Commit 0635f8ed authored by Amandine  PERRIN's avatar Amandine PERRIN
Browse files

Welcome to Panna cotta recipe

parents
Pipeline #77876 passed with stages
in 7 minutes and 4 seconds
.DS_Store
__pycache__
# Executables
*.pyc
# Distribution
*.egg-info
# test files
.cache
# coverage files
.coverage*
coverage.xml
htmlcov
junit_tests.xml
# pycharm project files
.idea
image: registry-gitlab.pasteur.fr/aperrin/pipeline_annotation/testing-ubuntu
stages:
- build
- test
- test2
- coverage
- doc
- deploy
- github
build-from-ubuntu:
image: registry-gitlab.pasteur.fr/aperrin/pipeline_annotation/install-ubuntu
stage: build
only:
- install
script:
- pip3 install --upgrade pip
- pip3 install -r requirements-dev.txt
- py.test test/test_install/test_make_ubuntu.py -xv
build-from-barrnap:
image: registry-gitlab.pasteur.fr/aperrin/pipeline_annotation/install-ubuntu-barrnaponly
stage: build
only:
- install
script:
- pip3 install --upgrade pip
- pip3 install -r requirements-dev.txt
- py.test test/test_install/test_make_barrnap.py -xv
build-from-prokka-quicktree:
image: registry-gitlab.pasteur.fr/aperrin/pipeline_annotation/install-ubuntu-annote-quicktree
stage: build
only:
- install
script:
- pip3 install --upgrade pip
- pip3 install -r requirements-dev.txt
- py.test test/test_install/test_make_prokka-quicktree.py -xv
build-from-prodigal:
image: registry-gitlab.pasteur.fr/aperrin/pipeline_annotation/install-prodigal
stage: build
only:
- install
script:
- pip3 install --upgrade pip
- pip3 install -r requirements-dev.txt
- py.test test/test_install/test_make_prodigal.py -xv
build-from-test-image:
stage: build
only:
- install
script:
- pip3 install --upgrade pip
- pip3 install -r requirements-dev.txt
- py.test test/test_install/test_make_all-installed.py -xv
unit-test-ubuntu:
stage: test
except:
- docker
- helpers
- install
before_script:
- pip3 install --upgrade pip
- pip3 install -r requirements-dev.txt
- ./make
script:
- pwd
- ls Examples/genomes_init/genome1.fst
- py.test test/test_unit/test_utils.py -vx
- py.test test/test_unit/test_utils-logging.py -xv
- py.test test/test_unit/test_utils-pan.py -vx
- py.test test/test_unit/test_utils-argparse.py -vx
- py.test test/test_unit/test_prepare -v -x
- py.test test/test_unit/test_annotate/test_genome_func.py -vx
- py.test test/test_unit/test_annotate/test_annotation* -vx
- py.test test/test_unit/test_annotate/test_format* -v -x
- py.test test/test_unit/test_pangenome -vx
- py.test test/test_unit/test_corepers -vx
- py.test test/test_unit/test_align -vx
- py.test test/test_unit/test_tree -xv
# - coverage report
- mv .coverage .coverage.unit
artifacts:
paths:
- .coverage.unit
expire_in: 1 hour
func-test-ubuntu:
stage: test
except:
- docker
- helpers
- install
before_script:
- pip3 install --upgrade pip
- pip3 install -r requirements-dev.txt
- ./make
script:
- pwd
- py.test test/test_functional/test_pangenome.py -vx
- py.test test/test_functional/test_pangenome-parser.py -vx
- py.test test/test_functional/test_corepers* -vx
- py.test test/test_functional/test_align-parser.py -vx
- py.test test/test_functional/test_align.py -vx
- py.test test/test_functional/test_tree* -vx
- py.test test/test_functional/test_annote-parser.py -vx
- py.test test/test_functional/test_annote.py -xv
- py.test test/test_functional/test_all* -vx
- py.test test/test_functional/test_prepare* -vx
# - coverage report
- mv .coverage .coverage.functional
artifacts:
paths:
- .coverage.functional
expire_in: 1 hour
coverage:
stage: coverage
except:
- docker
- helpers
- install
dependencies:
- unit-test-ubuntu
- func-test-ubuntu
before_script:
- pip3 install --upgrade pip
- pip3 install -r requirements-dev.txt
script:
- pwd
- coverage combine .coverage.unit .coverage.functional
- coverage html
- coverage report
# test coverage parsing: \d+\%\s*$
# or pytest-cov (Python): ^TOTAL.+?(\d+\%)$
artifacts:
paths:
- htmlcov
expire_in: 1 hour
sphinx-doc:
stage: doc
only:
- master
- documentation
before_script:
- pip3 install -r requirements-dev.txt
- ./make
script:
- cd doc/source
- make html
artifacts:
paths:
- doc/build/html
expire_in: 1 hour
pages:
stage: deploy
only:
- doc
- master
dependencies:
- coverage
- sphinx-doc
script:
- mkdir -p public/htmlcov
- mv htmlcov public
- mkdir -p public/html-doc
- mv doc/build/html html-doc
- mv html-doc public
artifacts:
paths:
- public
expire_in: 1 hour
This diff is collapsed.
PanACoTA (PANgenome with Annotations, COre identification, Tree and corresponding Alignments) is a software providing tools for large scale bacterial comparative genomics. You can download all refseq genomes for a given species, or use your set of complete and/or draft genomes, to:
- Do a quality control of your strains, to eliminate poor quality genomes, which would not give any information for the comparative study
- Uniformly annotate all genomes (with functional annotation, or only syntactic annotation, according to your needs)
- Do a Pan-genome
- Do a Core or Persistent genome
- Align all Core/Persistent families
- Infer a phylogenetic tree from the Core/Persistent families
Copyright © 2020 Institut Pasteur (Paris).
# Only QC
PanACoTA annotate -d Examples/genomes_init -l Examples/input_files/list_genomes.lst -r Examples/2-res-QC -Q
# With prokka
PanACoTA annotate -d Examples/genomes_init -r Examples/2-res-prokka -l Examples/input_files/list_genomes.lst -n GENO --l90 3 --nbcont 10
# With prodigal
PanACoTA annotate -d Examples/genomes_init -r Examples/2-res-prodigal -l Examples/input_files/list_genomes.lst -n GENO --l90 3 --prodigal --small
# after running the example command-line for annotate
PanACoTA pangenome -l Examples/2-res-prokka/LSTINFO-list_genomes.lst -n GENO3 -d Examples/2-res-prokka/Proteins -i 0.8 -o Examples/3-pangenome
# to run only pangenome step of the example
PanACoTA pangenome -l Examples/input_files/pan-input/LSTINFO-list_genomes.lst -n GENO3 -d Examples/input_files/pan-input/Proteins -i 0.8 -o Examples/3-pangenome-alone
# core genome
PanACoTA corepers -p Examples/3-pangenome/PanGenome-GENO3.All.prt-clust-0.8-mode1.lst -o Examples/4-corepers
# strict persistent at 95%
PanACoTA corepers -p Examples/3-pangenome/PanGenome-GENO3.All.prt-clust-0.8-mode1.lst -o Examples/4-corepers0.95 -t 0.95
# run only coregenome step from example
PanACoTA corepers -p Examples/input_files/core-input/PanGenome-example.lst -o Examples/4-corepers-alone
\ No newline at end of file
# run example (after running annotate, pan and core steps)
PanACoTA align -c Examples/4-corepers/PersGenome_PanGenome-GENO3.All.prt-clust-0.8-mode1.lst-all_1.lst -l Examples/2-res-prokka/LSTINFO-list_genomes.lst -n GENO3_1 -d Examples/2-res-prokka -o Examples/5-align
# only run align step of example
PanACoTA align -c Examples/input_files/align-input/coregenome-example.lst -l Examples/input_files/pan-input/LSTINFO-list_genomes.lst -n GENO3_1 -d Examples/input_files/pan-input -o Examples/5-align-alone
# run example after running all other steps (annotate, pan, core, align)
PanACoTA tree -a Examples/5-align/Phylo-GENO3_1/GENO3_1.nucl.grp.aln -o Examples/6-tree
# run only tree step
PanACoTA tree -a Examples/input_files/tree-input/GENO3_1.nucl.grp.aln -o Examples/6-tree-alone
\ No newline at end of file
>genome1
ATGTGTAAAAGCCGGAGGGGTTATCTTTTCCCGGCTTTTTATTATCAATTACTCATTAACTCCTGTTCCGTTCTTTTGCGTTTAATCACCGGAATATCTCCGGTATTGTTCAGCGCCCCGGAAATGTTTTTAACCACTGTTCTGCACTCCGTTTATTAA
acgcgctcagcgcgcgctcatatatcgcgcgcgcgcgcgcgcatatatatata
ATGAGTGAGGCTGAAGCCCGCCCGACTAACTTTATTCGTCAGATTATTGATGAAGATCTGGCGAGTGGTAAACATACCACTGTCCATACCCGTTTTCCGCCGGAGCCGAATGGCTATCTGCATATCGGCCACGCGAAATCTATCTGCCTGAACTTTGGCATCGCGCAAGATTATCAGGGCCAGTGCAACCTGCGTTTCGATGACACCAACCCGGTAAAAGAAGATATCGAGTACGTTGATTCGATCAAAAACGACGTCGAGTGGTTAGGCTTTCACTGGTCTGGCGATATTCGCTACTCCTCCGATTACTTTGACCAACTGCACGCCTATGCGGTCGAGCTAATCAATAAAGGCCTGGCCTATGTTGATGAGCTGACGCCGGAGCAGATCCGTGAATACCGCGGTACGCTGACCGCGCCGGGTAAAAACAGCCCGTTCCGCGATCGCAGCGTCGAAGAGAACCTCGCGCTATTTGAAAAAATGCGTACCGGCGGTTTTGAAGAGGGTAAAGCCTGTCTGCGCGCTAAAATCGACATGGCGTCGCCGTTTATCGTGATGCGCGATCCGGTGCTGTATCGCATTAAATTCGCCGAGCATCATCAGACTGGCAACAAGTGGTGCATCTATCCGATGTACGACTTTACTCACTGCATCAGCGATGCGCTGGAAGGCATTACTCATTCTCTGTGTACGCTGGAGTTCCAGGATAACCGTCGTCTGTACGACTGGGTGCTGGACAACATCACCATTCCGGTTCACCCGCGCCAGTACGAATTCTCGCGCCTGAATCTGGAATACACCGTGATGTCCAAGCGTAAGCTGAACCTGCTGGTGACCGACAAACACGTCGAAGGTTGGGACGATCCGCGTATGCCGACTATTTCCGGTCTGCGCCGTCGCGGCTATACCGCGGCTTCTATTCGTGAGTTCTGCAAACGCATCGGCGTCACCAAGCAGGACAACACTATTGAGATGGCGTCGCTGGAATCCTGCATTCGCGAAGATCTGAACGAAAACGCGCCGCGCGCGATGGCGGTAATCGATCCGGTAAAACTGGTTATCGAAAATTACCCGCAGGGTGAGAGCGAAATGGTTACCATGCCTAACCATCCGAATAAACCGGAGATGGGCAGCCGTGAAGTGCCGTTTAGCGGTGAGATCTGGATCGATCGCGCAGATTTCCGCGAAGAAGCGAACAAACAGTACAAACGTCTGGTGATGGGCAAAGAAGTGCGTCTGCGTAATGCCTACGTCATTAAAGCGGAGCGCGTAGAGAAGGATGCCGAAGGGAATATCACCACCATCTTCTGTACCTATGATGCTGATACGCTGAGTAAAGATCCGGCTGACGGGCGTAAAGTGAAAGGCGTAATCCACTGGGTTAGCGCAGCACATGCGCTGCCGATTGAAATTCGTCTCTACGACCGTCTGTTCAGCGTGCCGAATCCGGGCGCCGCGGAGGACTTCCTGTCTGTTATCAACCCCGAATCATTAGTGATTAAGCAGGGGTATGGCGAGCCGTCGCTGAAAGCGGCGGTAGCAGGAAAAGCTTTCCAGTTTGAACGTGAAGGCTACTTCTGCCTCGACAGCCGCTATGCAACGGCCGATAAGCTGGTCTTTAACCGCACCGTGGGCCTGCGTGATACCTGGGCGAAAGCGGGCGAGTAA
cgcgcataggcggccttcaaggaggcgctaggcga
