diff --git a/configure b/configure deleted file mode 100755 index 6eb122b1cafc9d13e738295e60405f1e27c063fb..0000000000000000000000000000000000000000 --- a/configure +++ /dev/null @@ -1,4664 +0,0 @@ -#! /bin/sh -# Guess values for system-dependent variables and create Makefiles. -# Generated by GNU Autoconf 2.69 for rock 1.9.5. -# -# -# Copyright (C) 1992-1996, 1998-2012 Free Software Foundation, Inc. -# -# -# This configure script is free software; the Free Software Foundation -# gives unlimited permission to copy, distribute and modify it. -## -------------------- ## -## M4sh Initialization. ## -## -------------------- ## - -# Be more Bourne compatible -DUALCASE=1; export DUALCASE # for MKS sh -if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then : - emulate sh - NULLCMD=: - # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which - # is contrary to our usage. Disable this feature. - alias -g '${1+"$@"}'='"$@"' - setopt NO_GLOB_SUBST -else - case `(set -o) 2>/dev/null` in #( - *posix*) : - set -o posix ;; #( - *) : - ;; -esac -fi - - -as_nl=' -' -export as_nl -# Printing a long string crashes Solaris 7 /usr/bin/printf. -as_echo='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\' -as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo -as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo$as_echo -# Prefer a ksh shell builtin over an external printf program on Solaris, -# but without wasting forks for bash or zsh. -if test -z "$BASH_VERSION$ZSH_VERSION" \ - && (test "X`print -r -- $as_echo`" = "X$as_echo") 2>/dev/null; then - as_echo='print -r --' - as_echo_n='print -rn --' -elif (test "X`printf %s $as_echo`" = "X$as_echo") 2>/dev/null; then - as_echo='printf %s\n' - as_echo_n='printf %s' -else - if test "X`(/usr/ucb/echo -n -n $as_echo) 2>/dev/null`" = "X-n $as_echo"; then - as_echo_body='eval /usr/ucb/echo -n "$1$as_nl"' - as_echo_n='/usr/ucb/echo -n' - else - as_echo_body='eval expr "X$1" : "X\\(.*\\)"' - as_echo_n_body='eval - arg=$1; - case $arg in #( - *"$as_nl"*) - expr "X$arg" : "X\\(.*\\)$as_nl"; - arg=`expr "X$arg" : ".*$as_nl\\(.*\\)"`;; - esac; - expr "X$arg" : "X\\(.*\\)" | tr -d "$as_nl" - ' - export as_echo_n_body - as_echo_n='sh -c $as_echo_n_body as_echo' - fi - export as_echo_body - as_echo='sh -c $as_echo_body as_echo' -fi - -# The user is always right. -if test "${PATH_SEPARATOR+set}" != set; then - PATH_SEPARATOR=: - (PATH='/bin;/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 && { - (PATH='/bin:/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 || - PATH_SEPARATOR=';' - } -fi - - -# IFS -# We need space, tab and new line, in precisely that order. Quoting is -# there to prevent editors from complaining about space-tab. -# (If _AS_PATH_WALK were called with IFS unset, it would disable word -# splitting by setting IFS to empty value.) -IFS=" "" $as_nl" - -# Find who we are. Look in the path if we contain no directory separator. -as_myself= -case $0 in #(( - *[\\/]* ) as_myself=$0 ;; - *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -for as_dir in $PATH -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break - done -IFS=$as_save_IFS - - ;; -esac -# We did not find ourselves, most probably we were run as `sh COMMAND' -# in which case we are not to be found in the path. -if test "x$as_myself" = x; then - as_myself=$0 -fi -if test ! -f "$as_myself"; then - $as_echo "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2 - exit 1 -fi - -# Unset variables that we do not need and which cause bugs (e.g. in -# pre-3.0 UWIN ksh). But do not cause bugs in bash 2.01; the "|| exit 1" -# suppresses any "Segmentation fault" message there. '((' could -# trigger a bug in pdksh 5.2.14. -for as_var in BASH_ENV ENV MAIL MAILPATH -do eval test x\${$as_var+set} = xset \ - && ( (unset $as_var) || exit 1) >/dev/null 2>&1 && unset $as_var || : -done -PS1='$ ' -PS2='> ' -PS4='+ ' - -# NLS nuisances. -LC_ALL=C -export LC_ALL -LANGUAGE=C -export LANGUAGE - -# CDPATH. -(unset CDPATH) >/dev/null 2>&1 && unset CDPATH - -# Use a proper internal environment variable to ensure we don't fall - # into an infinite loop, continuously re-executing ourselves. - if test x"${_as_can_reexec}" != xno && test "x$CONFIG_SHELL" != x; then - _as_can_reexec=no; export _as_can_reexec; - # We cannot yet assume a decent shell, so we have to provide a -# neutralization value for shells without unset; and this also -# works around shells that cannot unset nonexistent variables. -# Preserve -v and -x to the replacement shell. -BASH_ENV=/dev/null -ENV=/dev/null -(unset BASH_ENV) >/dev/null 2>&1 && unset BASH_ENV ENV -case $- in # (((( - *v*x* | *x*v* ) as_opts=-vx ;; - *v* ) as_opts=-v ;; - *x* ) as_opts=-x ;; - * ) as_opts= ;; -esac -exec $CONFIG_SHELL $as_opts "$as_myself" ${1+"$@"} -# Admittedly, this is quite paranoid, since all the known shells bail -# out after a failed `exec'. -$as_echo "$0: could not re-execute with $CONFIG_SHELL" >&2 -as_fn_exit 255 - fi - # We don't want this to propagate to other subprocesses. - { _as_can_reexec=; unset _as_can_reexec;} -if test "x$CONFIG_SHELL" = x; then - as_bourne_compatible="if test -n \"\${ZSH_VERSION+set}\" && (emulate sh) >/dev/null 2>&1; then : - emulate sh - NULLCMD=: - # Pre-4.2 versions of Zsh do word splitting on \${1+\"\$@\"}, which - # is contrary to our usage. Disable this feature. - alias -g '\${1+\"\$@\"}'='\"\$@\"' - setopt NO_GLOB_SUBST -else - case \`(set -o) 2>/dev/null\` in #( - *posix*) : - set -o posix ;; #( - *) : - ;; -esac -fi -" - as_required="as_fn_return () { (exit \$1); } -as_fn_success () { as_fn_return 0; } -as_fn_failure () { as_fn_return 1; } -as_fn_ret_success () { return 0; } -as_fn_ret_failure () { return 1; } - -exitcode=0 -as_fn_success || { exitcode=1; echo as_fn_success failed.; } -as_fn_failure && { exitcode=1; echo as_fn_failure succeeded.; } -as_fn_ret_success || { exitcode=1; echo as_fn_ret_success failed.; } -as_fn_ret_failure && { exitcode=1; echo as_fn_ret_failure succeeded.; } -if ( set x; as_fn_ret_success y && test x = \"\$1\" ); then : - -else - exitcode=1; echo positional parameters were not saved. -fi -test x\$exitcode = x0 || exit 1 -test -x / || exit 1" - as_suggested=" as_lineno_1=";as_suggested=$as_suggested$LINENO;as_suggested=$as_suggested" as_lineno_1a=\$LINENO - as_lineno_2=";as_suggested=$as_suggested$LINENO;as_suggested=$as_suggested" as_lineno_2a=\$LINENO - eval 'test \"x\$as_lineno_1'\$as_run'\" != \"x\$as_lineno_2'\$as_run'\" && - test \"x\`expr \$as_lineno_1'\$as_run' + 1\`\" = \"x\$as_lineno_2'\$as_run'\"' || exit 1" - if (eval "$as_required") 2>/dev/null; then : - as_have_required=yes -else - as_have_required=no -fi - if test x$as_have_required = xyes && (eval "$as_suggested") 2>/dev/null; then : - -else - as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -as_found=false -for as_dir in /bin$PATH_SEPARATOR/usr/bin$PATH_SEPARATOR$PATH -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - as_found=: - case $as_dir in #( - /*) - for as_base in sh bash ksh sh5; do - # Try only shells that exist, to save several forks. - as_shell=$as_dir/$as_base - if { test -f "$as_shell" || test -f "$as_shell.exe"; } && - { $as_echo "$as_bourne_compatible""$as_required" | as_run=a "$as_shell"; } 2>/dev/null; then : - CONFIG_SHELL=$as_shell as_have_required=yes - if { $as_echo "$as_bourne_compatible""$as_suggested" | as_run=a "$as_shell"; } 2>/dev/null; then : - break 2 -fi -fi - done;; - esac - as_found=false -done -$as_found || { if { test -f "$SHELL" || test -f "$SHELL.exe"; } && - { $as_echo "$as_bourne_compatible""$as_required" | as_run=a "$SHELL"; } 2>/dev/null; then : - CONFIG_SHELL=$SHELL as_have_required=yes -fi; } -IFS=$as_save_IFS - - - if test "x$CONFIG_SHELL" != x; then : - export CONFIG_SHELL - # We cannot yet assume a decent shell, so we have to provide a -# neutralization value for shells without unset; and this also -# works around shells that cannot unset nonexistent variables. -# Preserve -v and -x to the replacement shell. -BASH_ENV=/dev/null -ENV=/dev/null -(unset BASH_ENV) >/dev/null 2>&1 && unset BASH_ENV ENV -case $- in # (((( - *v*x* | *x*v* ) as_opts=-vx ;; - *v* ) as_opts=-v ;; - *x* ) as_opts=-x ;; - * ) as_opts= ;; -esac -exec $CONFIG_SHELL $as_opts "$as_myself" ${1+"$@"} -# Admittedly, this is quite paranoid, since all the known shells bail -# out after a failed `exec'. -$as_echo "$0: could not re-execute with $CONFIG_SHELL" >&2 -exit 255 -fi - - if test x$as_have_required = xno; then : - $as_echo "$0: This script requires a shell more modern than all" - $as_echo "$0: the shells that I found on your system." - if test x${ZSH_VERSION+set} = xset ; then - $as_echo "$0: In particular, zsh $ZSH_VERSION has bugs and should" - $as_echo "$0: be upgraded to zsh 4.3.4 or later." - else - $as_echo "$0: Please tell bug-autoconf@gnu.org about your system, -$0: including any error possibly output before this -$0: message. Then install a modern shell, or manually run -$0: the script under such a shell if you do have one." - fi - exit 1 -fi -fi -fi -SHELL=${CONFIG_SHELL-/bin/sh} -export SHELL -# Unset more variables known to interfere with behavior of common tools. -CLICOLOR_FORCE= GREP_OPTIONS= -unset CLICOLOR_FORCE GREP_OPTIONS - -## --------------------- ## -## M4sh Shell Functions. ## -## --------------------- ## -# as_fn_unset VAR -# --------------- -# Portably unset VAR. -as_fn_unset () -{ - { eval $1=; unset $1;} -} -as_unset=as_fn_unset - -# as_fn_set_status STATUS -# ----------------------- -# Set $? to STATUS, without forking. -as_fn_set_status () -{ - return $1 -} # as_fn_set_status - -# as_fn_exit STATUS -# ----------------- -# Exit the shell with STATUS, even in a "trap 0" or "set -e" context. -as_fn_exit () -{ - set +e - as_fn_set_status $1 - exit $1 -} # as_fn_exit - -# as_fn_mkdir_p -# ------------- -# Create "$as_dir" as a directory, including parents if necessary. -as_fn_mkdir_p () -{ - - case $as_dir in #( - -*) as_dir=./$as_dir;; - esac - test -d "$as_dir" || eval $as_mkdir_p || { - as_dirs= - while :; do - case $as_dir in #( - *\'*) as_qdir=`$as_echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'( - *) as_qdir=$as_dir;; - esac - as_dirs="'$as_qdir' $as_dirs" - as_dir=`$as_dirname -- "$as_dir" || -$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ - X"$as_dir" : 'X\(//\)[^/]' \| \ - X"$as_dir" : 'X\(//\)$' \| \ - X"$as_dir" : 'X\(/\)' \| . 2>/dev/null || -$as_echo X"$as_dir" | - sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ - s//\1/ - q - } - /^X\(\/\/\)[^/].*/{ - s//\1/ - q - } - /^X\(\/\/\)$/{ - s//\1/ - q - } - /^X\(\/\).*/{ - s//\1/ - q - } - s/.*/./; q'` - test -d "$as_dir" && break - done - test -z "$as_dirs" || eval "mkdir $as_dirs" - } || test -d "$as_dir" || as_fn_error $? "cannot create directory $as_dir" - - -} # as_fn_mkdir_p - -# as_fn_executable_p FILE -# ----------------------- -# Test if FILE is an executable regular file. -as_fn_executable_p () -{ - test -f "$1" && test -x "$1" -} # as_fn_executable_p -# as_fn_append VAR VALUE -# ---------------------- -# Append the text in VALUE to the end of the definition contained in VAR. Take -# advantage of any shell optimizations that allow amortized linear growth over -# repeated appends, instead of the typical quadratic growth present in naive -# implementations. -if (eval "as_var=1; as_var+=2; test x\$as_var = x12") 2>/dev/null; then : - eval 'as_fn_append () - { - eval $1+=\$2 - }' -else - as_fn_append () - { - eval $1=\$$1\$2 - } -fi # as_fn_append - -# as_fn_arith ARG... -# ------------------ -# Perform arithmetic evaluation on the ARGs, and store the result in the -# global $as_val. Take advantage of shells that can avoid forks. The arguments -# must be portable across $(()) and expr. -if (eval "test \$(( 1 + 1 )) = 2") 2>/dev/null; then : - eval 'as_fn_arith () - { - as_val=$(( $* )) - }' -else - as_fn_arith () - { - as_val=`expr "$@" || test $? -eq 1` - } -fi # as_fn_arith - - -# as_fn_error STATUS ERROR [LINENO LOG_FD] -# ---------------------------------------- -# Output "`basename $0`: error: ERROR" to stderr. If LINENO and LOG_FD are -# provided, also output the error to LOG_FD, referencing LINENO. Then exit the -# script with STATUS, using 1 if that was 0. -as_fn_error () -{ - as_status=$1; test $as_status -eq 0 && as_status=1 - if test "$4"; then - as_lineno=${as_lineno-"$3"} as_lineno_stack=as_lineno_stack=$as_lineno_stack - $as_echo "$as_me:${as_lineno-$LINENO}: error: $2" >&$4 - fi - $as_echo "$as_me: error: $2" >&2 - as_fn_exit $as_status -} # as_fn_error - -if expr a : '\(a\)' >/dev/null 2>&1 && - test "X`expr 00001 : '.*\(...\)'`" = X001; then - as_expr=expr -else - as_expr=false -fi - -if (basename -- /) >/dev/null 2>&1 && test "X`basename -- / 2>&1`" = "X/"; then - as_basename=basename -else - as_basename=false -fi - -if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then - as_dirname=dirname -else - as_dirname=false -fi - -as_me=`$as_basename -- "$0" || -$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \ - X"$0" : 'X\(//\)$' \| \ - X"$0" : 'X\(/\)' \| . 2>/dev/null || -$as_echo X/"$0" | - sed '/^.*\/\([^/][^/]*\)\/*$/{ - s//\1/ - q - } - /^X\/\(\/\/\)$/{ - s//\1/ - q - } - /^X\/\(\/\).*/{ - s//\1/ - q - } - s/.*/./; q'` - -# Avoid depending upon Character Ranges. -as_cr_letters='abcdefghijklmnopqrstuvwxyz' -as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ' -as_cr_Letters=$as_cr_letters$as_cr_LETTERS -as_cr_digits='0123456789' -as_cr_alnum=$as_cr_Letters$as_cr_digits - - - as_lineno_1=$LINENO as_lineno_1a=$LINENO - as_lineno_2=$LINENO as_lineno_2a=$LINENO - eval 'test "x$as_lineno_1'$as_run'" != "x$as_lineno_2'$as_run'" && - test "x`expr $as_lineno_1'$as_run' + 1`" = "x$as_lineno_2'$as_run'"' || { - # Blame Lee E. McMahon (1931-1989) for sed's syntax. :-) - sed -n ' - p - /[$]LINENO/= - ' <$as_myself | - sed ' - s/[$]LINENO.*/&-/ - t lineno - b - :lineno - N - :loop - s/[$]LINENO\([^'$as_cr_alnum'_].*\n\)\(.*\)/\2\1\2/ - t loop - s/-\n.*// - ' >$as_me.lineno && - chmod +x "$as_me.lineno" || - { $as_echo "$as_me: error: cannot create $as_me.lineno; rerun with a POSIX shell" >&2; as_fn_exit 1; } - - # If we had to re-execute with $CONFIG_SHELL, we're ensured to have - # already done that, so ensure we don't try to do so again and fall - # in an infinite loop. This has already happened in practice. - _as_can_reexec=no; export _as_can_reexec - # Don't try to exec as it changes $[0], causing all sort of problems - # (the dirname of $[0] is not the place where we might find the - # original and so on. Autoconf is especially sensitive to this). - . "./$as_me.lineno" - # Exit status is that of the last command. - exit -} - -ECHO_C= ECHO_N= ECHO_T= -case `echo -n x` in #((((( --n*) - case `echo 'xy\c'` in - *c*) ECHO_T=' ';; # ECHO_T is single tab character. - xy) ECHO_C='\c';; - *) echo `echo ksh88 bug on AIX 6.1` > /dev/null - ECHO_T=' ';; - esac;; -*) - ECHO_N='-n';; -esac - -rm -f conf$$ conf$$.exe conf$$.file -if test -d conf$$.dir; then - rm -f conf$$.dir/conf$$.file -else - rm -f conf$$.dir - mkdir conf$$.dir 2>/dev/null -fi -if (echo >conf$$.file) 2>/dev/null; then - if ln -s conf$$.file conf$$ 2>/dev/null; then - as_ln_s='ln -s' - # ... but there are two gotchas: - # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail. - # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable. - # In both cases, we have to default to `cp -pR'. - ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe || - as_ln_s='cp -pR' - elif ln conf$$.file conf$$ 2>/dev/null; then - as_ln_s=ln - else - as_ln_s='cp -pR' - fi -else - as_ln_s='cp -pR' -fi -rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file -rmdir conf$$.dir 2>/dev/null - -if mkdir -p . 2>/dev/null; then - as_mkdir_p='mkdir -p "$as_dir"' -else - test -d ./-p && rmdir ./-p - as_mkdir_p=false -fi - -as_test_x='test -x' -as_executable_p=as_fn_executable_p - -# Sed expression to map a string onto a valid CPP name. -as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'" - -# Sed expression to map a string onto a valid variable name. -as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'" - - -test -n "$DJDIR" || exec 7<&0 </dev/null -exec 6>&1 - -# Name of the host. -# hostname on some systems (SVR3.2, old GNU/Linux) returns a bogus exit status, -# so uname gets run too. -ac_hostname=`(hostname || uname -n) 2>/dev/null | sed 1q` - -# -# Initializations. -# -ac_default_prefix=/usr/local -ac_clean_files= -ac_config_libobj_dir=. -LIBOBJS= -cross_compiling=no -subdirs= -MFLAGS= -MAKEFLAGS= - -# Identity of this package. -PACKAGE_NAME='rock' -PACKAGE_TARNAME='rock' -PACKAGE_VERSION='1.9.5' -PACKAGE_STRING='rock 1.9.5' -PACKAGE_BUGREPORT='' -PACKAGE_URL='' - -ac_subst_vars='am__EXEEXT_FALSE -am__EXEEXT_TRUE -LTLIBOBJS -LIBOBJS -POD2MAN -RANLIB -am__fastdepCXX_FALSE -am__fastdepCXX_TRUE -CXXDEPMODE -am__nodep -AMDEPBACKSLASH -AMDEP_FALSE -AMDEP_TRUE -am__quote -am__include -DEPDIR -OBJEXT -EXEEXT -ac_ct_CXX -CPPFLAGS -LDFLAGS -CXXFLAGS -CXX -AM_BACKSLASH -AM_DEFAULT_VERBOSITY -AM_DEFAULT_V -AM_V -am__untar -am__tar -AMTAR -am__leading_dot -SET_MAKE -AWK -mkdir_p -MKDIR_P -INSTALL_STRIP_PROGRAM -STRIP -install_sh -MAKEINFO -AUTOHEADER -AUTOMAKE -AUTOCONF -ACLOCAL -VERSION -PACKAGE -CYGPATH_W -am__isrc -INSTALL_DATA -INSTALL_SCRIPT -INSTALL_PROGRAM -target_os -target_vendor -target_cpu -target -host_os -host_vendor -host_cpu -host -build_os -build_vendor -build_cpu -build -target_alias -host_alias -build_alias -LIBS -ECHO_T -ECHO_N -ECHO_C -DEFS -mandir -localedir -libdir -psdir -pdfdir -dvidir -htmldir -infodir -docdir -oldincludedir -includedir -localstatedir -sharedstatedir -sysconfdir -datadir -datarootdir -libexecdir -sbindir -bindir -program_transform_name -prefix -exec_prefix -PACKAGE_URL -PACKAGE_BUGREPORT -PACKAGE_STRING -PACKAGE_VERSION -PACKAGE_TARNAME -PACKAGE_NAME -PATH_SEPARATOR -SHELL' -ac_subst_files='' -ac_user_opts=' -enable_option_checking -enable_silent_rules -enable_dependency_tracking -' - ac_precious_vars='build_alias -host_alias -target_alias -CXX -CXXFLAGS -LDFLAGS -LIBS -CPPFLAGS -CCC' - - -# Initialize some variables set by options. -ac_init_help= -ac_init_version=false -ac_unrecognized_opts= -ac_unrecognized_sep= -# The variables have the same names as the options, with -# dashes changed to underlines. -cache_file=/dev/null -exec_prefix=NONE -no_create= -no_recursion= -prefix=NONE -program_prefix=NONE -program_suffix=NONE -program_transform_name=s,x,x, -silent= -site= -srcdir= -verbose= -x_includes=NONE -x_libraries=NONE - -# Installation directory options. -# These are left unexpanded so users can "make install exec_prefix=/foo" -# and all the variables that are supposed to be based on exec_prefix -# by default will actually change. -# Use braces instead of parens because sh, perl, etc. also accept them. -# (The list follows the same order as the GNU Coding Standards.) -bindir='${exec_prefix}/bin' -sbindir='${exec_prefix}/sbin' -libexecdir='${exec_prefix}/libexec' -datarootdir='${prefix}/share' -datadir='${datarootdir}' -sysconfdir='${prefix}/etc' -sharedstatedir='${prefix}/com' -localstatedir='${prefix}/var' -includedir='${prefix}/include' -oldincludedir='/usr/include' -docdir='${datarootdir}/doc/${PACKAGE_TARNAME}' -infodir='${datarootdir}/info' -htmldir='${docdir}' -dvidir='${docdir}' -pdfdir='${docdir}' -psdir='${docdir}' -libdir='${exec_prefix}/lib' -localedir='${datarootdir}/locale' -mandir='${datarootdir}/man' - -ac_prev= -ac_dashdash= -for ac_option -do - # If the previous option needs an argument, assign it. - if test -n "$ac_prev"; then - eval $ac_prev=\$ac_option - ac_prev= - continue - fi - - case $ac_option in - *=?