diff --git a/data/test_PE1.fq b/data/test_PE1.fq
new file mode 100644
index 0000000000000000000000000000000000000000..6be87976ca245fb623439e8dcd85285dd2da1561
--- /dev/null
+++ b/data/test_PE1.fq
@@ -0,0 +1,12 @@
+@NS500443:42:H3MH2AFXX:1:11101:1162:1066/1
+AGATCAAACTACTTGCCTCGCTTGAAAAAAGCATCGAGATTCATAATGACGCTGGTGTTGTAACGGCAGATTTGCTGCTTGCTCGGGTTTTACGGTATGATTTTTCAAGTGATGTATTTGACGAAGAAAAGGAGTATATTTTACCAGAATT
++
+/A6AAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EAEEEEEEEEEEEEAEEEEEEE<EEEEEEEAE<EEEEEE
+@NS500443:42:H3MH2AFXX:1:11101:7372:1069/1
+TTCCAGAAGCGGATTATTTGCAGGAACTGCGGCGGTTTTTCTATCAAGACGAACGGCAAACTTATTCGAATGAAGCTGTTGCTAACCGTTTTTATGAGCATTTTGATGTCGTCTATGAAAAACGAATAACGAAACAGAAAACGTTACAAAA
++
+AAAAAEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEE<EE<EEEEEEEEEEEE/EEEE<EEEEEEEEEEEEEEEEEEE/AEEAAAEEEEEEEE/EEEEEEEE
+@NS500443:42:H3MH2AFXX:1:11101:17849:1071/1
+ACAGTAACGCGCGCATGGTAATCCCCGTATTGTGCAAGACGTTCAGCAAACTCATTTCCAGACATAACACCTTCAGCAACAACAATGATGCTGTGCTTTTTACCACGTTCACGTCCCTTATTAAGACGCCCTACAATATCATCCATGTTAA
++
+AAAAAE6EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEAEEEEEEEEEE/EEAEE/EEAEAEAEEEEE</E//EE/EEEEEEEEEA<EEAAAEEEEEAEEEEAA<AE/EA<AEEEAEEE/EAEAEEEEEEEEEAEEEEEEEEEA/
diff --git a/data/test_PE2.fq b/data/test_PE2.fq
new file mode 100644
index 0000000000000000000000000000000000000000..c5b32694dcbf3f985ff71bc819ebe551b9bfed35
--- /dev/null
+++ b/data/test_PE2.fq
@@ -0,0 +1,12 @@
+@NS500443:42:H3MH2AFXX:1:11101:1162:1066/2
+CCCTAGAATTATAGTTCAGTTTAGTTCCAAATAGGGTCACAAAATGTGATAGACAGGTCCCGTTCCATACCAAAAAAACTTGGTACTCCGCACTATTCAATTAGCGGTTAACATTCACTTTGGAACGAAGTCTATACAGCCACATAATTTG
++
+AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEAEEEAEEEEE<EEEEEAEEEEEA/EEEAAEE<EAAEEAEEEE<EEEEEEEEE/EAE<EAEEEEEEE
+@NS500443:42:H3MH2AFXX:1:11101:7372:1069/2
+GGTGTTGTTGCAAGTTCCGCATCTAAAATGTCGACGCCACCTGCTTTTAAAACCGACACCAGTTTAGCCTTGATCCGCTCAGCAGAAAGCCTACTATCATGTCCGATAGCGACCACTATTTTTTCTTTTGGAGTTTTTTTCTTTTGCAAGA
++
+AAAAAEEEEEEEEEEEEEEEEEEEEAEEEEEEAEEEEE/EAEEAEEEEEEEEEEE/EAEEEEEEEEEEE<EE<EEEAEEE/EEEEEEEEEEEAEEEEEEEAEEEE/EEEEE/EEEEEEEEEAEEE</E<EEE/EAEEEE<<A/EEAE<EEA
+@NS500443:42:H3MH2AFXX:1:11101:17849:1071/2
+GTGGAGACGGTTCTTATCACGGTGCTGAGGCTCTTACTAAACGTGGTTTCCCAACAATTGGAATTCCGGGAACAATCGATAATGATATTTCAGGAACAGACTTCACAATAGGTTTCGATACAGCGCTAAATACAGTTTTAGACGCACTTGA
++
+AAAAAE6EE6EEEEEEEE/EEEEAE6EEAEEEEEEAEEEAEAEAEEEEEEAEAE6EEEEEEEEEEEAEEEAEEEEEEEEEEEEA6EAEAEA/AEAEE6EA6EEE<A/EE/EEEE//E/<AE/6AEAE//EEEAAEE/AA6E<AAEA6EAEA
diff --git a/src/FqAuxBackend.cpp b/src/FqAuxBackend.cpp
new file mode 100644
index 0000000000000000000000000000000000000000..f97f7857e0c1c248a93ca501f47d5a36bad4c942
--- /dev/null
+++ b/src/FqAuxBackend.cpp
@@ -0,0 +1,115 @@
+/*
+ * FqAuxProcessor.cpp
+ *
+ * Created on: Jan 7, 2016
+ * Author: vlegrand
+ */
+
+#include "FqConstants.h"
+#include <stdio.h>
+//#include <stdlib.h>
+#include <fcntl.h>
+#include <unistd.h>
+#include <errno.h>
+#include <err.h>
+#include "FqAuxBackend.h"
+
+
+
+int FqAuxBackend::getNextRead(rinfo * p_nr) {
+ rinfo nr;
+ int rfound=0;
+ int eof=0;
+
+ while (!rfound) {
+ if (pos_in_buf>=nread-1) readBuffer();
+ if (nread==0) { eof=1; break;}
+ rfound=processBuffer(p_nr);
+ }
+ return eof;
+}
+
+int FqAuxBackend::processBuffer(rinfo * p_nr) {
+ unsigned int s;
+ static unsigned int st;
+ static int num_l_in_rec; /* counter to know on which line inside the fastq record we are */
+ static int qual_score=0;
+ static unsigned long rstart_offset;
+ char * pchar=buf+pos_in_buf;
+ int rfound=0;
+ while (pos_in_buf<=nread-1 && !rfound) {
+ switch (*pchar){
+ case k_read_id_start: {
+ rstart_offset=cur_offset-nread+pos_in_buf;
+ num_l_in_rec=1; }
+ break;
+ case k_read_qual_start: {
+ qual_score=1;
+ st=0;}
+ break;
+ case '\n': {
+ num_l_in_rec+=1;
+ if (num_l_in_rec==5) {qual_score=0;/* end of fastq record */
+ // debug stuff
+ /*printf("\nquality score is : %d \n",st);
+ printf("read start_offset is %lu \n",rstart_offset);*/
+ p_nr->f_id=f_id;
+ p_nr->score=st;
+ p_nr->rstart_offset=rstart_offset;
+ rfound=1;
+ }
+ }
+ break;
+ default:
+ { if (qual_score==1) {
+ s=(int)*pchar;
+ s-=k_phred_32;
+ st+=s;
+ }
+ }
+ }
+ pchar++;
+ pos_in_buf++;
+ }
+ return rfound;
+}
+
+
+void FqAuxBackend::readBuffer() {
+ if ((nread=read(f_pe2,buf,bufsize))!=0) {
+ cur_offset=ftell(fp2);
+ pos_in_buf=0;
+ }
+}
+/*
+ * Opens file and performs the fist read operation.
+ */
+void FqAuxBackend::openFile(char * ficname, unsigned char id) {
+ int st,s;
+ // unsigned long cur_offset;
+ mode_t mode = S_IRUSR | S_IWUSR | S_IRGRP | S_IROTH;
+
+ closeFile();
+ filename=ficname;
+ f_id=id;
+
+ f_pe2=open(filename,O_RDONLY,mode);
+ if (f_pe2==-1) {
+ err(errno,"cannot open file: %s.",filename);
+ }
+
+ fp2=fdopen(f_pe2,"r");
+ if (fp2==NULL) {
+ err(errno,"cannot open file: %s.",filename);
+ }
+
+ }
+
+void FqAuxBackend::closeFile() {
+ if (filename!=NULL) {
+ close(f_pe2);
+ filename=NULL;
+ }
+ }
+
+
diff --git a/src/FqAuxBackend.h b/src/FqAuxBackend.h
new file mode 100644
index 0000000000000000000000000000000000000000..bc767e6c1c98960879a264c8f1c325feea2d9909
--- /dev/null
+++ b/src/FqAuxBackend.h
@@ -0,0 +1,46 @@
+/*
+ * FqAuxProcessor.h
+ *
+ * Created on: Jan 7, 2016
+ * Author: vlegrand
+ */
+
+#ifndef FQAUXBACKEND_H_
+#define FQAUXBACKEND_H_
+
+#include "srp.h"
+const size_t bufsize=10240;
+
+class FqAuxBackend {
+ char * filename;
+ unsigned char f_id;
+ char buf[bufsize];
+ int nread;
+ int f_pe2; // for calling read
+ FILE * fp2; // for calling ftell
+ unsigned long cur_offset;
+ int pos_in_buf;
+
+ void readBuffer();
+ int processBuffer(rinfo * p_nr);
+
+public:
+
+ FqAuxBackend() {
+ filename=NULL;
+ f_pe2=-1;
+ fp2=NULL;
+ f_id=0;
+ cur_offset=0;
+ nread=0;
+ pos_in_buf=bufsize; // do that to force first reading in buffer.
+ }
+
+ void openFile(char * ficname, unsigned char id);
+
+ void closeFile();
+ int getNextRead(rinfo *);
+
+};
+
+#endif /* FQAUXBACKEND_H_ */
diff --git a/src/FqConstants.h b/src/FqConstants.h
new file mode 100644
index 0000000000000000000000000000000000000000..e41463a17efac020316b8347839baf4ee6f7df9f
--- /dev/null
+++ b/src/FqConstants.h
@@ -0,0 +1,15 @@
+/*
+ * FqConstants.h
+ *
+ * Created on: Jan 7, 2016
+ * Author: vlegrand
+ */
+
+#ifndef FQCONSTANTS_H_
+#define FQCONSTANTS_H_
+
+#define k_read_id_start '@'
+#define k_read_qual_start '+'
+#define k_phred_32 33
+
+#endif /* FQCONSTANTS_H_ */
diff --git a/src/FqMainBackend.cpp b/src/FqMainBackend.cpp
new file mode 100644
index 0000000000000000000000000000000000000000..c8d4214adf2d8d9f180d5bfcfad195b1fbd29aa3
--- /dev/null
+++ b/src/FqMainBackend.cpp
@@ -0,0 +1,114 @@
+/*
+ * FqMainProcessor.cpp
+ *
+ * Created on: Jan 7, 2016
+ * Author: vlegrand
+ */
+
+#include <stdio.h>
+//#include <stdlib.h>
+#include <fcntl.h>
+#include <unistd.h>
+#include <errno.h>
+#include <err.h>
+#include <limits.h>
+#include <assert.h>
+
+#include "FqMainBackend.h"
+#include "srp.h"
+
+rpos init_rpos(unsigned char f_id, unsigned long rstart_offset) {
+ rpos rp;
+ rp.fileid=f_id <<4;
+ rp.read_a1=rstart_offset%INT_MAX;
+ return rp;
+}
+
+/*
+ * Add Paired read information to already existing rpos structure.
