Skip to content
Snippets Groups Projects
Commit b12908df authored by Alexis  CRISCUOLO's avatar Alexis CRISCUOLO :black_circle:
Browse files

1.0

parent 6b57dfb5
No related branches found
No related tags found
No related merge requests found
......@@ -446,7 +446,7 @@ RS24625 ACAAGGTAACCGTAGGGGAACCTGCGGTTGGATCACCTCCTTA
</sup>
As the HTS reads arise from an _E. coli_ genome, _ASSU_ can also be run by using option `-p` to specify this species as model (don't forget to use quotation marks when specifying a pattern with option `-p`):
As the HTS reads arise from an _E. coli_ genome, _ASSU_ can also be run by using option `-p` to specify this species as model (don't forget to use quotation marks when specifying a multiple word pattern with option `-p`):
```bash
./ASSU.sh -t 12 -p "Escherichia coli" -v SRR7896249_*.fastq.gz
......
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment