diff --git a/Dummy_rock/Dummy_rock/Dummy_rock.1 b/Dummy_rock/Dummy_rock/Dummy_rock.1
deleted file mode 100644
index 50ca864869ebb64a64050cf295c4595a327512c7..0000000000000000000000000000000000000000
--- a/Dummy_rock/Dummy_rock/Dummy_rock.1
+++ /dev/null
@@ -1,79 +0,0 @@
-.\"Modified from man(1) of FreeBSD, the NetBSD mdoc.template, and mdoc.samples.
-.\"See Also:
-.\"man mdoc.samples for a complete listing of options
-.\"man mdoc for the short list of editing options
-.\"/usr/share/misc/mdoc.template
-.Dd 07/12/15 \" DATE
-.Dt Dummy_rock 1 \" Program name and manual section number
-.Os Darwin
-.Sh NAME \" Section Header - required - don't modify
-.Nm Dummy_rock,
-.\" The following lines are read in generating the apropos(man -k) database. Use only key
-.\" words here as the database is built based on the words here and in the .ND line.
-.Nm Other_name_for_same_program(),
-.Nm Yet another name for the same program.
-.\" Use .Nm macro to designate other names for the documented program.
-.Nd This line parsed for whatis database.
-.Sh SYNOPSIS \" Section Header - required - don't modify
-.Nm
-.Op Fl abcd \" [-abcd]
-.Op Fl a Ar path \" [-a path]
-.Op Ar file \" [file]
-.Op Ar \" [file ...]
-.Ar arg0 \" Underlined argument - use .Ar anywhere to underline
-arg2 ... \" Arguments
-.Sh DESCRIPTION \" Section Header - required - don't modify
-Use the .Nm macro to refer to your program throughout the man page like such:
-.Nm
-Underlining is accomplished with the .Ar macro like this:
-.Ar underlined text .
-.Pp \" Inserts a space
-A list of items with descriptions:
-.Bl -tag -width -indent \" Begins a tagged list
-.It item a \" Each item preceded by .It macro
-Description of item a
-.It item b
-Description of item b
-.El \" Ends the list
-.Pp
-A list of flags and their descriptions:
-.Bl -tag -width -indent \" Differs from above in tag removed
-.It Fl a \"-a flag as a list item
-Description of -a flag
-.It Fl b
-Description of -b flag
-.El \" Ends the list
-.Pp
-.\" .Sh ENVIRONMENT \" May not be needed
-.\" .Bl -tag -width "ENV_VAR_1" -indent \" ENV_VAR_1 is width of the string ENV_VAR_1
-.\" .It Ev ENV_VAR_1
-.\" Description of ENV_VAR_1
-.\" .It Ev ENV_VAR_2
-.\" Description of ENV_VAR_2
-.\" .El
-.Sh FILES \" File used or created by the topic of the man page
-.Bl -tag -width "/Users/joeuser/Library/really_long_file_name" -compact
-.It Pa /usr/share/file_name
-FILE_1 description
-.It Pa /Users/joeuser/Library/really_long_file_name
-FILE_2 description
-.El \" Ends the list
-.\" .Sh DIAGNOSTICS \" May not be needed
-.\" .Bl -diag
-.\" .It Diagnostic Tag
-.\" Diagnostic informtion here.
-.\" .It Diagnostic Tag
-.\" Diagnostic informtion here.
-.\" .El
-.Sh SEE ALSO
-.\" List links in ascending order by section, alphabetically within a section.