+ */
+void update_rpos(unsigned char f_id,unsigned long rstart_offset,unsigned long j, rpos * rp) {
+ rp->fileid=rp->fileid|f_id;
+ rp->read_a2=rstart_offset-INT_MAX*j;
+}
+
+
+void FqMainBackend::processFile(char * filename,unsigned char f_id) {
+ FILE * fp;
+ int st,s;
+ int cnt,nread;
+ unsigned long cur_offset;
+ mode_t mode = S_IRUSR | S_IWUSR | S_IRGRP | S_IROTH;
+ char buf[bufsize];
+ int f_single=open(filename,O_RDONLY,mode);
+ if (f_single==-1) {
+ err(errno,"cannot open file: %s.",filename);
+ }
+
+ fp=fdopen(f_single,"r");
+ if (fp==NULL) {
+ err(errno,"cannot open file: %s.",filename);
+ }
+
+ /* for each read, we want : offset, filenb, total quality score. */
+ while ((nread=read(f_single,buf,bufsize))!=0) {
+ // printf("%s",buf);
+ cur_offset=ftell(fp);
+ processBuf((char *)&buf,nread,f_id,cur_offset);
+ }
+ close(f_single);
+
+}
+
+
+void FqMainBackend::processBuf(char * buf,int nread,unsigned char f_id,unsigned long cur_offset) {
+ int cnt=0;
+ unsigned int s;
+ static unsigned int st;
+ static int num_l_in_rec; /* counter to know on which line inside the fastq record we are */
+ static int qual_score=0;
+ static unsigned long rstart_offset;
+ char * pchar=buf;
+ while (cnt<=nread-1) {
+ switch (*pchar){
+ case k_read_id_start: {
+ rstart_offset=cur_offset-nread+cnt;
+ num_l_in_rec=1; }
+ break;
+ case k_read_qual_start: {
+ qual_score=1;
+ st=0;}
+ break;
+ case '\n': {
+ num_l_in_rec+=1;
+ if (num_l_in_rec==5) {qual_score=0;/* end of fastq record */
+ // debug stuff
+ /*printf("\nquality score is : %d \n",st);
+ printf("read start_offset is %lu \n",rstart_offset);*/
+ rpos rp=init_rpos(f_id,rstart_offset);
+ if (p_auxFqProcessor!=NULL) {
+ rinfo pe2info;
+ int eof=p_auxFqProcessor->getNextRead(&pe2info);
+ assert(!eof); // There should be the same number of reads in both PE files.
+ st+=pe2info.score;
+ unsigned long j=rstart_offset/INT_MAX;
+ update_rpos(pe2info.f_id,pe2info.rstart_offset,j,&rp);
+ }
+ i_dim& ref_i_dim=(*p_scoreReadStruct)[st/K_SCORE_NORM_FACTOR];
+ k_dim& ref_k_dim=ref_i_dim[rstart_offset/INT_MAX];
+ ref_k_dim.push_back(rp); }
+ }
+ break;
+ default:
+ { if (qual_score==1) {
+ s=(int)*pchar;
+ s-=k_phred_32;
+ st+=s;
+ }
+ }
+ }
+ pchar++;
+ cnt++;
+ }
+}
+
diff --git a/src/FqMainBackend.h b/src/FqMainBackend.h
new file mode 100644
index 0000000000000000000000000000000000000000..610a6a3b7be85d1de7fe1f7ff8c9a3659cb13dad
--- /dev/null
+++ b/src/FqMainBackend.h
@@ -0,0 +1,37 @@
+/*
+ * FqMainProcessor.h
+ *
+ * Created on: Jan 7, 2016
+ * Author: vlegrand
+ *
+ * Processes a fastq file (single or first of a pair of files that contain PE reads); Fills an srp data structure.
