINENO" 5;;
-      esac
-      case $ac_f in *\'*) ac_f=`$as_echo "$ac_f" | sed "s/'/'\\\\\\\\''/g"`;; esac
-      as_fn_append ac_file_inputs " '$ac_f'"
-    done
-
-    # Let's still pretend it is `configure' which instantiates (i.e., don't
-    # use $as_me), people would be surprised to read:
-    #    /* config.h.  Generated by config.status.  */
-    configure_input='Generated from '`
-	  $as_echo "$*" | sed 's|^[^:]*/||;s|:[^:]*/|, |g'
-	`' by configure.'
-    if test x"$ac_file" != x-; then
-      configure_input="$ac_file.  $configure_input"
-      { $as_echo "$as_me:${as_lineno-$LINENO}: creating $ac_file" >&5
-$as_echo "$as_me: creating $ac_file" >&6;}
-    fi
-    # Neutralize special characters interpreted by sed in replacement strings.
-    case $configure_input in #(
-    *\&* | *\|* | *\\* )
-       ac_sed_conf_input=`$as_echo "$configure_input" |
-       sed 's/[\\\\&|]/\\\\&/g'`;; #(
-    *) ac_sed_conf_input=$configure_input;;
-    esac
-
-    case $ac_tag in
-    *:-:* | *:-) cat >"$ac_tmp/stdin" \
-      || as_fn_error $? "could not create $ac_file" "$LINENO" 5 ;;
-    esac
-    ;;
-  esac
-
-  ac_dir=`$as_dirname -- "$ac_file" ||
-$as_expr X"$ac_file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
-	 X"$ac_file" : 'X\(//\)[^/]' \| \
-	 X"$ac_file" : 'X\(//\)$' \| \
-	 X"$ac_file" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$ac_file" |
-    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)[^/].*/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\).*/{
-	    s//\1/
-	    q
-	  }
-	  s/.*/./; q'`
-  as_dir="$ac_dir"; as_fn_mkdir_p
-  ac_builddir=.
-
-case "$ac_dir" in
-.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;;
-*)
-  ac_dir_suffix=/`$as_echo "$ac_dir" | sed 's|^\.[\\/]||'`
-  # A ".." for each directory in $ac_dir_suffix.
-  ac_top_builddir_sub=`$as_echo "$ac_dir_suffix" | sed 's|/[^\\/]*|/..|g;s|/||'`
-  case $ac_top_builddir_sub in
-  "") ac_top_builddir_sub=. ac_top_build_prefix= ;;
-  *)  ac_top_build_prefix=$ac_top_builddir_sub/ ;;
-  esac ;;
-esac
-ac_abs_top_builddir=$ac_pwd
-ac_abs_builddir=$ac_pwd$ac_dir_suffix
-# for backward compatibility:
-ac_top_builddir=$ac_top_build_prefix
-
-case $srcdir in
-  .)  # We are building in place.
-    ac_srcdir=.
-    ac_top_srcdir=$ac_top_builddir_sub
-    ac_abs_top_srcdir=$ac_pwd ;;
-  [\\/]* | ?:[\\/]* )  # Absolute name.
-    ac_srcdir=$srcdir$ac_dir_suffix;
-    ac_top_srcdir=$srcdir
-    ac_abs_top_srcdir=$srcdir ;;
-  *) # Relative name.
-    ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix
-    ac_top_srcdir=$ac_top_build_prefix$srcdir
-    ac_abs_top_srcdir=$ac_pwd/$srcdir ;;
-esac
-ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix
-
-
-  case $ac_mode in
-  :F)
-  #
-  # CONFIG_FILE
-  #
-
-  case $INSTALL in
-  [\\/$]* | ?:[\\/]* ) ac_INSTALL=$INSTALL ;;
-  *) ac_INSTALL=$ac_top_build_prefix$INSTALL ;;
-  esac
-  ac_MKDIR_P=$MKDIR_P
-  case $MKDIR_P in
-  [\\/$]* | ?:[\\/]* ) ;;
-  */*) ac_MKDIR_P=$ac_top_build_prefix$MKDIR_P ;;
-  esac
-_ACEOF
-
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-# If the template does not know about datarootdir, expand it.
-# FIXME: This hack should be removed a few years after 2.60.
-ac_datarootdir_hack=; ac_datarootdir_seen=
-ac_sed_dataroot='
-/datarootdir/ {
-  p
-  q
-}
-/@datadir@/p
-/@docdir@/p
-/@infodir@/p
-/@localedir@/p
-/@mandir@/p'
-case `eval "sed -n \"\$ac_sed_dataroot\" $ac_file_inputs"` in
-*datarootdir*) ac_datarootdir_seen=yes;;
-*@datadir@*|*@docdir@*|*@infodir@*|*@localedir@*|*@mandir@*)
-  { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&5
-$as_echo "$as_me: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&2;}
-_ACEOF
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-  ac_datarootdir_hack='
-  s&@datadir@&$datadir&g
-  s&@docdir@&$docdir&g
-  s&@infodir@&$infodir&g
-  s&@localedir@&$localedir&g
-  s&@mandir@&$mandir&g
-  s&\\\${datarootdir}&$datarootdir&g' ;;
-esac
-_ACEOF
-
-# Neutralize VPATH when `$srcdir' = `.'.
-# Shell code in configure.ac might set extrasub.
-# FIXME: do we really want to maintain this feature?
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-ac_sed_extra="$ac_vpsub
-$extrasub
-_ACEOF
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-:t
-/@[a-zA-Z_][a-zA-Z_0-9]*@/!b
-s|@configure_input@|$ac_sed_conf_input|;t t
-s&@top_builddir@&$ac_top_builddir_sub&;t t
-s&@top_build_prefix@&$ac_top_build_prefix&;t t
-s&@srcdir@&$ac_srcdir&;t t
-s&@abs_srcdir@&$ac_abs_srcdir&;t t
-s&@top_srcdir@&$ac_top_srcdir&;t t
-s&@abs_top_srcdir@&$ac_abs_top_srcdir&;t t
-s&@builddir@&$ac_builddir&;t t
-s&@abs_builddir@&$ac_abs_builddir&;t t
-s&@abs_top_builddir@&$ac_abs_top_builddir&;t t
-s&@INSTALL@&$ac_INSTALL&;t t
-s&@MKDIR_P@&$ac_MKDIR_P&;t t
-$ac_datarootdir_hack
-"
-eval sed \"\$ac_sed_extra\" "$ac_file_inputs" | $AWK -f "$ac_tmp/subs.awk" \
-  >$ac_tmp/out || as_fn_error $? "could not create $ac_file" "$LINENO" 5
-
-test -z "$ac_datarootdir_hack$ac_datarootdir_seen" &&
-  { ac_out=`sed -n '/\${datarootdir}/p' "$ac_tmp/out"`; test -n "$ac_out"; } &&
-  { ac_out=`sed -n '/^[	 ]*datarootdir[	 ]*:*=/p' \
-      "$ac_tmp/out"`; test -z "$ac_out"; } &&
-  { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $ac_file contains a reference to the variable \`datarootdir'
-which seems to be undefined.  Please make sure it is defined" >&5
-$as_echo "$as_me: WARNING: $ac_file contains a reference to the variable \`datarootdir'
-which seems to be undefined.  Please make sure it is defined" >&2;}
-
-  rm -f "$ac_tmp/stdin"
-  case $ac_file in
-  -) cat "$ac_tmp/out" && rm -f "$ac_tmp/out";;
-  *) rm -f "$ac_file" && mv "$ac_tmp/out" "$ac_file";;
-  esac \
-  || as_fn_error $? "could not create $ac_file" "$LINENO" 5
- ;;
-
-
-  :C)  { $as_echo "$as_me:${as_lineno-$LINENO}: executing $ac_file commands" >&5
-$as_echo "$as_me: executing $ac_file commands" >&6;}
- ;;
-  esac
-
-
-  case $ac_file$ac_mode in
-    "depfiles":C) test x"$AMDEP_TRUE" != x"" || {
-  # Older Autoconf quotes --file arguments for eval, but not when files
-  # are listed without --file.  Let's play safe and only enable the eval
-  # if we detect the quoting.
-  case $CONFIG_FILES in
-  *\'*) eval set x "$CONFIG_FILES" ;;
-  *)   set x $CONFIG_FILES ;;
-  esac
-  shift
-  for mf
-  do
-    # Strip MF so we end up with the name of the file.
-    mf=`echo "$mf" | sed -e 's/:.*$//'`
-    # Check whether this is an Automake generated Makefile or not.
-    # We used to match only the files named 'Makefile.in', but
-    # some people rename them; so instead we look at the file content.
-    # Grep'ing the first line is not enough: some people post-process
-    # each Makefile.in and add a new line on top of each file to say so.
-    # Grep'ing the whole file is not good either: AIX grep has a line
-    # limit of 2048, but all sed's we know have understand at least 4000.
-    if sed -n 's,^#.*generated by automake.*,X,p' "$mf" | grep X >/dev/null 2>&1; then
-      dirpart=`$as_dirname -- "$mf" ||