-.\" Please do not reference files that do not exist without filing a bug report
-.Xr a 1 ,
-.Xr b 1 ,
-.Xr c 1 ,
-.Xr a 2 ,
-.Xr b 2 ,
-.Xr a 3 ,
-.Xr b 3
-.\" .Sh BUGS \" Document known, unremedied bugs
-.\" .Sh HISTORY \" Document history if command behaves in a unique manner
\ No newline at end of file
diff --git a/Dummy_rock/Dummy_rock/main.c b/Dummy_rock/Dummy_rock/main.c
deleted file mode 100644
index a25cf869e41f0b5901fe298e5581b1a46d394acc..0000000000000000000000000000000000000000
--- a/Dummy_rock/Dummy_rock/main.c
+++ /dev/null
@@ -1,18 +0,0 @@
-//
-// main.c
-// Dummy_rock
-//
-// Created by vlegrand on 07/12/15.
-// Copyright (c) 2015 vlegrand. All rights reserved.
-//
-
-#include <stdio.h>
-
-int main(int argc, const char * argv[])
-{
-
- // insert code here...
- printf("Hello, World!\n");
- return 0;
-}
-
diff --git a/Dummy_rock/Dummy_rock/main.cpp b/Dummy_rock/Dummy_rock/main.cpp
deleted file mode 100644
index 2f61be73d3feeff1438f68a971333f202ba7dd2c..0000000000000000000000000000000000000000
--- a/Dummy_rock/Dummy_rock/main.cpp
+++ /dev/null
@@ -1,18 +0,0 @@
-//
-// main.cpp
-// Dummy_rock
-//
-// Created by vlegrand on 07/12/15.
-// Copyright (c) 2015 vlegrand. All rights reserved.
-//
-
-#include <iostream>
-
-int main(int argc, const char * argv[])
-{
-
- // insert code here...
- std::cout << "Hello, World!\n";
- return 0;
-}
-
diff --git a/configure.ac b/configure.ac
index db70897adab983dbf81f31ee6afd3ca02c929871..f810bdd7b22c2081017c2bb3038b5702f6fd656e 100644
--- a/configure.ac
+++ b/configure.ac
@@ -7,7 +7,11 @@ AC_INIT(rock, 1.0)
AC_CANONICAL_SYSTEM
AM_INIT_AUTOMAKE()
-AC_PROG_CC
+# Checks for programs.
+AC_PROG_CXX
+AC_PROG_RANLIB
+# AC_CHECK_PROG(POD2MAN, pod2man, pod2man, :)
+
AC_CONFIG_FILES(Makefile src/Makefile)
AC_OUTPUT
diff --git a/data/test_single.fq b/data/test_single.fq
index c457b1f04549d4b4539d7b97db64ea8d72ae9db0..8416483906c3c0546c68766ea0112d95bd332449 100644
--- a/data/test_single.fq
+++ b/data/test_single.fq
@@ -6,3 +6,19 @@ AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
CATGAAGGAACGCTTAGTCCAGTTTTATACGGACATGAACATTGATGGGAACTTTATTTCGCTTGGTAATAATACATGGGGACGTCGAGCATGGTATCCAATTGATGCGATCGATGAAGAAGTTCAAACACACTCAGCTCCGAAGAAAAAA
+
AAAAAEEEEEEEEEEEEEEEEEEEEEEE6EEEEEEEEEEEEEEEEEEEEEE6EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EEEEAEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEE//EEEEEEEEEEEEEEAEEEEEEEA
+@NS500443:42:H3MH2AFXX:1:11101:3205:10492/1
+ATTAGGCACATTGTTTCCTTCAAGTGCGGAAATTGGAATGATTTCTGCAAAATCAAGTTTTTCTCTATAGGTTTCTATTAGCTGGATAAGTTCATCTGGACTGACTAAATCAATTTTATTGATCAATAGAAAAACAGGTGTATCCACTTGT
++
+AAAAAEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEEEEEEAEEEEEEEAEEEEEEEEEEAEEEEEEEEEEEAEEEEEEEEEEE6AAEEEEEEAEEEE<EEAAEEAEE<EEAE/<EEA/EEEEEEAAEEEE/EEEA<EE
+@NS500443:42:H3MH2AFXX:1:11101:11822:11415/1