+ */
+
+#ifndef FQMAINBACKEND_H_
+#define FQMAINBACKEND_H_
+
+#include "FqAuxBackend.h"
+#include "FqConstants.h"
+
+class FqMainBackend {
+ FqAuxBackend * p_auxFqProcessor; /* Another fastq processor component is necessary for handling the case of PE reads.*/
+ srp * p_scoreReadStruct; /* Where we store information about the reads. */
+
+public:
+ FqMainBackend(srp * io_sr) {
+ p_scoreReadStruct=io_sr;
+ p_auxFqProcessor=NULL;
+ }
+
+
+
+ void setAuxProcessor(FqAuxBackend* fq2ndProc) {
+ p_auxFqProcessor=fq2ndProc;
+ }
+
+ void processFile(char * filename,unsigned char f_id);
+
+ void processBuf(char * buf,int nread,unsigned char f_id,unsigned long cur_offset);
+};
+
+#endif /* FQMAINBACKEND_H_ */
diff --git a/src/Makefile.am b/src/Makefile.am
index ecd0fde11583d36adedcaa6189fa33086b1a10d3..6763ca1aa7b40c095d98e690d0768270db99cb38 100644
--- a/src/Makefile.am
+++ b/src/Makefile.am
@@ -16,5 +16,5 @@ unit_test_fqreader_LDADD=librock.a
librock_a_SOURCES = $(SRC)
-SRC = fqreader.cpp
-HDR = srp.h fqreader.h
\ No newline at end of file
+SRC = fqreader.cpp FqAuxBackend.cpp FqMainBackend.cpp
+HDR = srp.h fqreader.h FqConstants.h FqAuxBackend.h FqMainBackend.h
\ No newline at end of file
diff --git a/src/fqreader.cpp b/src/fqreader.cpp
index 7171d022ff9dcad39aa14dc986f0b866f824a1c4..182a1d738c43be73808bb3e43ccb6816f2162023 100644
--- a/src/fqreader.cpp
+++ b/src/fqreader.cpp
@@ -14,102 +14,38 @@
//#include "srp.h"
#include "fqreader.h"
+#include "FqMainBackend.h"
+
+
+/*
+typedef struct {
+ char buf[bufsize];
+ unsigned char f_id;
+ int nread;
+ unsigned long cur_offset;
+}fastq_buf;*/
+
-const size_t bufsize=10240;
-// const size_t nb_reads=6; /* for my tests for the moment */
-rpos init_rpos(unsigned char f_id, unsigned long rstart_offset) {
- rpos rp;
- rp.fileid=f_id <<4;
- unsigned long j,k;
- k=rstart_offset%INT_MAX;
- j=rstart_offset/INT_MAX;
- rp.read_a1=rstart_offset-INT_MAX*j;
- return rp;
-}
-/*
- * Assume qualiy is phred 32.
- * Main idea : a fqreader component takes as input files containing single reads or files containing PE reads and fills a structure on which other components can work on...
- */
-void processBuf(char * buf,int nread,unsigned char f_id,unsigned long cur_offset, srp * io_sr) {
- int cnt=0;
- unsigned int s;
- static unsigned int st;
- static int num_l_in_rec; /* counter to know on which line inside the fastq record we are */
- static int qual_score=0;
- static unsigned long rstart_offset;
- char * pchar=buf;
- while (cnt<=nread-1) {
- switch (*pchar){
- case k_read_id_start: {
- rstart_offset=cur_offset-nread+cnt;
- num_l_in_rec=1; }
- break;
- case k_read_qual_start: {
- qual_score=1;
- st=0;}
- break;
- case '\n': {
- num_l_in_rec+=1;
- if (num_l_in_rec==5) {qual_score=0;/* end of fastq record */
- // debug stuff
- /*printf("\nquality score is : %d \n",st);
- printf("read start_offset is %lu \n",rstart_offset);*/
- rpos rp=init_rpos(f_id,rstart_offset);
- i_dim& ref_i_dim=(*io_sr)[st/K_SCORE_NORM_FACTOR];
- k_dim& ref_k_dim=ref_i_dim[rstart_offset/INT_MAX];
- ref_k_dim.push_back(rp);
- }
- }
- break;
- default:
- { if (qual_score==1) {
- s=(int)*pchar;
- s-=k_phred_32;
- st+=s;
- }
- }
- }
- pchar++;
- cnt++;
- }
-}
/*
* Processes 1 file containing single reads