ATGAAAGCGCTACTGTGGCTGGTGGGTCTCGCGTTGCTGTTAACAGGCTGCGCGAGCGAAAAAGGAATTATCGATAAAGAGGGATATCAGCTTGATACCCGACATCGGGCGCAGGCGGCCTATCCGCGCATTAAAGTCCTGGTGATTCACTATACGGCGGAAAACTTTGACGTTTCGCTGGCGACGTTAACGGGTCGCAACGTCAGTTCGCATTACCTGATTCCCGCAACCCCGCCATTATATGGCGGTAAACCGCGCATCTGGCAACTGGTGCCGGAACAGGATCAGGCCTGGCATGCGGGCGTCAGTTTCTGGCGAGGCGCCACGCGTCTCAATGATACGTCTATTGGCATTGAGCTGGAAAATCGTGGTTGGCGAATGTCCGGCGGGGTGAAATCTTTCGCGCCGTTTGAATCCGCGCAAATTCAGGCATTGATTCCGTTAGCGAAGGATATTATCGCGCGCTATAACATCAAACCGCAGAATGTGGTGGCCCATGCGGATATCGCGCCGCAGCGTAAAGACGATCCCGGCCCGCGCTTCCCGTGGCGCGAGCTGGCGGCGCAGGGGATTAGCGCCTGGCCTGACGCCCAGCGTGTGGCGTTTTATCTGGCTGGACGCGCGCCGTATACGCCAGTCGATACCGCAACGGTGCTTGCGTTACTCTCGCGCTATGGCTATGAAGTCAAAGCCGATATGACGGCACGCGAGCAGCAGCGGGTGATTATGGCGTTCCAGATGCACTTCCGTCCGGCGCAATGGAACGGTATCGCAGATGCCGAAACGCAGGCGATTGCCGAAGCATTACTGGAGAAGTACGGCCAGGATTAA
cgcgataggcgcgcgagattacgcgcgcagtatcgcgcnnnnnnnnnnncgcgcatagcgcgca
ATGCCGCACTTTATTGCTGAATGTACTGAAAATATTCGCGAGCAGGCTGATTTACCCGGCCTGTTCAGCAAGGTAAACGAGGCGCTGGCCGCCAGCGGGATTTTCCCCATCGGCGGTATCCGCAGTCGCGCCCACTGGCTGGATACCTGGCAGATGGCTGACGGTAAGCATGATTACGCGTTTGTGCATATGACGCTGAAAATCGGCGCCGGGCGCAGCCTGGAGAGCCGTCAGGAAGTTGGCGAAATGCTGTTTGGGCTGATTAAAGCCCACTTCGCCGACCTGATGGAGAACCGCTATCTGGCGCTGTCGTTTGAGATTGCCGAGCTACATCCGACGCTCAATTACAAACAAAACAACGTACACGCGTTATTTAAATAG
ccgatatgaggcgcggcgctataaggcgctcatgagc
ATGCCCGCGACTAAATTCTCCCGACGTACCCTCCTGACGGCAGGTTCTGCGCTTGCTGTTCTTCCTTTTCTGCGCGCCTTGCCGGTACAGGCGCGTGAACCTCGCGAGACCGTCGATATTAAGGATTATCCGGCGGATGACGGTATCGCCTCGTTCAAACAGGCCTTCGCCGACGGACAGACCGTGGTCGTACCGCCAGGATGGGTGTGTGAAAATATCAATGCGGCGATAACGATTCCGGCGGGAAAAACGCTGCGGGTACAGGGCGCGGTGCGTGGGAATGGCCGGGGACGGTTTATTTTGCAGGACGGGTGTCAGGTGGTGGGGGAGCAGGGCGGCAGTCTGCACAATGTGACGCTGGATGTTCGCGGGTCGGACTGTGTGATTAAAGGCGTGGCGATGAGCGGCTTTGGCCCCGTCGCGCAAATTTTCATCGGTGGTAAGGAACCGCAGGTGATGCGTAATCTCATTATCGATGACATCACCGTTACCCACGCCAACTACGCCATTCTCCGCCAGGGATTTCATAACCAAATGGATGGCGCGCGGATTACGCATAGCCGCTTTAGCGATTTACAGGGGGACGCCATTGAGTGGAATGTCGCGATTCACGACCGCGACATCCTGATTTCCGATCATGTCATCGAACGCATTAATTGTACCAATGGCAAAATCAACTGGGGGATCGGCATCGGGCTGGCGGGTAGCACCTATGACAACAGTTATCCTGAAGACCAGGCAGTAAAAAACTTTGTGGTGGCCAATATTACCGGATCTGATTGCCGACAGCTTGTGCACGTAGAAAATGGCAAACATTTCGTCATTCGCAATGTCAAAGCCAAAAACATCACGCCCGGTTTCAGTAAAAATGCGGGTATTGATAACGCAACGATCGCAATTTATGGCTGTGATAATTTCGTCATTGATAATATTGATATGACGAATAGTGCCGGGATGCTCATCGGCTATGGCGTCGTTAAAGGAAAATACCTGTCAATTCCGCAAAACTTTAAATTAAACGCTATTCGGTTGGATAATCGCCAGGTTGCTTATAAATTACGCGGCATTCAAATTTCCTCCGGCAACACCCCCTCTTTTGTCGCCATCACCAATGTACGGATGACGCGTGCTACGCTGGAACTGCATAATCAACCGCAGCACCTCTTTCTGCGCAATATCAACGTGATGCAAACTTCAGCGATTGGCCCGGCGTTAAAAATGCATTTCGATTTGCGTAAAGATGTACGTGGTCAATTTATGGCCCGCCAGGACACGCTGCTTTCCCTCGCTAATGTTCATGCCATCAATGAAAACGGGCAGAGTTCCGTGGATATCGACAGGATTAATCACCAAACCGTGAATGTCGAAGCAGTGAATTTTTCGCTGCCGAAGCGGGGAGGGTAA
cgaattccgcggcatatagcggcgcgatagc
ATGTCAGAAAATAAATTACACGTTATCGATTTGCACAAACGCTACGGCGGTCATGAAGTGCTGAAAGGGGTATCGCTGCAGGCCCGCGCCGGAGATGTGATTAGCATCATCGGCTCGTCCGGCTCCGGTAAAAGCACTTTTTTGCGCTGTATTAACTTCCTCGAAAAACCGAGCGAAGGCGCGATTATCGTGAACGGTCAGAACATTAATCTGGTGCGCGACAAAGATGGGCAGCTCAAAGTGGCGGATAAAAATCAGCTACGCTTGTTGCGTACCCGCCTGACGATGGTGTTTCAGCACTTCAACCTCTGGAGCCACATGACGGTGCTGGAAAATGTGATGGAAGCGCCGATTCAGGTACTGGGATTAAGCAAGCACGACGCGCGCGAGCGGGCGTTGAAATATCTGGCGAAGGTGGGGATTGATGAGCGCGCTCAGGGCAAATATCCCGTCCATCTCTCCGGCGGCCAACAGCAGCGCGTTTCTATTGCGCGCGCGCTGGCGATGGAACCTGACGTTTTACTGTTCGATGAACCCACATCGGCGCTCGATCCTGAACTGGTCGGCGAAGTGTTGCGCATCATGCAACAACTGGCGGAAGAAGGCAAAACGATGGTGGTGGTCACGCATGAAATGGGCTTCGCTCGCCATGTCTCTTCGCACGTTATTTTTCTGCATCAGGGGAAAATTGAAGAAGAGGGTGATCCGGAGCAGGTGTTCGGCAATCCGCAAAGCCCGCGTTTACAGCAATTCCTGAAAGGCTCGCTGAAATAA
cgctcagaggcgcgcgcgcgctatatacgcgca
GTGTTTATTGGCATAGTTAGCCTGTTTCCTGAAATGTTCCGCGCAATTACCGATTACGGGGTAACTGGCCGGGCAGTAAAAAAAGGCCTGCTGAACATCCAAAGCTGGAGTCCTCGCGACTTCGCGCATGACCGGCACCGTACCGTGGACGACCGTCCTTACGGCGGCGGACCGGGGATGTTAATGATGGTGCAACCCTTGCGGGACGCCATTCACGCAGCAAAAGCCGCGGCAGGTGAAGGCGCTAAAGTGATTTATCTGTCGCCTCAGGGACGCAAGCTTGATCAAGCGGGCGTTAGCGAGCTGGCCACGAATCAGAAGCTTATTCTGGTGTGTGGTCGCTACGAAGGCGTAGATGAGCGCGTAATTCAGACCGAAATTGACGAAGAATGGTCAATTGGCGATTACGTTCTCAGCGGTGGCGAACTACCGGCAATGACGCTGATTGACTCCGTCGCCCGGTTTATACCGGGGGTTCTGGGGCATGAGGCATCAGCAATCGAAGATTCGTTTGCTGATGGGTTGCTGGATTGTCCGCACTATACGCGCCCTGAAGTGTTAGAGGGGATGGAAGTACCGCCAGTATTGCTGTCGGGAAACCATGCTGAGATACGTCGCTGGCGTTTGAAACAGTCGCTGGGCCGAACCTGGCTTAGAAGACCTGAACTTCTGGAAAACCTGGCTCTGACTGAAGAGCAAGCAAGGTTGCTGGCGGAGTTCAAAACAGAACACGCACAACAGCAGCATAAACATGATGGGATGGCATAG