-$as_expr X"$mf" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
-	 X"$mf" : 'X\(//\)[^/]' \| \
-	 X"$mf" : 'X\(//\)$' \| \
-	 X"$mf" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$mf" |
-    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)[^/].*/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\).*/{
-	    s//\1/
-	    q
-	  }
-	  s/.*/./; q'`
-    else
-      continue
-    fi
-    # Extract the definition of DEPDIR, am__include, and am__quote
-    # from the Makefile without running 'make'.
-    DEPDIR=`sed -n 's/^DEPDIR = //p' < "$mf"`
-    test -z "$DEPDIR" && continue
-    am__include=`sed -n 's/^am__include = //p' < "$mf"`
-    test -z "$am__include" && continue
-    am__quote=`sed -n 's/^am__quote = //p' < "$mf"`
-    # Find all dependency output files, they are included files with
-    # $(DEPDIR) in their names.  We invoke sed twice because it is the
-    # simplest approach to changing $(DEPDIR) to its actual value in the
-    # expansion.
-    for file in `sed -n "
-      s/^$am__include $am__quote\(.*(DEPDIR).*\)$am__quote"'$/\1/p' <"$mf" | \
-	 sed -e 's/\$(DEPDIR)/'"$DEPDIR"'/g'`; do
-      # Make sure the directory exists.
-      test -f "$dirpart/$file" && continue
-      fdir=`$as_dirname -- "$file" ||
-$as_expr X"$file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
-	 X"$file" : 'X\(//\)[^/]' \| \
-	 X"$file" : 'X\(//\)$' \| \
-	 X"$file" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$file" |
-    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)[^/].*/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\).*/{
-	    s//\1/
-	    q
-	  }
-	  s/.*/./; q'`
-      as_dir=$dirpart/$fdir; as_fn_mkdir_p
-      # echo "creating $dirpart/$file"
-      echo '# dummy' > "$dirpart/$file"
-    done
-  done
-}
- ;;
-
-  esac
-done # for ac_tag
-
-
-as_fn_exit 0
-_ACEOF
-ac_clean_files=$ac_clean_files_save
-
-test $ac_write_fail = 0 ||
-  as_fn_error $? "write failure creating $CONFIG_STATUS" "$LINENO" 5
-
-
-# configure is writing to config.log, and then calls config.status.
-# config.status does its own redirection, appending to config.log.
-# Unfortunately, on DOS this fails, as config.log is still kept open
-# by configure, so config.status won't be able to write to it; its
-# output is simply discarded.  So we exec the FD to /dev/null,
-# effectively closing config.log, so it can be properly (re)opened and
-# appended to by config.status.  When coming back to configure, we
-# need to make the FD available again.
-if test "$no_create" != yes; then
-  ac_cs_success=:
-  ac_config_status_args=
-  test "$silent" = yes &&
-    ac_config_status_args="$ac_config_status_args --quiet"
-  exec 5>/dev/null
-  $SHELL $CONFIG_STATUS $ac_config_status_args || ac_cs_success=false
-  exec 5>>config.log
-  # Use ||, not &&, to avoid exiting from the if with $? = 1, which
-  # would make configure fail if this is the last instruction.
-  $ac_cs_success || as_fn_exit 1
-fi
-if test -n "$ac_unrecognized_opts" && test "$enable_option_checking" != no; then
-  { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: unrecognized options: $ac_unrecognized_opts" >&5
-$as_echo "$as_me: WARNING: unrecognized options: $ac_unrecognized_opts" >&2;}
-fi
-
-
diff --git a/src/FqAuxBackend.cpp b/src/FqAuxBackend.cpp
index a61b2f80aff1da0ee716b9ed867ff7fcf4375a8d..d872c1985dd68b819d8f4dac9aca5b959d7a2e14 100644
--- a/src/FqAuxBackend.cpp
+++ b/src/FqAuxBackend.cpp
@@ -53,8 +53,8 @@ int FqAuxBackend::getNextRead(rinfo * p_nr) {
 
