diff --git a/unit-tests/test_GPUMapper.py b/unit-tests/test_GPUMapper.py
deleted file mode 100755
index 784b189177cff484940a1b0801d46ecfb7959953..0000000000000000000000000000000000000000
--- a/unit-tests/test_GPUMapper.py
+++ /dev/null
@@ -1,255 +0,0 @@
-##@file test_GPUMapper.py
-# Tests of the GPU_chunkMapper
-
-import unittest
-import os
-os.environ['PYOPENCL_COMPILER_OUTPUT'] = '1'
-
-import numpy as np
-import sys
-sys.path.append("..")
-
-from _modules.GPU_chunkMapper import GPU_chunkMapper,computeChunkSize,doMapping
-from _modules.IData_handling import refData,getChunk,readsExtractsS,dump_d_rinfo,load_d_rinfo
-from _modules.GPU_mappingResults import getGPUChunkMappingResults
-
-from data_refseq import refseq_list
-nb_sequences=len(refseq_list)
-from data_refseq import all_extracts_l
-nb_extracts=len(all_extracts_l)
-print "nb_extracts=",nb_extracts
-
-ficdir="./tmp"
-
-## Class containing all the testing functions of the GPU_chunkMapper.
-class TestGPUMapper (unittest.TestCase):
-    # def setUp(self):
-    #     try:
-    #        os.mkdir(ficdir)
-    #     except:
-    #        print "Couldn't create directory: ",ficdir,". Cannot run tests"
-    #        exit(1)
-    #
-    # def teadDown(self):
-    #     shutil.rmtree(ficdir)
-
-    def test_computeChunkSize(self):
-        mapper=GPU_chunkMapper()
-        mapper.dev_mem==1536*1024*1024 # have to force this value otherwise test result depends on platform.
-        seq_data=refData(refseq_list,20,"")
-        nb_extracts=1000
-        # let the mapper compute the necessary number of chunks
-        nb_chunks,max_chunk_size=computeChunkSize(mapper, seq_data, nb_extracts, "",wanted_nb_chunks=None)
-        self.assertEqual(nb_chunks,1)
-        self.assertEqual(max_chunk_size,nb_extracts)
-        # declare that we want to process the reads in at least 2 chunks.
-        nb_chunks, max_chunk_size = computeChunkSize(mapper, seq_data,nb_extracts, "",wanted_nb_chunks=2)
-        self.assertEqual(nb_chunks, 2)
-        self.assertEqual(max_chunk_size, (nb_extracts//2))
-        nb_chunks, max_chunk_size = computeChunkSize(mapper, seq_data, nb_extracts, "", wanted_nb_chunks=3)
-        self.assertEqual(nb_chunks, 4)
-        self.assertEqual(max_chunk_size, 332)
-
-
-
-    def test_getChunks(self):
-        cnt_chk=0
-        for RE,d_rinfo in getChunk("../test-data/Virome.fastq", 20, "",67580):
-            cnt_chk+=1
-        self.assertEqual(RE.nb_extracts,67580)
-        r_extracts_list=RE.r_extracts_list
-        self.assertEqual(cnt_chk,1)
-        cnt_chk = 0
-        siz=4*1407
-        for RE, d_rinfo in getChunk("../test-data/Virome.fastq", 20, "", 67580// 4//12):
-            if cnt_chk<12:
-                self.assertEqual(RE.nb_extracts,siz)
-            if cnt_chk == 0:
-                self.assertEqual(RE.r_extracts_list[0],r_extracts_list[0])
-                self.assertEqual(RE.r_extracts_list[siz-1],r_extracts_list[siz-1])
-            if cnt_chk == 3:
-                fic=os.path.join(ficdir,"d_rinfo3")
-                dump_d_rinfo(d_rinfo, fic)
-                re = d_rinfo[2]
-                d_rinfo2=load_d_rinfo(fic)
-                re2=d_rinfo2[2]
-                self.assertEqual(len(d_rinfo),len(d_rinfo2))
-                self.assertEqual(re.offset1,re2.offset1)
-                self.assertEqual(re.offset2,re2.offset2)
-                self.assertEqual(re.corlen,re2.corlen)
-                self.assertEqual(RE.r_extracts_list[0],r_extracts_list[3*siz])
-                self.assertEqual(RE.r_extracts_list[siz-1],r_extracts_list[4*siz-1])
-            if cnt_chk == 7:
-                self.assertEqual(RE.r_extracts_list[0],r_extracts_list[7*siz] )
-                self.assertEqual(RE.r_extracts_list[siz-1],r_extracts_list[8*siz-1])
-            if cnt_chk == 11:
-                self.assertEqual(RE.r_extracts_list[0], r_extracts_list[11*siz])
-                self.assertEqual(RE.r_extracts_list[siz-1],r_extracts_list[12*siz-1])
-            if cnt_chk== 12:
-                self.assertEqual(RE.r_extracts_list[0], r_extracts_list[12 * siz ])
-                self.assertEqual(RE.r_extracts_list[43],r_extracts_list[-1])
-            cnt_chk += 1
-        self.assertEqual(cnt_chk,13)
-        # for RE, d_rinfo in getChunk("../test-data/Virome.fastq", 20, "", 33790 // 4//13):
-        #     self.assertEqual(RE.nb_extracts,
-
-
-    ## Testing that result files are generated where they should and that one can re-read them and check results.