ccgtcatatgggctctcagaggagacgcgctaatgcgcagtac
GTGTTTATTGGCATAGTTAGCCTGTTTCCTGAAATGTTCCGCGCAATTACCGATTACGGGGTAACTGGCCGGGCAGTAAAAAAAGGCCTGCTGAACATCCAAAGCTGGAGTCCTCGCGACTTCGCGCATGACCGGCACCGTACCGTGGACGACCGTCCTTACGGCGGCGGACCGGGGATGTTAATGATGGTGCAACCCTTGCGGGACGCCATTCACGCAGCAAAAGCCGCGGCAGGTGAAGGCGCTAAAGTGATTTATCTGTCGCCTCAGGGACGCAAGCTTGATCAAGCGGGCGTTAGCGAGCTGGCCACGAATCAGAAGCTTATTCTGGTGTGTGGTCGCTACGAAGGCGTAGATGAGCGCGTAATTCAGACCGAAATTGACGAAGAATGGTCAATTGGCGATTACGTTCTCAGCGGTGGCGAACTACCGGCAATGACGCTGATTGACTCCGTCGCCCGGTTTATACCGGGGGTTCTGGGGCATGAGGCATCAGCAATCGAAGATTCGTTTGCTGATGGGTTGCTGGATTGTCCGCACTATACGCGCCCTGAAGTGTTAGAGGGGATGGAAGTACCGCCAGTATTGCTGTCGGGAAACCATGCTGAGATACGTCGCTGGCGTTTGAAACAGTCGCTGGGCCGAACCTGGCTTAGAAGACCTGAACTTCTGGAAAACCTGGCTCTGACTGAAGAGCAAGCAAGGTTGCTGGCGGAGTTCAAAACAGAACACGCACAACAGCAGCATAAACATGATGGGATGGCATAG
cgcatacgcgcgcgatatatattcgcgcagaggcgcgcatagcg
ATGAAGTTTGTTGCGCCCGAACAGGCACCGGAACAGGCGGAGGTCATCAAAAATACGCCGTTCTGGCCTGATGTGGACCTGTCGGAATTTCGCAGTGTGATGCGCACTGACGGCACGGTGACGCAGCCGCGTTTAAAGCAGGTCGTGCTGACGGCGATCTCTGAGGTTAACGCTGAGCTGTACGACTTCCGCAACCGTCAGCAGATGCTGGGCTGGCGGACACTTGCTGAGGTTCCCGCAGAAATGCTGGACGGTAAAAGCGAGCGTATCCGGCACTACCACAACGCTGTTTTTTGCTGGGCGCGCGCTGTGCTTAATGAGCGTTATCAGGACTATGACGCCACGGCGTCAGGCGTGAAGCGAGGGGAGGAGCTGGCGGAGGCCAGCGGCGATCTGTGGCGTGATGCCCGCTGGGCCATCAGCCGGGTGCAGGATGTACCGCACTGTACGGTGGAGCTTATCTGA
ACGGCTAGCGCGTAGCGGCAGTCTCGG
ATGAATAATCATTTTGGGAAAGGGTTAATGGCCGGGTTGCACGCGCCATATGCATATAGCGCGCATCATGCGGTGAATTTCTGTTCTGAGTATAAACGTGGCTTTGTATTGGGTTTTACACACCGTATGTTCGAAAAGACCGGCGATCGTCAACTTAGCGCGTGGGAGGCTGGAATTCTGACGCGTCGCTATGGTCTGGATAAAGAAATGGTGATGGATTTCTTTAAAGAGAATCATTCCGGGATGGCGGTTCGCTTCTTTATGGCCGGTTATCGACTCGAAGGTTGA
CGATCGCGCGCAGGAGGAGAGCTCTCTTCTTCTAGAGC
ATGTCTACGCTTCTCTATTTGCACGGATTCAACAGTTCCCCTCGCTCGGCAAAAGCGTGCCAGCTAAAAAACTGGCTGGCGGAGCGTCATCCGCATGTTGAGATGATCGTCCCTCAGCTGCCGCCGTATCCTGCCGATGCGGCGGAGTTGCTGGAATCTCTCGTGCTTGAGCATGGCGGTGCGCCATTAGGGCTGGTAGGATCGTCGCTGGGTGGTTATTACGCCACCTGGCTGTCGCAATGTTTTATGCTGCCGGCTGTGGTGGTGAATCCCGCCGTGCGGCCCTTTGAATTACTGACCGACTATCTCGGTCAGAACGAGAACCCCTACACCGGGCAGCAATATGTGCTAGAGTCTCGCCATATTTATGATCTTAAAGTCATGCAGATTGACCCGCTGGAAGCGCCGGACCTGATCTGGCTACTGCAACAGACGGGCGATGAAGTGCTGTATTACCGCCAGGCGGTGGCATATTACGCCTCCTGCCGTCAGACAGTGACCGAGGGTGGTAATCACGCATTCACGGGCTTCGAAGATTATTTCAACCAGATTGTCGATTTTCTTGGACTGCACAGTTGCTGA
CGGCTATGCGCGCGCTCG
ATGATTGACCCTATTTTTGCGTCCTGTACGCTAATTGCCGTCTTTGTTGTTTTACTGGCCATGGGCGCGCCTATCGGGATCTGCATCGTTATCGCCTCTTTCAGCACCATGATGCTGGTACTGCCTTTCGATATTTCGATGTTCGCCACCGCGCAAAAAATGTTCTCCAGCCTGGACAGTTTTGCCTTGCTGGCCGTGCCGTTCTTCGTTTTGTCCGGGGTGATCATGAATAGCGGGGGAATTGCCGCCCGGCTGGTCAATTTTGCCAAACTGTTTACTGGCAAACTGCCCGGCTCGCTCTCTTATACCAACATCGTCGGCAATATGATGTTCGGTGCAATTTCCGGATCGGCGATTGCCGCCTCAACCTCCATCGGCGGCGTGATGGTGCCGATGAGCGCGCGCGAAGGTTACGATCGCGGCTTTGCGGCCGCGGTGAATATCGCCTCCGCGCCGACGGGAATGTTAATTCCGCCCACCACGGCTTTTATCCTTTACGCGCTGGCAAGCGGGGGAACATCGATTGCCGCTCTGTTCGCCGGCGGTCTGGTCGCGGGAGTGCTGTGGGGCGTTGGCTGTATGCTGGTCACGCTGGTGGTCGCTAAGCGTCGAAATTATCGGGTTTTCTTCACCGTCCAAAAAGGTATGGCGCTAAAAGTTGCCGTTGAGGCCATTCCCAGCCTGCTGCTGATCGTGATTATTGTCGGCGGCATTGTGCAGGGGATTTTCACCGCCATTGAAGCCTCCGCGATTGCCGTGGTGTATACGTTATTGCTGACGATGGTGTTTTACCGCACGCTGAAAATTAAGGATTTGCCTTCGATTTTGCTCCAGACAGTGGTAATGACCGGGGTCATCATGTTCCTGCTGGCAACCTCTTCGGCGATGTCCTTCTCGATGTCGATCACCAATATTCCTGCGGCGCTGAGCGATATGATCCTCGGTATTTCCGCCAATAAACTGGTTATCCTGTTAGTCATTACCGTCTTTTTGTTGATTATCGGCGCATTTATGGATATTGGTCCGGCCATTCTGATTTTTACCCCGATTCTGCTGCCAATCATGGCTAAACTGGGCGTCGATCCGGTGCATTTCGGCATTATCATGATCTATAACCTGGCGATTGGCACCATTACGCCGCCAGTTGGCAGTGGTTTATATGTCGGGGCGAGCGTCGGTAAGGTCAAAGTTGAGGAAGTGATTAAACCGTTGCTGCCTTTTTACGGCGCGATTATCGGCGTTCTGTTATTAATTACCTACATTCCGGAAATCACACTGTTCTTACCCCGTCTACTGGGCATCATGTAA
>this_is_genome2_contig_number1