*) ac_optarg=`expr "X$ac_option" : '[^=]*=\(.*\)'` ;; - *=) ac_optarg= ;; - *) ac_optarg=yes ;; - esac - - # Accept the important Cygnus configure options, so we can diagnose typos. - - case $ac_dashdash$ac_option in - --) - ac_dashdash=yes ;; - - -bindir | --bindir | --bindi | --bind | --bin | --bi) - ac_prev=bindir ;; - -bindir=* | --bindir=* | --bindi=* | --bind=* | --bin=* | --bi=*) - bindir=$ac_optarg ;; - - -build | --build | --buil | --bui | --bu) - ac_prev=build_alias ;; - -build=* | --build=* | --buil=* | --bui=* | --bu=*) - build_alias=$ac_optarg ;; - - -cache-file | --cache-file | --cache-fil | --cache-fi \ - | --cache-f | --cache- | --cache | --cach | --cac | --ca | --c) - ac_prev=cache_file ;; - -cache-file=* | --cache-file=* | --cache-fil=* | --cache-fi=* \ - | --cache-f=* | --cache-=* | --cache=* | --cach=* | --cac=* | --ca=* | --c=*) - cache_file=$ac_optarg ;; - - --config-cache | -C) - cache_file=config.cache ;; - - -datadir | --datadir | --datadi | --datad) - ac_prev=datadir ;; - -datadir=* | --datadir=* | --datadi=* | --datad=*) - datadir=$ac_optarg ;; - - -datarootdir | --datarootdir | --datarootdi | --datarootd | --dataroot \ - | --dataroo | --dataro | --datar) - ac_prev=datarootdir ;; - -datarootdir=* | --datarootdir=* | --datarootdi=* | --datarootd=* \ - | --dataroot=* | --dataroo=* | --dataro=* | --datar=*) - datarootdir=$ac_optarg ;; - - -disable-* | --disable-*) - ac_useropt=`expr "x$ac_option" : 'x-*disable-\(.*\)'` - # Reject names that are not valid shell variable names. - expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null && - as_fn_error $? "invalid feature name: $ac_useropt" - ac_useropt_orig=$ac_useropt - ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'` - case $ac_user_opts in - *" -"enable_$ac_useropt" -"*) ;; - *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--disable-$ac_useropt_orig" - ac_unrecognized_sep=', ';; - esac - eval enable_$ac_useropt=no ;; - - -docdir | --docdir | --docdi | --doc | --do) - ac_prev=docdir ;; - -docdir=* | --docdir=* | --docdi=* | --doc=* | --do=*) - docdir=$ac_optarg ;; - - -dvidir | --dvidir | --dvidi | --dvid | --dvi | --dv) - ac_prev=dvidir ;; - -dvidir=* | --dvidir=* | --dvidi=* | --dvid=* | --dvi=* | --dv=*) - dvidir=$ac_optarg ;; - - -enable-* | --enable-*) - ac_useropt=`expr "x$ac_option" : 'x-*enable-\([^=]*\)'` - # Reject names that are not valid shell variable names. - expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null && - as_fn_error $? "invalid feature name: $ac_useropt" - ac_useropt_orig=$ac_useropt - ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'` - case $ac_user_opts in - *" -"enable_$ac_useropt" -"*) ;; - *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--enable-$ac_useropt_orig" - ac_unrecognized_sep=', ';; - esac - eval enable_$ac_useropt=\$ac_optarg ;; - - -exec-prefix | --exec_prefix | --exec-prefix | --exec-prefi \ - | --exec-pref | --exec-pre | --exec-pr | --exec-p | --exec- \ - | --exec | --exe | --ex) - ac_prev=exec_prefix ;; - -exec-prefix=* | --exec_prefix=* | --exec-prefix=* | --exec-prefi=* \ - | --exec-pref=* | --exec-pre=* | --exec-pr=* | --exec-p=* | --exec-=* \ - | --exec=* | --exe=* | --ex=*) - exec_prefix=$ac_optarg ;; - - -gas | --gas | --ga | --g) - # Obsolete; use --with-gas. - with_gas=yes ;; - - -help | --help | --hel | --he | -h) - ac_init_help=long ;; - -help=r* | --help=r* | --hel=r* | --he=r* | -hr*) - ac_init_help=recursive ;; - -help=s* | --help=s* | --hel=s* | --he=s* | -hs*) - ac_init_help=short ;; - - -host | --host | --hos | --ho) - ac_prev=host_alias ;; - -host=* | --host=* | --hos=* | --ho=*) - host_alias=$ac_optarg ;; - - -htmldir | --htmldir | --htmldi | --htmld | --html | --htm | --ht) - ac_prev=htmldir ;; - -htmldir=* | --htmldir=* | --htmldi=* | --htmld=* | --html=* | --htm=* \ - | --ht=*) - htmldir=$ac_optarg ;; - - -includedir | --includedir | --includedi | --included | --include \ - | --includ | --inclu | --incl | --inc) - ac_prev=includedir ;; - -includedir=* | --includedir=* | --includedi=* | --included=* | --include=* \ - | --includ=* | --inclu=* | --incl=* | --inc=*) - includedir=$ac_optarg ;; - - -infodir | --infodir | --infodi | --infod | --info | --inf) - ac_prev=infodir ;; - -infodir=* | --infodir=* | --infodi=* | --infod=* | --info=* | --inf=*) - infodir=$ac_optarg ;; - - -libdir | --libdir | --libdi | --libd) - ac_prev=libdir ;; - -libdir=* | --libdir=* | --libdi=* | --libd=*) - libdir=$ac_optarg ;; - - -libexecdir | --libexecdir | --libexecdi | --libexecd | --libexec \ - | --libexe | --libex | --libe) - ac_prev=libexecdir ;; - -libexecdir=* | --libexecdir=* | --libexecdi=* | --libexecd=* | --libexec=* \ - | --libexe=* | --libex=* | --libe=*) - libexecdir=$ac_optarg ;; - - -localedir | --localedir | --localedi | --localed | --locale) - ac_prev=localedir ;; - -localedir=* | --localedir=* | --localedi=* | --localed=* | --locale=*) - localedir=$ac_optarg ;; - - -localstatedir | --localstatedir | --localstatedi | --localstated \ - | --localstate | --localstat | --localsta | --localst | --locals) - ac_prev=localstatedir ;; - -localstatedir=* | --localstatedir=* | --localstatedi=* | --localstated=* \ - | --localstate=* | --localstat=* | --localsta=* | --localst=* | --locals=*) - localstatedir=$ac_optarg ;; - - -mandir | --mandir | --mandi | --mand | --man | --ma | --m) - ac_prev=mandir ;; - -mandir=* | --mandir=* | --mandi=* | --mand=* | --man=* | --ma=* | --m=*) - mandir=$ac_optarg ;; - - -nfp | --nfp | --nf) - # Obsolete; use --without-fp. - with_fp=no ;; - - -no-create | --no-create | --no-creat | --no-crea | --no-cre \ - | --no-cr | --no-c | -n) - no_create=yes ;; - - -no-recursion | --no-recursion | --no-recursio | --no-recursi \ - | --no-recurs | --no-recur | --no-recu | --no-rec | --no-re | --no-r) - no_recursion=yes ;; - - -oldincludedir | --oldincludedir | --oldincludedi | --oldincluded \ - | --oldinclude | --oldinclud | --oldinclu | --oldincl | --oldinc \ - | --oldin | --oldi | --old | --ol | --o) - ac_prev=oldincludedir ;; - -oldincludedir=* | --oldincludedir=* | --oldincludedi=* | --oldincluded=* \ - | --oldinclude=* | --oldinclud=* | --oldinclu=* | --oldincl=* | --oldinc=* \ - | --oldin=* | --oldi=* | --old=* | --ol=* | --o=*) - oldincludedir=$ac_optarg ;; - - -prefix | --prefix | --prefi | --pref | --pre | --pr | --p) - ac_prev=prefix ;; - -prefix=* | --prefix=* | --prefi=* | --pref=* | --pre=* | --pr=* | --p=*) - prefix=$ac_optarg ;; - - -program-prefix | --program-prefix | --program-prefi | --program-pref \ - | --program-pre | --program-pr | --program-p) - ac_prev=program_prefix ;; - -program-prefix=* | --program-prefix=* | --program-prefi=* \ - | --program-pref=* | --program-pre=* | --program-pr=* | --program-p=*) - program_prefix=$ac_optarg ;; - - -program-suffix | --program-suffix | --program-suffi | --program-suff \ - | --program-suf | --program-su | --program-s) - ac_prev=program_suffix ;; - -program-suffix=* | --program-suffix=* | --program-suffi=* \ - | --program-suff=* | --program-suf=* | --program-su=* | --program-s=*) - program_suffix=$ac_optarg ;; - - -program-transform-name | --program-transform-name \ - | --program-transform-nam | --program-transform-na \ - | --program-transform-n | --program-transform- \ - | --program-transform | --program-transfor \ - | --program-transfo | --program-transf \ - | --program-trans | --program-tran \ - | --progr-tra | --program-tr | --program-t) - ac_prev=program_transform_name ;; - -program-transform-name=* | --program-transform-name=* \ - | --program-transform-nam=* | --program-transform-na=* \ - | --program-transform-n=* | --program-transform-=* \ - | --program-transform=* | --program-transfor=* \ - | --program-transfo=* | --program-transf=* \ - | --program-trans=* | --program-tran=* \ - | --progr-tra=* | --program-tr=* | --program-t=*) - program_transform_name=$ac_optarg ;; - - -pdfdir | --pdfdir | --pdfdi | --pdfd | --pdf | --pd) - ac_prev=pdfdir ;; - -pdfdir=* | --pdfdir=* | --pdfdi=* | --pdfd=* | --pdf=* | --pd=*) - pdfdir=$ac_optarg ;; - - -psdir | --psdir | --psdi | --psd | --ps) - ac_prev=psdir ;; - -psdir=* | --psdir=* | --psdi=* | --psd=* | --ps=*) - psdir=$ac_optarg ;; - - -q | -quiet | --quiet | --quie | --qui | --qu | --q \ - | -silent | --silent | --silen | --sile | --sil) - silent=yes ;; - - -sbindir | --sbindir | --sbindi | --sbind | --sbin | --sbi | --sb) - ac_prev=sbindir ;; - -sbindir=* | --sbindir=* | --sbindi=* | --sbind=* | --sbin=* \ - | --sbi=* | --sb=*) - sbindir=$ac_optarg ;; - - -sharedstatedir | --sharedstatedir | --sharedstatedi \ - | --sharedstated | --sharedstate | --sharedstat | --sharedsta \ - | --sharedst | --shareds | --shared | --share | --shar \ - | --sha | --sh) - ac_prev=sharedstatedir ;; - -sharedstatedir=* | --sharedstatedir=* | --sharedstatedi=* \ - | --sharedstated=* | --sharedstate=* | --sharedstat=* | --sharedsta=* \ - | --sharedst=* | --shareds=* | --shared=* | --share=* | --shar=* \ - | --sha=* | --sh=*) - sharedstatedir=$ac_optarg ;; - - -site | --site | --sit) - ac_prev=site ;; - -site=* | --site=* | --sit=*) - site=$ac_optarg ;; - - -srcdir | --srcdir | --srcdi | --srcd | --src | --sr) - ac_prev=srcdir ;; - -srcdir=* | --srcdir=* | --srcdi=* | --srcd=* | --src=* | --sr=*) - srcdir=$ac_optarg ;; - - -sysconfdir | --sysconfdir | --sysconfdi | --sysconfd | --sysconf \ - | --syscon | --sysco | --sysc | --sys | --sy) - ac_prev=sysconfdir ;; - -sysconfdir=* | --sysconfdir=* | --sysconfdi=* | --sysconfd=* | --sysconf=* \ - | --syscon=* | --sysco=* | --sysc=* | --sys=* | --sy=*) - sysconfdir=$ac_optarg ;; - - -target | --target | --targe | --targ | --tar | --ta | --t) - ac_prev=target_alias ;; - -target=* | --target=* | --targe=* | --targ=* | --tar=* | --ta=* | --t=*) - target_alias=$ac_optarg ;; - - -v | -verbose | --verbose | --verbos | --verbo | --verb) - verbose=yes ;; - - -version | --version | --versio | --versi | --vers | -V) - ac_init_version=: ;; - - -with-* | --with-*) - ac_useropt=`expr "x$ac_option" : 'x-*with-\([^=]*\)'` - # Reject names that are not valid shell variable names. - expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null && - as_fn_error $? "invalid package name: $ac_useropt" - ac_useropt_orig=$ac_useropt - ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'` - case $ac_user_opts in - *" -"with_$ac_useropt" -"*) ;; - *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--with-$ac_useropt_orig" - ac_unrecognized_sep=', ';; - esac - eval with_$ac_useropt=\$ac_optarg ;; - - -without-* | --without-*) - ac_useropt=`expr "x$ac_option" : 'x-*without-\(.*\)'` - # Reject names that are not valid shell variable names. - expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null && - as_fn_error $? "invalid package name: $ac_useropt" - ac_useropt_orig=$ac_useropt - ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'` - case $ac_user_opts in - *" -"with_$ac_useropt" -"*) ;; - *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--without-$ac_useropt_orig" - ac_unrecognized_sep=', ';; - esac - eval with_$ac_useropt=no ;; - - --x) - # Obsolete; use --with-x. - with_x=yes ;; - - -x-includes | --x-includes | --x-include | --x-includ | --x-inclu \ - | --x-incl | --x-inc | --x-in | --x-i) - ac_prev=x_includes ;; - -x-includes=* | --x-includes=* | --x-include=* | --x-includ=* | --x-inclu=* \ - | --x-incl=* | --x-inc=* | --x-in=* | --x-i=*) - x_includes=$ac_optarg ;; - - -x-libraries | --x-libraries | --x-librarie | --x-librari \ - | --x-librar | --x-libra | --x-libr | --x-lib | --x-li | --x-l) - ac_prev=x_libraries ;; - -x-libraries=* | --x-libraries=* | --x-librarie=* | --x-librari=* \ - | --x-librar=* | --x-libra=* | --x-libr=* | --x-lib=* | --x-li=* | --x-l=*) - x_libraries=$ac_optarg ;; - - -*) as_fn_error $? "unrecognized option: \`$ac_option' -Try \`$0 --help' for more information" - ;; - - *=*) - ac_envvar=`expr "x$ac_option" : 'x\([^=]*\)='` - # Reject names that are not valid shell variable names. - case $ac_envvar in #( - '' | [0-9]* | *[!_$as_cr_alnum]* ) - as_fn_error $? "invalid variable name: \`$ac_envvar'" ;; - esac - eval $ac_envvar=\$ac_optarg - export $ac_envvar ;; - - *) - # FIXME: should be removed in autoconf 3.0. - $as_echo "$as_me: WARNING: you should use --build, --host, --target" >&2 - expr "x$ac_option" : ".*[^-._$as_cr_alnum]" >/dev/null && - $as_echo "$as_me: WARNING: invalid host type: $ac_option" >&2 - : "${build_alias=$ac_option} ${host_alias=$ac_option} ${target_alias=$ac_option}" - ;; - - esac -done - -if test -n "$ac_prev"; then - ac_option=--`echo $ac_prev | sed 's/_/-/g'` - as_fn_error $? "missing argument to $ac_option" -fi - -if test -n "$ac_unrecognized_opts"; then - case $enable_option_checking in - no) ;; - fatal) as_fn_error $? "unrecognized options: $ac_unrecognized_opts" ;; - *) $as_echo "$as_me: WARNING: unrecognized options: $ac_unrecognized_opts" >&2 ;; - esac -fi - -# Check all directory arguments for consistency. -for ac_var in exec_prefix prefix bindir sbindir libexecdir datarootdir \ - datadir sysconfdir sharedstatedir localstatedir includedir \ - oldincludedir docdir infodir htmldir dvidir pdfdir psdir \ - libdir localedir mandir -do - eval ac_val=\$$ac_var - # Remove trailing slashes. - case $ac_val in - */ ) - ac_val=`expr "X$ac_val" : 'X\(.*[^/]\)' \| "X$ac_val" : 'X\(.*\)'` - eval $ac_var=\$ac_val;; - esac - # Be sure to have absolute directory names. - case $ac_val in - [\\/$]* | ?:[\\/]* ) continue;; - NONE | '' ) case $ac_var in *prefix ) continue;; esac;; - esac - as_fn_error $? "expected an absolute directory name for --$ac_var: $ac_val" -done - -# There might be people who depend on the old broken behavior: `$host' -# used to hold the argument of --host etc. -# FIXME: To remove some day. -build=$build_alias -host=$host_alias -target=$target_alias - -# FIXME: To remove some day. -if test "x$host_alias" != x; then - if test "x$build_alias" = x; then - cross_compiling=maybe - elif test "x$build_alias" != "x$host_alias"; then - cross_compiling=yes - fi -fi - -ac_tool_prefix= -test -n "$host_alias" && ac_tool_prefix=$host_alias- - -test "$silent" = yes && exec 6>/dev/null - - -ac_pwd=`pwd` && test -n "$ac_pwd" && -ac_ls_di=`ls -di .` && -ac_pwd_ls_di=`cd "$ac_pwd" && ls -di .` || - as_fn_error $? "working directory cannot be determined" -test "X$ac_ls_di" = "X$ac_pwd_ls_di" || - as_fn_error $? "pwd does not report name of working directory" - - -# Find the source files, if location was not specified. -if test -z "$srcdir"; then - ac_srcdir_defaulted=yes - # Try the directory containing this script, then the parent directory. - ac_confdir=`$as_dirname -- "$as_myself" || -$as_expr X"$as_myself" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ - X"$as_myself" : 'X\(//\)[^/]' \| \ - X"$as_myself" : 'X\(//\)$' \| \ - X"$as_myself" : 'X\(/\)' \| . 2>/dev/null || -$as_echo X"$as_myself" | - sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ - s//\1/ - q - } - /^X\(\/\/\)[^/].*/{ - s//\1/ - q - } - /^X\(\/\/\)$/{ - s//\1/ - q - } - /^X\(\/\).*/{ - s//\1/ - q - } - s/.*/./; q'` - srcdir=$ac_confdir - if test ! -r "$srcdir/$ac_unique_file"; then - srcdir=.. - fi -else - ac_srcdir_defaulted=no -fi -if test ! -r "$srcdir/$ac_unique_file"; then - test "$ac_srcdir_defaulted" = yes && srcdir="$ac_confdir or .." - as_fn_error $? "cannot find sources ($ac_unique_file) in $srcdir" -fi -ac_msg="sources are in $srcdir, but \`cd $srcdir' does not work" -ac_abs_confdir=`( - cd "$srcdir" && test -r "./$ac_unique_file" || as_fn_error $? "$ac_msg" - pwd)` -# When building in place, set srcdir=. -if test "$ac_abs_confdir" = "$ac_pwd"; then - srcdir=. -fi -# Remove unnecessary trailing slashes from srcdir. -# Double slashes in file names in object file debugging info -# mess up M-x gdb in Emacs. -case $srcdir in -*/) srcdir=`expr "X$srcdir" : 'X\(.*[^/]\)' \| "X$srcdir" : 'X\(.*\)'`;; -esac -for ac_var in $ac_precious_vars; do - eval ac_env_${ac_var}_set=\${${ac_var}+set} - eval ac_env_${ac_var}_value=\$${ac_var} - eval ac_cv_env_${ac_var}_set=\${${ac_var}+set} - eval ac_cv_env_${ac_var}_value=\$${ac_var} -done - -# -# Report the --help message. -# -if test "$ac_init_help" = "long"; then - # Omit some internal or obsolete options to make the list less imposing. - # This message is too long to be a string in the A/UX 3.1 sh. - cat <<_ACEOF -\`configure' configures rock 1.9.5 to adapt to many kinds of systems. - -Usage: $0 [OPTION]... [VAR=VALUE]... - -To assign environment variables (e.g., CC, CFLAGS...), specify them as -VAR=VALUE. See below for descriptions of some of the useful variables. - -Defaults for the options are specified in brackets. - -Configuration: - -h, --help display this help and exit - --help=short display options specific to this package - --help=recursive display the short help of all the included packages - -V, --version display version information and exit - -q, --quiet, --silent do not print \`checking ...' messages - --cache-file=FILE cache test results in FILE [disabled] - -C, --config-cache alias for \`--cache-file=config.cache' - -n, --no-create do not create output files - --srcdir=DIR find the sources in DIR [configure dir or \`..'] - -Installation directories: - --prefix=PREFIX install architecture-independent files in PREFIX - [$ac_default_prefix] - --exec-prefix=EPREFIX install architecture-dependent files in EPREFIX - [PREFIX] - -By default, \`make install' will install all the files in -\`$ac_default_prefix/bin', \`$ac_default_prefix/lib' etc. You can specify -an installation prefix other than \`$ac_default_prefix' using \`--prefix', -for instance \`--prefix=\$HOME'. - -For better control, use the options below. - -Fine tuning of the installation directories: - --bindir=DIR user executables [EPREFIX/bin] - --sbindir=DIR system admin executables [EPREFIX/sbin] - --libexecdir=DIR program executables [EPREFIX/libexec] - --sysconfdir=DIR read-only single-machine data [PREFIX/etc] - --sharedstatedir=DIR modifiable architecture-independent data [PREFIX/com] - --localstatedir=DIR modifiable single-machine data [PREFIX/var] - --libdir=DIR object code libraries [EPREFIX/lib] - --includedir=DIR C header files [PREFIX/include] - --oldincludedir=DIR C header files for non-gcc [/usr/include] - --datarootdir=DIR read-only arch.