-    #
-    def testMappingOnly(self):
-        rd=refData(refseq_list,20,"")
-        mapper=GPU_chunkMapper()
-        mapper.setRefData(rd)
-        mapper.setFicDir(ficdir)
-        nb_kmer_in_chunk=33788
-        nb_kmer_per_read=4
-        doMapping(nb_kmer_in_chunk,mapper,"../test-data/Virome.fastq","",rd,nb_kmer_per_read)
-        #mapper.setRExtracts(re)
-        #print all_extracts_l[33790]
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions0_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions0_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions0_2")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions1_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions1_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions1_2")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions2_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions2_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions2_2")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions3_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions3_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions3_2")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions4_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions4_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "read_occ_positions4_2")))
-
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced0_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced0_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced0_2")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced1_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced1_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced1_2")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced2_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced2_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced2_2")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced3_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced3_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced3_2")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced4_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced4_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "reduced4_2")))
-
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ0_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ0_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ0_2")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ1_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ1_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ1_2")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ2_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ2_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ2_2")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ3_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ3_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ3_2")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ4_0")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ4_1")))
-        self.assertTrue(os.path.isfile(os.path.join(ficdir, "max_occ4_2")))
-
-        i_occ_pos = np.loadtxt(os.path.join(ficdir, "read_occ_positions0_0"), dtype=np.int32, delimiter='|')
-        self.assertEqual(i_occ_pos[7677],1864)
-        self.assertEqual(i_occ_pos[7678],1954)
-        reduced=np.loadtxt(os.path.join(ficdir, "reduced0_0"), dtype=np.int64, delimiter='|')
-        self.assertEqual(reduced[15690], 11104)
-        self.assertEqual(reduced[15691], 1)
-        self.assertEqual(reduced[15692], 7677)
-        self.assertEqual(reduced[15693], 11105)
-        self.assertEqual(reduced[15694], 1)
-        self.assertEqual(reduced[15695], 7678)
-
-        reduced = np.loadtxt(os.path.join(ficdir, "reduced3_1"), dtype=np.int64, delimiter='|')
-        i=0
-        found1=False
-        found2=False
-        for x in np.nditer(reduced):
-            if (i%3==0):
-                if x==-1:
-                    break
-                    #print "found kmer: ",x," in seq 3"
-                if (x==26766):
-                    found1=True
-                if (x==26767):
-                    found2=True
-                if (found1 and found2):
-                    break
-            i+=1
-
-        self.assertTrue(found1)
-        self.assertTrue(found2)
-
-        f_nb_occ=open(os.path.join(ficdir,"max_occ0_0"))
-        str_nb_occ=f_nb_occ.read()
-        f_nb_occ.close()
-        max_nb_occ=int(str_nb_occ)
-        self.assertEqual(max_nb_occ,15690)
-
-
-        reduced = np.loadtxt(os.path.join(ficdir, "reduced2_1"), dtype=np.int64, delimiter='|')
-        found = False
-        i = 0
-        nb_occ=0
-        for x in np.nditer(reduced):
-            if (i%3==0):
-                if (x==2):
-                    found=True
-                    nb_occ=reduced[i+1]
-            i+=1
-        self.assertTrue(found)
-        self.assertEqual(nb_occ,2)
-
-        reduced = np.loadtxt(os.path.join(ficdir, "reduced2_1"), dtype=np.int64, delimiter='|')
-        found = False
-        i = 0
-        nb_occ = 0
-        for x in np.nditer(reduced):
-            if (i % 3 == 0):
-                if (x == 3):
-                    found = True
-                    nb_occ = reduced[i + 1]
-            i += 1
-        self.assertTrue(found)
-        self.assertEqual(nb_occ, 2)
-
-
-    def testIterationOverMappingResults(self):
-        seed=20
-        rd = refData(refseq_list, seed, "")
-        re = readsExtractsS(seed)
-        re.r_extracts_list = all_extracts_l
-        print all_extracts_l[60559]
-        print all_extracts_l[60560] # TODO: track mapping of these kmers in openCL and in result files.
-        print all_extracts_l[60561]
-        print all_extracts_l[60562]
-        print all_extracts_l[60563] # appears twice in seq 3.
-        re.nb_extracts = nb_extracts
-        re.nb_reads = 16895
-        mapper = GPU_chunkMapper()
-        mapper.setRefData(rd)
-        mapper.setFicDir(ficdir)
-        doMapping(33788, mapper, "../test-data/Virome.fastq", "", rd, 4)
-        # mres=getGPUChunkMappingResults(os.path.join(ficdir, "reduced3_1"), os.path.join(ficdir, "read_occ_positions3_1"),
-        #                          os.path.join(ficdir,"max_occ3_1"), re.nb_reads, re.nb_extracts, rd, single=True)
-        mres=getGPUChunkMappingResults(3,1,ficdir,re.nb_reads,re.nb_extracts,rd,True)
-        found =False
-        for r, r_hostseq, idx_read in mres.mappingResults(): #TODO VL: add more tests.
-            self.assertTrue(idx_read>=6398)
-            if (idx_read==6693): # extracts from 60560
-                self.assertEqual(r.read_start_match,(-1,-1))
-                self.assertEqual(r.read_start_match,(-1,-1))
-                self.assertEqual(r.rev_cpl_start_match,(-1,-1))
-                self.assertTrue(r.rev_cpl_end_match==(448,468) or r.rev_cpl_end_match==(2449,2469))
-
-
-
-
-
-if __name__ == "__main__":
-    unittest.main()
diff --git a/unit-tests/test_OCL_Kernels.py b/unit-tests/test_OCL_Kernels.py
deleted file mode 100755
index a5113ff8dad5afafe00eb4fcde3ebbdba630ed50..0000000000000000000000000000000000000000
--- a/unit-tests/test_OCL_Kernels.py
+++ /dev/null
@@ -1,341 +0,0 @@
-## @file test_OCL_Kernels.py
-# Small elementary tests for openCL kernels
-#
-# Unit testing of openCL kernels.
-
-import unittest
-import os
-os.environ['PYOPENCL_COMPILER_OUTPUT'] = '1'
-# TODO VL: fix compilation error of kernels on CPU. See clGetProgramBuildInfo(program, device_id, CL_PROGRAM_BUILD_LOG, len, log, null);
-
-import numpy as np
-import sys
-sys.path.append("..")
-from _modules.OCL_kernels import *
-
-
-## Gets a list containing the sizes of all sequemces given in input.
-#
-# Sequences are reference sequences (genomes).
-def getSeqSizesList(refseq_list):
-    seq_sizes_list = []
-    for seq in refseq_list:
-        seq_sizes_list.append(len(seq))
-    return seq_sizes_list
-
-## Class containing all the unit testing functions of the openCL kernels.
-class TestMyOCLKernels(unittest.TestCase):
-    ## test the a kernel that copies an array into another
-    #
-    # This is just to do some basic checkings of the openCL implementation when switching to a new environment.
-    def test_copy(self):
-        read_list=["NAATTGCCTCTAAAATTGGA", "NCTGCTAAGTTCTTCAACTC", "NGACCTCGATATCATCGAGC", "NCACTTCATAGCGCACACCT",
-                 "NCATGGTTTAGTACTTCTGT", \
-                 "NCACCAATTACATCAGCCAT", "TCCATACTCAATCCTCCAAC", "AGACAGGTAAAGGAATCTTT", "NNNACTANGTCATTTCAATA",
-                 "CTTTCTTACTCAATCTAGTA"]
-        print "going to copy", len(read_list), " reads of length: 20"
-        ctx, queue, mf, max_dim1,dev_mem=getOpenCLElements()
-        input_reads = np.array(read_list)
-        nb_reads = len(read_list)
-        device_reads = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=input_reads)
-        device_nb_reads = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=np.array(nb_reads))
-        host_reads_copy = np.full(len(read_list) * 20, "X",np.str)
-        device_reads_copy = cl.Buffer(ctx, mf.WRITE_ONLY | mf.USE_HOST_PTR, hostbuf=host_reads_copy)
-
-        nb_threads_dim1 = getNbThreads(nb_reads, max_dim1)
-
-        dummy_prg = cl.Program(ctx, copy_kernel_str).build()
-        dummy_prg.dummy(queue, (nb_threads_dim1,), (1,), device_reads, device_nb_reads, device_reads_copy)
-        cl.enqueue_copy(queue, host_reads_copy, device_reads_copy).wait()
-        str_reads_copy=''.join(host_reads_copy)
-        str_reads_orig=''.join(read_list)
-        self.assertEqual(str_reads_copy,str_reads_orig)
-        # print(host_reads_copy)
-
-    ## tests a kernel that extracts the firts letter of each read passed as argument.
-    #
-    # This is just to do some basic checkings of the openCL implementation when switching to a new environment.