+ATATTACGAACTATTTTTTTGCACGAACTGTCCAACACATTGAGGAAACGCTGTTTAAAAATGGCTATTCCACCATTATTTGTAACACAGATCGAAGTCTCGAAAAGGAAAAAGCTTATCTTGAAATGTTGAAGGCGAAAATGATCGACGG
++
+AAA/AEEEEEEEEEEEEEEEEEEEEE6EEEEEEEAEEEEEEEEEEEE6EEEEEEEEEEEEEEEEEEEEE//AE/E<EEEEEEEEAE/EEEEEEEEEEEEEEEEEE<EEEEEEEEAEEAEEE<<EEEAAEEEEEAAAEEEEEEEEEAAA6EE
+@NS500443:42:H3MH2AFXX:1:11101:17702:11983/1
+TTGGTAGACCGAGTGATTCCGATGTTGCCGCATAAACTTTCAAATGGAATTTGTTCGCTGAATCCGCAAGTGGATCGCTTTACGCTTAGCTGTGTGATGGAAATTGATGCGGACGGGCAAGTCGTGAATCACGAGATTTTTGAAAGTGTGA
++
+AAAAAEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEE
+@NS500443:42:H3MH2AFXX:1:11101:11233:12467/1
+GTATTTGCGGCATGTGAAAGAGCAAATGGGCGATTTGCCAGTTGCGATTGAATTTCGGAATAGCAGCTGGTATAGTGATGCCAATTATGAAAAAACGCTAGCGCTACTGACTGAACTTGGATTCATTCACGTGGTTGTCGATGAGCCGCAA
++
+AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEAE<<AAEA
diff --git a/rock-doc/main.c b/rock-doc/main.c
deleted file mode 100644
index 582b52c40c21d7cfb9d0883e75c808f105e08154..0000000000000000000000000000000000000000
--- a/rock-doc/main.c
+++ /dev/null
@@ -1,18 +0,0 @@
-//
-// main.c
-// rock-doc
-//
-// Created by vlegrand on 07/12/15.
-// Copyright (c) 2015 vlegrand. All rights reserved.
-//
-
-#include <stdio.h>
-
-int main(int argc, const char * argv[])
-{
-
- // insert code here...
- printf("Hello, World!\n");
- return 0;
-}
-
diff --git a/rock-doc/rock_doc.1 b/rock-doc/rock_doc.1
deleted file mode 100644
index f00fd075e996374307e295e5025fc854d48919d5..0000000000000000000000000000000000000000
--- a/rock-doc/rock_doc.1
+++ /dev/null
@@ -1,79 +0,0 @@
-.\"Modified from man(1) of FreeBSD, the NetBSD mdoc.template, and mdoc.samples.
-.\"See Also:
-.\"man mdoc.samples for a complete listing of options
-.\"man mdoc for the short list of editing options
-.\"/usr/share/misc/mdoc.template
-.Dd 07/12/15 \" DATE
-.Dt rock-doc 1 \" Program name and manual section number
-.Os Darwin
-.Sh NAME \" Section Header - required - don't modify
-.Nm rock-doc,
-.\" The following lines are read in generating the apropos(man -k) database. Use only key
-.\" words here as the database is built based on the words here and in the .ND line.
-.Nm Other_name_for_same_program(),
-.Nm Yet another name for the same program.
-.\" Use .Nm macro to designate other names for the documented program.
-.Nd This line parsed for whatis database.
-.Sh SYNOPSIS \" Section Header - required - don't modify
-.Nm
-.Op Fl abcd \" [-abcd]
-.Op Fl a Ar path \" [-a path]
-.Op Ar file \" [file]
-.Op Ar \" [file ...]
-.Ar arg0 \" Underlined argument - use .Ar anywhere to underline
-arg2 ... \" Arguments
-.Sh DESCRIPTION \" Section Header - required - don't modify
-Use the .Nm macro to refer to your program throughout the man page like such:
-.Nm
-Underlining is accomplished with the .Ar macro like this:
-.Ar underlined text .