 int FqAuxBackend::processBuffer(rinfo * p_nr) {
     static T_fq_rec_info fq_rec_info;
-    static int num_l_in_rec; /* counter to know on which line inside the fastq record we are */
-    static int qual_score=0;
+    static int num_l_in_rec=5; /* counter to know on which line inside the fastq record we are */
+    //static int qual_score=0;
     static int n;
     static int start_rec_in_buf;
 
@@ -65,27 +65,24 @@ int FqAuxBackend::processBuffer(rinfo * p_nr) {
     while (buf_info.cnt<=buf_info.real_bufsize-1 && !rfound) {
         switch (*buf_info.pchar){
             case k_read_id_start:
-                if (qual_score) goto inc_score;
+                if (num_l_in_rec==4) goto inc_score;
                 else {
                     //debug_processBuf(on_record_new,buf_info,fq_rec_info.rstart_offset);
                     rstart_offset=cur_offset-buf_info.real_bufsize+buf_info.cnt;
                     start_rec_in_buf=buf_info.cnt;
                     buf_info.p_start_cur_rec=buf_info.pchar;
                     num_l_in_rec=1;
-                    fq_rec_info.nb_nucleotides_in_read=0;}
-                break;
-            case k_read_qual_start:
-                qual_score=1;
-                fq_rec_info.nb_k_mers_in_error=0;
-                fq_rec_info.st=0;
-                fq_rec_info.idx_nucl_in_read=0;
-                n=0;
+                    fq_rec_info.nb_nucleotides_in_read=0;
+                    fq_rec_info.nb_k_mers_in_error=0;
+					fq_rec_info.st=0;
+					fq_rec_info.idx_nucl_in_read=0;
+					n=0;
+                }
                 break;
             case '\n':
                 // debug_processBuf(on_line_end,buf_info,fq_rec_info.rstart_offset);
-                (qual_score==1)?qual_score++:qual_score;
                 num_l_in_rec+=1;
-                if (num_l_in_rec==5) { qual_score=0;/* end of fastq record */
+                if (num_l_in_rec==5) { /* end of fastq record */
                     p_nr->f_id=f_id;
                     p_nr->score=fq_rec_info.st;
                     p_nr->rstart_offset=rstart_offset;
@@ -98,7 +95,7 @@ int FqAuxBackend::processBuffer(rinfo * p_nr) {
             //debug_processBuf(on_store_read_id,buf_info,fq_rec_info.rstart_offset);
             (num_l_in_rec==2)?fq_rec_info.nb_nucleotides_in_read++:fq_rec_info.nb_nucleotides_in_read;
             inc_score:
-                { if (qual_score==2) onIncScore(fq_rec_info,buf_info,n);
+                { if (num_l_in_rec==4) onIncScore(fq_rec_info,buf_info,n);
                 }
         }
         buf_info.pchar++;
diff --git a/src/FqAuxBackend.h b/src/FqAuxBackend.h
index 392d50322a85e522ede2d4917fbb4c7139bed4b0..a09a372848c4217f9629916111e7b36cfab5d9b2 100644
--- a/src/FqAuxBackend.h
+++ b/src/FqAuxBackend.h
@@ -21,6 +21,7 @@ class FqAuxBackend:public FqBaseBackend {
     int processBuffer(rinfo * p_nr);
 