-independent data root [PREFIX/share] - --datadir=DIR read-only architecture-independent data [DATAROOTDIR] - --infodir=DIR info documentation [DATAROOTDIR/info] - --localedir=DIR locale-dependent data [DATAROOTDIR/locale] - --mandir=DIR man documentation [DATAROOTDIR/man] - --docdir=DIR documentation root [DATAROOTDIR/doc/rock] - --htmldir=DIR html documentation [DOCDIR] - --dvidir=DIR dvi documentation [DOCDIR] - --pdfdir=DIR pdf documentation [DOCDIR] - --psdir=DIR ps documentation [DOCDIR] -_ACEOF - - cat <<\_ACEOF - -Program names: - --program-prefix=PREFIX prepend PREFIX to installed program names - --program-suffix=SUFFIX append SUFFIX to installed program names - --program-transform-name=PROGRAM run sed PROGRAM on installed program names - -System types: - --build=BUILD configure for building on BUILD [guessed] - --host=HOST cross-compile to build programs to run on HOST [BUILD] - --target=TARGET configure for building compilers for TARGET [HOST] -_ACEOF -fi - -if test -n "$ac_init_help"; then - case $ac_init_help in - short | recursive ) echo "Configuration of rock 1.9.5:";; - esac - cat <<\_ACEOF - -Optional Features: - --disable-option-checking ignore unrecognized --enable/--with options - --disable-FEATURE do not include FEATURE (same as --enable-FEATURE=no) - --enable-FEATURE[=ARG] include FEATURE [ARG=yes] - --enable-silent-rules less verbose build output (undo: "make V=1") - --disable-silent-rules verbose build output (undo: "make V=0") - --enable-dependency-tracking - do not reject slow dependency extractors - --disable-dependency-tracking - speeds up one-time build - -Some influential environment variables: - CXX C++ compiler command - CXXFLAGS C++ compiler flags - LDFLAGS linker flags, e.g. -L<lib dir> if you have libraries in a - nonstandard directory <lib dir> - LIBS libraries to pass to the linker, e.g. -l<library> - CPPFLAGS (Objective) C/C++ preprocessor flags, e.g. -I<include dir> if - you have headers in a nonstandard directory <include dir> - -Use these variables to override the choices made by `configure' or to help -it to find libraries and programs with nonstandard names/locations. - -Report bugs to the package provider. -_ACEOF -ac_status=$? -fi - -if test "$ac_init_help" = "recursive"; then - # If there are subdirs, report their specific --help. - for ac_dir in : $ac_subdirs_all; do test "x$ac_dir" = x: && continue - test -d "$ac_dir" || - { cd "$srcdir" && ac_pwd=`pwd` && srcdir=. && test -d "$ac_dir"; } || - continue - ac_builddir=. - -case "$ac_dir" in -.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;; -*) - ac_dir_suffix=/`$as_echo "$ac_dir" | sed 's|^\.[\\/]||'` - # A ".." for each directory in $ac_dir_suffix. - ac_top_builddir_sub=`$as_echo "$ac_dir_suffix" | sed 's|/[^\\/]*|/..|g;s|/||'` - case $ac_top_builddir_sub in - "") ac_top_builddir_sub=. ac_top_build_prefix= ;; - *) ac_top_build_prefix=$ac_top_builddir_sub/ ;; - esac ;; -esac -ac_abs_top_builddir=$ac_pwd -ac_abs_builddir=$ac_pwd$ac_dir_suffix -# for backward compatibility: -ac_top_builddir=$ac_top_build_prefix - -case $srcdir in - .) # We are building in place. - ac_srcdir=. - ac_top_srcdir=$ac_top_builddir_sub - ac_abs_top_srcdir=$ac_pwd ;; - [\\/]* | ?:[\\/]* ) # Absolute name. - ac_srcdir=$srcdir$ac_dir_suffix; - ac_top_srcdir=$srcdir - ac_abs_top_srcdir=$srcdir ;; - *) # Relative name. - ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix - ac_top_srcdir=$ac_top_build_prefix$srcdir - ac_abs_top_srcdir=$ac_pwd/$srcdir ;; -esac -ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix - - cd "$ac_dir" || { ac_status=$?; continue; } - # Check for guested configure. - if test -f "$ac_srcdir/configure.gnu"; then - echo && - $SHELL "$ac_srcdir/configure.gnu" --help=recursive - elif test -f "$ac_srcdir/configure"; then - echo && - $SHELL "$ac_srcdir/configure" --help=recursive - else - $as_echo "$as_me: WARNING: no configuration information is in $ac_dir" >&2 - fi || ac_status=$? - cd "$ac_pwd" || { ac_status=$?; break; } - done -fi - -test -n "$ac_init_help" && exit $ac_status -if $ac_init_version; then - cat <<\_ACEOF -rock configure 1.9.5 -generated by GNU Autoconf 2.69 - -Copyright (C) 2012 Free Software Foundation, Inc. -This configure script is free software; the Free Software Foundation -gives unlimited permission to copy, distribute and modify it. -_ACEOF - exit -fi - -## ------------------------ ## -## Autoconf initialization. ## -## ------------------------ ## - -# ac_fn_cxx_try_compile LINENO -# ---------------------------- -# Try to compile conftest.$ac_ext, and return whether this succeeded. -ac_fn_cxx_try_compile () -{ - as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack - rm -f conftest.$ac_objext - if { { ac_try="$ac_compile" -case "(($ac_try" in - *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; - *) ac_try_echo=$ac_try;; -esac -eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\"" -$as_echo "$ac_try_echo"; } >&5 - (eval "$ac_compile") 2>conftest.err - ac_status=$? - if test -s conftest.err; then - grep -v '^ *+' conftest.err >conftest.er1 - cat conftest.er1 >&5 - mv -f conftest.er1 conftest.err - fi - $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5 - test $ac_status = 0; } && { - test -z "$ac_cxx_werror_flag" || - test ! -s conftest.err - } && test -s conftest.$ac_objext; then : - ac_retval=0 -else - $as_echo "$as_me: failed program was:" >&5 -sed 's/^/| /' conftest.$ac_ext >&5 - - ac_retval=1 -fi - eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno - as_fn_set_status $ac_retval - -} # ac_fn_cxx_try_compile -cat >config.log <<_ACEOF -This file contains any messages produced by compilers while -running configure, to aid debugging if configure makes a mistake. - -It was created by rock $as_me 1.9.5, which was -generated by GNU Autoconf 2.69. Invocation command line was - - $ $0 $@ - -_ACEOF -exec 5>>config.log -{ -cat <<_ASUNAME -## --------- ## -## Platform. ## -## --------- ## - -hostname = `(hostname || uname -n) 2>/dev/null | sed 1q` -uname -m = `(uname -m) 2>/dev/null || echo unknown` -uname -r = `(uname -r) 2>/dev/null || echo unknown` -uname -s = `(uname -s) 2>/dev/null || echo unknown` -uname -v = `(uname -v) 2>/dev/null || echo unknown` - -/usr/bin/uname -p = `(/usr/bin/uname -p) 2>/dev/null || echo unknown` -/bin/uname -X = `(/bin/uname -X) 2>/dev/null || echo unknown` - -/bin/arch = `(/bin/arch) 2>/dev/null || echo unknown` -/usr/bin/arch -k = `(/usr/bin/arch -k) 2>/dev/null || echo unknown` -/usr/convex/getsysinfo = `(/usr/convex/getsysinfo) 2>/dev/null || echo unknown` -/usr/bin/hostinfo = `(/usr/bin/hostinfo) 2>/dev/null || echo unknown` -/bin/machine = `(/bin/machine) 2>/dev/null || echo unknown` -/usr/bin/oslevel = `(/usr/bin/oslevel) 2>/dev/null || echo unknown` -/bin/universe = `(/bin/universe) 2>/dev/null || echo unknown` - -_ASUNAME - -as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -for as_dir in $PATH -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - $as_echo "PATH: $as_dir" - done -IFS=$as_save_IFS - -} >&5 - -cat >&5 <<_ACEOF - - -## ----------- ## -## Core tests. ## -## ----------- ## - -_ACEOF - - -# Keep a trace of the command line. -# Strip out --no-create and --no-recursion so they do not pile up. -# Strip out --silent because we don't want to record it for future runs. -# Also quote any args containing shell meta-characters. -# Make two passes to allow for proper duplicate-argument suppression. -ac_configure_args= -ac_configure_args0= -ac_configure_args1= -ac_must_keep_next=false -for ac_pass in 1 2 -do - for ac_arg - do - case $ac_arg in - -no-create | --no-c* | -n | -no-recursion | --no-r*) continue ;; - -q | -quiet | --quiet | --quie | --qui | --qu | --q \ - | -silent | --silent | --silen | --sile | --sil) - continue ;; - *\'*) - ac_arg=`$as_echo "$ac_arg" | sed "s/'/'\\\\\\\\''/g"` ;; - esac - case $ac_pass in - 1) as_fn_append ac_configure_args0 " '$ac_arg'" ;; - 2) - as_fn_append ac_configure_args1 " '$ac_arg'" - if test $ac_must_keep_next = true; then - ac_must_keep_next=false # Got value, back to normal. - else - case $ac_arg in - *=* | --config-cache | -C | -disable-* | --disable-* \ - | -enable-* | --enable-* | -gas | --g* | -nfp | --nf* \ - | -q | -quiet | --q* | -silent | --sil* | -v | -verb* \ - | -with-* | --with-* | -without-* | --without-* | --x) - case "$ac_configure_args0 " in - "$ac_configure_args1"*" '$ac_arg' "* ) continue ;; - esac - ;; - -* ) ac_must_keep_next=true ;; - esac - fi - as_fn_append ac_configure_args " '$ac_arg'" - ;; - esac - done -done -{ ac_configure_args0=; unset ac_configure_args0;} -{ ac_configure_args1=; unset ac_configure_args1;} - -# When interrupted or exit'd, cleanup temporary files, and complete -# config.log. We remove comments because anyway the quotes in there -# would cause problems or look ugly. -# WARNING: Use '\'' to represent an apostrophe within the trap. -# WARNING: Do not start the trap code with a newline, due to a FreeBSD 4.0 bug. -trap 'exit_status=$? - # Save into config.log some information that might help in debugging. - { - echo - - $as_echo "## ---------------- ## -## Cache variables. ## -## ---------------- ##" - echo - # The following way of writing the cache mishandles newlines in values, -( - for ac_var in `(set) 2>&1 | sed -n '\''s/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'\''`; do - eval ac_val=\$$ac_var - case $ac_val in #( - *${as_nl}*) - case $ac_var in #( - *_cv_*) { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: cache variable $ac_var contains a newline" >&5 -$as_echo "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;; - esac - case $ac_var in #( - _ | IFS | as_nl) ;; #( - BASH_ARGV | BASH_SOURCE) eval $ac_var= ;; #( - *) { eval $ac_var=; unset $ac_var;} ;; - esac ;; - esac - done - (set) 2>&1 | - case $as_nl`(ac_space='\'' '\''; set) 2>&1` in #( - *${as_nl}ac_space=\ *) - sed -n \ - "s/'\''/'\''\\\\'\'''\''/g; - s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\''\\2'\''/p" - ;; #( - *) - sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p" - ;; - esac | - sort -) - echo - - $as_echo "## ----------------- ## -## Output variables. ## -## ----------------- ##" - echo - for ac_var in $ac_subst_vars - do - eval ac_val=\$$ac_var - case $ac_val in - *\'\''*) ac_val=`$as_echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;; - esac - $as_echo "$ac_var='\''$ac_val'\''" - done | sort - echo - - if test -n "$ac_subst_files"; then - $as_echo "## ------------------- ## -## File substitutions. ## -## ------------------- ##" - echo - for ac_var in $ac_subst_files - do - eval ac_val=\$$ac_var - case $ac_val in - *\'\''*) ac_val=`$as_echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;; - esac - $as_echo "$ac_var='\''$ac_val'\''" - done | sort - echo - fi - - if test -s confdefs.h; then - $as_echo "## ----------- ## -## confdefs.h. ## -## ----------- ##" - echo - cat confdefs.h - echo - fi - test "$ac_signal" != 0 && - $as_echo "$as_me: caught signal $ac_signal" - $as_echo "$as_me: exit $exit_status" - } >&5 - rm -f core *.core core.conftest.* && - rm -f -r conftest* confdefs* conf$$* $ac_clean_files && - exit $exit_status -' 0 -for ac_signal in 1 2 13 15; do - trap 'ac_signal='$ac_signal'; as_fn_exit 1' $ac_signal -done -ac_signal=0 - -# confdefs.h avoids OS command line length limits that DEFS can exceed. -rm -f -r conftest* confdefs.h - -$as_echo "/* confdefs.h */" > confdefs.h - -# Predefined preprocessor variables. - -cat >>confdefs.h <<_ACEOF -#define PACKAGE_NAME "$PACKAGE_NAME" -_ACEOF - -cat >>confdefs.h <<_ACEOF -#define PACKAGE_TARNAME "$PACKAGE_TARNAME" -_ACEOF - -cat >>confdefs.h <<_ACEOF -#define PACKAGE_VERSION "$PACKAGE_VERSION" -_ACEOF - -cat >>confdefs.h <<_ACEOF -#define PACKAGE_STRING "$PACKAGE_STRING" -_ACEOF - -cat >>confdefs.h <<_ACEOF -#define PACKAGE_BUGREPORT "$PACKAGE_BUGREPORT" -_ACEOF - -cat >>confdefs.h <<_ACEOF -#define PACKAGE_URL "$PACKAGE_URL" -_ACEOF - - -# Let the site file select an alternate cache file if it wants to. -# Prefer an explicitly selected file to automatically selected ones. -ac_site_file1=NONE -ac_site_file2=NONE -if test -n "$CONFIG_SITE"; then - # We do not want a PATH search for config.site. - case $CONFIG_SITE in #(( - -*) ac_site_file1=./$CONFIG_SITE;; - */*) ac_site_file1=$CONFIG_SITE;; - *) ac_site_file1=./$CONFIG_SITE;; - esac -elif test "x$prefix" != xNONE; then - ac_site_file1=$prefix/share/config.site - ac_site_file2=$prefix/etc/config.site -else - ac_site_file1=$ac_default_prefix/share/config.site - ac_site_file2=$ac_default_prefix/etc/config.site -fi -for ac_site_file in "$ac_site_file1" "$ac_site_file2" -do - test "x$ac_site_file" = xNONE && continue - if test /dev/null != "$ac_site_file" && test -r "$ac_site_file"; then - { $as_echo "$as_me:${as_lineno-$LINENO}: loading site script $ac_site_file" >&5 -$as_echo "$as_me: loading site script $ac_site_file" >&6;} - sed 's/^/| /' "$ac_site_file" >&5 - . "$ac_site_file" \ - || { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5 -$as_echo "$as_me: error: in \`$ac_pwd':" >&2;} -as_fn_error $? "failed to load site script $ac_site_file -See \`config.log' for more details" "$LINENO" 5; } - fi -done - -if test -r "$cache_file"; then - # Some versions of bash will fail to source /dev/null (special files - # actually), so we avoid doing that. DJGPP emulates it as a regular file. - if test /dev/null != "$cache_file" && test -f "$cache_file"; then - { $as_echo "$as_me:${as_lineno-$LINENO}: loading cache $cache_file" >&5 -$as_echo "$as_me: loading cache $cache_file" >&6;} - case $cache_file in - [\\/]* | ?:[\\/]* ) . "$cache_file";; - *) . "./$cache_file";; - esac - fi -else - { $as_echo "$as_me:${as_lineno-$LINENO}: creating cache $cache_file" >&5 -$as_echo "$as_me: creating cache $cache_file" >&6;} - >$cache_file -fi - -# Check that the precious variables saved in the cache have kept the same -# value. -ac_cache_corrupted=false -for ac_var in $ac_precious_vars; do - eval ac_old_set=\$ac_cv_env_${ac_var}_set - eval ac_new_set=\$ac_env_${ac_var}_set - eval ac_old_val=\$ac_cv_env_${ac_var}_value - eval ac_new_val=\$ac_env_${ac_var}_value - case $ac_old_set,$ac_new_set in - set,) - { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&5 -$as_echo "$as_me: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&2;} - ac_cache_corrupted=: ;; - ,set) - { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' was not set in the previous run" >&5 -$as_echo "$as_me: error: \`$ac_var' was not set in the previous run" >&2;} - ac_cache_corrupted=: ;; - ,);; - *) - if test "x$ac_old_val" != "x$ac_new_val"; then - # differences in whitespace do not lead to failure. - ac_old_val_w=`echo x $ac_old_val` - ac_new_val_w=`echo x $ac_new_val` - if test "$ac_old_val_w" != "$ac_new_val_w"; then - { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' has changed since the previous run:" >&5 -$as_echo "$as_me: error: \`$ac_var' has changed since the previous run:" >&2;} - ac_cache_corrupted=: - else - { $as_echo "$as_me:${as_lineno-$LINENO}: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&5 -$as_echo "$as_me: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&2;} - eval $ac_var=\$ac_old_val - fi - { $as_echo "$as_me:${as_lineno-$LINENO}: former value: \`$ac_old_val'" >&5 -$as_echo "$as_me: former value: \`$ac_old_val'" >&2;} - { $as_echo "$as_me:${as_lineno-$LINENO}: current value: \`$ac_new_val'" >&5 -$as_echo "$as_me: current value: \`$ac_new_val'" >&2;} - fi;; - esac - # Pass precious variables to config.status. - if test "$ac_new_set" = set; then - case $ac_new_val in - *\'*) ac_arg=$ac_var=`$as_echo "$ac_new_val" | sed "s/'/'\\\\\\\\''/g"` ;; - *) ac_arg=$ac_var=$ac_new_val ;; - esac - case " $ac_configure_args " in - *" '$ac_arg' "*) ;; # Avoid dups. Use of quotes ensures accuracy. - *) as_fn_append ac_configure_args " '$ac_arg'" ;; - esac - fi -done -if $ac_cache_corrupted; then - { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5 -$as_echo "$as_me: error: in \`$ac_pwd':" >&2;} - { $as_echo "$as_me:${as_lineno-$LINENO}: error: changes in the environment can compromise the build" >&5 -$as_echo "$as_me: error: changes in the environment can compromise the build" >&2;} - as_fn_error $? "run \`make distclean' and/or \`rm $cache_file' and start over" "$LINENO" 5 -fi -## -------------------- ## -## Main body of script. ## -## -------------------- ## - -ac_ext=c -ac_cpp='$CPP $CPPFLAGS' -ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5' -ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' -ac_compiler_gnu=$ac_cv_c_compiler_gnu - - - - -ac_aux_dir= -for ac_dir in "$srcdir" "$srcdir/.." "$srcdir/../.."; do - if test -f "$ac_dir/install-sh"; then - ac_aux_dir=$ac_dir - ac_install_sh="$ac_aux_dir/install-sh -c" - break - elif test -f "$ac_dir/install.sh"; then - ac_aux_dir=$ac_dir - ac_install_sh="$ac_aux_dir/install.sh -c" - break - elif test -f "$ac_dir/shtool"; then - ac_aux_dir=$ac_dir - ac_install_sh="$ac_aux_dir/shtool install -c" - break - fi -done -if test -z "$ac_aux_dir"; then - as_fn_error $? "cannot find install-sh, install.sh, or shtool in \"$srcdir\" \"$srcdir/..\" \"$srcdir/../..\"" "$LINENO" 5 -fi - -# These three variables are undocumented and unsupported, -# and are intended to be withdrawn in a future Autoconf release. -# They can cause serious problems if a builder's source tree is in a directory -# whose full name contains unusual characters. -ac_config_guess="$SHELL $ac_aux_dir/config.guess" # Please don't use this var. -ac_config_sub="$SHELL $ac_aux_dir/config.sub" # Please don't use this var. -ac_configure="$SHELL $ac_aux_dir/configure" # Please don't use this var. - - -# Make sure we can run config.sub. -$SHELL "$ac_aux_dir/config.sub" sun4 >/dev/null 2>&1 || - as_fn_error $? "cannot run $SHELL $ac_aux_dir/config.sub" "$LINENO" 5 - -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking build system type" >&5 -$as_echo_n "checking build system type... " >&6; } -if ${ac_cv_build+:} false; then : - $as_echo_n "(cached) " >&6 -else - ac_build_alias=$build_alias -test "x$ac_build_alias" = x && - ac_build_alias=`$SHELL "$ac_aux_dir/config.guess"` -test "x$ac_build_alias" = x && - as_fn_error $? "cannot guess build type; you must specify one" "$LINENO" 5 -ac_cv_build=`$SHELL "$ac_aux_dir/config.sub" $ac_build_alias` || - as_fn_error $? "$SHELL $ac_aux_dir/config.sub $ac_build_alias failed" "$LINENO" 5 - -fi -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_build" >&5 -$as_echo "$ac_cv_build" >&6; } -case $ac_cv_build in -*-*-*) ;; -*) as_fn_error $? "invalid value of canonical build" "$LINENO" 5;; -esac -build=$ac_cv_build -ac_save_IFS=$IFS; IFS='-' -set x $ac_cv_build -shift -build_cpu=$1 -build_vendor=$2 -shift; shift -# Remember, the first character of IFS is used to create $*, -# except with old shells: -build_os=$* -IFS=$ac_save_IFS -case $build_os in *\ *) build_os=`echo "$build_os" | sed 's/ /-/g'`;; esac - - -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking host system type" >&5 -$as_echo_n "checking host system type... " >&6; } -if ${ac_cv_host+:} false; then : - $as_echo_n "(cached) " >&6 -else - if test "x$host_alias" = x; then - ac_cv_host=$ac_cv_build -else - ac_cv_host=`$SHELL "$ac_aux_dir/config.sub" $host_alias` || - as_fn_error $? "$SHELL $ac_aux_dir/config.sub $host_alias failed" "$LINENO" 5 -fi - -fi -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_host" >&5 -$as_echo "$ac_cv_host" >&6; } -case $ac_cv_host in -*-*-*) ;; -*) as_fn_error $? "invalid value of canonical host" "$LINENO" 5;; -esac -host=$ac_cv_host -ac_save_IFS=$IFS; IFS='-' -set x $ac_cv_host -shift -host_cpu=$1 -host_vendor=$2 -shift; shift -# Remember, the first character of IFS is used to create $*, -# except with old shells: -host_os=$* -IFS=$ac_save_IFS -case $host_os in *\ *) host_os=`echo "$host_os" | sed 's/ /-/g'`;; esac - - -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking target system type" >&5 -$as_echo_n "checking target system type... " >&6; } -if ${ac_cv_target+:} false; then : - $as_echo_n "(cached) " >&6 -else - if test "x$target_alias" = x; then - ac_cv_target=$ac_cv_host -else - ac_cv_target=`$SHELL "$ac_aux_dir/config.sub" $target_alias` || - as_fn_error $? "$SHELL $ac_aux_dir/config.sub $target_alias failed" "$LINENO" 5 -fi - -fi -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_target" >&5 -$as_echo "$ac_cv_target" >&6; } -case $ac_cv_target in -*-*-*) ;; -*) as_fn_error $? "invalid value of canonical target" "$LINENO" 5;; -esac -target=$ac_cv_target -ac_save_IFS=$IFS; IFS='-' -set x $ac_cv_target -shift -target_cpu=$1 -target_vendor=$2 -shift; shift -# Remember, the first character of IFS is used to create $*, -# except with old shells: -target_os=$* -IFS=$ac_save_IFS -case $target_os in *\ *) target_os=`echo "$target_os" | sed 's/ /-/g'`;; esac - - -# The aliases save the names the user supplied, while $host etc. -# will get canonicalized. -test -n "$target_alias" && - test "$program_prefix$program_suffix$program_transform_name" = \ - NONENONEs,x,x, && - program_prefix=${target_alias}- - -am__api_version='1.15' - -# Find a good install program. We prefer a C program (faster), -# so one script is as good as another. But avoid the broken or -# incompatible versions: -# SysV /etc/install, /usr/sbin/install -# SunOS /usr/etc/install -# IRIX /sbin/install -# AIX /bin/install -# AmigaOS /C/install, which installs bootblocks on floppy discs -# AIX 4 /usr/bin/installbsd, which doesn't work without a -g flag -# AFS /usr/afsws/bin/install, which mishandles nonexistent args -# SVR4 /usr/ucb/install, which tries to use the nonexistent group "staff" -# OS/2's system install, which has a completely different semantic -# ./install, which can be erroneously created by make from ./install.sh. -# Reject install programs that cannot install multiple files. -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for a BSD-compatible install" >&5 -$as_echo_n "checking for a BSD-compatible install... " >&6; } -if test -z "$INSTALL"; then -if ${ac_cv_path_install+:} false; then : - $as_echo_n "(cached) " >&6 -else - as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -for as_dir in $PATH -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - # Account for people who put trailing slashes in PATH elements. -case $as_dir/ in #(( - ./ | .// | /[cC]/* | \ - /etc/* | /usr/sbin/* | /usr/etc/* | /sbin/* | /usr/afsws/bin/* | \ - ?:[\\/]os2[\\/]install[\\/]* | ?:[\\/]OS2[\\/]INSTALL[\\/]* | \ - /usr/ucb/* ) ;; - *) - # OSF1 and SCO ODT 3.0 have their own names for install. - # Don't use installbsd from OSF since it installs stuff as root - # by default. - for ac_prog in ginstall scoinst install; do - for ac_exec_ext in '' $ac_executable_extensions; do - if as_fn_executable_p "$as_dir/$ac_prog$ac_exec_ext"; then - if test $ac_prog = install && - grep dspmsg "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then - # AIX install. It has an incompatible calling convention. - : - elif test $ac_prog = install && - grep pwplus "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then - # program-specific install script used by HP pwplus--don't use. - : - else - rm -rf conftest.one conftest.two conftest.dir - echo one > conftest.one - echo two > conftest.two - mkdir conftest.dir - if "$as_dir/$ac_prog$ac_exec_ext" -c conftest.one conftest.two "`pwd`/conftest.dir" && - test -s conftest.one && test -s conftest.two && - test -s conftest.dir/conftest.one && - test -s conftest.dir/conftest.two - then - ac_cv_path_install="$as_dir/$ac_prog$ac_exec_ext -c" - break 3 - fi - fi - fi - done - done - ;; -esac - - done -IFS=$as_save_IFS - -rm -rf conftest.one conftest.two conftest.dir - -fi - if test "${ac_cv_path_install+set}" = set; then - INSTALL=$ac_cv_path_install - else - # As a last resort, use the slow shell script. Don't cache a - # value for INSTALL within a source directory, because that will - # break other packages using the cache if that directory is - # removed, or if the value is a relative name. - INSTALL=$ac_install_sh - fi -fi -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $INSTALL" >&5 -$as_echo "$INSTALL" >&6; } - -# Use test -z because SunOS4 sh mishandles braces in ${var-val}. -# It thinks the first close brace ends the variable substitution. -test -z "$INSTALL_PROGRAM" && INSTALL_PROGRAM='${INSTALL}' - -test -z "$INSTALL_SCRIPT" && INSTALL_SCRIPT='${INSTALL}' - -test -z "$INSTALL_DATA" && INSTALL_DATA='${INSTALL} -m 644' - -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether build environment is sane" >&5 -$as_echo_n "checking whether build environment is sane... " >&6; } -# Reject unsafe characters in $srcdir or the absolute working directory -# name. Accept space and tab only in the latter. -am_lf=' -' -case `pwd` in - *[\\\"\#\$\&\'\`$am_lf]*) - as_fn_error $? "unsafe absolute working directory name" "$LINENO" 5;; -esac -case $srcdir in - *[\\\"\#\$\&\'\`$am_lf\ \ ]*) - as_fn_error $? "unsafe srcdir value: '$srcdir'" "$LINENO" 5;; -esac - -# Do 'set' in a subshell so we don't clobber the current shell's -# arguments. Must try -L first in case configure is actually a -# symlink; some systems play weird games with the mod time of symlinks -# (eg FreeBSD returns the mod time of the symlink's containing -# directory). -if ( - am_has_slept=no - for am_try in 1 2; do - echo "timestamp, slept: $am_has_slept" > conftest.file - set X `ls -Lt "$srcdir/configure" conftest.file 2> /dev/null` - if test "$*" = "X"; then - # -L didn't work. - set X `ls -t "$srcdir/configure" conftest.file` - fi - if test "$*" != "X $srcdir/configure conftest.file" \ - && test "$*" != "X conftest.file $srcdir/configure"; then - - # If neither matched, then we have a broken ls. This can happen - # if, for instance, CONFIG_SHELL is bash and it inherits a - # broken ls alias from the environment. This has actually - # happened. Such a system could not be considered "sane". - as_fn_error $? "ls -t appears to fail. Make sure there is not a broken - alias in your environment" "$LINENO" 5 - fi - if test "$2" = conftest.file || test $am_try -eq 2; then - break - fi - # Just in case. - sleep 1 - am_has_slept=yes - done - test "$2" = conftest.file - ) -then - # Ok. - : -else - as_fn_error $? "newly created file is older than distributed files! -Check your system clock" "$LINENO" 5 -fi -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5 -$as_echo "yes" >&6; } -# If we didn't sleep, we still need to ensure time stamps of config.status and -# generated files are strictly newer. -am_sleep_pid= -if grep 'slept: no' conftest.file >/dev/null 2>&1; then - ( sleep 1 ) & - am_sleep_pid=$! -fi - -rm -f conftest.file - -test "$program_prefix" != NONE && - program_transform_name="s&^&$program_prefix&;$program_transform_name" -# Use a double $ so make ignores it. -test "$program_suffix" != NONE && - program_transform_name="s&\$&$program_suffix&;$program_transform_name" -# Double any \ or $. -# By default was `s,x,x', remove it if useless. -ac_script='s/[\\$]/&&/g;s/;s,x,x,$//' -program_transform_name=`$as_echo "$program_transform_name" | sed "$ac_script"` - -# Expand $ac_aux_dir to an absolute path. -am_aux_dir=`cd "$ac_aux_dir" && pwd` - -if test x"${MISSING+set}" != xset; then - case $am_aux_dir in - *\ * | *\ *) - MISSING="\${SHELL} \"$am_aux_dir/missing\"" ;; - *) - MISSING="\${SHELL} $am_aux_dir/missing" ;; - esac -fi -# Use eval to expand $SHELL -if eval "$MISSING --is-lightweight"; then - am_missing_run="$MISSING " -else - am_missing_run= - { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: 'missing' script is too old or missing" >&5 -$as_echo "$as_me: WARNING: 'missing' script is too old or missing" >&2;} -fi - -if test x"${install_sh+set}" != xset; then - case $am_aux_dir in - *\ * | *\ *) - install_sh="\${SHELL} '$am_aux_dir/install-sh'" ;; - *) - install_sh="\${SHELL} $am_aux_dir/install-sh" - esac -fi - -# Installed binaries are usually stripped using 'strip' when the user -# run "make install-strip". However 'strip' might not be the right -# tool to use in cross-compilation environments, therefore Automake -# will honor the 'STRIP' environment variable to overrule this program. -if test "$cross_compiling" != no; then - if test -n "$ac_tool_prefix"; then - # Extract the first word of "${ac_tool_prefix}strip", so it can be a program name with args. -set dummy ${ac_tool_prefix}strip; ac_word=$2 -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5 -$as_echo_n "checking for $ac_word... " >&6; } -if ${ac_cv_prog_STRIP+:} false; then : - $as_echo_n "(cached) " >&6 -else - if test -n "$STRIP"; then - ac_cv_prog_STRIP="$STRIP" # Let the user override the test. -else -as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -for as_dir in $PATH -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - for ac_exec_ext in '' $ac_executable_extensions; do - if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then - ac_cv_prog_STRIP="${ac_tool_prefix}strip" - $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5 - break 2 - fi -done - done -IFS=$as_save_IFS - -fi -fi -STRIP=$ac_cv_prog_STRIP -if test -n "$STRIP"; then - { $as_echo "$as_me:${as_lineno-$LINENO}: result: $STRIP" >&5 -$as_echo "$STRIP" >&6; } -else - { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5 -$as_echo "no" >&6; } -fi - - -fi -if test -z "$ac_cv_prog_STRIP"; then - ac_ct_STRIP=$STRIP - # Extract the first word of "strip", so it can be a program name with args. -set dummy strip; ac_word=$2 -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5 -$as_echo_n "checking for $ac_word... " >&6; } -if ${ac_cv_prog_ac_ct_STRIP+:} false; then : - $as_echo_n "(cached) " >&6 -else - if test -n "$ac_ct_STRIP"; then - ac_cv_prog_ac_ct_STRIP="$ac_ct_STRIP" # Let the user override the test. -else -as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -for as_dir in $PATH -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - for ac_exec_ext in '' $ac_executable_extensions; do - if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then - ac_cv_prog_ac_ct_STRIP="strip" - $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5 - break 2 - fi -done - done -IFS=$as_save_IFS - -fi -fi -ac_ct_STRIP=$ac_cv_prog_ac_ct_STRIP -if test -n "$ac_ct_STRIP"; then - { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_STRIP" >&5 -$as_echo "$ac_ct_STRIP" >&6; } -else - { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5 -$as_echo "no" >&6; } -fi - - if test "x$ac_ct_STRIP" = x; then - STRIP=":" - else - case $cross_compiling:$ac_tool_warned in -yes:) -{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5 -$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;} -ac_tool_warned=yes ;; -esac - STRIP=$ac_ct_STRIP - fi -else - STRIP="$ac_cv_prog_STRIP" -fi - -fi -INSTALL_STRIP_PROGRAM="\$(install_sh) -c -s" - -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for a thread-safe mkdir -p" >&5 -$as_echo_n "checking for a thread-safe mkdir -p... " >&6; } -if test -z "$MKDIR_P"; then - if ${ac_cv_path_mkdir+:} false; then : - $as_echo_n "(cached) " >&6 -else - as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -for as_dir in $PATH$PATH_SEPARATOR/opt/sfw/bin -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - for ac_prog in mkdir gmkdir; do - for ac_exec_ext in '' $ac_executable_extensions; do - as_fn_executable_p "$as_dir/$ac_prog$ac_exec_ext" || continue - case `"$as_dir/$ac_prog$ac_exec_ext" --version 2>&1` in #( - 'mkdir (GNU coreutils) '* | \ - 'mkdir (coreutils) '* | \ - 'mkdir (fileutils) '4.1*) - ac_cv_path_mkdir=$as_dir/$ac_prog$ac_exec_ext - break 3;; - esac - done - done - done -IFS=$as_save_IFS - -fi - - test -d ./--version && rmdir ./--version - if test "${ac_cv_path_mkdir+set}" = set; then - MKDIR_P="$ac_cv_path_mkdir -p" - else - # As a last resort, use the slow shell script. Don't cache a - # value for MKDIR_P within a source directory, because that will - # break other packages using the cache if that directory is - # removed, or if the value is a relative name. - MKDIR_P="$ac_install_sh -d" - fi -fi -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $MKDIR_P" >&5 -$as_echo "$MKDIR_P" >&6; } - -for ac_prog in gawk mawk nawk awk -do - # Extract the first word of "$ac_prog", so it can be a program name with args. -set dummy $ac_prog; ac_word=$2 -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5 -$as_echo_n "checking for $ac_word... " >&6; } -if ${ac_cv_prog_AWK+:} false; then : - $as_echo_n "(cached) " >&6 -else - if test -n "$AWK"; then - ac_cv_prog_AWK="$AWK" # Let the user override the test. -else -as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -for as_dir in $PATH -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - for ac_exec_ext in '' $ac_executable_extensions; do - if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then - ac_cv_prog_AWK="$ac_prog" - $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5 - break 2 - fi -done - done -IFS=$as_save_IFS - -fi -fi -AWK=$ac_cv_prog_AWK -if test -n "$AWK"; then - { $as_echo "$as_me:${as_lineno-$LINENO}: result: $AWK" >&5 -$as_echo "$AWK" >&6; } -else - { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5 -$as_echo "no" >&6; } -fi - - - test -n "$AWK" && break -done - -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether ${MAKE-make} sets \$(MAKE)" >&5 -$as_echo_n "checking whether ${MAKE-make} sets \$(MAKE)... " >&6; } -set x ${MAKE-make} -ac_make=`$as_echo "$2" | sed 's/+/p/g; s/[^a-zA-Z0-9_]/_/g'` -if eval \${ac_cv_prog_make_${ac_make}_set+:} false; then : - $as_echo_n "(cached) " >&6 -else - cat >conftest.make <<\_ACEOF -SHELL = /bin/sh -all: - @echo '@@@%%%=$(MAKE)=@@@%%%' -_ACEOF -# GNU make sometimes prints "make[1]: Entering ...", which would confuse us. -case `${MAKE-make} -f conftest.make 2>/dev/null` in - *@@@%%%=?