-    def test_first_letter(self):
-        print "going to get 1rst letter of each read"
-        read_list = ["NAATTGCCTCTAAAATTGGA", "NCTGCTAAGTTCTTCAACTC", "NGACCTCGATATCATCGAGC", "NCACTTCATAGCGCACACCT",
-                     "NCATGGTTTAGTACTTCTGT", \
-                     "NCACCAATTACATCAGCCAT", "TCCATACTCAATCCTCCAAC", "AGACAGGTAAAGGAATCTTT", "NNNACTANGTCATTTCAATA",
-                     "CTTTCTTACTCAATCTAGTA"]
-        ctx, queue, mf,max_dim1,dev_mem = getOpenCLElements()
-        input_reads = np.array(read_list)
-        nb_reads = len(read_list)
-        device_reads = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=input_reads)
-        device_nb_reads = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=np.array(nb_reads))
-        host_reads_firstL = np.full(len(read_list), 'X',np.str)
-        device_reads_firstL = cl.Buffer(ctx, mf.WRITE_ONLY | mf.USE_HOST_PTR, hostbuf=host_reads_firstL)
-
-        nb_threads_dim1 = getNbThreads(nb_reads, max_dim1)
-        # aim of this kernel is to try to determine how a numpy array created from a list of char string is treated inside an openCL kernel.
-        dummy_prg = cl.Program(ctx, first_letter_kernel_str).build()
-
-        dummy_prg.dummy(queue, (nb_threads_dim1,), (1,), device_reads, device_nb_reads, device_reads_firstL)
-        cl.enqueue_copy(queue, host_reads_firstL, device_reads_firstL).wait()
-        expected_result=['N','N','N','N','N','N','T','A','N','C']
-        self.assertItemsEqual(expected_result,host_reads_firstL)
-        # print(host_reads_firstL)
-
-    ## tests the 1rts kernel really used by Phageterm.
-    #
-    # Here we want to get the number of occurrences of each read in each of the sequences.
-    # output format contains 2* nb_reads*nb_seq number.
-    # each 2*nb_reads line corresponds to 1 sequence
-    def test_reads_nb_occ(self):
-        seq_list = [
-            "NAATTGCCTCTAAAATTGGAAACAATCTCTGAATTNNNNNNNTNNAAATTTTCTCCATACTCAATCCTCCAACTCTATNTTATGTTCTTCTGCGAAACTATCTTCTNCCTCTTCACAAAACTGACCTTCGCAAAGTGATNCNGNGAGTACTCTGCTAGTATAANACTCTCGGCAGCATAGCTTACAGATTTCATCTTCATAATTATTCCTTAACTCTTCTCTAGTCATTATTCACCCTCCTTTCTGACTAAATAGTCATACATAGGCTTGCAATTACTAAGANNNTTNTNACGTATCTTT", \
-            "NCTGCTAAGTTCTTCAACTCAAAGGTAACTTTTGANNNNNNTGNNTCTATCACAGAAAGACAGGTAAAGGAATCTTTCAGCAGCGCAGAACAGTTGAACGGTTTCTTGTCTATGATTTATTCAGCAGTTGAAAAGTCAANGNCTATCAAGACCGATGCACTTGNTATGCGTACAATTAACAATATGATTGCGGAAACTTTGGACGCAGACAAAGCCGCTTTCGGTTGGGTTGCATCAACAAATGAAAATGTTGACTATGCGAGTGCGTCAACCGTTCGTTGTNNNAACCNGTTGAACATT"]
-        read_list = ["NAATTGCCTCTAAAATTGGA", "NCTGCTAAGTTCTTCAACTC", "NGACCTCGATATCATCGAGC", "NCACTTCATAGCGCACACCT",
-                     "NCATGGTTTAGTACTTCTGT", \
-                     "NCACCAATTACATCAGCCAT", "TCCATACTCAATCCTCCAAC", "AGACAGGTAAAGGAATCTTT", "NNNACTANGTCATTTCAATA",
-                     "CTTTCTTACTCAATCTAGTA"]
-        print "going to get the number of occurrences of each read in each of the sequences"
-        seed=20
-        ctx, queue, mf,max_dim1,dev_mem = getOpenCLElements()
-
-        seq_sizes_list=getSeqSizesList(seq_list)
-        input_reads = np.array(read_list)
-        input_seq=np.array(seq_list)
-        nb_reads = len(read_list)
-        nb_sequences = len(seq_list)
-        output_read_pos=np.full(2*len(read_list)*len(seq_list),0,np.int64)
-
-        device_reads = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=input_reads)
-        k = np.array(seed,np.uint32)  # need to pass an arry of 1 element otherwise get an exception while trying to create buffer.
-        device_k = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=k)
-        device_sequences = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=input_seq)
-        device_nb_reads = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=np.array(nb_reads,np.int64))
-        device_nb_sequences = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=np.array(nb_sequences,dtype=np.uint32))
-        device_seq_sizes = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                     hostbuf=np.array(seq_sizes_list,dtype=np.uint32))
-        device_read_pos = cl.Buffer(ctx, mf.WRITE_ONLY | mf.USE_HOST_PTR, hostbuf=output_read_pos)
-        prg = cl.Program(ctx, reads_nb_occ_in_sequences_str).build()
-        nb_threads_dim1 = getNbThreads(nb_reads, max_dim1)
-        prg.reads_nb_occ(queue, (nb_threads_dim1,), (1,), device_k, device_reads, device_nb_reads, device_sequences,
-                         device_seq_sizes, device_nb_sequences, device_read_pos)
-        cl.enqueue_copy(queue, output_read_pos, device_read_pos).wait()
-        #print(output_read_pos)
-        for i in range(0,40):
-            if ((i==0) or (i==12) or (i==22) or (i==34)):
-                self.assertEqual(output_read_pos[i],1)
-            else:
-                self.assertEqual(output_read_pos[i],0)
-
-    ## Testing the 2nd Kernel used in PhageTerm
-    #
-    # This kernel updates the array produced by the 1rst one.
-    # See "doc/explanation of openCL Kernels for more detailed information on what this kernel does.
-    def test_upd_nb_occ_array(self):
-        ctx, queue, mf,max_dim1,dev_mem = getOpenCLElements()
-        seq_list = [
-            "NAATTGCCTCTAAAATTGGAAACAATCTCTGAATTNNNNNNNTNNAAATTTTCTCCATACTCAATCCTCCAACTCTATNTTATGTTCTTCTGCGAAACTATCTTCTNCCTCTTCACAAAACTGACCTTCGCAAAGTGATNCNGNGAGTACTCTGCTAGTATAANACTCTCGGCAGCATAGCTTACAGATTTCATCTTCATAATTATTCCTTAACTCTTCTCTAGTCATTATTCACCCTCCTTTCTGACTAAATAGTCATACATAGGCTTGCAATTACTAAGANNNTTNTNACGTATCTTT", \
-            "NCTGCTAAGTTCTTCAACTCAAAGGTAACTTTTGANNNNNNTGNNTCTATCACAGAAAGACAGGTAAAGGAATCTTTCAGCAGCGCAGAACAGTTGAACGGTTTCTTGTCTATGATTTATTCAGCAGTTGAAAAGTCAANGNCTATCAAGACCGATGCACTTGNTATGCGTACAATTAACAATATGATTGCGGAAACTTTGGACGCAGACAAAGCCGCTTTCGGTTGGGTTGCATCAACAAATGAAAATGTTGACTATGCGAGTGCGTCAACCGTTCGTTGTNNNAACCNGTTGAACATT"]
-        read_list = ["NAATTGCCTCTAAAATTGGA", "NCTGCTAAGTTCTTCAACTC", "NGACCTCGATATCATCGAGC", "NCACTTCATAGCGCACACCT",
-                     "NCATGGTTTAGTACTTCTGT", \
-                     "NCACCAATTACATCAGCCAT", "TCCATACTCAATCCTCCAAC", "AGACAGGTAAAGGAATCTTT", "NNNACTANGTCATTTCAATA",
-                     "CTTTCTTACTCAATCTAGTA"]
-        output_read_pos = np.full(2 * len(read_list) * len(seq_list), 0,np.int64)
-        output_read_pos[0]=1
-        output_read_pos[12]=1
-        output_read_pos[22]=1
-        output_read_pos[34]=1
-        device_read_pos = cl.Buffer(ctx, mf.WRITE_ONLY | mf.USE_HOST_PTR, hostbuf=output_read_pos)
-        nb_sequences = len(seq_list)
-        device_nb_sequences = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                        hostbuf=np.array(nb_sequences, np.uint32))
-        nb_reads = len(read_list)
-        device_nb_reads = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=np.array(nb_reads,np.int64))
-
-        # This kernel is intended to be used with 1 thread per sequence.
-        prg_update = cl.Program(ctx, upd_reads_nb_occ_in_sequences_str).build()
-        nb_threads_dim1 = getNbThreads(nb_sequences, max_dim1)
-        prg_update.upd_nb_occ_array(queue, (nb_threads_dim1,), (1,), device_read_pos, device_nb_sequences,
-                                    device_nb_reads)
-        cl.enqueue_copy(queue, output_read_pos, device_read_pos)
-
-        host_max_nb_occ=getMaxNbOccPerSeq(output_read_pos,nb_reads,nb_sequences)
-        self.assertEqual(host_max_nb_occ,2)
-        expected_output_read_pos = np.full(2 * len(read_list) * len(seq_list), 0,np.int64)
-        expected_output_read_pos[0] = 1
-        expected_output_read_pos[12] = 1
-        expected_output_read_pos[22] = 1
-        expected_output_read_pos[34] = 1
-        expected_output_read_pos[3] = 1
-        expected_output_read_pos[5] = 1
-        expected_output_read_pos[7] = 1
-        expected_output_read_pos[9] = 1
-        expected_output_read_pos[11] = 1
-        expected_output_read_pos[13] = 1
-        expected_output_read_pos[15] = 2
-        expected_output_read_pos[17] = 2
-        expected_output_read_pos[19] = 2
-        expected_output_read_pos[25] = 1
-        expected_output_read_pos[27] = 1
-        expected_output_read_pos[29] = 1
-        expected_output_read_pos[31] = 1
-        expected_output_read_pos[33] = 1
-        expected_output_read_pos[35] = 1
-        expected_output_read_pos[37] = 2
-        expected_output_read_pos[39] = 2
-        self.assertTrue(np.array_equal(expected_output_read_pos,output_read_pos))
-        #print output_read_pos
-        #print host_max_nb_occ
-
-    ## Testing the 3rd kernel used in Phageterm.
-    #
-    # This kernel looks for all occurrences of all kmers in all sequences.
-    # See "doc/explanation of openCL Kernels for more detailed information on what this kernel does.
-    def test_get_occ_pos(self):
-        seq_list = [
-            "NAATTGCCTCTAAAATTGGAAACAATCTCTGAATTNNNNNNNTNNAAATTTTCTCCATACTCAATCCTCCAACTCTATNTTATGTTCTTCTGCGAAACTATCTTCTNCCTCTTCACAAAACTGACCTTCGCAAAGTGATNCNGNGAGTACTCTGCTAGTATAANACTCTCGGCAGCATAGCTTACAGATTTCATCTTCATAATTATTCCTTAACTCTTCTCTAGTCATTATTCACCCTCCTTTCTGACTAAATAGTCATACATAGGCTTGCAATTACTAAGANNNTTNTNACGTATCTTT", \
-            "NCTGCTAAGTTCTTCAACTCAAAGGTAACTTTTGANNNNNNTGNNTCTATCACAGAAAGACAGGTAAAGGAATCTTTCAGCAGCGCAGAACAGTTGAACGGTTTCTTGTCTATGATTTATTCAGCAGTTGAAAAGTCAANGNCTATCAAGACCGATGCACTTGNTATGCGTACAATTAACAATATGATTGCGGAAACTTTGGACGCAGACAAAGCCGCTTTCGGTTGGGTTGCATCAACAAATGAAAATGTTGACTATGCGAGTGCGTCAACCGTTCGTTGTNNNAACCNGTTGAACATT"]
-        read_list = ["NAATTGCCTCTAAAATTGGA", "NCTGCTAAGTTCTTCAACTC", "NGACCTCGATATCATCGAGC", "NCACTTCATAGCGCACACCT",
-                     "NCATGGTTTAGTACTTCTGT", \
-                     "NCACCAATTACATCAGCCAT", "TCCATACTCAATCCTCCAAC", "AGACAGGTAAAGGAATCTTT", "NNNACTANGTCATTTCAATA",
-                     "CTTTCTTACTCAATCTAGTA"]
-        seq_sizes_list = getSeqSizesList(seq_list)
-        ctx, queue, mf,max_dim1,dev_mem = getOpenCLElements()
-        seed = 20
-        output_read_pos = np.full(2 * len(read_list) * len(seq_list), 0,np.int64)
-        output_read_pos[0] = 1
-        output_read_pos[12] = 1
-        output_read_pos[22] = 1
-        output_read_pos[34] = 1
-        output_read_pos[3] = 1
-        output_read_pos[5] = 1
-        output_read_pos[7] = 1
-        output_read_pos[9] = 1
-        output_read_pos[11] = 1
-        output_read_pos[13] = 1
-        output_read_pos[15] = 2
-        output_read_pos[17] = 2
-        output_read_pos[19] = 2
-        output_read_pos[25] = 1
-        output_read_pos[27] = 1
-        output_read_pos[29] = 1
-        output_read_pos[31] = 1
-        output_read_pos[33] = 1
-        output_read_pos[35] = 1
-        output_read_pos[37] = 2
-        output_read_pos[39] = 2
-        device_read_pos = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=output_read_pos)
-        nb_sequences = len(seq_list)
-        device_nb_sequences = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                        hostbuf=np.array(nb_sequences,np.uint32))
-        nb_reads = len(read_list)
-        device_nb_reads = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=np.array(nb_reads))
-        max_nb_occ = 2
-        host_max_nb_occ = np.array(max_nb_occ)
-
-
-        device_max_nb_occ = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=host_max_nb_occ)
-        device_reads = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=np.array(read_list))
-        k = np.array(seed)  # need to pass an arry of 1 element otherwise get an exception while trying to create buffer.
-        device_k = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=k)
-        device_sequences = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=np.array(seq_list))
-
-        device_seq_sizes = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                     hostbuf=np.array(seq_sizes_list,dtype=np.uint32))
-        host_read_occ_positions = np.full(host_max_nb_occ * len(seq_list), 0,np.uint32)
-        device_read_occ_positions = cl.Buffer(ctx, mf.WRITE_ONLY | mf.USE_HOST_PTR, hostbuf=host_read_occ_positions)
-
-
-
-
-        prg_get_occ_pos = cl.Program(ctx, reads_occ_pos_in_seqs_str).build()
-        nb_threads_dim1 = getNbThreads(nb_reads, max_dim1)
-        prg_get_occ_pos.get_occ_pos(queue, (nb_threads_dim1,), (1,), device_read_pos, device_nb_sequences,
-                                    device_nb_reads, device_max_nb_occ, device_read_occ_positions, device_k,
-                                    device_reads, device_sequences, device_seq_sizes)
-        cl.enqueue_copy(queue, host_read_occ_positions, device_read_occ_positions)
-        print host_read_occ_positions
-
-        self.assertEqual(host_read_occ_positions[0],0)
-        self.assertEqual(host_read_occ_positions[1], 53)
-        self.assertEqual(host_read_occ_positions[2], 0)
-        self.assertEqual(host_read_occ_positions[3], 57)
-
-    ## Testing the 4rth openCL kernel used in phageterm
-    #
-    # This kernel produces the final results array.
-    # See "doc/explanation of openCL Kernels for more detailed information on what this kernel does.
-    def test_reads_nb_occ_reduction(self):
-        ctx, queue, mf, max_dim1,dev_mem = getOpenCLElements()
-        output_read_pos = np.full(2 * 10 * 2, 0,np.int64)
-        output_read_pos[0] = 1
-        output_read_pos[12] = 1
-        output_read_pos[22] = 1
-        output_read_pos[34] = 1
-        output_read_pos[3] = 1
-        output_read_pos[5] = 1
-        output_read_pos[7] = 1
-        output_read_pos[9] = 1
-        output_read_pos[11] = 1
-        output_read_pos[13] = 1
-        output_read_pos[15] = 2
-        output_read_pos[17] = 2
-        output_read_pos[19] = 2
-        output_read_pos[25] = 1
-        output_read_pos[27] = 1
-        output_read_pos[29] = 1
-        output_read_pos[31] = 1
-        output_read_pos[33] = 1
-        output_read_pos[35] = 1
-        output_read_pos[37] = 2
-        output_read_pos[39] = 2
-        device_read_pos = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=output_read_pos)
-        nb_sequences = 2
-        device_nb_sequences = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                hostbuf=np.array(nb_sequences,np.uint32))
-        nb_reads=10
-        device_nb_reads = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=np.array(nb_reads,np.int64))
-
-        host_max_nb_occ = np.array(2, np.int64)
-        device_max_nb_occ = cl.Buffer(ctx, mf.READ_ONLY | mf.USE_HOST_PTR, hostbuf=host_max_nb_occ)
-        #device_found_read_carac_line_length=cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=np.array(3*nb_max_diff_read_occ))
-        host_found_reads_carac = np.full(3 * 2 * nb_sequences, -1,np.int64)
-        device_found_reads_carac = cl.Buffer(ctx, mf.WRITE_ONLY | mf.USE_HOST_PTR, hostbuf=host_found_reads_carac)
-
-        # This kernel is intended to be used with 1 thread per sequence.
-        prg_reduce = cl.Program(ctx, reads_nb_occ_reduction_str).build()
-        nb_threads_dim1 = getNbThreads(nb_sequences, max_dim1)
-        #sf=np.array(0, np.int64)
-        #device_sf=cl.Buffer(ctx, mf.READ_ONLY | mf.USE_HOST_PTR, hostbuf=sf)
-        #prg_reduce.reads_nb_occ_reduction(queue, (nb_threads_dim1,), (1,), device_read_pos, device_nb_sequences,device_nb_reads,device_found_reads_carac,device_max_nb_occ,device_sf)
-        #prg_reduce.reads_nb_occ_reduction(queue, (nb_threads_dim1,), (1,), device_read_pos, device_nb_sequences,
-        #                                  device_nb_reads, device_found_reads_carac, device_max_nb_occ, device_sf)
-        prg_reduce.reads_nb_occ_reduction(queue, (nb_threads_dim1,), (1,), device_read_pos, device_nb_sequences,
-                                          device_nb_reads, device_found_reads_carac, device_max_nb_occ)
-
-        cl.enqueue_copy(queue, host_found_reads_carac, device_found_reads_carac)
-        print host_found_reads_carac
-        self.assertEqual(host_found_reads_carac[0], 0)
-        self.assertEqual(host_found_reads_carac[1], 1)
-        self.assertEqual(host_found_reads_carac[2], 0)
-        self.assertEqual(host_found_reads_carac[3], 6)
-        self.assertEqual(host_found_reads_carac[4], 1)
-        self.assertEqual(host_found_reads_carac[5], 1)
-
-        self.assertEqual(host_found_reads_carac[6], 1)
-        self.assertEqual(host_found_reads_carac[7], 1)
-        self.assertEqual(host_found_reads_carac[8], 0)
-
-        self.assertEqual(host_found_reads_carac[9], 7)
-        self.assertEqual(host_found_reads_carac[10], 1)
-        self.assertEqual(host_found_reads_carac[11], 1)
-
-
-
-if __name__ == "__main__":
-    unittest.main()
-
-
-
-
-
-
-
-
diff --git a/unit-tests/test_OCL_Kernels_bigger.py b/unit-tests/test_OCL_Kernels_bigger.py
deleted file mode 100755
index 7d3713d23ec11ba6d3287d76b70b114654789f7b..0000000000000000000000000000000000000000
--- a/unit-tests/test_OCL_Kernels_bigger.py
+++ /dev/null
@@ -1,246 +0,0 @@
-##@file test_OCL_Kernels_bigger.py
-# Tests for openCL kernels on bigger datasets (more "real life like")
-
-import unittest
-
-import numpy as np
-import sys
-#print sys.path
-sys.path.append("..")
-
-from _modules.OCL_kernels import *
-
-from data_refseq import refseq_list
-nb_sequences=len(refseq_list)
-from data_refseq import all_extracts_l
-nb_extracts=len(all_extracts_l)
-print nb_extracts
-extracts_l=all_extracts_l
-
-## Class containing all the testing functions of the openCL kernels for bigger datasets than simple unit tests.
-class TestMyOCLKernels (unittest.TestCase):
-    ## Testing the 1rts kernel used in Phageterm.
-    #
-    # The one that counts the number of occurrences of each kmers in each sequence.
-    def test_get_nb_occ(self):
-        ctx, queue, mf,max_dim1,dev_mem = getOpenCLElements()
-        # prepare input and output parameters on host side.
-        seq_sizes_l = []  # list of the length of all sequences
-        for s in refseq_list:
-            seq_sizes_l.append(len(s))
-        str_seqs = "".join(refseq_list)  # all contigs concatenated in a string
-        input_seqs = np.array(str_seqs)  # Need to put all the sequences in a numpy array for openCL.
-
-        input_rextracts = np.array(extracts_l)  # all read extracts
-        o_nb_occ_foreach_extract_in_seqs = np.full(2 * nb_extracts * nb_sequences, 0,np.int64)  # result array for kernel 1.
-
-        # prepare input and output parameters on device size.
-        device_rextracts = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=input_rextracts)
-        k = np.array(20,np.uint32)  # need to pass an array of 1 element otherwise get an exception while trying to create buffer.