-.Pp \" Inserts a space
-A list of items with descriptions:
-.Bl -tag -width -indent \" Begins a tagged list
-.It item a \" Each item preceded by .It macro
-Description of item a
-.It item b
-Description of item b
-.El \" Ends the list
-.Pp
-A list of flags and their descriptions:
-.Bl -tag -width -indent \" Differs from above in tag removed
-.It Fl a \"-a flag as a list item
-Description of -a flag
-.It Fl b
-Description of -b flag
-.El \" Ends the list
-.Pp
-.\" .Sh ENVIRONMENT \" May not be needed
-.\" .Bl -tag -width "ENV_VAR_1" -indent \" ENV_VAR_1 is width of the string ENV_VAR_1
-.\" .It Ev ENV_VAR_1
-.\" Description of ENV_VAR_1
-.\" .It Ev ENV_VAR_2
-.\" Description of ENV_VAR_2
-.\" .El
-.Sh FILES \" File used or created by the topic of the man page
-.Bl -tag -width "/Users/joeuser/Library/really_long_file_name" -compact
-.It Pa /usr/share/file_name
-FILE_1 description
-.It Pa /Users/joeuser/Library/really_long_file_name
-FILE_2 description
-.El \" Ends the list
-.\" .Sh DIAGNOSTICS \" May not be needed
-.\" .Bl -diag
-.\" .It Diagnostic Tag
-.\" Diagnostic informtion here.
-.\" .It Diagnostic Tag
-.\" Diagnostic informtion here.
-.\" .El
-.Sh SEE ALSO
-.\" List links in ascending order by section, alphabetically within a section.
-.\" Please do not reference files that do not exist without filing a bug report
-.Xr a 1 ,
-.Xr b 1 ,
-.Xr c 1 ,
-.Xr a 2 ,
-.Xr b 2 ,
-.Xr a 3 ,
-.Xr b 3
-.\" .Sh BUGS \" Document known, unremedied bugs
-.\" .Sh HISTORY \" Document history if command behaves in a unique manner
\ No newline at end of file
diff --git a/src/fqreader.cpp b/src/fqreader.cpp
new file mode 100644
index 0000000000000000000000000000000000000000..7171d022ff9dcad39aa14dc986f0b866f824a1c4
--- /dev/null
+++ b/src/fqreader.cpp
@@ -0,0 +1,115 @@
+/*
+ * fqreader.cpp
+ *
+ * Created on: Dec 8, 2015
+ * Author: vlegrand
+ */
+#include <stdio.h>
+//#include <stdlib.h>
+#include <fcntl.h>
+#include <unistd.h>
+#include <errno.h>
+#include <err.h>
+#include <limits.h>
+
+//#include "srp.h"
+#include "fqreader.h"
+
+const size_t bufsize=10240;
+// const size_t nb_reads=6; /* for my tests for the moment */
+
+rpos init_rpos(unsigned char f_id, unsigned long rstart_offset) {
+ rpos rp;
+ rp.fileid=f_id <<4;
+ unsigned long j,k;
+ k=rstart_offset%INT_MAX;
+ j=rstart_offset/INT_MAX;
+ rp.read_a1=rstart_offset-INT_MAX*j;
+ return rp;
+}
+
+
+/*
+ * Assume qualiy is phred 32.
+ * Main idea : a fqreader component takes as input files containing single reads or files containing PE reads and fills a structure on which other components can work on...