     friend void test_processBufPE();
+    friend void test_processBufPEWithPlusChar();
 
 public:
     
diff --git a/src/unit_test_fqreader.cpp b/src/unit_test_fqreader.cpp
index b5eb927d67da46feb759cbb4858d09f2c69c14bc..9379cdb8dab15b7c5aa053a6bd30d6a7a97cee54 100644
--- a/src/unit_test_fqreader.cpp
+++ b/src/unit_test_fqreader.cpp
@@ -42,7 +42,7 @@
 
 using namespace std;
 
-
+const int treat_PE_as_single=0;
 
 void test_processSingleFile() {
     srp sr;
@@ -54,13 +54,6 @@ void test_processSingleFile() {
     k_dim::iterator it_struct;
 
     int cnt_read=0;
-    /*cout<<"sizeof 1rst map when empty:"<<sizeof(srp)<<" "<<sizeof(sr)<<endl;
-    i_dim stuff1;
-    cout<<"sizeof 2np map when empty:"<<sizeof(stuff1)<<endl;
-    k_dim stuff2;
-    cout<<"sizeof vector when empty:"<<sizeof(stuff2)<<endl;
-    cout<<"sizeof(long)"<<sizeof(long)<<endl;
-    cout<<"sizeof(int)"<<sizeof(int)<<endl;*/
 
     for (rit=sr.rbegin(); rit!=sr.rend(); ++rit) { //process map in reverse order (by decreasing scores).
         //cout << "score="<<rit->first<<endl;
@@ -598,7 +591,7 @@ void test_processInputFiles() {
     default_qual_thres.min_correct_k_mers_in_read=0; // aim of that test is not to check undef file creation. Disable it by putting 0 here
     default_qual_thres.nucl_score_threshold=0; // leave default values for that test
     
-    FqMainBackend::setTreatPEMode(0);
+    FqMainBackend::setTreatPEMode(treat_PE_as_single);
 