*/
void processSingleFile(char * fq_s,unsigned char f_id, srp* io_sr) {
- FILE * fp;
- int st,s;
- int cnt,nread;
- unsigned long cur_offset,rstart_offset;
- mode_t mode = S_IRUSR | S_IWUSR | S_IRGRP | S_IROTH;
- char buf[bufsize];
- int f_single=open(fq_s,O_RDONLY,mode);
- if (f_single==-1) {
- err(errno,"cannot open file: %s.",fq_s);
- }
-
- fp=fdopen(f_single,"r");
- if (fp==NULL) {
- err(errno,"cannot open file: %s.",fq_s);
- }
-
- /* for each read, we want : offset, filenb, total quality score. */
- while ((nread=read(f_single,buf,bufsize))!=0) {
- // printf("%s",buf);
- cur_offset=ftell(fp);
- processBuf((char *)&buf,nread,f_id,cur_offset,io_sr);
- }
- close(f_single);
-
+ FqMainBackend be_fq=FqMainBackend(io_sr);
+ be_fq.processFile(fq_s,f_id);
}
/* Processes 1 pair of files containing PE reads.*/
-void processPEFiles(char * fq_1, int f_id1,char * gq_2, int f_id2,srp * io_sr ) {
-
+void processPEFiles(char * fq_1, unsigned char f_id1,char * fq_2, unsigned char f_id2,srp * io_sr ) {
+ FqMainBackend be_fq1=FqMainBackend(io_sr);
+ FqAuxBackend be_fq2=FqAuxBackend();
+ be_fq2.openFile(fq_2,f_id2);
+ be_fq1.setAuxProcessor(&be_fq2);
+ be_fq1.processFile(fq_1,f_id1);
+ be_fq2.closeFile();
}
diff --git a/src/fqreader.h b/src/fqreader.h
index 7a319d649baec1f51d70dbedbe2a36d857d7ab3e..cc664c7274125cabe3b764fa456a17a220720ec8 100644
--- a/src/fqreader.h
+++ b/src/fqreader.h
@@ -8,12 +8,10 @@
#define FQREADER_H
#include "srp.h"
-#define k_read_id_start '@'
-#define k_read_qual_start '+'
-#define k_phred_32 33
+
/*void processBuf(char * buf,int nread,int cur_offset);*/
void processSingleFile(char *, unsigned char, srp*);
-void processPEFiles(char * fq_1, int f_id1,char * gq_2, int f_id2,srp *io_sr );
+void processPEFiles(char * fq_1, unsigned char f_id1,char * gq_2, unsigned char f_id2,srp *io_sr );
#endif
diff --git a/src/srp.h b/src/srp.h
index 1941b1699ecf8ac32ff498e8bec75dbcb35d8860..488cd23e05825bf54aaaa11a988b72c7825eb874 100644
--- a/src/srp.h
+++ b/src/srp.h
@@ -13,12 +13,22 @@
#define K_SCORE_NORM_FACTOR 1000
-typedef struct { /* Here store read offset in file whose id is fileid.*/
+typedef struct { /* Here store read offset in files whose ids are stored in the fileid field .*/
unsigned char fileid;
unsigned long read_a1;
unsigned long read_a2;
}rpos;
+
+
+
+
+typedef struct {
+ unsigned int score; // total quality score for read.
+ unsigned long rstart_offset; // read offset in file
+ unsigned char f_id; // identifier of the file.
+}rinfo;
+
typedef std::vector<rpos> k_dim;
typedef std::map<unsigned long,k_dim> i_dim;
typedef std::map<unsigned long,i_dim> srp;
diff --git a/src/unit_test_fqreader.cpp b/src/unit_test_fqreader.cpp
index 43d3b3ad843a8a174c994d0e82104b3175ea6ba4..61db57c805ce0d701827f256565fede68b4287ee 100644
--- a/src/unit_test_fqreader.cpp
+++ b/src/unit_test_fqreader.cpp
@@ -17,7 +17,7 @@
using namespace std;
void test_processSingleFile() {
- printf("MAX_UINT=%u \n",UINT_MAX);
+ //printf("MAX_UINT=%u \n",UINT_MAX);
srp sr;
unsigned char f_id=1;
processSingleFile((char *) "data/test_single.fq",f_id,&sr);
@@ -28,7 +28,7 @@ void test_processSingleFile() {
int cnt_read=0;
for (rit=sr.rbegin(); rit!=sr.rend(); ++rit) { //process map in reverse order (by decreasing scores).