*=@@@%%%*) - eval ac_cv_prog_make_${ac_make}_set=yes;; - *) - eval ac_cv_prog_make_${ac_make}_set=no;; -esac -rm -f conftest.make -fi -if eval test \$ac_cv_prog_make_${ac_make}_set = yes; then - { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5 -$as_echo "yes" >&6; } - SET_MAKE= -else - { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5 -$as_echo "no" >&6; } - SET_MAKE="MAKE=${MAKE-make}" -fi - -rm -rf .tst 2>/dev/null -mkdir .tst 2>/dev/null -if test -d .tst; then - am__leading_dot=. -else - am__leading_dot=_ -fi -rmdir .tst 2>/dev/null - -# Check whether --enable-silent-rules was given. -if test "${enable_silent_rules+set}" = set; then : - enableval=$enable_silent_rules; -fi - -case $enable_silent_rules in # ((( - yes) AM_DEFAULT_VERBOSITY=0;; - no) AM_DEFAULT_VERBOSITY=1;; - *) AM_DEFAULT_VERBOSITY=1;; -esac -am_make=${MAKE-make} -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $am_make supports nested variables" >&5 -$as_echo_n "checking whether $am_make supports nested variables... " >&6; } -if ${am_cv_make_support_nested_variables+:} false; then : - $as_echo_n "(cached) " >&6 -else - if $as_echo 'TRUE=$(BAR$(V)) -BAR0=false -BAR1=true -V=1 -am__doit: - @$(TRUE) -.PHONY: am__doit' | $am_make -f - >/dev/null 2>&1; then - am_cv_make_support_nested_variables=yes -else - am_cv_make_support_nested_variables=no -fi -fi -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_make_support_nested_variables" >&5 -$as_echo "$am_cv_make_support_nested_variables" >&6; } -if test $am_cv_make_support_nested_variables = yes; then - AM_V='$(V)' - AM_DEFAULT_V='$(AM_DEFAULT_VERBOSITY)' -else - AM_V=$AM_DEFAULT_VERBOSITY - AM_DEFAULT_V=$AM_DEFAULT_VERBOSITY -fi -AM_BACKSLASH='\' - -if test "`cd $srcdir && pwd`" != "`pwd`"; then - # Use -I$(srcdir) only when $(srcdir) != ., so that make's output - # is not polluted with repeated "-I." - am__isrc=' -I$(srcdir)' - # test to see if srcdir already configured - if test -f $srcdir/config.status; then - as_fn_error $? "source directory already configured; run \"make distclean\" there first" "$LINENO" 5 - fi -fi - -# test whether we have cygpath -if test -z "$CYGPATH_W"; then - if (cygpath --version) >/dev/null 2>/dev/null; then - CYGPATH_W='cygpath -w' - else - CYGPATH_W=echo - fi -fi - - -# Define the identity of the package. - PACKAGE='rock' - VERSION='1.9.5' - - -cat >>confdefs.h <<_ACEOF -#define PACKAGE "$PACKAGE" -_ACEOF - - -cat >>confdefs.h <<_ACEOF -#define VERSION "$VERSION" -_ACEOF - -# Some tools Automake needs. - -ACLOCAL=${ACLOCAL-"${am_missing_run}aclocal-${am__api_version}"} - - -AUTOCONF=${AUTOCONF-"${am_missing_run}autoconf"} - - -AUTOMAKE=${AUTOMAKE-"${am_missing_run}automake-${am__api_version}"} - - -AUTOHEADER=${AUTOHEADER-"${am_missing_run}autoheader"} - - -MAKEINFO=${MAKEINFO-"${am_missing_run}makeinfo"} - -# For better backward compatibility. To be removed once Automake 1.9.x -# dies out for good. For more background, see: -# <http://lists.gnu.org/archive/html/automake/2012-07/msg00001.html> -# <http://lists.gnu.org/archive/html/automake/2012-07/msg00014.html> -mkdir_p='$(MKDIR_P)' - -# We need awk for the "check" target (and possibly the TAP driver). The -# system "awk" is bad on some platforms. -# Always define AMTAR for backward compatibility. Yes, it's still used -# in the wild :-( We should find a proper way to deprecate it ... -AMTAR='$${TAR-tar}' - - -# We'll loop over all known methods to create a tar archive until one works. -_am_tools='gnutar pax cpio none' - -am__tar='$${TAR-tar} chof - "$$tardir"' am__untar='$${TAR-tar} xf -' - - - - - - -# POSIX will say in a future version that running "rm -f" with no argument -# is OK; and we want to be able to make that assumption in our Makefile -# recipes. So use an aggressive probe to check that the usage we want is -# actually supported "in the wild" to an acceptable degree. -# See automake bug#10828. -# To make any issue more visible, cause the running configure to be aborted -# by default if the 'rm' program in use doesn't match our expectations; the -# user can still override this though. -if rm -f && rm -fr && rm -rf; then : OK; else - cat >&2 <<'END' -Oops! - -Your 'rm' program seems unable to run without file operands specified -on the command line, even when the '-f' option is present. This is contrary -to the behaviour of most rm programs out there, and not conforming with -the upcoming POSIX standard: <http://austingroupbugs.net/view.php?id=542> - -Please tell bug-automake@gnu.org about your system, including the value -of your $PATH and any error possibly output before this message. This -can help us improve future automake versions. - -END - if test x"$ACCEPT_INFERIOR_RM_PROGRAM" = x"yes"; then - echo 'Configuration will proceed anyway, since you have set the' >&2 - echo 'ACCEPT_INFERIOR_RM_PROGRAM variable to "yes"' >&2 - echo >&2 - else - cat >&2 <<'END' -Aborting the configuration process, to ensure you take notice of the issue. - -You can download and install GNU coreutils to get an 'rm' implementation -that behaves properly: <http://www.gnu.org/software/coreutils/>. - -If you want to complete the configuration process using your problematic -'rm' anyway, export the environment variable ACCEPT_INFERIOR_RM_PROGRAM -to "yes", and re-run configure. - -END - as_fn_error $? "Your 'rm' program is bad, sorry." "$LINENO" 5 - fi -fi - - -# Checks for programs. -ac_ext=cpp -ac_cpp='$CXXCPP $CPPFLAGS' -ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5' -ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' -ac_compiler_gnu=$ac_cv_cxx_compiler_gnu -if test -z "$CXX"; then - if test -n "$CCC"; then - CXX=$CCC - else - if test -n "$ac_tool_prefix"; then - for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC - do - # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args. -set dummy $ac_tool_prefix$ac_prog; ac_word=$2 -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5 -$as_echo_n "checking for $ac_word... " >&6; } -if ${ac_cv_prog_CXX+:} false; then : - $as_echo_n "(cached) " >&6 -else - if test -n "$CXX"; then - ac_cv_prog_CXX="$CXX" # Let the user override the test. -else -as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -for as_dir in $PATH -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - for ac_exec_ext in '' $ac_executable_extensions; do - if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then - ac_cv_prog_CXX="$ac_tool_prefix$ac_prog" - $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5 - break 2 - fi -done - done -IFS=$as_save_IFS - -fi -fi -CXX=$ac_cv_prog_CXX -if test -n "$CXX"; then - { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CXX" >&5 -$as_echo "$CXX" >&6; } -else - { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5 -$as_echo "no" >&6; } -fi - - - test -n "$CXX" && break - done -fi -if test -z "$CXX"; then - ac_ct_CXX=$CXX - for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC -do - # Extract the first word of "$ac_prog", so it can be a program name with args. -set dummy $ac_prog; ac_word=$2 -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5 -$as_echo_n "checking for $ac_word... " >&6; } -if ${ac_cv_prog_ac_ct_CXX+:} false; then : - $as_echo_n "(cached) " >&6 -else - if test -n "$ac_ct_CXX"; then - ac_cv_prog_ac_ct_CXX="$ac_ct_CXX" # Let the user override the test. -else -as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -for as_dir in $PATH -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - for ac_exec_ext in '' $ac_executable_extensions; do - if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then - ac_cv_prog_ac_ct_CXX="$ac_prog" - $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5 - break 2 - fi -done - done -IFS=$as_save_IFS - -fi -fi -ac_ct_CXX=$ac_cv_prog_ac_ct_CXX -if test -n "$ac_ct_CXX"; then - { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CXX" >&5 -$as_echo "$ac_ct_CXX" >&6; } -else - { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5 -$as_echo "no" >&6; } -fi - - - test -n "$ac_ct_CXX" && break -done - - if test "x$ac_ct_CXX" = x; then - CXX="g++" - else - case $cross_compiling:$ac_tool_warned in -yes:) -{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5 -$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;} -ac_tool_warned=yes ;; -esac - CXX=$ac_ct_CXX - fi -fi - - fi -fi -# Provide some information about the compiler. -$as_echo "$as_me:${as_lineno-$LINENO}: checking for C++ compiler version" >&5 -set X $ac_compile -ac_compiler=$2 -for ac_option in --version -v -V -qversion; do - { { ac_try="$ac_compiler $ac_option >&5" -case "(($ac_try" in - *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; - *) ac_try_echo=$ac_try;; -esac -eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\"" -$as_echo "$ac_try_echo"; } >&5 - (eval "$ac_compiler $ac_option >&5") 2>conftest.err - ac_status=$? - if test -s conftest.err; then - sed '10a\ -... rest of stderr output deleted ... - 10q' conftest.err >conftest.er1 - cat conftest.er1 >&5 - fi - rm -f conftest.er1 conftest.err - $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5 - test $ac_status = 0; } -done - -cat confdefs.h - <<_ACEOF >conftest.$ac_ext -/* end confdefs.h. */ - -int -main () -{ - - ; - return 0; -} -_ACEOF -ac_clean_files_save=$ac_clean_files -ac_clean_files="$ac_clean_files a.out a.out.dSYM a.exe b.out" -# Try to create an executable without -o first, disregard a.out. -# It will help us diagnose broken compilers, and finding out an intuition -# of exeext. -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether the C++ compiler works" >&5 -$as_echo_n "checking whether the C++ compiler works... " >&6; } -ac_link_default=`$as_echo "$ac_link" | sed 's/ -o *conftest[^ ]*//'` - -# The possible output files: -ac_files="a.out conftest.exe conftest a.exe a_out.exe b.out conftest.*" - -ac_rmfiles= -for ac_file in $ac_files -do - case $ac_file in - *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;; - * ) ac_rmfiles="$ac_rmfiles $ac_file";; - esac -done -rm -f $ac_rmfiles - -if { { ac_try="$ac_link_default" -case "(($ac_try" in - *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; - *) ac_try_echo=$ac_try;; -esac -eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\"" -$as_echo "$ac_try_echo"; } >&5 - (eval "$ac_link_default") 2>&5 - ac_status=$? - $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5 - test $ac_status = 0; }; then : - # Autoconf-2.13 could set the ac_cv_exeext variable to `no'. -# So ignore a value of `no', otherwise this would lead to `EXEEXT = no' -# in a Makefile. We should not override ac_cv_exeext if it was cached, -# so that the user can short-circuit this test for compilers unknown to -# Autoconf. -for ac_file in $ac_files '' -do - test -f "$ac_file" || continue - case $ac_file in - *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) - ;; - [ab].out ) - # We found the default executable, but exeext='' is most - # certainly right. - break;; - *.* ) - if test "${ac_cv_exeext+set}" = set && test "$ac_cv_exeext" != no; - then :; else - ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'` - fi - # We set ac_cv_exeext here because the later test for it is not - # safe: cross compilers may not add the suffix if given an `-o' - # argument, so we may need to know it at that point already. - # Even if this section looks crufty: it has the advantage of - # actually working. - break;; - * ) - break;; - esac -done -test "$ac_cv_exeext" = no && ac_cv_exeext= - -else - ac_file='' -fi -if test -z "$ac_file"; then : - { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5 -$as_echo "no" >&6; } -$as_echo "$as_me: failed program was:" >&5 -sed 's/^/| /' conftest.$ac_ext >&5 - -{ { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5 -$as_echo "$as_me: error: in \`$ac_pwd':" >&2;} -as_fn_error 77 "C++ compiler cannot create executables -See \`config.log' for more details" "$LINENO" 5; } -else - { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5 -$as_echo "yes" >&6; } -fi -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for C++ compiler default output file name" >&5 -$as_echo_n "checking for C++ compiler default output file name... " >&6; } -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_file" >&5 -$as_echo "$ac_file" >&6; } -ac_exeext=$ac_cv_exeext - -rm -f -r a.out a.out.dSYM a.exe conftest$ac_cv_exeext b.out -ac_clean_files=$ac_clean_files_save -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for suffix of executables" >&5 -$as_echo_n "checking for suffix of executables... " >&6; } -if { { ac_try="$ac_link" -case "(($ac_try" in - *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; - *) ac_try_echo=$ac_try;; -esac -eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\"" -$as_echo "$ac_try_echo"; } >&5 - (eval "$ac_link") 2>&5 - ac_status=$? - $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5 - test $ac_status = 0; }; then : - # If both `conftest.exe' and `conftest' are `present' (well, observable) -# catch `conftest.exe'. For instance with Cygwin, `ls conftest' will -# work properly (i.e., refer to `conftest.exe'), while it won't with -# `rm'. -for ac_file in conftest.exe conftest conftest.*; do - test -f "$ac_file" || continue - case $ac_file in - *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;; - *.* ) ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'` - break;; - * ) break;; - esac -done -else - { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5 -$as_echo "$as_me: error: in \`$ac_pwd':" >&2;} -as_fn_error $? "cannot compute suffix of executables: cannot compile and link -See \`config.log' for more details" "$LINENO" 5; } -fi -rm -f conftest conftest$ac_cv_exeext -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_exeext" >&5 -$as_echo "$ac_cv_exeext" >&6; } - -rm -f conftest.$ac_ext -EXEEXT=$ac_cv_exeext -ac_exeext=$EXEEXT -cat confdefs.h - <<_ACEOF >conftest.$ac_ext -/* end confdefs.h. */ -#include <stdio.h> -int -main () -{ -FILE *f = fopen ("conftest.out", "w"); - return ferror (f) || fclose (f) != 0; - - ; - return 0; -} -_ACEOF -ac_clean_files="$ac_clean_files conftest.out" -# Check that the compiler produces executables we can run. If not, either -# the compiler is broken, or we cross compile. -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether we are cross compiling" >&5 -$as_echo_n "checking whether we are cross compiling... " >&6; } -if test "$cross_compiling" != yes; then - { { ac_try="$ac_link" -case "(($ac_try" in - *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; - *) ac_try_echo=$ac_try;; -esac -eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\"" -$as_echo "$ac_try_echo"; } >&5 - (eval "$ac_link") 2>&5 - ac_status=$? - $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5 - test $ac_status = 0; } - if { ac_try='./conftest$ac_cv_exeext' - { { case "(($ac_try" in - *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; - *) ac_try_echo=$ac_try;; -esac -eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\"" -$as_echo "$ac_try_echo"; } >&5 - (eval "$ac_try") 2>&5 - ac_status=$? - $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5 - test $ac_status = 0; }; }; then - cross_compiling=no - else - if test "$cross_compiling" = maybe; then - cross_compiling=yes - else - { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5 -$as_echo "$as_me: error: in \`$ac_pwd':" >&2;} -as_fn_error $? "cannot run C++ compiled programs. -If you meant to cross compile, use \`--host'. -See \`config.log' for more details" "$LINENO" 5; } - fi - fi -fi -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $cross_compiling" >&5 -$as_echo "$cross_compiling" >&6; } - -rm -f conftest.$ac_ext conftest$ac_cv_exeext conftest.out -ac_clean_files=$ac_clean_files_save -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for suffix of object files" >&5 -$as_echo_n "checking for suffix of object files... " >&6; } -if ${ac_cv_objext+:} false; then : - $as_echo_n "(cached) " >&6 -else - cat confdefs.h - <<_ACEOF >conftest.$ac_ext -/* end confdefs.h. */ - -int -main () -{ - - ; - return 0; -} -_ACEOF -rm -f conftest.o conftest.obj -if { { ac_try="$ac_compile" -case "(($ac_try" in - *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; - *) ac_try_echo=$ac_try;; -esac -eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\"" -$as_echo "$ac_try_echo"; } >&5 - (eval "$ac_compile") 2>&5 - ac_status=$? - $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5 - test $ac_status = 0; }; then : - for ac_file in conftest.o conftest.obj conftest.*; do - test -f "$ac_file" || continue; - case $ac_file in - *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM ) ;; - *) ac_cv_objext=`expr "$ac_file" : '.*\.\(.*\)'` - break;; - esac -done -else - $as_echo "$as_me: failed program was:" >&5 -sed 's/^/| /' conftest.$ac_ext >&5 - -{ { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5 -$as_echo "$as_me: error: in \`$ac_pwd':" >&2;} -as_fn_error $? "cannot compute suffix of object files: cannot compile -See \`config.log' for more details" "$LINENO" 5; } -fi -rm -f conftest.$ac_cv_objext conftest.$ac_ext -fi -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_objext" >&5 -$as_echo "$ac_cv_objext" >&6; } -OBJEXT=$ac_cv_objext -ac_objext=$OBJEXT -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether we are using the GNU C++ compiler" >&5 -$as_echo_n "checking whether we are using the GNU C++ compiler... " >&6; } -if ${ac_cv_cxx_compiler_gnu+:} false; then : - $as_echo_n "(cached) " >&6 -else - cat confdefs.h - <<_ACEOF >conftest.$ac_ext -/* end confdefs.h. */ - -int -main () -{ -#ifndef __GNUC__ - choke me -#endif - - ; - return 0; -} -_ACEOF -if ac_fn_cxx_try_compile "$LINENO"; then : - ac_compiler_gnu=yes -else - ac_compiler_gnu=no -fi -rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext -ac_cv_cxx_compiler_gnu=$ac_compiler_gnu - -fi -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_cxx_compiler_gnu" >&5 -$as_echo "$ac_cv_cxx_compiler_gnu" >&6; } -if test $ac_compiler_gnu = yes; then - GXX=yes -else - GXX= -fi -ac_test_CXXFLAGS=${CXXFLAGS+set} -ac_save_CXXFLAGS=$CXXFLAGS -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CXX accepts -g" >&5 -$as_echo_n "checking whether $CXX accepts -g... " >&6; } -if ${ac_cv_prog_cxx_g+:} false; then : - $as_echo_n "(cached) " >&6 -else - ac_save_cxx_werror_flag=$ac_cxx_werror_flag - ac_cxx_werror_flag=yes - ac_cv_prog_cxx_g=no - CXXFLAGS="-g" - cat confdefs.h - <<_ACEOF >conftest.$ac_ext -/* end confdefs.h. */ - -int -main () -{ - - ; - return 0; -} -_ACEOF -if ac_fn_cxx_try_compile "$LINENO"; then : - ac_cv_prog_cxx_g=yes -else - CXXFLAGS="" - cat confdefs.h - <<_ACEOF >conftest.$ac_ext -/* end confdefs.h. */ - -int -main () -{ - - ; - return 0; -} -_ACEOF -if ac_fn_cxx_try_compile "$LINENO"; then : - -else - ac_cxx_werror_flag=$ac_save_cxx_werror_flag - CXXFLAGS="-g" - cat confdefs.h - <<_ACEOF >conftest.