+ */
+void processBuf(char * buf,int nread,unsigned char f_id,unsigned long cur_offset, srp * io_sr) {
+ int cnt=0;
+ unsigned int s;
+ static unsigned int st;
+ static int num_l_in_rec; /* counter to know on which line inside the fastq record we are */
+ static int qual_score=0;
+ static unsigned long rstart_offset;
+ char * pchar=buf;
+ while (cnt<=nread-1) {
+ switch (*pchar){
+ case k_read_id_start: {
+ rstart_offset=cur_offset-nread+cnt;
+ num_l_in_rec=1; }
+ break;
+ case k_read_qual_start: {
+ qual_score=1;
+ st=0;}
+ break;
+ case '\n': {
+ num_l_in_rec+=1;
+ if (num_l_in_rec==5) {qual_score=0;/* end of fastq record */
+ // debug stuff
+ /*printf("\nquality score is : %d \n",st);
+ printf("read start_offset is %lu \n",rstart_offset);*/
+ rpos rp=init_rpos(f_id,rstart_offset);
+ i_dim& ref_i_dim=(*io_sr)[st/K_SCORE_NORM_FACTOR];
+ k_dim& ref_k_dim=ref_i_dim[rstart_offset/INT_MAX];
+ ref_k_dim.push_back(rp);
+ }
+ }
+ break;
+ default:
+ { if (qual_score==1) {
+ s=(int)*pchar;
+ s-=k_phred_32;
+ st+=s;
+ }
+ }
+ }
+ pchar++;
+ cnt++;
+ }
+}
+
+/*
+ * Processes 1 file containing single reads
+ */
+void processSingleFile(char * fq_s,unsigned char f_id, srp* io_sr) {
+ FILE * fp;
+ int st,s;
+ int cnt,nread;
+ unsigned long cur_offset,rstart_offset;
+ mode_t mode = S_IRUSR | S_IWUSR | S_IRGRP | S_IROTH;
+ char buf[bufsize];
+ int f_single=open(fq_s,O_RDONLY,mode);
+ if (f_single==-1) {
+ err(errno,"cannot open file: %s.",fq_s);
+ }
+
+ fp=fdopen(f_single,"r");
+ if (fp==NULL) {
+ err(errno,"cannot open file: %s.",fq_s);
+ }
+
+ /* for each read, we want : offset, filenb, total quality score. */
+ while ((nread=read(f_single,buf,bufsize))!=0) {
+ // printf("%s",buf);
+ cur_offset=ftell(fp);
+ processBuf((char *)&buf,nread,f_id,cur_offset,io_sr);
+ }
+ close(f_single);
+
+}
+
+/* Processes 1 pair of files containing PE reads.*/
+void processPEFiles(char * fq_1, int f_id1,char * gq_2, int f_id2,srp * io_sr ) {
+
+}
+
+
diff --git a/src/fqreader.h b/src/fqreader.h
new file mode 100644
index 0000000000000000000000000000000000000000..7a319d649baec1f51d70dbedbe2a36d857d7ab3e
--- /dev/null
+++ b/src/fqreader.h
@@ -0,0 +1,19 @@
+/*
+ * fqreader.h
+ *
+ * Created on: Dec 8, 2015
+ * Author: vlegrand
+ */
+#ifndef FQREADER_H
+#define FQREADER_H
+#include "srp.h"
+
+#define k_read_id_start '@'
+#define k_read_qual_start '+'
+#define k_phred_32 33
+
+
+/*void processBuf(char * buf,int nread,int cur_offset);*/
+void processSingleFile(char *, unsigned char, srp*);
+void processPEFiles(char * fq_1, int f_id1,char * gq_2, int f_id2,srp *io_sr );
+#endif
diff --git a/src/rock.c b/src/rock.c
deleted file mode 100644
index e8f25abe801a299792e6ccd3291de661a930db19..0000000000000000000000000000000000000000
--- a/src/rock.c
+++ /dev/null
@@ -1,102 +0,0 @@
-/*
- ============================================================================
- Name : rock.c
- Author : Véronique Legrand
- Version :
- Copyright : Your copyright notice
- Description : Program in C, Ansi-style
- ============================================================================
- */
-
-#include <stdio.h>
-#include <stdlib.h>
-#include <fcntl.h>
-#include <unistd.h>
-#include <errno.h>
-#include <err.h>
-
-#define k_read_id_start '@'
-#define k_read_qual_start '+'
-#define k_phred_32 33
-
-/*
- * Assume qualiy is phred 32.