-        device_k = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=k)
-        device_sequences = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=input_seqs)
-        device_nb_extracts = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                       hostbuf=np.array(nb_extracts, np.int64))
-        device_nb_sequences = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                        hostbuf=np.array(nb_sequences, np.uint32))
-        device_seq_sizes = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                     hostbuf=np.array(seq_sizes_l, np.uint32))
-        device_nb_occ_foreach_extract_in_seqs = cl.Buffer(ctx, mf.WRITE_ONLY | mf.USE_HOST_PTR,
-                                                          hostbuf=o_nb_occ_foreach_extract_in_seqs)
-        prg = cl.Program(ctx, reads_nb_occ_in_sequences_str).build()
-        nb_threads_dim1 = getNbThreads(nb_extracts, max_dim1)
-        print "nb_threads_dim1=",nb_threads_dim1
-        prg.reads_nb_occ(queue, (nb_threads_dim1,), (1,), device_k, device_rextracts, device_nb_extracts,
-                         device_sequences,
-                         device_seq_sizes, device_nb_sequences, device_nb_occ_foreach_extract_in_seqs)
-        # get kernel execution results back to host (number of occurrences of each k_mer in each sequence.
-        cl.enqueue_copy(queue, o_nb_occ_foreach_extract_in_seqs, device_nb_occ_foreach_extract_in_seqs).wait()
-        self.assertEqual(o_nb_occ_foreach_extract_in_seqs[2*11104],1)
-        self.assertEqual(o_nb_occ_foreach_extract_in_seqs[2*11104+1],0)
-        self.assertEqual(o_nb_occ_foreach_extract_in_seqs[2*11105],1)
-        self.assertEqual(o_nb_occ_foreach_extract_in_seqs[2*11105+1],0)
-        self.assertEqual(o_nb_occ_foreach_extract_in_seqs[2*11106],0)
-        self.assertEqual(o_nb_occ_foreach_extract_in_seqs[2*11106+1],0)
-        self.assertEqual(o_nb_occ_foreach_extract_in_seqs[2*11107],0)
-        self.assertEqual(o_nb_occ_foreach_extract_in_seqs[2*11107+1], 0)
-        array_l_siz=2*nb_extracts
-        for i in range (array_l_siz+2*11104,array_l_siz+2*11107+1):
-            self.assertEqual(o_nb_occ_foreach_extract_in_seqs[i],0) # None of these k-mers should appear in the 2nd sequence.
-        #np.savetxt("kmer_nb_occ.txt", o_nb_occ_foreach_extract_in_seqs, fmt="%d", delimiter=',')
-
-    ## Testing the 2nd kernel used in Phageterm
-    def test_upd_nb_occ(self):
-        ctx, queue, mf, max_dim1,dev_mem = getOpenCLElements()
-        # nb_sequences = self.seq_data.nb_sequences  # for readability.
-        # prepare input and output parameters on host side.
-        seq_sizes_l = []  # list of the length of all sequences
-        for s in refseq_list:
-            seq_sizes_l.append(len(s))
-        str_seqs = "".join(refseq_list)  # all contigs concatenated in a string
-        o_nb_occ_pos = np.loadtxt("kmer_nb_occ.txt", dtype=np.int64, delimiter=',')
-        # Just check that data is still here
-        self.assertEqual(o_nb_occ_pos[2 * 11104], 1)
-        self.assertEqual(o_nb_occ_pos[2 * 11104 + 1], 0)
-        self.assertEqual(o_nb_occ_pos[2 * 11105], 1)
-        self.assertEqual(o_nb_occ_pos[2 * 11105 + 1], 0)
-        device_nb_occ_foreach_extract_in_seqs = cl.Buffer(ctx, mf.WRITE_ONLY | mf.USE_HOST_PTR,
-                                                              hostbuf=o_nb_occ_pos)
-        device_nb_extracts = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                           hostbuf=np.array(nb_extracts, np.int64))
-        device_nb_sequences = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                            hostbuf=np.array(nb_sequences, np.uint32))
-        # This kernel is intended to be used with 1 thread per sequence.
-        # It computes for each sequence, the total number of occurrences of kmers.
-        # It returns the max amongst all these sums.
-        prg_update = cl.Program(ctx, upd_reads_nb_occ_in_sequences_str).build()
-        nb_threads_dim1 = getNbThreads(nb_sequences, max_dim1)
-        print "updating occ array with ",nb_threads_dim1, "threads"
-        prg_update.upd_nb_occ_array(queue, (nb_threads_dim1,), (1,), device_nb_occ_foreach_extract_in_seqs,
-                                        device_nb_sequences,
-                                        device_nb_extracts)
-        #print "going to copy results"
-        cl.enqueue_copy(queue, o_nb_occ_pos, device_nb_occ_foreach_extract_in_seqs)
-        host_max_nb_occ = getMaxNbOccPerSeq(o_nb_occ_pos, nb_extracts, nb_sequences) # max over all sequences of the total number of read extracts occurrences per sequence
-        #print "results copied"
-        # o_nb_occ_foreach_extract_in_seqs.tofile("res_kernel2", sep="|", format="%s")
-        self.assertEqual(o_nb_occ_pos[2 * 11104], 1)
-        self.assertEqual(o_nb_occ_pos[2 * 11104 + 1], 7677)
-        self.assertEqual(o_nb_occ_pos[2 * 11105], 1)
-        self.assertEqual(o_nb_occ_pos[2 * 11105 + 1], 7678)
-        self.assertEqual(o_nb_occ_pos[2 * 11106], 0)
-        self.assertEqual(o_nb_occ_pos[2 * 11106 + 1], 7679)
-        self.assertEqual(o_nb_occ_pos[2 * 11107], 0)
-        self.assertEqual(o_nb_occ_pos[2 * 11107 + 1], 7679)
-        #np.savetxt("kmer_nb_occ_pos.txt",o_nb_occ_pos, fmt="%d", delimiter=',')
-        self.assertEqual(host_max_nb_occ, 16908)
-
-    ## Testing 3rd kernel used in PhageTerm
-    def test_get_occ_pos(self):
-        ctx, queue, mf, max_dim1,dev_mem = getOpenCLElements()
-        # nb_sequences = self.seq_data.nb_sequences  # for readability.
-        # prepare input and output parameters on host side.
-        seq_sizes_l = []  # list of the length of all sequences
-        for s in refseq_list:
-            seq_sizes_l.append(len(s))
-        str_seqs = "".join(refseq_list)  # all contigs concatenated in a string
-        input_seqs = np.array(str_seqs)  # Need to put all the sequences in a numpy array for openCL.
-        input_rextracts = np.array(extracts_l)  # all read extracts
-        # np.savetxt("kmer_nb_occ.txt", o_nb_occ_foreach_extract_in_seqs, fmt="%d", delimiter=',')
-        o_nb_occ_pos = np.loadtxt("kmer_nb_occ_pos.txt", dtype=np.int64, delimiter=',')
-        # Just check that data is still here
-        self.assertEqual(o_nb_occ_pos[2 * 11104], 1)
-        self.assertEqual(o_nb_occ_pos[2 * 11104 + 1], 7677)
-        self.assertEqual(o_nb_occ_pos[2 * 11105], 1)
-        self.assertEqual(o_nb_occ_pos[2 * 11105 + 1], 7678)
-        self.assertEqual(o_nb_occ_pos[2 * 11106], 0)
-        self.assertEqual(o_nb_occ_pos[2 * 11106 + 1], 7679)
-        self.assertEqual(o_nb_occ_pos[2 * 11107], 0)
-        self.assertEqual(o_nb_occ_pos[2 * 11107 + 1], 7679)
-        device_nb_occ_foreach_extract_in_seqs = cl.Buffer(ctx, mf.WRITE_ONLY | mf.USE_HOST_PTR,
-                                                          hostbuf=o_nb_occ_pos)
-        k = np.array(20, np.uint32)
-        host_max_nb_occ = np.array(16908,
-                                   np.int64)  # max over all sequences of the total number of read extracts occurrences per sequence
-        device_max_nb_occ = cl.Buffer(ctx, mf.WRITE_ONLY | mf.USE_HOST_PTR, hostbuf=host_max_nb_occ)
-
-        print "size of pos array for all sequences: ", int(host_max_nb_occ * nb_sequences)
-        host_read_occ_positions = np.full(int(host_max_nb_occ * nb_sequences), 0,
-                                          dtype=np.uint32)  # contains the positions of all extracts occurrences in the sequences.