$ac_ext -/* end confdefs.h. */ - -int -main () -{ - - ; - return 0; -} -_ACEOF -if ac_fn_cxx_try_compile "$LINENO"; then : - ac_cv_prog_cxx_g=yes -fi -rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext -fi -rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext -fi -rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext - ac_cxx_werror_flag=$ac_save_cxx_werror_flag -fi -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cxx_g" >&5 -$as_echo "$ac_cv_prog_cxx_g" >&6; } -if test "$ac_test_CXXFLAGS" = set; then - CXXFLAGS=$ac_save_CXXFLAGS -elif test $ac_cv_prog_cxx_g = yes; then - if test "$GXX" = yes; then - CXXFLAGS="-g -O2" - else - CXXFLAGS="-g" - fi -else - if test "$GXX" = yes; then - CXXFLAGS="-O2" - else - CXXFLAGS= - fi -fi -ac_ext=c -ac_cpp='$CPP $CPPFLAGS' -ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5' -ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' -ac_compiler_gnu=$ac_cv_c_compiler_gnu -DEPDIR="${am__leading_dot}deps" - -ac_config_commands="$ac_config_commands depfiles" - - -am_make=${MAKE-make} -cat > confinc << 'END' -am__doit: - @echo this is the am__doit target -.PHONY: am__doit -END -# If we don't find an include directive, just comment out the code. -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for style of include used by $am_make" >&5 -$as_echo_n "checking for style of include used by $am_make... " >&6; } -am__include="#" -am__quote= -_am_result=none -# First try GNU make style include. -echo "include confinc" > confmf -# Ignore all kinds of additional output from 'make'. -case `$am_make -s -f confmf 2> /dev/null` in #( -*the\ am__doit\ target*) - am__include=include - am__quote= - _am_result=GNU - ;; -esac -# Now try BSD make style include. -if test "$am__include" = "#"; then - echo '.include "confinc"' > confmf - case `$am_make -s -f confmf 2> /dev/null` in #( - *the\ am__doit\ target*) - am__include=.include - am__quote="\"" - _am_result=BSD - ;; - esac -fi - - -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $_am_result" >&5 -$as_echo "$_am_result" >&6; } -rm -f confinc confmf - -# Check whether --enable-dependency-tracking was given. -if test "${enable_dependency_tracking+set}" = set; then : - enableval=$enable_dependency_tracking; -fi - -if test "x$enable_dependency_tracking" != xno; then - am_depcomp="$ac_aux_dir/depcomp" - AMDEPBACKSLASH='\' - am__nodep='_no' -fi - if test "x$enable_dependency_tracking" != xno; then - AMDEP_TRUE= - AMDEP_FALSE='#' -else - AMDEP_TRUE='#' - AMDEP_FALSE= -fi - - - -depcc="$CXX" am_compiler_list= - -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking dependency style of $depcc" >&5 -$as_echo_n "checking dependency style of $depcc... " >&6; } -if ${am_cv_CXX_dependencies_compiler_type+:} false; then : - $as_echo_n "(cached) " >&6 -else - if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then - # We make a subdir and do the tests there. Otherwise we can end up - # making bogus files that we don't know about and never remove. For - # instance it was reported that on HP-UX the gcc test will end up - # making a dummy file named 'D' -- because '-MD' means "put the output - # in D". - rm -rf conftest.dir - mkdir conftest.dir - # Copy depcomp to subdir because otherwise we won't find it if we're - # using a relative directory. - cp "$am_depcomp" conftest.dir - cd conftest.dir - # We will build objects and dependencies in a subdirectory because - # it helps to detect inapplicable dependency modes. For instance - # both Tru64's cc and ICC support -MD to output dependencies as a - # side effect of compilation, but ICC will put the dependencies in - # the current directory while Tru64 will put them in the object - # directory. - mkdir sub - - am_cv_CXX_dependencies_compiler_type=none - if test "$am_compiler_list" = ""; then - am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp` - fi - am__universal=false - case " $depcc " in #( - *\ -arch\ *\ -arch\ *) am__universal=true ;; - esac - - for depmode in $am_compiler_list; do - # Setup a source with many dependencies, because some compilers - # like to wrap large dependency lists on column 80 (with \), and - # we should not choose a depcomp mode which is confused by this. - # - # We need to recreate these files for each test, as the compiler may - # overwrite some of them when testing with obscure command lines. - # This happens at least with the AIX C compiler. - : > sub/conftest.c - for i in 1 2 3 4 5 6; do - echo '#include "conftst'$i'.h"' >> sub/conftest.c - # Using ": > sub/conftst$i.h" creates only sub/conftst1.h with - # Solaris 10 /bin/sh. - echo '/* dummy */' > sub/conftst$i.h - done - echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf - - # We check with '-c' and '-o' for the sake of the "dashmstdout" - # mode. It turns out that the SunPro C++ compiler does not properly - # handle '-M -o', and we need to detect this. Also, some Intel - # versions had trouble with output in subdirs. - am__obj=sub/conftest.${OBJEXT-o} - am__minus_obj="-o $am__obj" - case $depmode in - gcc) - # This depmode causes a compiler race in universal mode. - test "$am__universal" = false || continue - ;; - nosideeffect) - # After this tag, mechanisms are not by side-effect, so they'll - # only be used when explicitly requested. - if test "x$enable_dependency_tracking" = xyes; then - continue - else - break - fi - ;; - msvc7 | msvc7msys | msvisualcpp | msvcmsys) - # This compiler won't grok '-c -o', but also, the minuso test has - # not run yet. These depmodes are late enough in the game, and - # so weak that their functioning should not be impacted. - am__obj=conftest.${OBJEXT-o} - am__minus_obj= - ;; - none) break ;; - esac - if depmode=$depmode \ - source=sub/conftest.c object=$am__obj \ - depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \ - $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \ - >/dev/null 2>conftest.err && - grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 && - grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 && - grep $am__obj sub/conftest.Po > /dev/null 2>&1 && - ${MAKE-make} -s -f confmf > /dev/null 2>&1; then - # icc doesn't choke on unknown options, it will just issue warnings - # or remarks (even with -Werror). So we grep stderr for any message - # that says an option was ignored or not supported. - # When given -MP, icc 7.0 and 7.1 complain thusly: - # icc: Command line warning: ignoring option '-M'; no argument required - # The diagnosis changed in icc 8.0: - # icc: Command line remark: option '-MP' not supported - if (grep 'ignoring option' conftest.err || - grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else - am_cv_CXX_dependencies_compiler_type=$depmode - break - fi - fi - done - - cd .. - rm -rf conftest.dir -else - am_cv_CXX_dependencies_compiler_type=none -fi - -fi -{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_CXX_dependencies_compiler_type" >&5 -$as_echo "$am_cv_CXX_dependencies_compiler_type" >&6; } -CXXDEPMODE=depmode=$am_cv_CXX_dependencies_compiler_type - - if - test "x$enable_dependency_tracking" != xno \ - && test "$am_cv_CXX_dependencies_compiler_type" = gcc3; then - am__fastdepCXX_TRUE= - am__fastdepCXX_FALSE='#' -else - am__fastdepCXX_TRUE='#' - am__fastdepCXX_FALSE= -fi - - -if test -n "$ac_tool_prefix"; then - # Extract the first word of "${ac_tool_prefix}ranlib", so it can be a program name with args. -set dummy ${ac_tool_prefix}ranlib; ac_word=$2 -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5 -$as_echo_n "checking for $ac_word... " >&6; } -if ${ac_cv_prog_RANLIB+:} false; then : - $as_echo_n "(cached) " >&6 -else - if test -n "$RANLIB"; then - ac_cv_prog_RANLIB="$RANLIB" # Let the user override the test. -else -as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -for as_dir in $PATH -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - for ac_exec_ext in '' $ac_executable_extensions; do - if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then - ac_cv_prog_RANLIB="${ac_tool_prefix}ranlib" - $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5 - break 2 - fi -done - done -IFS=$as_save_IFS - -fi -fi -RANLIB=$ac_cv_prog_RANLIB -if test -n "$RANLIB"; then - { $as_echo "$as_me:${as_lineno-$LINENO}: result: $RANLIB" >&5 -$as_echo "$RANLIB" >&6; } -else - { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5 -$as_echo "no" >&6; } -fi - - -fi -if test -z "$ac_cv_prog_RANLIB"; then - ac_ct_RANLIB=$RANLIB - # Extract the first word of "ranlib", so it can be a program name with args. -set dummy ranlib; ac_word=$2 -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5 -$as_echo_n "checking for $ac_word... " >&6; } -if ${ac_cv_prog_ac_ct_RANLIB+:} false; then : - $as_echo_n "(cached) " >&6 -else - if test -n "$ac_ct_RANLIB"; then - ac_cv_prog_ac_ct_RANLIB="$ac_ct_RANLIB" # Let the user override the test. -else -as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -for as_dir in $PATH -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - for ac_exec_ext in '' $ac_executable_extensions; do - if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then - ac_cv_prog_ac_ct_RANLIB="ranlib" - $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5 - break 2 - fi -done - done -IFS=$as_save_IFS - -fi -fi -ac_ct_RANLIB=$ac_cv_prog_ac_ct_RANLIB -if test -n "$ac_ct_RANLIB"; then - { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_RANLIB" >&5 -$as_echo "$ac_ct_RANLIB" >&6; } -else - { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5 -$as_echo "no" >&6; } -fi - - if test "x$ac_ct_RANLIB" = x; then - RANLIB=":" - else - case $cross_compiling:$ac_tool_warned in -yes:) -{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5 -$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;} -ac_tool_warned=yes ;; -esac - RANLIB=$ac_ct_RANLIB - fi -else - RANLIB="$ac_cv_prog_RANLIB" -fi - -# Extract the first word of "pod2man", so it can be a program name with args. -set dummy pod2man; ac_word=$2 -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5 -$as_echo_n "checking for $ac_word... " >&6; } -if ${ac_cv_prog_POD2MAN+:} false; then : - $as_echo_n "(cached) " >&6 -else - if test -n "$POD2MAN"; then - ac_cv_prog_POD2MAN="$POD2MAN" # Let the user override the test. -else -as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -for as_dir in $PATH -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - for ac_exec_ext in '' $ac_executable_extensions; do - if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then - ac_cv_prog_POD2MAN="pod2man" - $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5 - break 2 - fi -done - done -IFS=$as_save_IFS - - test -z "$ac_cv_prog_POD2MAN" && ac_cv_prog_POD2MAN=":" -fi -fi -POD2MAN=$ac_cv_prog_POD2MAN -if test -n "$POD2MAN"; then - { $as_echo "$as_me:${as_lineno-$LINENO}: result: $POD2MAN" >&5 -$as_echo "$POD2MAN" >&6; } -else - { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5 -$as_echo "no" >&6; } -fi - - - - -ac_config_files="$ac_config_files Makefile src/Makefile test/Makefile doc/Makefile" - -cat >confcache <<\_ACEOF -# This file is a shell script that caches the results of configure -# tests run on this system so they can be shared between configure -# scripts and configure runs, see configure's option --config-cache. -# It is not useful on other systems. If it contains results you don't -# want to keep, you may remove or edit it. -# -# config.status only pays attention to the cache file if you give it -# the --recheck option to rerun configure. -# -# `ac_cv_env_foo' variables (set or unset) will be overridden when -# loading this file, other *unset* `ac_cv_foo' will be assigned the -# following values. - -_ACEOF - -# The following way of writing the cache mishandles newlines in values, -# but we know of no workaround that is simple, portable, and efficient. -# So, we kill variables containing newlines. -# Ultrix sh set writes to stderr and can't be redirected directly, -# and sets the high bit in the cache file unless we assign to the vars. -( - for ac_var in `(set) 2>&1 | sed -n 's/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'`; do - eval ac_val=\$$ac_var - case $ac_val in #( - *${as_nl}*) - case $ac_var in #( - *_cv_*) { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: cache variable $ac_var contains a newline" >&5 -$as_echo "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;; - esac - case $ac_var in #( - _ | IFS | as_nl) ;; #( - BASH_ARGV | BASH_SOURCE) eval $ac_var= ;; #( - *) { eval $ac_var=; unset $ac_var;} ;; - esac ;; - esac - done - - (set) 2>&1 | - case $as_nl`(ac_space=' '; set) 2>&1` in #( - *${as_nl}ac_space=\ *) - # `set' does not quote correctly, so add quotes: double-quote - # substitution turns \\\\ into \\, and sed turns \\ into \. - sed -n \ - "s/'/'\\\\''/g; - s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\\2'/p" - ;; #( - *) - # `set' quotes correctly as required by POSIX, so do not add quotes. - sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p" - ;; - esac | - sort -) | - sed ' - /^ac_cv_env_/b end - t clear - :clear - s/^\([^=]*\)=\(.*[{}].*\)$/test "${\1+set}" = set || &/ - t end - s/^\([^=]*\)=\(.*\)$/\1=${\1=\2}/ - :end' >>confcache -if diff "$cache_file" confcache >/dev/null 2>&1; then :; else - if test -w "$cache_file"; then - if test "x$cache_file" != "x/dev/null"; then - { $as_echo "$as_me:${as_lineno-$LINENO}: updating cache $cache_file" >&5 -$as_echo "$as_me: updating cache $cache_file" >&6;} - if test ! -f "$cache_file" || test -h "$cache_file"; then - cat confcache >"$cache_file" - else - case $cache_file in #( - */* | ?:*) - mv -f confcache "$cache_file"$$ && - mv -f "$cache_file"$$ "$cache_file" ;; #( - *) - mv -f confcache "$cache_file" ;; - esac - fi - fi - else - { $as_echo "$as_me:${as_lineno-$LINENO}: not updating unwritable cache $cache_file" >&5 -$as_echo "$as_me: not updating unwritable cache $cache_file" >&6;} - fi -fi -rm -f confcache - -test "x$prefix" = xNONE && prefix=$ac_default_prefix -# Let make expand exec_prefix. -test "x$exec_prefix" = xNONE && exec_prefix='${prefix}' - -# Transform confdefs.h into DEFS. -# Protect against shell expansion while executing Makefile rules. -# Protect against Makefile macro expansion. -# -# If the first sed substitution is executed (which looks for macros that -# take arguments), then branch to the quote section. Otherwise, -# look for a macro that doesn't take arguments. -ac_script=' -:mline -/\\$/{ - N - s,\\\n,, - b mline -} -t clear -:clear -s/^[ ]*#[ ]*define[ ][ ]*\([^ (][^ (]*([^)]*)\)[ ]*\(.*\)/-D\1=\2/g -t quote -s/^[ ]*#[ ]*define[ ][ ]*\([^ ][^ ]*\)[ ]*\(.*\)/-D\1=\2/g -t quote -b any -:quote -s/[ `~#$^&*(){}\\|;'\''"<>?]/\\&/g -s/\[/\\&/g -s/\]/\\&/g -s/\$/$$/g -H -:any -${ - g - s/^\n// - s/\n/ /g - p -} -' -DEFS=`sed -n "$ac_script" confdefs.h` - - -ac_libobjs= -ac_ltlibobjs= -U= -for ac_i in : $LIBOBJS; do test "x$ac_i" = x: && continue - # 1. Remove the extension, and $U if already installed. - ac_script='s/\$U\././;s/\.o$//;s/\.obj$//' - ac_i=`$as_echo "$ac_i" | sed "$ac_script"` - # 2. Prepend LIBOBJDIR. When used with automake>=1.10 LIBOBJDIR - # will be set to the directory where LIBOBJS objects are built. - as_fn_append ac_libobjs " \${LIBOBJDIR}$ac_i\$U.$ac_objext" - as_fn_append ac_ltlibobjs " \${LIBOBJDIR}$ac_i"'$U.lo' -done -LIBOBJS=$ac_libobjs - -LTLIBOBJS=$ac_ltlibobjs - - -{ $as_echo "$as_me:${as_lineno-$LINENO}: checking that generated files are newer than configure" >&5 -$as_echo_n "checking that generated files are newer than configure... " >&6; } - if test -n "$am_sleep_pid"; then - # Hide warnings about reused PIDs. - wait $am_sleep_pid 2>/dev/null - fi - { $as_echo "$as_me:${as_lineno-$LINENO}: result: done" >&5 -$as_echo "done" >&6; } - if test -n "$EXEEXT"; then - am__EXEEXT_TRUE= - am__EXEEXT_FALSE='#' -else - am__EXEEXT_TRUE='#' - am__EXEEXT_FALSE= -fi - -if test -z "${AMDEP_TRUE}" && test -z "${AMDEP_FALSE}"; then - as_fn_error $? "conditional \"AMDEP\" was never defined. -Usually this means the macro was only invoked conditionally." "$LINENO" 5 -fi -if test -z "${am__fastdepCXX_TRUE}" && test -z "${am__fastdepCXX_FALSE}"; then - as_fn_error $? "conditional \"am__fastdepCXX\" was never defined. -Usually this means the macro was only invoked conditionally." "$LINENO" 5 -fi - -: "${CONFIG_STATUS=./config.status}" -ac_write_fail=0 -ac_clean_files_save=$ac_clean_files -ac_clean_files="$ac_clean_files $CONFIG_STATUS" -{ $as_echo "$as_me:${as_lineno-$LINENO}: creating $CONFIG_STATUS" >&5 -$as_echo "$as_me: creating $CONFIG_STATUS" >&6;} -as_write_fail=0 -cat >$CONFIG_STATUS <<_ASEOF || as_write_fail=1 -#! $SHELL -# Generated by $as_me. -# Run this file to recreate the current configuration. -# Compiler output produced by configure, useful for debugging -# configure, is in config.log if it exists. - -debug=false -ac_cs_recheck=false -ac_cs_silent=false - -SHELL=\${CONFIG_SHELL-$SHELL} -export SHELL -_ASEOF -cat >>$CONFIG_STATUS <<\_ASEOF || as_write_fail=1 -## -------------------- ## -## M4sh Initialization. ## -## -------------------- ## - -# Be more Bourne compatible -DUALCASE=1; export DUALCASE # for MKS sh -if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then : - emulate sh - NULLCMD=: - # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which - # is contrary to our usage. Disable this feature. - alias -g '${1+"$@"}'='"$@"' - setopt NO_GLOB_SUBST -else - case `(set -o) 2>/dev/null` in #( - *posix*) : - set -o posix ;; #( - *) : - ;; -esac -fi - - -as_nl=' -' -export as_nl -# Printing a long string crashes Solaris 7 /usr/bin/printf. -as_echo='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\' -as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo -as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo$as_echo -# Prefer a ksh shell builtin over an external printf program on Solaris, -# but without wasting forks for bash or zsh. -if test -z "$BASH_VERSION$ZSH_VERSION" \ - && (test "X`print -r -- $as_echo`" = "X$as_echo") 2>/dev/null; then - as_echo='print -r --' - as_echo_n='print -rn --' -elif (test "X`printf %s $as_echo`" = "X$as_echo") 2>/dev/null; then - as_echo='printf %s\n' - as_echo_n='printf %s' -else - if test "X`(/usr/ucb/echo -n -n $as_echo) 2>/dev/null`" = "X-n $as_echo"; then - as_echo_body='eval /usr/ucb/echo -n "$1$as_nl"' - as_echo_n='/usr/ucb/echo -n' - else - as_echo_body='eval expr "X$1" : "X\\(.*\\)"' - as_echo_n_body='eval - arg=$1; - case $arg in #( - *"$as_nl"*) - expr "X$arg" : "X\\(.*\\)$as_nl"; - arg=`expr "X$arg" : ".*$as_nl\\(.*\\)"`;; - esac; - expr "X$arg" : "X\\(.