     FqBaseBackend * array_be[k_max_input_files];
     processInputFiles(v_single,v_pe,array_be,default_qual_thres,&sr,1);
@@ -645,7 +638,7 @@ AAAAAEEAEEEEEEEEE6EE/EEEEEEEEAEEAEEEEEEEEEEEEEEAEEEA/A/EEEAEEEEEE/EE</EAEEEEEE/E
     qual_thres.min_correct_k_mers_in_read=78;
     T_buf_info buf_info;
     FqBaseBackend::setQualThreshold(qual_thres);
-    FqMainBackend::setTreatPEMode(0);
+    FqMainBackend::setTreatPEMode(treat_PE_as_single);
     FqMainBackend be(&sr);
     buf_info.buf=buf;
     buf_info.pchar=buf;
@@ -687,7 +680,7 @@ AAAAAEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEE<EEEAEEEEA<EAEEEEEEEAAAAE<EEEE/EEEEAAEEE
 	qual_thres.nucl_score_threshold=k_phred_32;
 	qual_thres.k=25;
 	FqBaseBackend::setQualThreshold(qual_thres);
-	FqMainBackend::setTreatPEMode(0);
+	FqMainBackend::setTreatPEMode(treat_PE_as_single);
 	FqMainBackend be(&sr);
 	buf_info.buf=buf;
 	buf_info.pchar=buf;
@@ -705,15 +698,94 @@ AAAAAEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEE<EEEAEEEEA<EAEEEEEEEAAAAE<EEEE/EEEEAAEEE
 	            cnt_read++;
 	            if (cnt_read==1) {
 	            	assert(score==9); // real score is 5016+151*k_phred_32 but it is normalized by taking the quotient of a division by 1000.
-	            	//assert(it_struct->read_a1==429);
 	            }
 	            else if (cnt_read==2) {
 	            	assert(score==8); // real score is 3076 + 151*k_phred_32
-	            	//assert(it_struct->read_a1==120);
 	            }
 	            else if (cnt_read==3) {
 	            	assert(score==2); // real score is 1256 + 36*k_phred_32 (we don't do the substraction to gain calculation time).
-	            	//assert(it_struct->read_a1==0);
+	            }
+	        }
+	    }
+	}
+	assert(cnt_read==3);
+
+}
+
+void test_processBufPEWithPlusChar() {
+    srp::reverse_iterator rit;
+    i_dim::iterator it_offs;
+    k_dim::iterator it_struct;
+    unsigned char f_id1=1;
+    std::string bufstr_PE1="@SRR001666.4 071112_SLXA-EAS1_s_7:5:1:792:346/2\n\
+AAAGTTAACGAACGCGCGAAAGGTCTGGAAGGTATC\n\
++\n\
+IIIIIIII@+IIIIIIIIB@7IIF=III+CIID0I+\n\
+@NB501291:419:HWLVNBGXK:1:11101:20148:1052 2:N:0:ATCTCAGG+NGGAGAGA\n\
+GATTTTAAANNNNNNNNNAAATNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNAANTTAANGNAANCTGATTACCATGNTAGNNCATATTAGTTNGANCGCCGCGTTNTTCNANACATANNGTAATCNNANTNACTAAGTATTCNTNCGGTA\n\
++\n\
+AAAA/EEEE#########EEEE###############E##############EE#EEEE#E#EE#/EEEEEEEAEEE#EEE##<AAEEEEEEE#AE#6EE/EEE<E#EEE#E#EEEA/##/EEEE<##<#/#/<AE/AA/EE/#A#/AAA/\n\
+@NB501291:419:HWLVNBGXK:1:11101:11957:1078 2:N:0:ATCTCAGG+CGGAGAGA\n\
+ATTATATGATGCAGTAAAAGCCATTGGTGAAGAGCTATGCCCACAATTAGGTATTACTATTCCGGTGGGTAAGGACTCAATGTCCATGAAAACGCGTTGGCAAGATGATCAAGGGAAAACGAAAGAAGTTATTTCACCGCTCTCTTTAGTT\n\
++\n\
+AAAAAEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEE<EEEAEEEEA<EAEEEEEEEAAAAE<EEEE/EEEEAAEEEEEEE<EEEEAAEEE<AE<EE<EEEEAEE/EE/EEEE<EE/EE/E/EEEEEAE<E</<<<AE<AAAEEE/AE\n";
+    std::string bufstr_PE2="@SRR001666.4 071112_SLXA-EAS1_s_7:5:1:792:346/2\n\
+AAAGTTAACGAACGCGCGAAAGGTCTGGAAGGTATC\n\
++\n\