ATGTCAGAAAATAAATTACACGTTATCGATTTGCACAAACGCTACGGCGGTCATGAAGTGCTGAAAGGGGTATCGCTGCAGGCCCGCGCCGGAGATGTGATTAGCATTATCGGCTCGTCCGGTTCCGGTAAAAGCACTTTTTTGCGCTGCATTAACTTCCTCGAAAAATCGAGCGAAGGCGCGATTATCGTGAACGGTCAGAACATTAATCTGGTGCGCGACAAAGACGGGCAGCTCAAAGTGGCGGATAAAAATCAGCTACGCTTGTTGCGTACCCGCCTGACGATGGTGTTTCAGCACTTTAACCTCTGGAACCACATGACGGTGCTGGAAAATGTGATGGAAGCGCCGATTCAGGTACTGGGATTAAGCAAGCACGACGCGCGCGAGCGGGCGTTGAAATATCTGGCGAAGGTGGGGATTGATGAGCGCGCTCAGGGCAAATATCCCGTCCATCTCTCCGGCGGCCAACAGCAGCGCGTTTCTATTGCGCGCGCGCTGGCGATGGAACCTGACGTTTTACTGTTCGATGAACCCACATCGGCGCTCGATCCTGAACTGGTCGGCGAAGTGTTGCGCATCATGCAACAACTGGCGGAAGAAGGCAAAACGATGGTGGTGGTCACGCATGAAATGGGCTTCGCCCGCCATGTCTCTTCGCACGTGATTTTTCTGCATCAGGGGAAAATTGAAGAAGAGGGCAATCCGGAGCAGGTGTTCGGCAATCCGCAAAGCCCGCGTTTACAGCAATTCCTGAAAGGCTCGCTGAAATAA
acgctagaggacgcgcctctcagagagcgcgctctctcagagaggcgcgcgcctctttcgcagagaccnncgctcatgagcg
ATGCCCGCGACTAAATTCTCCCGACGTACCCTCCTGACGGCAGGTTCCGCGCTTGCTGTTCTTCCTTTTCTGCGCGCCTTGCCGGTACAGGCGCGTGAACCTCGCCAGACCGTCGATATTAAGGATTATCCGGCGGATGACGGTATCGCCTCGTTCAAACAGGCCTTCGCCGACGGGCAGACTGTGGTCGTGCCGTCAGGATGGGTGTGTGAAAATATCAATGCGGCGATAACGATTCCGGCGGGAAAAACGCTGCGGATACAGGGCGCGGTGCGTGGGAATGGCCGGGGACGGTTTATTTTGCTGGACGGGTGTCAGGTGGTGGGGGAGCAGGGCGGCAGTCTGCACAATGTGACGCTGGATGTTCGCGGGTCGGACTGTGTGATTAAAGGCGTGACGATGAGCGGCTTTGGCCCCGTCGCGCAAATTTTCATCGGCGGTAAGGAACCGCAGGTGATGCGTAATCTCATTATCGATGACATCACCGTTACCCACGCCAACTACGCCATTCTCCGCCAGGGATTTCATAACCAAATGGACGGCGCGCGGATTACGCATAGTCGCTTTAGCGATTTGCAGGGGGACGCCATTGAGTGGAATGTCGCGATTCATGACCGCGACATCCTGATTTCCGATCATGTCATCGAACGCATTGATTGTACCAATGGCAAAATCAACTGGGGGATCGGCATCGGGCTGGCGGGTAGCGCCTATGACAATAGTTATCCTGAAGACCAGGCAGTAAAAAACTTTGTGGTGGCCAATATTACCGGATCTGATTGCCGACAACTGGTACACGTAGAAAATGGCAAACATTTCGTCATTCGCAATGTCAAAGCCAAAAACATCACGCCCGATTTCAGTAAAAATGCGGGTATTGATAACGCAACGATCGCCATTTATGGCTGTGATAATTTCGTCATTGATAATATTGATATGACGAATAGTGCCGGGATGCTCATCGGCTATGGCGTCGTTAAAGGAAAATACCTGTCAATTCCGCAAAACTTTAAATTAAACGCTATTCGGTTGGATAATCGCCAGGTTGCTTATAAATTACGCGGCATTCAAATTTCCTCCGGTAACGCCCCCTCATTTGTTGCCATCACCAATGTACGGATGACGCGTGCTACGCTGGAACTGCATAATCAACCGCAGCACCTCTTTTTGCGTAATATCAACGTGATGCAAACTTCAGCGATTGGCCCGGCGTTAAAAATGCATTTTGATTTGCGTAAAGATGTCCGTGGTCAATTTATGGCCCGCCAGGACACGCTGCTTTCCCTCGCTAATGTTCATGCCATCAATGAAAACGGGCAGAGTTCCGTGGATATCGACAGGATTAATCACCAAACCGTGAATGTCGAAGCAGTGAATTTTTCGCTGCCGAAGCGGGGAGGGTAA
cactcgcgcatagagagctctcagaggagcgcgcgcgctatagcgcgcnnnnncgcgataatatagcgcgcgctcatagc
ATGAGCGCGCTATTTCTGGCCATCCCGTTAACCATTTTTGTGTTGTTTGTGTTACCGATTTGGCTGTGGCTGCATTACAGCAACCGCGCCGGTCGGGGAGAACTGTCGCAAAGCGAGCAGCAACGCTTACTGCAACTCACAGACGACGCGCAACGTATGCGCGAGCGCATTCAGGCGCTGGAAGATATTCTTGATGCAGAGCATCCGAACTGGAGAGAGCGCTAA
cgccatattatagcgcgcctcataagagcggcctatagcgcgctannn
ATGCCGCACTTTATTGCTGAATGTACTGAAAATATTCGCGAGCAGGCTGATTTACCAAGCCTGTTCAGCAAGGTAAACGAGGCGCTGGCCGCCACCGGGATTTTCCCCATCGGCGGTATCCGCAGTCGCGCCCACTGGCTGGATACCTGGCAGATGGCTGACGGTAAGCATGATTACGCGTTTGTGCATATGACGCTGAAAATCGGCGCCGGGCGCAGCCTGGAGAGCCGTCAGGAAGTCGGCGAAATGCTGTTTGGGCTGATTAAAGCCCACTTCGCCGACCTGATGGAGAACCGCTATCTGGCGCTGTCGTTTGAGATTGCCGAGTTACATCCAACGCTCAATTACAAACAAAACAACGTACACGCGTTATTTAAATAG
ccagagattcgcgcgttcagagaggagctctctcatagacgcgcgcatatgcgctctagagaggcgcgcctaatggcgcgctatg
ATGAAAGCGCTACTGTGGCTGGTTGGTCTCGCGTTGCTGTTAACAGGCTGCGCGAGCGAAAAAGGAATTATCGATAAAGAGGGATATCAGCTTGATACCCGACATCGGGCGCAGGCGGCCTATCCGCGCATTAAAGTCCTGGTGATTCACTATACGGCGGAAAACTTTGACGTTTCGCTGGCGACGTTAACGGGTCGCAACGTCAGTTCGCATTACCTGATTCCCGCAACCCCGCCATTATATGGCGGTAAACCGCGCATCTGGCAACTGGTGCCGGAACAGGATCAGGCTTGGCATGCGGGCGTCAGTTTCTGGCGAGGCGCCACGCGTCTCAATGATACGTCTATTGGCATTGAGCTGGAAAATCGCGGCTGGCGAATGTCCGGCGGGGTGAAATCTTTCGCGCCGTTTGAATCCGCGCAAATTCAGGCATTGATCCCGTTAGCGAAGGACATTATCGCGCGCTATGACATCAAACCGCAGAATGTGGTGGCCCATGCGGATATCGCGCCGCAGCGTAAAGACGATCCCGGCCCGCGCTTCCCGTGGCGCGAGCTGGCGGCACAGGGGATTGGCGCCTGGCCTGACGCCCAGCGTGTGGCGTTTTATCTGGCTGGACGCGCGCCGTATACGCCAGTCGATACCGCAACGGTGCTTGCGTTACTCTCGCGCTATGGCTATGAAGTCAAAGCCGATATGACGGCGCGCGAGCAACAGCGGGTGATTATGGCGTTCCAGATGCACTTCCGTCCGGCGCAATGGAACGGTATCGCAGATGCCGAAACGCAGGCGATTGCCGAAGCATTACTGGAGAAGTACGGCCAGGATTAA
caaagcgctctcagagagagcgctctgcag