*\\)" | tr -d "$as_nl" - ' - export as_echo_n_body - as_echo_n='sh -c $as_echo_n_body as_echo' - fi - export as_echo_body - as_echo='sh -c $as_echo_body as_echo' -fi - -# The user is always right. -if test "${PATH_SEPARATOR+set}" != set; then - PATH_SEPARATOR=: - (PATH='/bin;/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 && { - (PATH='/bin:/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 || - PATH_SEPARATOR=';' - } -fi - - -# IFS -# We need space, tab and new line, in precisely that order. Quoting is -# there to prevent editors from complaining about space-tab. -# (If _AS_PATH_WALK were called with IFS unset, it would disable word -# splitting by setting IFS to empty value.) -IFS=" "" $as_nl" - -# Find who we are. Look in the path if we contain no directory separator. -as_myself= -case $0 in #(( - *[\\/]* ) as_myself=$0 ;; - *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR -for as_dir in $PATH -do - IFS=$as_save_IFS - test -z "$as_dir" && as_dir=. - test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break - done -IFS=$as_save_IFS - - ;; -esac -# We did not find ourselves, most probably we were run as `sh COMMAND' -# in which case we are not to be found in the path. -if test "x$as_myself" = x; then - as_myself=$0 -fi -if test ! -f "$as_myself"; then - $as_echo "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2 - exit 1 -fi - -# Unset variables that we do not need and which cause bugs (e.g. in -# pre-3.0 UWIN ksh). But do not cause bugs in bash 2.01; the "|| exit 1" -# suppresses any "Segmentation fault" message there. '((' could -# trigger a bug in pdksh 5.2.14. -for as_var in BASH_ENV ENV MAIL MAILPATH -do eval test x\${$as_var+set} = xset \ - && ( (unset $as_var) || exit 1) >/dev/null 2>&1 && unset $as_var || : -done -PS1='$ ' -PS2='> ' -PS4='+ ' - -# NLS nuisances. -LC_ALL=C -export LC_ALL -LANGUAGE=C -export LANGUAGE - -# CDPATH. -(unset CDPATH) >/dev/null 2>&1 && unset CDPATH - - -# as_fn_error STATUS ERROR [LINENO LOG_FD] -# ---------------------------------------- -# Output "`basename $0`: error: ERROR" to stderr. If LINENO and LOG_FD are -# provided, also output the error to LOG_FD, referencing LINENO. Then exit the -# script with STATUS, using 1 if that was 0. -as_fn_error () -{ - as_status=$1; test $as_status -eq 0 && as_status=1 - if test "$4"; then - as_lineno=${as_lineno-"$3"} as_lineno_stack=as_lineno_stack=$as_lineno_stack - $as_echo "$as_me:${as_lineno-$LINENO}: error: $2" >&$4 - fi - $as_echo "$as_me: error: $2" >&2 - as_fn_exit $as_status -} # as_fn_error - - -# as_fn_set_status STATUS -# ----------------------- -# Set $? to STATUS, without forking. -as_fn_set_status () -{ - return $1 -} # as_fn_set_status - -# as_fn_exit STATUS -# ----------------- -# Exit the shell with STATUS, even in a "trap 0" or "set -e" context. -as_fn_exit () -{ - set +e - as_fn_set_status $1 - exit $1 -} # as_fn_exit - -# as_fn_unset VAR -# --------------- -# Portably unset VAR. -as_fn_unset () -{ - { eval $1=; unset $1;} -} -as_unset=as_fn_unset -# as_fn_append VAR VALUE -# ---------------------- -# Append the text in VALUE to the end of the definition contained in VAR. Take -# advantage of any shell optimizations that allow amortized linear growth over -# repeated appends, instead of the typical quadratic growth present in naive -# implementations. -if (eval "as_var=1; as_var+=2; test x\$as_var = x12") 2>/dev/null; then : - eval 'as_fn_append () - { - eval $1+=\$2 - }' -else - as_fn_append () - { - eval $1=\$$1\$2 - } -fi # as_fn_append - -# as_fn_arith ARG... -# ------------------ -# Perform arithmetic evaluation on the ARGs, and store the result in the -# global $as_val. Take advantage of shells that can avoid forks. The arguments -# must be portable across $(()) and expr. -if (eval "test \$(( 1 + 1 )) = 2") 2>/dev/null; then : - eval 'as_fn_arith () - { - as_val=$(( $* )) - }' -else - as_fn_arith () - { - as_val=`expr "$@" || test $? -eq 1` - } -fi # as_fn_arith - - -if expr a : '\(a\)' >/dev/null 2>&1 && - test "X`expr 00001 : '.*\(...\)'`" = X001; then - as_expr=expr -else - as_expr=false -fi - -if (basename -- /) >/dev/null 2>&1 && test "X`basename -- / 2>&1`" = "X/"; then - as_basename=basename -else - as_basename=false -fi - -if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then - as_dirname=dirname -else - as_dirname=false -fi - -as_me=`$as_basename -- "$0" || -$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \ - X"$0" : 'X\(//\)$' \| \ - X"$0" : 'X\(/\)' \| . 2>/dev/null || -$as_echo X/"$0" | - sed '/^.*\/\([^/][^/]*\)\/*$/{ - s//\1/ - q - } - /^X\/\(\/\/\)$/{ - s//\1/ - q - } - /^X\/\(\/\).*/{ - s//\1/ - q - } - s/.*/./; q'` - -# Avoid depending upon Character Ranges. -as_cr_letters='abcdefghijklmnopqrstuvwxyz' -as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ' -as_cr_Letters=$as_cr_letters$as_cr_LETTERS -as_cr_digits='0123456789' -as_cr_alnum=$as_cr_Letters$as_cr_digits - -ECHO_C= ECHO_N= ECHO_T= -case `echo -n x` in #((((( --n*) - case `echo 'xy\c'` in - *c*) ECHO_T=' ';; # ECHO_T is single tab character. - xy) ECHO_C='\c';; - *) echo `echo ksh88 bug on AIX 6.1` > /dev/null - ECHO_T=' ';; - esac;; -*) - ECHO_N='-n';; -esac - -rm -f conf$$ conf$$.exe conf$$.file -if test -d conf$$.dir; then - rm -f conf$$.dir/conf$$.file -else - rm -f conf$$.dir - mkdir conf$$.dir 2>/dev/null -fi -if (echo >conf$$.file) 2>/dev/null; then - if ln -s conf$$.file conf$$ 2>/dev/null; then - as_ln_s='ln -s' - # ... but there are two gotchas: - # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail. - # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable. - # In both cases, we have to default to `cp -pR'. - ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe || - as_ln_s='cp -pR' - elif ln conf$$.file conf$$ 2>/dev/null; then - as_ln_s=ln - else - as_ln_s='cp -pR' - fi -else - as_ln_s='cp -pR' -fi -rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file -rmdir conf$$.dir 2>/dev/null - - -# as_fn_mkdir_p -# ------------- -# Create "$as_dir" as a directory, including parents if necessary. -as_fn_mkdir_p () -{ - - case $as_dir in #( - -*) as_dir=./$as_dir;; - esac - test -d "$as_dir" || eval $as_mkdir_p || { - as_dirs= - while :; do - case $as_dir in #( - *\'*) as_qdir=`$as_echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'( - *) as_qdir=$as_dir;; - esac - as_dirs="'$as_qdir' $as_dirs" - as_dir=`$as_dirname -- "$as_dir" || -$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ - X"$as_dir" : 'X\(//\)[^/]' \| \ - X"$as_dir" : 'X\(//\)$' \| \ - X"$as_dir" : 'X\(/\)' \| . 2>/dev/null || -$as_echo X"$as_dir" | - sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ - s//\1/ - q - } - /^X\(\/\/\)[^/].*/{ - s//\1/ - q - } - /^X\(\/\/\)$/{ - s//\1/ - q - } - /^X\(\/\).*/{ - s//\1/ - q - } - s/.*/./; q'` - test -d "$as_dir" && break - done - test -z "$as_dirs" || eval "mkdir $as_dirs" - } || test -d "$as_dir" || as_fn_error $? "cannot create directory $as_dir" - - -} # as_fn_mkdir_p -if mkdir -p . 2>/dev/null; then - as_mkdir_p='mkdir -p "$as_dir"' -else - test -d ./-p && rmdir ./-p - as_mkdir_p=false -fi - - -# as_fn_executable_p FILE -# ----------------------- -# Test if FILE is an executable regular file. -as_fn_executable_p () -{ - test -f "$1" && test -x "$1" -} # as_fn_executable_p -as_test_x='test -x' -as_executable_p=as_fn_executable_p - -# Sed expression to map a string onto a valid CPP name. -as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'" - -# Sed expression to map a string onto a valid variable name. -as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'" - - -exec 6>&1 -## ----------------------------------- ## -## Main body of $CONFIG_STATUS script. ## -## ----------------------------------- ## -_ASEOF -test $as_write_fail = 0 && chmod +x $CONFIG_STATUS || ac_write_fail=1 - -cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1 -# Save the log message, to keep $0 and so on meaningful, and to -# report actual input values of CONFIG_FILES etc. instead of their -# values after options handling. -ac_log=" -This file was extended by rock $as_me 1.9.5, which was -generated by GNU Autoconf 2.69. Invocation command line was - - CONFIG_FILES = $CONFIG_FILES - CONFIG_HEADERS = $CONFIG_HEADERS - CONFIG_LINKS = $CONFIG_LINKS - CONFIG_COMMANDS = $CONFIG_COMMANDS - $ $0 $@ - -on `(hostname || uname -n) 2>/dev/null | sed 1q` -" - -_ACEOF - -case $ac_config_files in *" -"*) set x $ac_config_files; shift; ac_config_files=$*;; -esac - - - -cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1 -# Files that config.status was made for. -config_files="$ac_config_files" -config_commands="$ac_config_commands" - -_ACEOF - -cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1 -ac_cs_usage="\ -\`$as_me' instantiates files and other configuration actions -from templates according to the current configuration. Unless the files -and actions are specified as TAGs, all are instantiated by default. - -Usage: $0 [OPTION]... [TAG]... - - -h, --help print this help, then exit - -V, --version print version number and configuration settings, then exit - --config print configuration, then exit - -q, --quiet, --silent - do not print progress messages - -d, --debug don't remove temporary files - --recheck update $as_me by reconfiguring in the same conditions - --file=FILE[:TEMPLATE] - instantiate the configuration file FILE - -Configuration files: -$config_files - -Configuration commands: -$config_commands - -Report bugs to the package provider." - -_ACEOF -cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1 -ac_cs_config="`$as_echo "$ac_configure_args" | sed 's/^ //; s/[\\""\`\$]/\\\\&/g'`" -ac_cs_version="\\ -rock config.status 1.9.5 -configured by $0, generated by GNU Autoconf 2.69, - with options \\"\$ac_cs_config\\" - -Copyright (C) 2012 Free Software Foundation, Inc. -This config.status script is free software; the Free Software Foundation -gives unlimited permission to copy, distribute and modify it." - -ac_pwd='$ac_pwd' -srcdir='$srcdir' -INSTALL='$INSTALL' -MKDIR_P='$MKDIR_P' -AWK='$AWK' -test -n "\$AWK" || AWK=awk -_ACEOF - -cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1 -# The default lists apply if the user does not specify any file. -ac_need_defaults=: -while test $# != 0 -do - case $1 in - --*=?*) - ac_option=`expr "X$1" : 'X\([^=]*\)='` - ac_optarg=`expr "X$1" : 'X[^=]*=\(.*\)'` - ac_shift=: - ;; - --*=) - ac_option=`expr "X$1" : 'X\([^=]*\)='` - ac_optarg= - ac_shift=: - ;; - *) - ac_option=$1 - ac_optarg=$2 - ac_shift=shift - ;; - esac - - case $ac_option in - # Handling of the options. - -recheck | --recheck | --rechec | --reche | --rech | --rec | --re | --r) - ac_cs_recheck=: ;; - --version | --versio | --versi | --vers | --ver | --ve | --v | -V ) - $as_echo "$ac_cs_version"; exit ;; - --config | --confi | --conf | --con | --co | --c ) - $as_echo "$ac_cs_config"; exit ;; - --debug | --debu | --deb | --de | --d | -d ) - debug=: ;; - --file | --fil | --fi | --f ) - $ac_shift - case $ac_optarg in - *\'*) ac_optarg=`$as_echo "$ac_optarg" | sed "s/'/'\\\\\\\\''/g"` ;; - '') as_fn_error $? "missing file argument" ;; - esac - as_fn_append CONFIG_FILES " '$ac_optarg'" - ac_need_defaults=false;; - --he | --h | --help | --hel | -h ) - $as_echo "$ac_cs_usage"; exit ;; - -q | -quiet | --quiet | --quie | --qui | --qu | --q \ - | -silent | --silent | --silen | --sile | --sil | --si | --s) - ac_cs_silent=: ;; - - # This is an error. - -*) as_fn_error $? "unrecognized option: \`$1' -Try \`$0 --help' for more information." ;; - - *) as_fn_append ac_config_targets " $1" - ac_need_defaults=false ;; - - esac - shift -done - -ac_configure_extra_args= - -if $ac_cs_silent; then - exec 6>/dev/null - ac_configure_extra_args="$ac_configure_extra_args --silent" -fi - -_ACEOF -cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1 -if \$ac_cs_recheck; then - set X $SHELL '$0' $ac_configure_args \$ac_configure_extra_args --no-create --no-recursion - shift - \$as_echo "running CONFIG_SHELL=$SHELL \$*" >&6 - CONFIG_SHELL='$SHELL' - export CONFIG_SHELL - exec "\$@" -fi - -_ACEOF -cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1 -exec 5>>config.log -{ - echo - sed 'h;s/./-/g;s/^.../## /;s/...$/ ##/;p;x;p;x' <<_ASBOX -## Running $as_me. ## -_ASBOX - $as_echo "$ac_log" -} >&5 - -_ACEOF -cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1 -# -# INIT-COMMANDS -# -AMDEP_TRUE="$AMDEP_TRUE" ac_aux_dir="$ac_aux_dir" - -_ACEOF - -cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1 - -# Handling of arguments. -for ac_config_target in $ac_config_targets -do - case $ac_config_target in - "depfiles") CONFIG_COMMANDS="$CONFIG_COMMANDS depfiles" ;; - "Makefile") CONFIG_FILES="$CONFIG_FILES Makefile" ;; - "src/Makefile") CONFIG_FILES="$CONFIG_FILES src/Makefile" ;; - "test/Makefile") CONFIG_FILES="$CONFIG_FILES test/Makefile" ;; - "doc/Makefile") CONFIG_FILES="$CONFIG_FILES doc/Makefile" ;; - - *) as_fn_error $? "invalid argument: \`$ac_config_target'" "$LINENO" 5;; - esac -done - - -# If the user did not use the arguments to specify the items to instantiate, -# then the envvar interface is used. Set only those that are not. -# We use the long form for the default assignment because of an extremely -# bizarre bug on SunOS 4.1.3. -if $ac_need_defaults; then - test "${CONFIG_FILES+set}" = set || CONFIG_FILES=$config_files - test "${CONFIG_COMMANDS+set}" = set || CONFIG_COMMANDS=$config_commands -fi - -# Have a temporary directory for convenience. Make it in the build tree -# simply because there is no reason against having it here, and in addition, -# creating and moving files from /tmp can sometimes cause problems. -# Hook for its removal unless debugging. -# Note that there is a small window in which the directory will not be cleaned: -# after its creation but before its name has been assigned to `$tmp'. -$debug || -{ - tmp= ac_tmp= - trap 'exit_status=$? - : "${ac_tmp:=$tmp}" - { test ! -d "$ac_tmp" || rm -fr "$ac_tmp"; } && exit $exit_status -' 0 - trap 'as_fn_exit 1' 1 2 13 15 -} -# Create a (secure) tmp directory for tmp files. - -{ - tmp=`(umask 077 && mktemp -d "./confXXXXXX") 2>/dev/null` && - test -d "$tmp" -} || -{ - tmp=./conf$$-$RANDOM - (umask 077 && mkdir "$tmp") -} || as_fn_error $? "cannot create a temporary directory in ." "$LINENO" 5 -ac_tmp=$tmp - -# Set up the scripts for CONFIG_FILES section. -# No need to generate them if there are no CONFIG_FILES. -# This happens for instance with `./config.status config.h'. -if test -n "$CONFIG_FILES"; then - - -ac_cr=`echo X | tr X '\015'` -# On cygwin, bash can eat \r inside `` if the user requested igncr. -# But we know of no other shell where ac_cr would be empty at this -# point, so we can use a bashism as a fallback. -if test "x$ac_cr" = x; then - eval ac_cr=\$\'\\r\' -fi -ac_cs_awk_cr=`$AWK 'BEGIN { print "a\rb" }' </dev/null 2>/dev/null` -if test "$ac_cs_awk_cr" = "a${ac_cr}b"; then - ac_cs_awk_cr='\\r' -else - ac_cs_awk_cr=$ac_cr -fi - -echo 'BEGIN {' >"$ac_tmp/subs1.awk" && -_ACEOF - - -{ - echo "cat >conf$$subs.awk <<_ACEOF" && - echo "$ac_subst_vars" | sed 's/.*/&!$&$ac_delim/' && - echo "_ACEOF" -} >conf$$subs.sh || - as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5 -ac_delim_num=`echo "$ac_subst_vars" | grep -c '^'` -ac_delim='%!_!# ' -for ac_last_try in false false false false false :; do - . ./conf$$subs.sh || - as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5 - - ac_delim_n=`sed -n "s/.*$ac_delim\$/X/p" conf$$subs.awk | grep -c X` - if test $ac_delim_n = $ac_delim_num; then - break - elif $ac_last_try; then - as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5 - else - ac_delim="$ac_delim!$ac_delim _$ac_delim!! " - fi -done -rm -f conf$$subs.sh - -cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1 -cat >>"\$ac_tmp/subs1.awk" <<\\_ACAWK && -_ACEOF -sed -n ' -h -s/^/S["/; s/!.*/"]=/ -p -g -s/^[^!]*!// -:repl -t repl -s/'"$ac_delim"'$// -t delim -:nl -h -s/\(.\{148\}\)..*/\1/ -t more1 -s/["\\]/\\&/g; s/^/"/; s/$/\\n"\\/ -p -n -b repl -:more1 -s/["\\]/\\&/g; s/^/"/; s/$/"\\/ -p -g -s/.\{148\}// -t nl -:delim -h -s/\(.\{148\}\)..*/\1/ -t more2 -s/["\\]/\\&/g; s/^/"/; s/$/"/ -p -b -:more2 -s/["\\]/\\&/g; s/^/"/; s/$/"\\/ -p -g -s/.\{148\}// -t delim -' <conf$$subs.awk | sed ' -/^[^""]/{ - N - s/\n// -} -' >>$CONFIG_STATUS || ac_write_fail=1 -rm -f conf$$subs.awk -cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1 -_ACAWK -cat >>"\$ac_tmp/subs1.awk" <<_ACAWK && - for (key in S) S_is_set[key] = 1 - FS = "" - -} -{ - line = $ 0 - nfields = split(line, field, "@") - substed = 0 - len = length(field[1]) - for (i = 2; i < nfields; i++) { - key = field[i] - keylen = length(key) - if (S_is_set[key]) { - value = S[key] - line = substr(line, 1, len) "" value "" substr(line, len + keylen + 3) - len += length(value) + length(field[++i]) - substed = 1 - } else - len += 1 + keylen - } - - print line -} - -_ACAWK -_ACEOF -cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1 -if sed "s/$ac_cr//" < /dev/null > /dev/null 2>&1; then - sed "s/$ac_cr\$//; s/$ac_cr/$ac_cs_awk_cr/g" -else - cat -fi < "$ac_tmp/subs1.awk" > "$ac_tmp/subs.awk" \ - || as_fn_error $? "could not setup config files machinery" "$LINENO" 5 -_ACEOF - -# VPATH may cause trouble with some makes, so we remove sole $(srcdir), -# ${srcdir} and @srcdir@ entries from VPATH if srcdir is ".", strip leading and -# trailing colons and then remove the whole line if VPATH becomes empty -# (actually we leave an empty line to preserve line numbers). -if test "x$srcdir" = x.; then - ac_vpsub='/^[ ]*VPATH[ ]*=[ ]*/{ -h -s/// -s/^/:/ -s/[ ]*$/:/ -s/:\$(srcdir):/:/g -s/:\${srcdir}:/:/g -s/:@srcdir@:/:/g -s/^:*// -s/:*$// -x -s/\(=[ ]*\).*/\1/ -G -s/\n// -s/^[^=]*=[ ]*$// -}' -fi - -cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1 -fi # test -n "$CONFIG_FILES" - - -eval set X " :F $CONFIG_FILES :C $CONFIG_COMMANDS" -shift -for ac_tag -do - case $ac_tag in - :[FHLC]) ac_mode=$ac_tag; continue;; - esac - case $ac_mode$ac_tag in - :[FHL]*:*);; - :L* | :C*:*) as_fn_error $? "invalid tag \`$ac_tag'" "$LINENO" 5;; - :[FH]-) ac_tag=-:-;; - :[FH]*) ac_tag=$ac_tag:$ac_tag.in;; - esac - ac_save_IFS=$IFS - IFS=: - set x $ac_tag - IFS=$ac_save_IFS - shift - ac_file=$1 - shift - - case $ac_mode in - :L) ac_source=$1;; - :[FH]) - ac_file_inputs= - for ac_f - do - case $ac_f in - -) ac_f="$ac_tmp/stdin";; - *) # Look for the file first in the build tree, then in the source tree - # (if the path is not absolute). The absolute path cannot be DOS-style, - # because $ac_f cannot contain `:'. - test -f "$ac_f" || - case $ac_f in - [\\/$]*) false;; - *) test -f "$srcdir/$ac_f" && ac_f="$srcdir/$ac_f";; - esac || - as_fn_error 1 "cannot find input file: \`$ac_f'" "$LINENO" 5;; - esac - case $ac_f in *\'*) ac_f=`$as_echo "$ac_f" | sed "s/'/'\\\\\\\\''/g"`;; esac - as_fn_append ac_file_inputs " '$ac_f'" - done - - # Let's still pretend it is `configure' which instantiates (i.e., don't - # use $as_me), people would be surprised to read: - # /* config.h. Generated by config.status. */ - configure_input='Generated from '` - $as_echo "$*" | sed 's|^[^:]*/||;s|:[^:]*/|, |g' - `' by configure.' - if test x"$ac_file" != x-; then - configure_input="$ac_file. $configure_input" - { $as_echo "$as_me:${as_lineno-$LINENO}: creating $ac_file" >&5 -$as_echo "$as_me: creating $ac_file" >&6;} - fi - # Neutralize special characters interpreted by sed in replacement strings. - case $configure_input in #( - *\&* | *\|* | *\\* ) - ac_sed_conf_input=`$as_echo "$configure_input" | - sed 's/[\\\\&|]/\\\\&/g'`;; #( - *) ac_sed_conf_input=$configure_input;; - esac - - case $ac_tag in - *:-:* | *:-) cat >"$ac_tmp/stdin" \ - || as_fn_error $? "could not create $ac_file" "$LINENO" 5 ;; - esac - ;; - esac - - ac_dir=`$as_dirname -- "$ac_file" || -$as_expr X"$ac_file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ - X"$ac_file" : 'X\(//\)[^/]' \| \ - X"$ac_file" : 'X\(//\)$' \| \ - X"$ac_file" : 'X\(/\)' \| . 