-        device_read_occ_positions = cl.Buffer(ctx, mf.WRITE_ONLY | mf.USE_HOST_PTR, hostbuf=host_read_occ_positions)
-        device_k = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=k)
-        device_sequences = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=input_seqs)
-        device_nb_extracts = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                       hostbuf=np.array(nb_extracts, np.int64))
-        device_nb_sequences = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                        hostbuf=np.array(nb_sequences, np.uint32))
-        device_seq_sizes = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                     hostbuf=np.array(seq_sizes_l, np.uint32))
-        device_rextracts = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR, hostbuf=input_rextracts)
-        prg_get_occ_pos = cl.Program(ctx, reads_occ_pos_in_seqs_str).build()
-        nb_threads_dim1 = getNbThreads(nb_extracts, max_dim1)
-        prg_get_occ_pos.get_occ_pos(queue, (nb_threads_dim1,), (1,), device_nb_occ_foreach_extract_in_seqs,
-                                    device_nb_sequences,
-                                    device_nb_extracts, device_max_nb_occ, device_read_occ_positions, device_k,
-                                    device_rextracts, device_sequences, device_seq_sizes)
-        cl.enqueue_copy(queue, host_read_occ_positions, device_read_occ_positions)
-        self.assertEqual(host_read_occ_positions[7677],1864)
-        self.assertEqual(host_read_occ_positions[7678],1954)
-        # Check that no kmer occurrence is above sequence length. Seems silly but I really wasted a lot of time on this bug!
-        for i in range(0,nb_sequences):
-            l=seq_sizes_l[i]
-            for j in range(0,host_max_nb_occ):
-                if (host_read_occ_positions[j]==1):
-                    break
-                my_str="sequence "
-                my_str+=str(i)
-                my_str+=" Occ: "
-                my_str+=str(i)
-                my_str+=" l="
-                my_str+=str(l)
-                my_str+=" pos="
-                my_str+=str(host_read_occ_positions[i*host_max_nb_occ+j])
-                self.assertTrue(host_read_occ_positions[i*host_max_nb_occ+j]<=l-20,my_str)
-
-    #    np.savetxt("kmer_list_occ_pos.txt", o_nb_occ_pos, fmt="%d", delimiter=',')
-
-    ## Testing 4rth kernel used in phageterm.
-    def test_get_final_array(self):
-        ctx, queue, mf,max_dim1,dev_mem = getOpenCLElements()
-        i_nb_occ_pos = np.loadtxt("kmer_nb_occ_pos.txt", dtype=np.int64, delimiter=',')
-        # Checking that data is still here
-        self.assertEqual(i_nb_occ_pos[2 * 11104], 1)
-        self.assertEqual(i_nb_occ_pos[2 * 11104 + 1], 7677)
-        self.assertEqual(i_nb_occ_pos[2 * 11105], 1)
-        self.assertEqual(i_nb_occ_pos[2 * 11105 + 1], 7678)
-        self.assertEqual(i_nb_occ_pos[2 * 11106], 0)
-        self.assertEqual(i_nb_occ_pos[2 * 11106 + 1], 7679)
-        self.assertEqual(i_nb_occ_pos[2 * 11107], 0)
-        self.assertEqual(i_nb_occ_pos[2 * 11107 + 1], 7679)
-        #i_l_occ_pos=np.loadtxt("kmer_list_occ_pos.txt",dtype=np.uint32,delimiter=',')
-        host_max_nb_occ = np.array(15690,np.int64)
-        reduced_nb_occ_foreach_extract_in_seqs = np.full(int(3 * host_max_nb_occ * nb_sequences), -1, dtype=np.int64)
-        device_reduced_nb_occ_foreach_extract_in_seqs = cl.Buffer(ctx, mf.WRITE_ONLY | mf.USE_HOST_PTR,
-                                                                  hostbuf=reduced_nb_occ_foreach_extract_in_seqs)
-        device_nb_occ_foreach_extract_in_seqs = cl.Buffer(ctx, mf.READ_ONLY | mf.USE_HOST_PTR,
-                                                          hostbuf=i_nb_occ_pos) # TODO Maybe put this buffer in read write in doMapping.
-        device_nb_sequences = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                        hostbuf=np.array(nb_sequences, np.uint32))
-        device_nb_extracts = cl.Buffer(ctx, mf.READ_ONLY | mf.HOST_READ_ONLY | mf.USE_HOST_PTR,
-                                       hostbuf=np.array(nb_extracts, np.int64))
-        device_max_nb_occ = cl.Buffer(ctx, mf.READ_ONLY | mf.USE_HOST_PTR, hostbuf=host_max_nb_occ) # TODO Maybe put this buffer in read write in doMapping.
-        # sf = np.array(0, np.int64)
-        # device_sf = cl.Buffer(ctx, mf.READ_ONLY | mf.USE_HOST_PTR, hostbuf=sf)
-        prg_red_rd_occ = cl.Program(ctx, reads_nb_occ_reduction_str).build()
-        nb_threads_dim1 = getNbThreads(nb_sequences, max_dim1)
-        # prg_red_rd_occ.reads_nb_occ_reduction(queue, (nb_threads_dim1,), (1,), device_nb_occ_foreach_extract_in_seqs,
-        #                                       device_nb_sequences,
-        #                                       device_nb_extracts, device_reduced_nb_occ_foreach_extract_in_seqs,
-        #                                       device_max_nb_occ,device_sf)
-        prg_red_rd_occ.reads_nb_occ_reduction(queue, (nb_threads_dim1,), (1,), device_nb_occ_foreach_extract_in_seqs,
-                                              device_nb_sequences,
-                                              device_nb_extracts, device_reduced_nb_occ_foreach_extract_in_seqs,
-                                              device_max_nb_occ)
-        cl.enqueue_copy(queue, reduced_nb_occ_foreach_extract_in_seqs, device_reduced_nb_occ_foreach_extract_in_seqs)
-        # Checking results for a few kmers. TODO: add more checkings later.