- */
-void processBuf(char * buf,int nread,int cur_offset) {
- int cnt;
- int s;
- static int st;
- static int num_l_in_rec; /* counter to know on which line inside the fastq record we are */
- static int qual_score=0;
- static int rstart_offset;
- char * pchar=buf;
- while (cnt<=nread-1) {
- switch (*pchar){
- case k_read_id_start: {
- rstart_offset=cur_offset-nread+cnt;
- num_l_in_rec=1; }
- break;
- case k_read_qual_start: {
- qual_score=1;
- st=0;}
- break;
- case '\n': {
- num_l_in_rec+=1;
- if (num_l_in_rec==5) {qual_score=0;/* end of fastq record */
- // debug stuff
- printf("\nquality score is : %d \n",st);
- }
- }
- break;
- default:
- { if (qual_score==1) {
- s=(int)*pchar;
- s-=k_phred_32;
- /*printf("%c %d\n",*pchar,s);*/
- st+=s;
- }
- }
- }
- pchar++;
- cnt++;
-
- }
-}
-
-int main(void) {
- /* 1rst step : read a fastq and compute quality score for each record (PE or single) */
- char * fq_pe1="../data/LM201200065_S106_R1.TM.fq";
- char * fq_pe2="../data/LM201200065_S106_R2.TM.fq";
- char * fq_s="../data/LM201200065_S106_RS.TM.fq";
- char* fq_s_test="data/test_single.fq";
-
- int st,s;
- int cnt,nread;
-
- size_t bufsize=10240;
- char buf[bufsize];
- mode_t mode = S_IRUSR | S_IWUSR | S_IRGRP | S_IROTH;
- int cur_offset,rstart_offset;
- FILE * fp;
- char * pchar;
-
- /* Let's start with the easiest case : single reads. */
- int f_single=open(fq_s_test,O_RDONLY,mode);
- if (f_single==-1) {
- err(errno,"cannot open file: %s.",fq_s_test);
- }
-
- fp=fdopen(f_single,"r");
- if (fp==NULL) {
- err(errno,"cannot open file: %s.",fq_s_test);
- }
-
- /* for each read, we want : offset, filenb, total quality score. */
- while((nread=read(f_single,buf,bufsize))!=0) {
- printf("%s",buf);
- cur_offset=ftell(fp);
- processBuf((char *)&buf,nread,cur_offset);
- }
- close(f_single);
- return EXIT_SUCCESS;
-}
diff --git a/src/rock.cpp b/src/rock.cpp
new file mode 100644
index 0000000000000000000000000000000000000000..dea30b58558f02e3ce68eddadee5de87274693a6
--- /dev/null
+++ b/src/rock.cpp
@@ -0,0 +1,92 @@
+/*
+ ============================================================================
+ Name : rock.c
+ Author : Véronique Legrand
+ Version :
+ Copyright : Your copyright notice
+ Description : see : https://projets.pasteur.fr/projects/homogeneisation-couverture-pre-assemblage/wiki
+ ============================================================================
+ */
+
+#include <stdio.h>
+#include <stdlib.h>
+#include <fcntl.h>
+#include <unistd.h>
+#include <errno.h>
+#include <err.h>
+#include <string.h>
+
+#include "srp.h"
+#include "fqreader.h"
+
+#define k_max_input_files 15
+
+
+
+
+
+int main(void) {
+ /* 1rst step : read a fastq and compute quality score for each record (PE or single) */