ATGAGTGAGGCTGAAGCCCGCCCGACTAACTTTATTCGTCAGATTATTGATGAAGATCTGGCGAGTGGTAAACATACCACTGTCCATACCCGTTTTCCGCCGGAGCCGAATGGCTATCTGCACATCGGCCACGCGAAATCTATCTGCCTGAACTTTGGCATCGCGCAAGATTATCAGGGCCAGTGCAACCTGCGTTTCGATGACACCAACCCGGTAAAAGAAGATATCGAGTACGTTGATTCGATCAAAAACGACGTCGAGTGGTTAGGCTTTCACTGGTCTGGCGATATTCGCTACTCCTCCGATTACTTTGACCAACTGCACGCCTATGCGGTCGAGCTCATCAATAAAGGCCTGGCCTACGTTGATGAGCTGACGCCGGAGCAGATCCGCGAATACCGTGGTACGCTGACCGCGCCGGGTAAAAACAGCCCGTTCCGCGATCGCAGCGTGGAAGAAAACCTCGCGCTATTTGAAAAAATGCGTACCGGCGGTTTTGAAGAGGGTAAAGCCTGTCTGCGCGCTAAAATCGACATGGCGTCGCCGTTTATCGTGATGCGCGATCCGGTGCTGTATCGCATTAAATTCGCCGAGCATCATCAGACCGGCACGAAGTGGTGCATCTATCCGATGTACGACTTTACTCACTGCATCAGCGATGCGCTGGAAGGCATTACTCATTCTCTGTGTACGCTGGAGTTCCAGGACAACCGTCGTCTGTACGACTGGGTGCTGGACAACATCACCATTCCGGTTCACCCGCGCCAGTACGAATTCTCGCGCCTGAATCTGGAATACACCGTGATGTCCAAGCGTAAGCTGAACCTGCTGGTGACCGACAAACACGTCGAAGGTTGGGATGATCCGCGTATGCCGACTATTTCCGGTCTGCGCCGTCGCGGCTATACCGCGGCTTCTATTCGTGAGTTCTGCAAACGCATCGGCGTCACCAAGCAGGACAACACTATTGAGATGGCGTCGCTGGAATCCTGCATTCGCGAAGATCTGAACGAAAACGCGCCGCGCGCGATGGCGGTAATCGATCCGGTAAAACTGGTTATCGAAAACTACCCGCAGGGCGAGAGCGAAATGGTTACCATGCCTAACCATCCGAATAAACCGGAGATGGGCAGCCGTGAAGTGCCGTTTAGCGGTGAGATCTGGATCGATCGCGCGGATTTCCGCGAAGAAGCGAACAAACAGTACAAACGTCTGGTGATGGGCAAAGAAGTGCGTCTGCGTAATGCCTACGTCATTAAAGCGGAGCGCGTAGAGAAGGATGCCGAAGGGAATATCACCACCATCTTCTGTACCTATGATGCTGATACGCTGAGTAAAGATCCGGCTGACGGGCGTAAAGTGAAAGGCGTAATCCACTGGGTTAGCGTAGCACATGCGCTGCCGATTGAAATTCGTCTCTACGACCGTCTGTTCAGCGTGCCGAACCCGGGCGCCGCGGAGGACTTCCTGTCTGTTATCAACCCCGAATCATTAGTGATTAAGCAGGGGTATGGCGAGCCGTCGCTGAAAGCGGCGGTAGCAGGGAAAGCTTTCCAGTTTGAACGTGAAGGTTACTTCTGCCTTGACAGCCGCTATGCAACGGCCGATAAGCTGGTCTTTAACCGCACCGTGGGCCTGCGTGATACCTGGGCGAAAGCGGGCGAATAA
>this_is_genome2_contig_number2
acgcgctatagggctctcagagagtctca
GTGTTTATTGGCATCGTTAGCCTGTTTCCTGAAATGTTCCGCGCAATTACCGATTACGGGGTAACTGGCCGGGCAGTAAAAAAAGGCCTGCTGAACATCCAAAGCTGGAGTCCTCGCGACTTCGCGCATGACCGGCACCGTACCGTGGACGACCGTCCTTACGGCGGCGGACCGGGGATGTTAATGATGGTGCAACCCTTGCGGGACGCCATTCATGCAGCAAAAGCCGCGGCAGGTGAAGGCGCTAAAGTGATTTATCTGTCGCCTCAGGGACGCAAGCTTGATCAAGCGGGCGTTAGCGAGCTGGCCACGAATCAGAAACTCATTCTGGTGTGTGGTCGCTACGAAGGCGTAGATGAGCGCGTAATTCAGGCCGAAATTGACGAAGAATGGTCAATTGGCGATTACGTTCTCAGCGGTGGCGAACTACCGGCAATGACGCTGATTGACTCCGTCGCCCGGTTTATACCGGGGGTTCTGGGGCATGAGGCATCAGCAATCGAAGATTCGTTTGCTGATGGGTTGCTGGATTGTCCGCACTATACGCGCCCTGAAGTGTTAGAGGGGATGGAAGTACCGCCAGTATTGCTGTCGGGAAACCATGCTGAGATACGTCGCTGGCGTTTGAAACAGTCACTGGGCCGAACCTGGCTTAGAAGACCTGAACTTCTGGAAAACCTGGCTCTGACTGAAGAGCAAGCAAGGTTGCTGGCGGAGTTCAAAACAGAACACGCACAACAGCAGCATAAACATGATGGGATGGCATAG
cgagatcgcgcatagcgcgcggcgagatccgcgagac
ATGAATAATCATTTTGGGAAAGGGTTAATGGCCGGGTTGCACGCGCCATATGCATATAGCGCGCATCATGCGGTGAATTTCTGTTCTGAGTATAAACGTGGCTTTGTATTGGGTTTTACACACCGTATGTTCGAAAAGACCGGCGATCGTCAACTTAGCGCGTGGGAGGCCGGAATTCTGACGCGTCGCTATGGTCTGGATAAAGAAATGGTGATGGATTTCTTTAAAGAGAATCATTCCGGGATGGCGGTTCGCTTCTTTATGGCTGGTTATCGACTCGAAGGTTGA
acgcctctagagcgctagaggcgcgcgcgatatacgcggcgcgagac
ATGTCTACGCTTCTCTATTTGCACGGATTCAACAGTTCCCCTCGCTCGGCAAAAGCGTGCCAGCTAAAAAACTGGCTGGCGGAGCGTCATCCGCATGTTGAGATGATCGTCCCTCAACTGCCGCCGTATCCTGCCGATGCGGCGGAGTTGCTGGAATCTCTCGTACTTGAGCATGGCGGTGCGCCATTAGGGCTGGTAGGATCGTCGCTGGGTGGTTATTACGCCACCTGGCTGTCGCAATGTTTTATGCTGCCGGCTGTGGTGGTGAATCCCGCCGTGCGGCCCTTTGAATTACTGACCGACTATCTCGGTCAGAACGAGAACCCCTACACCGGGCAGCAATATGTGCTAGAGTCTCGCCATATTTATGATCTTAAAGTCATGCAGATTGACCCGCTGGAAGCGCCGGACCTGATCTGGCTACTGCAACAGACGGGCGATGAAGTGCTGGATTACCGCCAGGCGGTGGCATATTACGCCTCCTGCCGTCAGACAGTGACCGAGGGGGGTAATCACGCATTCACGGGCTTCGAAGATTATTTCAACCAGATTGTCGATTTTCTTGGACTGCACAGTTGCTGA
ccggatatacgcgcgcgcgctatatagcgcgcgcggcgatatagcgc
ATGAAGTTTGTTGCGCCAGAACAGGCACCGGAACAGGCGGAAATCATCAGAAATACGCCGTTCTGGCCTGATGTGGACCTGTCGGAGTTTCGCAGCATGATGCGCACTGATGGCACGGTGACGCAGCCGCGTTTAAAGCAGGTTGCGCTGTCGGCAATTTCGGAGGTCAACGCAGAGCTGTATGAGTTTCGCAGACGCCAGCAGATGCTGGGGTATGCCTCGCTGGCAGAAGTCCCGGCGGAACAACTGGACGGCAAAAGCGAGCGCATTCAGCACTATTTCAACGCGGTTTACTGCTGGGCACGCGCCATGCTCAACGAACGTTACCAGGACTATGACGCCACGGCATCCGGTGTGAAGCGGGGCGAAGAACTGGCAGAAGCCAGCGGTGATTTGTGGCGTGACGCCCGCTGGGCCATCAGCCGGGTGCAGGATGCGCCGCACTGCACAGTGGAGCTTATCTGA
>this_is_genome2_contig_number3