+IIIIIIII@+IIIIIIIIB@7IIF=III+CIID0I+\n\
+@NB501291:419:HWLVNBGXK:1:11101:20148:1052 2:N:0:ATCTCAGG+NGGAGAGA\n\
+GATTTTAAANNNNNNNNNAAATNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNAANTTAANGNAANCTGATTACCATGNTAGNNCATATTAGTTNGANCGCCGCGTTNTTCNANACATANNGTAATCNNANTNACTAAGTATTCNTNCGGTA\n\
++\n\
+AAAA/EEEE#########EEEE###############E##############EE#EEEE#E#EE#/EEEEEEEAEEE#EEE##<AAEEEEEEE#AE#6EE/EEE<E#EEE#E#EEEA/##/EEEE<##<#/#/<AE/AA/EE/#A#/AAA/\n\
+@NB501291:419:HWLVNBGXK:1:11101:11957:1078 2:N:0:ATCTCAGG+CGGAGAGA\n\
+ATTATATGATGCAGTAAAAGCCATTGGTGAAGAGCTATGCCCACAATTAGGTATTACTATTCCGGTGGGTAAGGACTCAATGTCCATGAAAACGCGTTGGCAAGATGATCAAGGGAAAACGAAAGAAGTTATTTCACCGCTCTCTTTAGTT\n\
++\n\
+AAAAAEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEE<EEEAEEEEA<EAEEEEEEEAAAAE<EEEE/EEEEAAEEEEEEE<EEEEAAEEE<AE<EE<EEEEAEE/EE/EEEE<EE/EE/E/EEEEEAE<E</<<<AE<AAAEEE/AE\n";
+    char * buf_PE1=(char *) bufstr_PE1.c_str();
+    char * buf_PE2=(char *) bufstr_PE2.c_str();
+    srp sr;
+    T_buf_info buf_info;
+    T_buf_info PE2_buf_info;
+    FasqQualThreshold qual_thres;
+    qual_thres.min_correct_k_mers_in_read=1;
+    qual_thres.nucl_score_threshold=k_phred_32;
+    qual_thres.k=25;
+    FqBaseBackend::setQualThreshold(qual_thres);
+    FqMainBackend::setTreatPEMode(treat_PE_as_single);
+    FqMainBackend be(&sr);
+    FqAuxBackend be2;
+
+	PE2_buf_info.buf=buf_PE2;
+	PE2_buf_info.pchar=buf_PE2;
+	PE2_buf_info.cnt=0;
+	PE2_buf_info.real_bufsize=strlen(buf_PE2);
+
+	buf_info.buf=buf_PE1;
+	buf_info.pchar=buf_PE1;
+	buf_info.cnt=0;
+	buf_info.real_bufsize=strlen(buf_PE1);
+
+	be2.buf_info=PE2_buf_info;
+
+	be.setAuxProcessor(&be2);
+
+	be.processBuf(buf_info,f_id1,855);
+	int cnt_read=0;
+	for (rit=sr.rbegin(); rit!=sr.rend(); ++rit) { //process map in reverse order (by decreasing scores).
+		int score=rit->first;
+	    for (it_offs=rit->second.begin();it_offs!=rit->second.end();it_offs++) {
+	    	unsigned int q=it_offs->first;
+	    	assert(q==0);
+	        for (it_struct=it_offs->second.begin();it_struct!=it_offs->second.end();it_struct++) {
+	            cnt_read++;
+	            if (cnt_read==1) {
+	            	assert(score==19); // real score is 2*(5016+151*k_phred_32) but it is normalized by taking the quotient of a division by 1000.
+	            }
+	            else if (cnt_read==2) {
+	            	assert(score==16); // real score is 2*(3076 + 151*k_phred_32)
+	            }
+	            else if (cnt_read==3) {
+	            	assert(score==4); // real score is 2*(1256 + 36*k_phred_32) (we don't do the substraction to gain calculation time).
 	            }
 	        }
 	    }
@@ -845,7 +917,8 @@ void test_MimicBigPEFilesWithMQOptions() {
 
 int main(int argc, char **argv) {
 	cout<<"test for the case where there are + characters in read score and or read id"<<endl;
-	test_processBufSinglePlusCharBug();
+	//test_processBufSinglePlusCharBug();
+	test_processBufPEWithPlusChar();
     cout<<"test for single file"<<endl;
     test_processSingleFile();
     cout<<"test for PE files"<<endl;