-        self.assertEqual(reduced_nb_occ_foreach_extract_in_seqs[15690],11104)
-        self.assertEqual(reduced_nb_occ_foreach_extract_in_seqs[15691],1)
-        self.assertEqual(reduced_nb_occ_foreach_extract_in_seqs[15692],7677)
-        self.assertEqual(reduced_nb_occ_foreach_extract_in_seqs[15693], 11105)
-        self.assertEqual(reduced_nb_occ_foreach_extract_in_seqs[15694], 1)
-        self.assertEqual(reduced_nb_occ_foreach_extract_in_seqs[15695], 7678)
-
-        # idx=0
-        # for e in np.nditer(reduced_nb_occ_foreach_extract_in_seqs):
-        #     if (idx % 3)==0:
-        #         if e>=33791:
-        #             print "found kmer with id:",e, idx
-        #     idx+=1
-
-
-
-
-
-if __name__ == "__main__":
-    unittest.main()
-
-
diff --git a/unit-tests/test_functions_PhageTerm_for_GPU.py b/unit-tests/test_functions_PhageTerm_for_GPU.py
deleted file mode 100755
index 296b5d15e656ffeac3c8d4aaa64dac0ac84cbd6e..0000000000000000000000000000000000000000
--- a/unit-tests/test_functions_PhageTerm_for_GPU.py
+++ /dev/null
@@ -1,118 +0,0 @@
-import unittest
-import numpy as np
-
-##@file test_functions_PhageTerm_for_GPU.py
-#
-# Need to be able to compare results of mappings done on CPU with those performed on GPU.
-# For that, use test data that were already provided with previous phageterm version.
-##@author vlegrand@pasteur.fr
-
-import sys
-sys.path.append("..")
-
-from _modules.GPU_allMapper import GPU_allMapper
-from _modules.functions_PhageTerm import readsCoverage
-from _modules.IData_handling import getAllReads,refData
-from _modules.functions_PhageTerm_gpu import readsCoverageGPU
-from _modules.debug_utils import ReadMappingInfoLogger
-from _modules.IData_handling import ReadGetter
-from Data4Test import buildTestData
-
-
-
-## Tests that mapping results produced by CPU and GPU version are the same.
-#
-class Test_functions_Phageterm (unittest.TestCase):
-    ## Auxilliary method that compares mapping results globally
-    def compareMappingRes(self,d,d_rinfo,return_dict,l_res,logger_cpu,logger_gpu):
-        phage_hybrid_coverage = return_dict[d.core_id][3]
-        host_hybrid_coverage = return_dict[d.core_id][4]
-        host_whole_coverage = return_dict[d.core_id][5]
-        list_hybrid = return_dict[d.core_id][6]
-        insert = return_dict[d.core_id][7].tolist()
-        paired_mismatch = return_dict[d.core_id][8]
-        reads_tested = return_dict[d.core_id][9]
-
-        phage_hybrid_coverage_gpu = l_res[3]
-        host_hybrid_coverage_gpu = l_res[4]
-        host_whole_coverage_gpu = l_res[5]
-        list_hybrid_gpu = l_res[6]
-        insert_gpu = l_res[7].tolist()
-        paired_mismatch_gpu = l_res[8]
-        reads_tested_gpu = l_res[9]
-
-        self.assertEqual(reads_tested,reads_tested_gpu-1) # TODO fix bug in CPU version that skips read 0.
-        self.assertEqual(reads_tested, d.reads_tested-1)
-        self.assertEqual(paired_mismatch,paired_mismatch_gpu)
-        self.assertEqual(paired_mismatch,0)
-        self.assertEqual(insert,insert_gpu)
-        self.assertEqual(insert,[])
-        self.assertTrue(np.array_equal(list_hybrid,list_hybrid_gpu))
-        self.assertTrue(np.array_equal(host_whole_coverage,host_whole_coverage_gpu))
-        self.assertTrue(np.array_equal(host_hybrid_coverage,host_hybrid_coverage_gpu))
-        self.assertTrue(np.array_equal(phage_hybrid_coverage,phage_hybrid_coverage_gpu))
-        # self.assertTrue(np.array_equal(paired_whole_coverage,paired_whole_coverage_gpu)) # always different since the counters that are incremented depend on matchPlus_start which is chosen randomly.
-        #self.assertTrue(np.array_equal(whole_coverage,whole_coverage_gpu))
-        # self.assertTrue(np.array_equal(termini_coverage,termini_coverage_gpu))
-        r_getter = ReadGetter(d.fastq, d_rinfo)
-        self.compareMappingResByRead(logger_cpu, logger_gpu,r_getter)
-
-
-    ## Compares mapping results read by read.
-    def compareMappingResByRead(self, logger_cpu, logger_gpu,r_getter):
-        l_rmatch_info_cpu = logger_cpu.getMatchInfoList()
-        l_rmatch_info_gpu = logger_gpu.getMatchInfoList()
-        self.assertEqual(logger_cpu.cnt_read,logger_gpu.cnt_read-1)
-        for i in range(0,logger_cpu.cnt_read):
-            # The cpu version skips the 1st read in the fasta file. This is a bug but it doesn't have any impact on the final results.
-            # TODO (cpu version authors): fix this bug.
-            rmi_cpu=l_rmatch_info_cpu[i]
-            rmi_gpu=l_rmatch_info_gpu[i+1]
-            #print rmi_cpu.idx_read
-            read_cpu,rp = r_getter.getOneRead(rmi_cpu.idx_read)
-            #print read_cpu
-            read_gpu,rp=r_getter.getOneRead(rmi_gpu.idx_read)
-            #print read_gpu
-
-            self.assertEqual(rmi_cpu.idx_read,rmi_gpu.idx_read)
-            self.assertEqual(rmi_cpu.map_start,rmi_gpu.map_start)
-            if (rmi_cpu.map_start==0):
-                self.assertEqual(rmi_cpu.map_rcpl_start,rmi_gpu.map_rcpl_start)
-
-    ## Auxilliary method that performs mapping on GPU
-    def performGPUMapping(self,d):
-        RE, d_rinfo = getAllReads(d.fastq, d.seed, d.paired)
-        print len(RE.r_extracts_list)
-        print RE.r_extracts_list
-        refseq_liste = d.refseq_list
-        ref_data = refData(refseq_liste, d.seed, d.hostseq)
-        mapper = GPU_allMapper(RE, ref_data)
-        mapping_res = mapper.doMapping()
-        return mapping_res,d_rinfo
-
-
-
-
-    ## This function tests that both version of readsCoverage (CPU and GPU) return the same results.
-    def testReadsCoverageGPU_CPU(self):
-        l_data=buildTestData()
-        for d in l_data:
-            print "processing dataset: ", d.fastq
-            mapping_res, d_rinfo = self.performGPUMapping(d)
-            for refseq in d.refseq_list:
-                logger_gpu = ReadMappingInfoLogger()
-                return_dict = dict()
-                logger_cpu = ReadMappingInfoLogger()
-                #readsCoverage(fastq, refseq, hostseq, seed, edge, paired, insert_max, core, core_id, return_dict, line_start, line_end, limit_coverage, virome,idx_refseq=None, dir_cov_res=None,logger=None)
-                readsCoverage(d.fastq, refseq, d.hostseq, d.seed, d.edge, d.paired, d.insert_max,\
-                              d.core, d.core_id, return_dict,d.line_start, d.line_end, \
-                              d.limit_coverage, d.virome,None,None,logger_cpu)
-
-                l_res = readsCoverageGPU(d.fastq, refseq, d.hostseq, mapping_res, d_rinfo, d.edge, d.paired,
-                                         d.insert_max,d.limit_coverage,d.virome, logger_gpu)
-                self.compareMappingRes( d, d_rinfo, return_dict, l_res, logger_cpu, logger_gpu)
-
-
-
-if __name__ == "__main__":
-    unittest.main()
\ No newline at end of file