ATGATTGACCCTATTTTTGCGTCCTGTACGCTAATTGCCGTCTTTGTTGTTTTACTGGCCATGGGCGCGCCTATCGGGATCTGCATCGTTATCGCCTCTTTCAGCACCATGATGCTGGTACTGCCTTTCGATATTTCGATGTTCGCCACCGCGCAAAAAATGTTCTCCAGCCTGGACAGTTTTGCCTTGCTGGCCGTGCCGTTCTTCGTTTTGTCCGGGGTGATCATGAATAGCGGGGGAATTGCCGCCCGACTGGTCAATTTTGCCAAACTGTTTACTGGCAAACTGCCCGGCTCGCTCTCTTACACCAACATCGTCGGCAATATGATGTTCGGTGCAATTTCCGGATCGGCGATTGCCGCCTCAACCTCTATCGGCGGCGTGATGGTGCCGATGAGCGCGCGCGAAGGTTACGATCGCGGTTTTGCGGCCGCGGTGAATATCGCCTCCGCGCCGACGGGAATGTTAATTCCGCCCACCACGGCTTTTATCCTTTATGCGCTGGCAAGCGGGGGAACATCGATTGCCGCTCTGTTCGCCGGCGGTCTGGTCGCGGGAGTGCTGTGGGGCGTTGGCTGTATGCTGGTCACGCTGGTGGTCGCTAAGCGTCGAAATTATCGGGTTTTCTTCACCGTCCAAAAAGGCATGGCGCTAAAAGTTGCCGTTGAGGCCATTCCCAGCCTGTTACTGATCGTGATTATTGTCGGCGGCATTGTGCAGGGGATTTTCACCGCCATTGAAGCCTCCGCGATTGCCGTGGTGTATACGTTATTGCTGACGATAGTGTTTTACCGCACGCTGAAAATTAAGGATTTGCCTTCGATTTTGCTCCAGACAGTGGTAATGACCGGGGTCATCATGTTCCTGCTGGCAACCTCTTCGGCGATGTCCTTCTCGATGTCGATCACCAATATTCCTGCGGCGCTGAGCGATATGATCCTCGGTATTTCCGCCAATAAACTGGTTATCCTGTTAGTCATTACCGTCTTTTTGTTGATTATCGGCGCATTTATGGATATCGGTCCGGCCATTCTGATTTTTACCCCGATTCTGCTGCCGATTATGACTAAACTGGGCGTCGATCCGGTGCATTTCGGCATTATCATGATCTATAACCTGGCGATAGGCACCATTACGCCGCCAGTTGGCAGTGGTTTATATGTCGGGGCGAGCGTCGGTAAGGTCAAAGTTGAGGACGTTATCAAACCGTTGATGCCTTTTTACGGCGCGATTATCGGCGTTCTGTTATTAATTACCTACATTCCGGAAATCACACTGTTTTTACCCCGTCTACTGGGCATCATGTAA
acgctcataggcggcgcgcgcgctctcagga
ATGAAGTTTGTTGCGCCAGAACAGGCACCGGAACAGGCGGAGGTCATCAAAAATACGCCGTTCTGGCCTGATGTGAACCTGTCGGAATTTCGCAGTGTGATGCGCACTGACGGCACGGTGACGCAGCCGCGTTTAAAGCAGGTCGTGCTGACGGCGATCTCTGAGGTTAACGCTGAGCTGTACGACTTCCGCAACCGTCAGCAGATGCTGGGCTGGCGGACACTTGCTGAGGTTCCCGCAGAAATGCTGGACGGTAAAAGCGAGCGTATCCGGCACTACCACAACGCTGTTTTTTGCTGGGCGCGCGCTGTGCTTAATGAGCGTTATCAGGACTATGACGCCACGGCGTCAGGCGTGAAGCGAGGGGAGGAGCTGGCGGAGGCCAGCGGCGATCTGTGGCGTGATGCCCGCTGGGCCATCAGCCGGGTGCAGGATGCACCGCACTGTACGGTGGAGCTTATCTGA
cgctcataggcgcgcgctcatagcgcg
ATGGAAACAAATATTACCTGGCAACAATTGATAGATGAATATTTCTTCGCAAAACCTCTGCGCTCAGCATCTGAATGGAGTTACACCAAAGTCTTCAAATCATTTGTACATTATATGGGGCCGTTAAGCTGCCCTAATGATGTGACATATCACAAAGTGCTTGCCTGGCGCCGTTTTCTTTTAAAAGAGAAAAAGCTGTCCGGACGTACCTGGAATAACAAGGTGGCGCATATGCGGGCCATCTTTAACTACGGAATACAGCGAGGGTTACTGCACTATGACGAAAATCCGTTTAACAATTCGGTAGTTAAACCGGACAAGAAGAGAAAGAAAACGCTCACTCAGGCACAGATTGAGTATGCCTATCAGATCATGGAGCAGTATGAAAATCAGGAGAATACAGGGCTGGGACTGAAATATTCCCGCTGCGCCTTATTTCCTGCATGGTTCTGGCTCACTGTCCTGGATACGCTCTATTACACAGGGATACGTCAGAACCAGTTATTACATATTCGGCTGAATGATGTTGATTTGAGAGAAGGGCAGATTCGGCTGATTACGGAGGGGTGTAAAAATCACAAAGAACACTATGTGCCGGTGATCAGTTTTCTGCGTCCACGGCTGACCTGTTTAATGGAGAAAGCGCAGAGCGAAGGATTGAAAGGTAATGACCGCCTGTTCAATATTGCACTTTTTACCGGCAAAGATCCCGCCATTGGCGATGACATGGATTCTCCTCAGGTAAGAGCATTCTTCCGTCGTCTGTCCAAGGAGTGTCAGTTTGCGATCAGTCCTCATCGTTTCAGACACACGCTGGCCACGGAGATGATGAAAATGCCGGAACAGAATCTGCATATGGCGCAAAGTGTGCTGGGTCATTCAAACATGAAATCCACGCTGGAGTATGTGGAGAATGATATTGCAGTGATGGGGAGGGCTCTGGAAGCGCAGTTTATGCAGATTAAGGCAGCACATGCCCGAAGCATTTACAGTGGGTTGACAAAGAATAGATAA
>genome2_small
GATACA
\ No newline at end of file
>header_genome3_chromo
ATGAGAGCGCTACTGTGGCTGGTGGGTCTTGCGTTGCTGTTAACAGGCTGCGCGAGCGAAAAAGGAATTATCGATGAAGAGGGATATCAGCTTGATACCCGACATCGGGCGCAGGCGGCCTATCCGCGCATTAAAGTCCTGGTGATTCACTATACGGCGGAAAACTTTGACGTTTCGCTGGCGACGTTAACGGGCCGCAACGTCAGTTCGCATTACCTGATTCCCGCAACCCCGCCATTATATGGCGGTAAACCGCGCATCTGGCAACTGGTGCCGGAACAGGATCAGGCCTGGCATGCGGGCGTCAGTTTCTGGCGAGGCGCCACGCGTCTCAATGATACGTCTATTGGCATTGAGCTGGAAAATCGCGGCTGGCGAATGTCCGGCGGGGTGAAATCTTTCGCGCCGTTTGAATCCGCGCAAATTCAGGCATTGATTCCGTTAGCGAAGGACATTATCGCGCGCTATGACATCAAACCGCAGAATGTGGTGGCCCATGCGGATATCGCGCCGCAGCGTAAAGACGATCCCGGCCCGCGCTTCCCGTGGCGCGAGCTGGCGGCACAGGGGATTGGCGCCTGGCCTGACGCCCAGCGTGTGGCGTTTTATCTGGCTGGACGCGCGCCGTATACGCCAGTCGATACCGCAACGGTGCTTGCGTTACTCTCGCGCTATGGCTATGAAGTCAAAGCCGATATGACGGCGCGCGAGCAACAGCGGGTGATTATGGCGTTCCAGATGCACTTCCGTCCGGCGCAATGGAACGGTATCGCAGATGCCGAAACGCAGGCGATTGCCGAAGCATTACTGGAGAAGTACGGCCAGGATTAA
CGAGTCCGGGAGCGGCGAGATTCCGGGCAGAGGAGGCGGCTATAGCGG