+ char * fq_pe1="../data/LM201200065_S106_R1.TM.fq";
+ char * fq_pe2="../data/LM201200065_S106_R2.TM.fq";
+ char * fq_s="../data/LM201200065_S106_RS.TM.fq";
+ char* fq_s_test="data/test_single.fq";
+
+ /* All these data will be given from input. */
+ char ** list_single=(char *[]){"../data/LM201200065_S106_RS.TM.fq"};
+ int nb_single=1;
+ char ** list_pe=(char *[]) {"../data/LM201200065_S106_R1.TM.fq",
+ "../data/LM201200065_S106_R2.TM.fq"};
+ int nb_pairs=1;
+
+
+ char ** l_files; /* array of filenames; indexed on fileid */
+ int maxlen=0;
+ int len;
+
+ int cnt;
+ int nb_all=nb_pairs*2+nb_single; /* TODO : check that nb_all doesn't exceed 15. We only have 4 bits to store fileid in memory! */
+
+
+ for (cnt=0;cnt<nb_pairs;cnt++) {
+ char * pe1=list_pe[0];
+ len=strlen(pe1);
+ if (len>maxlen) maxlen=len;
+ char * pe2=list_pe[1];
+ len=strlen(pe2);
+ if (len>maxlen) maxlen=len;
+ list_pe+=2;
+ }
+
+ for (cnt=0;cnt<nb_single;cnt++) {
+ char * single=list_single[0];
+ len=strlen(single);
+ if (len>maxlen) maxlen=len;
+ list_single++;
+ }
+
+ l_files=(char **) malloc((nb_all)*(maxlen+1));
+
+ for (cnt=0;cnt<nb_pairs*2;cnt++) {
+ if (list_pe!=NULL) strcpy(l_files[cnt],list_pe[cnt]);
+ }
+ for (cnt=nb_pairs*2;cnt<nb_all;cnt++) {
+ if (list_single!=NULL) strcpy(l_files[cnt],list_single[cnt-nb_pairs*2]);
+ }
+
+ /* process files. Sequential processing for the moment.
+ * fileid is file position inside l_files array starting at 1.
+ */
+ srp all_sr;
+ cnt=0;
+ while (cnt<2*nb_pairs) {
+ processPEFiles(l_files[cnt],cnt+1,l_files[cnt+1],cnt+2,&all_sr);
+ cnt+=2;
+ }
+ while (cnt<nb_all) {
+ processSingleFile(l_files[cnt],cnt+1,&all_sr);
+ cnt+=1;
+ }
+
+ return EXIT_SUCCESS;
+}
diff --git a/src/srp.h b/src/srp.h
new file mode 100644
index 0000000000000000000000000000000000000000..1941b1699ecf8ac32ff498e8bec75dbcb35d8860
--- /dev/null
+++ b/src/srp.h
@@ -0,0 +1,27 @@
+/*
+ * srp.h
+ *
+ * Created on: Jan 4, 2016
+ * Author: vlegrand
+ */
+
+#ifndef SRP_H_
+#define SRP_H_
+
+#include <vector>
+#include <map>
+
+#define K_SCORE_NORM_FACTOR 1000
+
+typedef struct { /* Here store read offset in file whose id is fileid.*/
+ unsigned char fileid;
+ unsigned long read_a1;
+ unsigned long read_a2;
+}rpos;
+
+typedef std::vector<rpos> k_dim;
+typedef std::map<unsigned long,k_dim> i_dim;
+typedef std::map<unsigned long,i_dim> srp;
+
+
+#endif /* SRP_H_ */
diff --git a/src/srp_old.h b/src/srp_old.h
new file mode 100644
index 0000000000000000000000000000000000000000..89f06b6e5456711be0d4fe1f311d6eb5e2a47f64
--- /dev/null
+++ b/src/srp_old.h
@@ -0,0 +1,30 @@
+/*
+ * srp.h
+ *
+ * Created on: Dec 8, 2015
+ * Author: vlegrand
+ *
+ * SRP stands for score-read position. Indeed, this structure assoiates a score with a read's position inthe input fq file.
+ */
+
+#ifndef SRP_H_
+#define SRP_H_
+
+typedef struct { /* Here store read offset in file whose id is fileid.*/
+ char fileid;
+ unsigned long read_a1;
+}rpos;
+
+char ** l_files; /* array of filenames; indexed on fileid */
+
+typedef rpos *** srp;
+
+/*
+ * Physically, srp is :
+ * An array indexed on read total score (Arr1).
+ * Arr1 contains pointers to other other arrays (Arr2).
+ * Arr2 is indexed on something that is deduced from offset (read position in a file).
+ * Arr2 contains pointers to array of rpos structures.
+ */
+
+#endif /* SRP_H_ */
diff --git a/src/unit_test_fqreader.cpp b/src/unit_test_fqreader.cpp
new file mode 100644
index 0000000000000000000000000000000000000000..43d3b3ad843a8a174c994d0e82104b3175ea6ba4
--- /dev/null
+++ b/src/unit_test_fqreader.cpp
@@ -0,0 +1,73 @@
+/*
+ * unit_test_fqreader.cpp
+ *
+ * Created on: Dec 8, 2015
+ * Author: vlegrand
+ * unit testing for the fqreader component.
+ * Keep using assert for the moment, don't want to add a dependency on boost (or any other test framework) just for the tests.
+ */
+#include <stdio.h>
+#include <iostream>
+#include <limits.h>
+#include <assert.h>
+#include <stdlib.h>
+#include "srp.h"
+#include "fqreader.h"
+
+using namespace std;
+
+void test_processSingleFile() {
+ printf("MAX_UINT=%u \n",UINT_MAX);
+ srp sr;
+ unsigned char f_id=1;
+ processSingleFile((char *) "data/test_single.fq",f_id,&sr);
+ srp::reverse_iterator rit;
+ i_dim::iterator it_offs;
+ k_dim::iterator it_struct;
+
+ int cnt_read=0;
+
+ for (rit=sr.rbegin(); rit!=sr.rend(); ++rit) { //process map in reverse order (by decreasing scores).
+ // cout << "score="<<rit->first<<endl;
+ unsigned long score=rit->first;
+ assert(score==5);
+ for (it_offs=rit->second.begin();it_offs!=rit->second.end();it_offs++) {
+ unsigned long offset_quotient=it_offs->first;
+ assert(offset_quotient==0);
+ for (it_struct=it_offs->second.begin();it_struct!=it_offs->second.end();it_struct++) {
+ unsigned char fid_stored=it_struct->fileid;
+ assert(fid_stored >>4==f_id);
+ if (cnt_read==0) assert(it_struct->read_a1==0);
+ if (cnt_read==1) assert(it_struct->read_a1==350);
+ if (cnt_read==2) assert(it_struct->read_a1==699);
+ if (cnt_read==3) assert(it_struct->read_a1==1049);
+ if (cnt_read==4) assert(it_struct->read_a1==1400);
+ if (cnt_read==5) assert(it_struct->read_a1==1751);
+ cnt_read++;
+ /*int tmp=fid_stored >>4;
+ cout<<" fileid="<<tmp<<" read_a1="<<it_struct->read_a1<<endl;*/
+ }
+ }
+ }
+ assert(cnt_read==6);
+}
+
+void test_processPEFiles() {
+ char * fq_1_test=(char *) "data/test_PE1.fq";
+ char * fq_2_test=(char *) "data/test_PE2.fq";
+
+}
+
+void test_processAllFiles() {
+
+}
+
+int main(int argc, char **argv) {
+ /*char* fq_s_test="data/test_single.fq";*/
+ test_processSingleFile();
+ test_processPEFiles();
+ test_processAllFiles(); /* mix PE together with single; nearly as in real life.*/
+
+
+ /*void test_processPEFiles(fq_1_test,fq_2_test);*/
+}