- // cout << "score="<<rit->first<<endl;
+ //cout << "score="<<rit->first<<endl;
unsigned long score=rit->first;
assert(score==5);
for (it_offs=rit->second.begin();it_offs!=rit->second.end();it_offs++) {
@@ -56,10 +56,94 @@ void test_processPEFiles() {
char * fq_1_test=(char *) "data/test_PE1.fq";
char * fq_2_test=(char *) "data/test_PE2.fq";
+ unsigned char f_id1=1;
+ unsigned char f_id2=2;
+
+ srp sr;
+
+ processPEFiles(fq_1_test, f_id1,fq_2_test, f_id2,&sr);
+ srp::reverse_iterator rit;
+ i_dim::iterator it_offs;
+ k_dim::iterator it_struct;
+ int cnt_read=0;
+
+ unsigned char masque=0x0F;
+
+ for (rit=sr.rbegin(); rit!=sr.rend(); ++rit) { //process map in reverse order (by decreasing scores).
+ // cout << "score="<<rit->first<<endl;
+ unsigned long score=rit->first;
+ if (cnt_read==0 || cnt_read==1) assert(score==10);
+ if (cnt_read==2) assert(score==9);
+ for (it_offs=rit->second.begin();it_offs!=rit->second.end();it_offs++) {
+ unsigned long offset_quotient=it_offs->first;
+ assert(offset_quotient==0);
+ for (it_struct=it_offs->second.begin();it_struct!=it_offs->second.end();it_struct++) {
+ unsigned char fid_stored=it_struct->fileid;
+ assert(fid_stored >>4==f_id1);
+ assert((fid_stored &masque)==f_id2);
+ if (cnt_read==0) {
+ assert(it_struct->read_a1==0);
+ assert(it_struct->read_a1==0);
+ }
+ if (cnt_read==1) {
+ //std::cout<<it_struct->read_a1<<" "<<it_struct->read_a2;
+ assert(it_struct->read_a1==349);
+ assert(it_struct->read_a2==349);
+ }
+ if (cnt_read==2) {
+ // std::cout<<it_struct->read_a1<<" "<<it_struct->read_a2;
+ assert(it_struct->read_a1==698);
+ assert(it_struct->read_a2==698);
+ }
+ cnt_read++;
+ /*
+ int tmp1=fid_stored >>4;
+ int tmp2=fid_stored &masque;
+ cout<<" fileid1="<<tmp1<<" read_a1="<<it_struct->read_a1<<endl;
+ cout<<" fileid2="<<tmp2<<" read_a2="<<it_struct->read_a2<<endl; */
+ }
+ }
+ }
+ assert(cnt_read==3);
}
void test_processAllFiles() {
+ char * fq_1_test=(char *) "data/test_PE1.fq";
+ char * fq_2_test=(char *) "data/test_PE2.fq";
+ char * fq_single=(char *) "data/test_single.fq";
+ unsigned char f_id1=1;
+ unsigned char f_id2=2;
+ unsigned char f_single=3;
+
+ srp sr;
+
+ processPEFiles(fq_1_test, f_id1,fq_2_test, f_id2,&sr);
+ processSingleFile(fq_single,f_single,&sr);
+
+ srp::reverse_iterator rit;
+ i_dim::iterator it_offs;
+ k_dim::iterator it_struct;
+ int cnt_read=0;
+
+ for (rit=sr.rbegin(); rit!=sr.rend(); ++rit) { //process map in reverse order (by decreasing scores).
+ // cout << "score="<<rit->first<<endl;
+ unsigned long score=rit->first;
+ if (cnt_read==0 || cnt_read==1) assert(score==10);
+ else if (cnt_read==2) assert(score==9);
+ else {
+ //cout << "score="<<rit->first<<endl;
+ assert(score==5);
+ }
+ for (it_offs=rit->second.begin();it_offs!=rit->second.end();it_offs++) {
+ unsigned long offset_quotient=it_offs->first;
+ assert(offset_quotient==0);
+ for (it_struct=it_offs->second.begin();it_struct!=it_offs->second.end();it_struct++) {
+ cnt_read++;
+ }
+ }
+ }
+ assert(cnt_read==9);
}
int main(int argc, char **argv) {
@@ -67,7 +151,4 @@ int main(int argc, char **argv) {
test_processSingleFile();
test_processPEFiles();
test_processAllFiles(); /* mix PE together with single; nearly as in real life.*/
-
-
- /*void test_processPEFiles(fq_1_test,fq_2_test);*/
}