2>/dev/null || -$as_echo X"$ac_file" | - sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ - s//\1/ - q - } - /^X\(\/\/\)[^/].*/{ - s//\1/ - q - } - /^X\(\/\/\)$/{ - s//\1/ - q - } - /^X\(\/\).*/{ - s//\1/ - q - } - s/.*/./; q'` - as_dir="$ac_dir"; as_fn_mkdir_p - ac_builddir=. - -case "$ac_dir" in -.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;; -*) - ac_dir_suffix=/`$as_echo "$ac_dir" | sed 's|^\.[\\/]||'` - # A ".." for each directory in $ac_dir_suffix. - ac_top_builddir_sub=`$as_echo "$ac_dir_suffix" | sed 's|/[^\\/]*|/..|g;s|/||'` - case $ac_top_builddir_sub in - "") ac_top_builddir_sub=. ac_top_build_prefix= ;; - *) ac_top_build_prefix=$ac_top_builddir_sub/ ;; - esac ;; -esac -ac_abs_top_builddir=$ac_pwd -ac_abs_builddir=$ac_pwd$ac_dir_suffix -# for backward compatibility: -ac_top_builddir=$ac_top_build_prefix - -case $srcdir in - .) # We are building in place. - ac_srcdir=. - ac_top_srcdir=$ac_top_builddir_sub - ac_abs_top_srcdir=$ac_pwd ;; - [\\/]* | ?:[\\/]* ) # Absolute name. - ac_srcdir=$srcdir$ac_dir_suffix; - ac_top_srcdir=$srcdir - ac_abs_top_srcdir=$srcdir ;; - *) # Relative name. - ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix - ac_top_srcdir=$ac_top_build_prefix$srcdir - ac_abs_top_srcdir=$ac_pwd/$srcdir ;; -esac -ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix - - - case $ac_mode in - :F) - # - # CONFIG_FILE - # - - case $INSTALL in - [\\/$]* | ?:[\\/]* ) ac_INSTALL=$INSTALL ;; - *) ac_INSTALL=$ac_top_build_prefix$INSTALL ;; - esac - ac_MKDIR_P=$MKDIR_P - case $MKDIR_P in - [\\/$]* | ?:[\\/]* ) ;; - */*) ac_MKDIR_P=$ac_top_build_prefix$MKDIR_P ;; - esac -_ACEOF - -cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1 -# If the template does not know about datarootdir, expand it. -# FIXME: This hack should be removed a few years after 2.60. -ac_datarootdir_hack=; ac_datarootdir_seen= -ac_sed_dataroot=' -/datarootdir/ { - p - q -} -/@datadir@/p -/@docdir@/p -/@infodir@/p -/@localedir@/p -/@mandir@/p' -case `eval "sed -n \"\$ac_sed_dataroot\" $ac_file_inputs"` in -*datarootdir*) ac_datarootdir_seen=yes;; -*@datadir@*|*@docdir@*|*@infodir@*|*@localedir@*|*@mandir@*) - { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&5 -$as_echo "$as_me: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&2;} -_ACEOF -cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1 - ac_datarootdir_hack=' - s&@datadir@&$datadir&g - s&@docdir@&$docdir&g - s&@infodir@&$infodir&g - s&@localedir@&$localedir&g - s&@mandir@&$mandir&g - s&\\\${datarootdir}&$datarootdir&g' ;; -esac -_ACEOF - -# Neutralize VPATH when `$srcdir' = `.'. -# Shell code in configure.ac might set extrasub. -# FIXME: do we really want to maintain this feature? -cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1 -ac_sed_extra="$ac_vpsub -$extrasub -_ACEOF -cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1 -:t -/@[a-zA-Z_][a-zA-Z_0-9]*@/!b -s|@configure_input@|$ac_sed_conf_input|;t t -s&@top_builddir@&$ac_top_builddir_sub&;t t -s&@top_build_prefix@&$ac_top_build_prefix&;t t -s&@srcdir@&$ac_srcdir&;t t -s&@abs_srcdir@&$ac_abs_srcdir&;t t -s&@top_srcdir@&$ac_top_srcdir&;t t -s&@abs_top_srcdir@&$ac_abs_top_srcdir&;t t -s&@builddir@&$ac_builddir&;t t -s&@abs_builddir@&$ac_abs_builddir&;t t -s&@abs_top_builddir@&$ac_abs_top_builddir&;t t -s&@INSTALL@&$ac_INSTALL&;t t -s&@MKDIR_P@&$ac_MKDIR_P&;t t -$ac_datarootdir_hack -" -eval sed \"\$ac_sed_extra\" "$ac_file_inputs" | $AWK -f "$ac_tmp/subs.awk" \ - >$ac_tmp/out || as_fn_error $? "could not create $ac_file" "$LINENO" 5 - -test -z "$ac_datarootdir_hack$ac_datarootdir_seen" && - { ac_out=`sed -n '/\${datarootdir}/p' "$ac_tmp/out"`; test -n "$ac_out"; } && - { ac_out=`sed -n '/^[ ]*datarootdir[ ]*:*=/p' \ - "$ac_tmp/out"`; test -z "$ac_out"; } && - { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $ac_file contains a reference to the variable \`datarootdir' -which seems to be undefined. Please make sure it is defined" >&5 -$as_echo "$as_me: WARNING: $ac_file contains a reference to the variable \`datarootdir' -which seems to be undefined. Please make sure it is defined" >&2;} - - rm -f "$ac_tmp/stdin" - case $ac_file in - -) cat "$ac_tmp/out" && rm -f "$ac_tmp/out";; - *) rm -f "$ac_file" && mv "$ac_tmp/out" "$ac_file";; - esac \ - || as_fn_error $? "could not create $ac_file" "$LINENO" 5 - ;; - - - :C) { $as_echo "$as_me:${as_lineno-$LINENO}: executing $ac_file commands" >&5 -$as_echo "$as_me: executing $ac_file commands" >&6;} - ;; - esac - - - case $ac_file$ac_mode in - "depfiles":C) test x"$AMDEP_TRUE" != x"" || { - # Older Autoconf quotes --file arguments for eval, but not when files - # are listed without --file. Let's play safe and only enable the eval - # if we detect the quoting. - case $CONFIG_FILES in - *\'*) eval set x "$CONFIG_FILES" ;; - *) set x $CONFIG_FILES ;; - esac - shift - for mf - do - # Strip MF so we end up with the name of the file. - mf=`echo "$mf" | sed -e 's/:.*$//'` - # Check whether this is an Automake generated Makefile or not. - # We used to match only the files named 'Makefile.in', but - # some people rename them; so instead we look at the file content. - # Grep'ing the first line is not enough: some people post-process - # each Makefile.in and add a new line on top of each file to say so. - # Grep'ing the whole file is not good either: AIX grep has a line - # limit of 2048, but all sed's we know have understand at least 4000. - if sed -n 's,^#.*generated by automake.*,X,p' "$mf" | grep X >/dev/null 2>&1; then - dirpart=`$as_dirname -- "$mf" || -$as_expr X"$mf" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ - X"$mf" : 'X\(//\)[^/]' \| \ - X"$mf" : 'X\(//\)$' \| \ - X"$mf" : 'X\(/\)' \| . 2>/dev/null || -$as_echo X"$mf" | - sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ - s//\1/ - q - } - /^X\(\/\/\)[^/].*/{ - s//\1/ - q - } - /^X\(\/\/\)$/{ - s//\1/ - q - } - /^X\(\/\).*/{ - s//\1/ - q - } - s/.*/./; q'` - else - continue - fi - # Extract the definition of DEPDIR, am__include, and am__quote - # from the Makefile without running 'make'. - DEPDIR=`sed -n 's/^DEPDIR = //p' < "$mf"` - test -z "$DEPDIR" && continue - am__include=`sed -n 's/^am__include = //p' < "$mf"` - test -z "$am__include" && continue - am__quote=`sed -n 's/^am__quote = //p' < "$mf"` - # Find all dependency output files, they are included files with - # $(DEPDIR) in their names. We invoke sed twice because it is the - # simplest approach to changing $(DEPDIR) to its actual value in the - # expansion. - for file in `sed -n " - s/^$am__include $am__quote\(.*(DEPDIR).*\)$am__quote"'$/\1/p' <"$mf" | \ - sed -e 's/\$(DEPDIR)/'"$DEPDIR"'/g'`; do - # Make sure the directory exists. - test -f "$dirpart/$file" && continue - fdir=`$as_dirname -- "$file" || -$as_expr X"$file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ - X"$file" : 'X\(//\)[^/]' \| \ - X"$file" : 'X\(//\)$' \| \ - X"$file" : 'X\(/\)' \| . 2>/dev/null || -$as_echo X"$file" | - sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ - s//\1/ - q - } - /^X\(\/\/\)[^/].*/{ - s//\1/ - q - } - /^X\(\/\/\)$/{ - s//\1/ - q - } - /^X\(\/\).*/{ - s//\1/ - q - } - s/.*/./; q'` - as_dir=$dirpart/$fdir; as_fn_mkdir_p - # echo "creating $dirpart/$file" - echo '# dummy' > "$dirpart/$file" - done - done -} - ;; - - esac -done # for ac_tag - - -as_fn_exit 0 -_ACEOF -ac_clean_files=$ac_clean_files_save - -test $ac_write_fail = 0 || - as_fn_error $? "write failure creating $CONFIG_STATUS" "$LINENO" 5 - - -# configure is writing to config.log, and then calls config.status. -# config.status does its own redirection, appending to config.log. -# Unfortunately, on DOS this fails, as config.log is still kept open -# by configure, so config.status won't be able to write to it; its -# output is simply discarded. So we exec the FD to /dev/null, -# effectively closing config.log, so it can be properly (re)opened and -# appended to by config.status. When coming back to configure, we -# need to make the FD available again. -if test "$no_create" != yes; then - ac_cs_success=: - ac_config_status_args= - test "$silent" = yes && - ac_config_status_args="$ac_config_status_args --quiet" - exec 5>/dev/null - $SHELL $CONFIG_STATUS $ac_config_status_args || ac_cs_success=false - exec 5>>config.log - # Use ||, not &&, to avoid exiting from the if with $? = 1, which - # would make configure fail if this is the last instruction. - $ac_cs_success || as_fn_exit 1 -fi -if test -n "$ac_unrecognized_opts" && test "$enable_option_checking" != no; then - { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: unrecognized options: $ac_unrecognized_opts" >&5 -$as_echo "$as_me: WARNING: unrecognized options: $ac_unrecognized_opts" >&2;} -fi - - diff --git a/src/FqAuxBackend.cpp b/src/FqAuxBackend.cpp index a61b2f80aff1da0ee716b9ed867ff7fcf4375a8d..d872c1985dd68b819d8f4dac9aca5b959d7a2e14 100644 --- a/src/FqAuxBackend.cpp +++ b/src/FqAuxBackend.cpp @@ -53,8 +53,8 @@ int FqAuxBackend::getNextRead(rinfo * p_nr) { int FqAuxBackend::processBuffer(rinfo * p_nr) { static T_fq_rec_info fq_rec_info; - static int num_l_in_rec; /* counter to know on which line inside the fastq record we are */ - static int qual_score=0; + static int num_l_in_rec=5; /* counter to know on which line inside the fastq record we are */ + //static int qual_score=0; static int n; static int start_rec_in_buf; @@ -65,27 +65,24 @@ int FqAuxBackend::processBuffer(rinfo * p_nr) { while (buf_info.cnt<=buf_info.real_bufsize-1 && !rfound) { switch (*buf_info.pchar){ case k_read_id_start: - if (qual_score) goto inc_score; + if (num_l_in_rec==4) goto inc_score; else { //debug_processBuf(on_record_new,buf_info,fq_rec_info.rstart_offset); rstart_offset=cur_offset-buf_info.real_bufsize+buf_info.cnt; start_rec_in_buf=buf_info.cnt; buf_info.p_start_cur_rec=buf_info.pchar; num_l_in_rec=1; - fq_rec_info.nb_nucleotides_in_read=0;} - break; - case k_read_qual_start: - qual_score=1; - fq_rec_info.nb_k_mers_in_error=0; - fq_rec_info.st=0; - fq_rec_info.idx_nucl_in_read=0; - n=0; + fq_rec_info.nb_nucleotides_in_read=0; + fq_rec_info.nb_k_mers_in_error=0; + fq_rec_info.st=0; + fq_rec_info.idx_nucl_in_read=0; + n=0; + } break; case '\n': // debug_processBuf(on_line_end,buf_info,fq_rec_info.rstart_offset); - (qual_score==1)?qual_score++:qual_score; num_l_in_rec+=1; - if (num_l_in_rec==5) { qual_score=0;/* end of fastq record */ + if (num_l_in_rec==5) { /* end of fastq record */ p_nr->f_id=f_id; p_nr->score=fq_rec_info.st; p_nr->rstart_offset=rstart_offset; @@ -98,7 +95,7 @@ int FqAuxBackend::processBuffer(rinfo * p_nr) { //debug_processBuf(on_store_read_id,buf_info,fq_rec_info.rstart_offset); (num_l_in_rec==2)?fq_rec_info.nb_nucleotides_in_read++:fq_rec_info.nb_nucleotides_in_read; inc_score: - { if (qual_score==2) onIncScore(fq_rec_info,buf_info,n); + { if (num_l_in_rec==4) onIncScore(fq_rec_info,buf_info,n); } } buf_info.pchar++; diff --git a/src/FqAuxBackend.h b/src/FqAuxBackend.h index 392d50322a85e522ede2d4917fbb4c7139bed4b0..a09a372848c4217f9629916111e7b36cfab5d9b2 100644 --- a/src/FqAuxBackend.h +++ b/src/FqAuxBackend.h @@ -21,6 +21,7 @@ class FqAuxBackend:public FqBaseBackend { int processBuffer(rinfo * p_nr); friend void test_processBufPE(); + friend void test_processBufPEWithPlusChar(); public: diff --git a/src/unit_test_fqreader.cpp b/src/unit_test_fqreader.cpp index b5eb927d67da46feb759cbb4858d09f2c69c14bc..9379cdb8dab15b7c5aa053a6bd30d6a7a97cee54 100644 --- a/src/unit_test_fqreader.cpp +++ b/src/unit_test_fqreader.cpp @@ -42,7 +42,7 @@ using namespace std; - +const int treat_PE_as_single=0; void test_processSingleFile() { srp sr; @@ -54,13 +54,6 @@ void test_processSingleFile() { k_dim::iterator it_struct; int cnt_read=0; - /*cout<<"sizeof 1rst map when empty:"<<sizeof(srp)<<" "<<sizeof(sr)<<endl; - i_dim stuff1; - cout<<"sizeof 2np map when empty:"<<sizeof(stuff1)<<endl; - k_dim stuff2; - cout<<"sizeof vector when empty:"<<sizeof(stuff2)<<endl; - cout<<"sizeof(long)"<<sizeof(long)<<endl; - cout<<"sizeof(int)"<<sizeof(int)<<endl;*/ for (rit=sr.rbegin(); rit!=sr.rend(); ++rit) { //process map in reverse order (by decreasing scores). //cout << "score="<<rit->first<<endl; @@ -598,7 +591,7 @@ void test_processInputFiles() { default_qual_thres.min_correct_k_mers_in_read=0; // aim of that test is not to check undef file creation. Disable it by putting 0 here default_qual_thres.nucl_score_threshold=0; // leave default values for that test - FqMainBackend::setTreatPEMode(0); + FqMainBackend::setTreatPEMode(treat_PE_as_single); FqBaseBackend * array_be[k_max_input_files]; processInputFiles(v_single,v_pe,array_be,default_qual_thres,&sr,1); @@ -645,7 +638,7 @@ AAAAAEEAEEEEEEEEE6EE/EEEEEEEEAEEAEEEEEEEEEEEEEEAEEEA/A/EEEAEEEEEE/EE</EAEEEEEE/E qual_thres.min_correct_k_mers_in_read=78; T_buf_info buf_info; FqBaseBackend::setQualThreshold(qual_thres); - FqMainBackend::setTreatPEMode(0); + FqMainBackend::setTreatPEMode(treat_PE_as_single); FqMainBackend be(&sr); buf_info.buf=buf; buf_info.pchar=buf; @@ -687,7 +680,7 @@ AAAAAEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEE<EEEAEEEEA<EAEEEEEEEAAAAE<EEEE/EEEEAAEEE qual_thres.nucl_score_threshold=k_phred_32; qual_thres.k=25; FqBaseBackend::setQualThreshold(qual_thres); - FqMainBackend::setTreatPEMode(0); + FqMainBackend::setTreatPEMode(treat_PE_as_single); FqMainBackend be(&sr); buf_info.buf=buf; buf_info.pchar=buf; @@ -705,15 +698,94 @@ AAAAAEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEE<EEEAEEEEA<EAEEEEEEEAAAAE<EEEE/EEEEAAEEE cnt_read++; if (cnt_read==1) { assert(score==9); // real score is 5016+151*k_phred_32 but it is normalized by taking the quotient of a division by 1000. - //assert(it_struct->read_a1==429); } else if (cnt_read==2) { assert(score==8); // real score is 3076 + 151*k_phred_32 - //assert(it_struct->read_a1==120); } else if (cnt_read==3) { assert(score==2); // real score is 1256 + 36*k_phred_32 (we don't do the substraction to gain calculation time). - //assert(it_struct->read_a1==0); + } + } + } + } + assert(cnt_read==3); + +} + +void test_processBufPEWithPlusChar() { + srp::reverse_iterator rit; + i_dim::iterator it_offs; + k_dim::iterator it_struct; + unsigned char f_id1=1; + std::string bufstr_PE1="@SRR001666.4 071112_SLXA-EAS1_s_7:5:1:792:346/2\n\ +AAAGTTAACGAACGCGCGAAAGGTCTGGAAGGTATC\n\ ++\n\ +IIIIIIII@+IIIIIIIIB@7IIF=III+CIID0I+\n\ +@NB501291:419:HWLVNBGXK:1:11101:20148:1052 2:N:0:ATCTCAGG+NGGAGAGA\n\ +GATTTTAAANNNNNNNNNAAATNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNAANTTAANGNAANCTGATTACCATGNTAGNNCATATTAGTTNGANCGCCGCGTTNTTCNANACATANNGTAATCNNANTNACTAAGTATTCNTNCGGTA\n\ ++\n\ +AAAA/EEEE#########EEEE###############E##############EE#EEEE#E#EE#/EEEEEEEAEEE#EEE##<AAEEEEEEE#AE#6EE/EEE<E#EEE#E#EEEA/##/EEEE<##<#/#/<AE/AA/EE/#A#/AAA/\n\ +@NB501291:419:HWLVNBGXK:1:11101:11957:1078 2:N:0:ATCTCAGG+CGGAGAGA\n\ +ATTATATGATGCAGTAAAAGCCATTGGTGAAGAGCTATGCCCACAATTAGGTATTACTATTCCGGTGGGTAAGGACTCAATGTCCATGAAAACGCGTTGGCAAGATGATCAAGGGAAAACGAAAGAAGTTATTTCACCGCTCTCTTTAGTT\n\ ++\n\ +AAAAAEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEE<EEEAEEEEA<EAEEEEEEEAAAAE<EEEE/EEEEAAEEEEEEE<EEEEAAEEE<AE<EE<EEEEAEE/EE/EEEE<EE/EE/E/EEEEEAE<E</<<<AE<AAAEEE/AE\n"; + std::string bufstr_PE2="@SRR001666.4 071112_SLXA-EAS1_s_7:5:1:792:346/2\n\ +AAAGTTAACGAACGCGCGAAAGGTCTGGAAGGTATC\n\ ++\n\ +IIIIIIII@+IIIIIIIIB@7IIF=III+CIID0I+\n\ +@NB501291:419:HWLVNBGXK:1:11101:20148:1052 2:N:0:ATCTCAGG+NGGAGAGA\n\ +GATTTTAAANNNNNNNNNAAATNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNAANTTAANGNAANCTGATTACCATGNTAGNNCATATTAGTTNGANCGCCGCGTTNTTCNANACATANNGTAATCNNANTNACTAAGTATTCNTNCGGTA\n\ ++\n\ +AAAA/EEEE#########EEEE###############E##############EE#EEEE#E#EE#/EEEEEEEAEEE#EEE##<AAEEEEEEE#AE#6EE/EEE<E#EEE#E#EEEA/##/EEEE<##<#/#/<AE/AA/EE/#A#/AAA/\n\ +@NB501291:419:HWLVNBGXK:1:11101:11957:1078 2:N:0:ATCTCAGG+CGGAGAGA\n\ +ATTATATGATGCAGTAAAAGCCATTGGTGAAGAGCTATGCCCACAATTAGGTATTACTATTCCGGTGGGTAAGGACTCAATGTCCATGAAAACGCGTTGGCAAGATGATCAAGGGAAAACGAAAGAAGTTATTTCACCGCTCTCTTTAGTT\n\ ++\n\ +AAAAAEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEE<EEEAEEEEA<EAEEEEEEEAAAAE<EEEE/EEEEAAEEEEEEE<EEEEAAEEE<AE<EE<EEEEAEE/EE/EEEE<EE/EE/E/EEEEEAE<E</<<<AE<AAAEEE/AE\n"; + char * buf_PE1=(char *) bufstr_PE1.c_str(); + char * buf_PE2=(char *) bufstr_PE2.c_str(); + srp sr; + T_buf_info buf_info; + T_buf_info PE2_buf_info; + FasqQualThreshold qual_thres; + qual_thres.min_correct_k_mers_in_read=1; + qual_thres.nucl_score_threshold=k_phred_32; + qual_thres.k=25; + FqBaseBackend::setQualThreshold(qual_thres); + FqMainBackend::setTreatPEMode(treat_PE_as_single); + FqMainBackend be(&sr); + FqAuxBackend be2; + + PE2_buf_info.buf=buf_PE2; + PE2_buf_info.pchar=buf_PE2; + PE2_buf_info.cnt=0; + PE2_buf_info.real_bufsize=strlen(buf_PE2); + + buf_info.buf=buf_PE1; + buf_info.pchar=buf_PE1; + buf_info.cnt=0; + buf_info.real_bufsize=strlen(buf_PE1); + + be2.buf_info=PE2_buf_info; + + be.setAuxProcessor(&be2); + + be.processBuf(buf_info,f_id1,855); + int cnt_read=0; + for (rit=sr.rbegin(); rit!=sr.rend(); ++rit) { //process map in reverse order (by decreasing scores). + int score=rit->first; + for (it_offs=rit->second.begin();it_offs!=rit->second.end();it_offs++) { + unsigned int q=it_offs->first; + assert(q==0); + for (it_struct=it_offs->second.begin();it_struct!=it_offs->second.end();it_struct++) { + cnt_read++; + if (cnt_read==1) { + assert(score==19); // real score is 2*(5016+151*k_phred_32) but it is normalized by taking the quotient of a division by 1000. + } + else if (cnt_read==2) { + assert(score==16); // real score is 2*(3076 + 151*k_phred_32) + } + else if (cnt_read==3) { + assert(score==4); // real score is 2*(1256 + 36*k_phred_32) (we don't do the substraction to gain calculation time). } } } @@ -845,7 +917,8 @@ void test_MimicBigPEFilesWithMQOptions() { int main(int argc, char **argv) { cout<<"test for the case where there are + characters in read score and or read id"<<endl; - test_processBufSinglePlusCharBug(); + //test_processBufSinglePlusCharBug(); + test_processBufPEWithPlusChar(); cout<<"test for single file"<<endl; test_processSingleFile(); cout<<"test for PE files"<<endl;