ATGAGAGCGCTACTGTGGCTGGTGGGTCTTGCGTTGCTGTTAACAGGCTGCGCGAGCGAAAAAGGAATTATCGATGAAGAGGGATATCAGCTTGATACCCGACATCGGGCGCAGGCGGCCTATCCGCGCATTAAAGTCCTGGTGATTCACTATACGGCGGAAAACTTTGACGTTTCGCTGGCGACGTTAACGGGCCGCAACGTCAGTTCGCATTACCTGATTCCCGCAACCCCGCCATTATATGGCGGTAAACCGCGCATCTGGCAACTGGTGCCGGAACAGGATCAGGCCTGGCATGCGGGCGTCAGTTTCTGGCGAGGCGCCACGCGTCTCAATGATACGTCTATTGGCATTGAGCTGGAAAATCGCGGCTGGCGAATGTCCGGCGGGGTGAAATCTTTCGCGCCGTTTGAATCCGCGCAAATTCAGGCATTGATTCCGTTAGCGAAGGACATTATCGCGCGCTATGACATCAAACCGCAGAATGTGGTGGCCCATGCGGATATCGCGCCGCAGCGTAAAGACGATCCCGGCCCGCGCTTCCCGTGGCGCGAGCTGGCGGCACAGGGGATTGGCGCCTGGCCTGACGCCCAGCGTGTGGCGTTTTATCTGGCTGGACGCGCGCCGTATACGCCAGTCGATACCGCAACGGTGCTTGCGTTACTCTCGCGCTATGGCTATGAAGTCAAAGCCGATATGACGGCGCGCGAGCAACAGCGGGTGATTATGGCGTTCCAGATGCACTTCCGTCCGGCGCAATGGAACGGTATCGCAGATGCCGAAACGCAGGCGATTGCCGAAGCATTACTGGAGAAGTACGGCCAGGATTAA
CAGGGCGCGGTATCGCGAGGACTCTCTCTTCGAGGAC
ATGCCGCACTTTATTGCTGAATGTACTGAAAATATTCGCGAGCAGGCTGATTTACCCGGCCTGTTCAGCAAGGTAAACGAGGCGCTGGCCGCCAGCGGGATTTTCCCCATCGGCGGTATCCGCAGTCGCGCCCACTGGCTGGATACCTGGCAGATGGCTGACGGTAAGCATGATTACGCGTTTGTGCATATGACGCTGAAAATCGGCGCCGGGCGCAGCCTGGAGAGCCGTCAGGAAGTCGGCGAAATGCTGTTCGGGCTGATTAAAGCCCACTTCGCCGACCTGATGGAGAACCGCTATCTGGCGCTGTCGTTTGAGATTGCCGAGTTACATCCAACGCTCAATTACAAACAAAACAACGTACACGCGTTATTTAAATAG
CCCGAGTATTAGCGCGCGGCGGCGCTATAGGCGCGCTATAGGC
ATGAGCGCGCTATTTCTGGCCATCCCGTTAACCATTTTTGTGTTGTTTGTGTTACCGATTTGGCTGTGGCTGCATTACAGCAACCGCGCCGGTCGGGGAGAACTGTCGCAAAGCGAGCAGCAACGCTTACTGCAACTCACAGACGACGCGCAACGTATGCGCGAGCGCATTCAGGCGCTGGAAGACATTCTTGATGCAGAGCATCCGAACTGGAGAGAGCGCTAA
CGAGAGTCTCGGAGGAGCGGCGCTCTGg
ATGCCCGCGACTAAATTCTCCCGACGTACCCTCCTGACGGCAGGTTCTGCGCTTGCTGTTCTTCCTTTCCTGCGCGCCTTGCCGGTACAGGCGCGTGAACCTCGCGAGACCGTCGATATTAAGGATTATCCGGCGGATGACGGTATCGCCTCGTTCAAACAGGCCTTCGCCGACGGACAGACCGTGGTCGTACCGCCAGGATGGGTGTGTGAAAATATCAATGCGGCGATAACGATTCCGGCGGGAAAAACGCTGCGGGTACAGGGCGCGGTGCGTGGGAATGGCCGGGGACGGTTTATTTTGCAGGACGGGTGTCAGGTGGTGGGGGAGCAGGGCGGCAGTCTGCACAATGTGACGCTGGATGTTCGCGGGTCGGACTGTGTGATTAAAGGCGTGGCGATGAGCGGCTTTGGCCCCGTCGCGCAAATTTTCATCGGTGGTAAGGAACCGCAGGTGATGCGTAATCTCATTATCGATGACATCACCGTTACCCACGCCAACTACGCCATTCTCCGCCAGGGATTTCATAACCAAATGGACGGCGCGAGGATTACGCATAGCCGCTTTAGCGATTTACAGGGGGACGCCATTGAGTGGAATGTCGCGATTCACGACCGCGATATCCTGATTTCCGATCATGTCATCGAACGCATTGATTGTACCAATGGCAAAATCAACTGGGGGATCGGCATCGGGCTGGCGGGTAGCACCTATGACAACAGTTATCCTGAAGACCAGGCAGTAAAAAACTTTGTGGTGGCCAATATTACCGGATCTGATTGCCGACAGCTTGTGCACGTAGAAAATGGCAAACATTTCGTCATTCGCAATGTCAAAGCCAAAAACATCACGCCCGATTTCAGTAAAAATGCGGGTATTGATAACGCAACGATCGCAATTTATGGCTGTGATAATTTCGTCATTGATAATATTGATATGACGAATAGTGCCGGGATGCTCATCGGCTATGGCGTCGTTAAAGGAAAATACCTGTCAATTCCGCAAAACTTTAAATTAAACGCTATTCGGTTGGATAATCGCCAGGTTGCTTATAAATTACGCGGCATTCAAATTTCCTCCGGCAACACCCCCTCTTTTGTCGCCATCACCAATGTACGGATGACGCGTGCTACGCTGGAACTGCATAATCAACCGCAGCACCTCTTCCTGCGTAATATCAACGTGATGCAAACTTCAGCGATTGGCCCGGCGTTAAAAATGCATTTCGATTTGCGTAAAGATGTCCGTGGTCAATTTATGGCCCGCCAGGACACGCTGCTTTCCCTCGCTAATGTTCATGCCATCAATGAAAACGGGCAGAGTTCCGTGGATATCGACAGGATTAATCACCAAACCGTGAATGTCGAAGCAGTGAATTTTTCGCTGCCGAAGCGGGGAGGGTAA
CGCGTCTGCGCGCGCGGAGAGAGGCTCTCAGGAC
ATGTCAGAAAATAAATTACACGTTATCGATTTGCACAAACGCTACGGCGGTCATGAAGTGCTGAAAGGGGTATCGCTGCAGGCCCGCGCCGGAGATGTGATTAGCATCATCGGCTCGTCCGGCTCCGGTAAAAGCACTTTTTTGCGCTGTATTAACTTCCTCGAAAAACCGAGCGAAGACGCGATTATCGTGAACGGTCAGAACATTAATCTGGTGCGCGACAAAGACGGGCAGCTCAAAGTGGCGGATAAAAATCAGCTACGCTTGTTGCGTACCCGCCTGACGATGGTGTTTCAGCACTTTAACCTCTGGAGCCACATGACGGTGCTGGAAAATGTGATGGAAGCGCCGATTCAGGTACTGGGATTAAGCAAGCACGACGCGCGCGAGCGGGCGTTGAAATATCTGGCGAAGGTGGGGATTGATGAGCGCGCTCAGGGCAAATATCCCGTTCATCTCTCCGGTGGCCAACAGCAGCGCGTTTCTATTGCGCGCGCGCTGGCGATGGAACCTGACGTTTTACTGTTCGATGAACCCACTTCGGCGCTCGATCCTGAACTGGTCGGCGAAGTGTTGCGCATCATGCAACAACTGGCGGAAGAAGGCAAAACGATGGTGGTGGTCACGCATGAAATGGGCTTCGTTCGCCATGTCTCTTCGCACGTTATTTTTCTGCATCAGGGGAAAATTGAAGAAGAGGGCGATCCGGAGCAGGTGTTCGGCAATCCGCAAAGCCCGCGTTTACAGCAATTCCTGAAAGGCTCGCTGAAATAA
CCGGATGCGCGCGATATATCGGCGATGC
GTGTTTATTGGCATCGTTAGCCTGTTTCCTGAAATGTTCCGCGCAATTACCGATTACGGGGTAACTGGCCGGGCAGTAAAAAATGGCCTGCTGAACATCCAAAGCTGGAGTCCTCGCGACTTCACGCATGACCGGCACCGTACCGTGGACGATCGTCCTTACGGCGGCGGACCAGGGATGTTAATGATGGTGCAACCCTTGCGGGACGCCATTCACGCAGCAAAAGCCGCGGCAGGTGAAGGCGCTAAAGTGATTTATCTGTCGCCTCAGGGACGCAAGCTTGATCAAGCGGGCGTTAGCGAGCTGGCCACGAATCAGAAGCTTATTCTGGTGTGTGGTCGCTACGAAGGCGTAGATGAGCGCGTAATTCAGACCGAAATTGACGAAGAATGGTCAATTGGCGATTACGTTCTCAGCGGTGGCGAACTACCGGCAATGACGCTGATTGACTCCGTCGCCCGGTTTATACCGGGAGTTCTGGGGCATGAAGCATCAGCAATCGAAGATTCGTTTGCTGATGGGTTGCTGGATTGTCCGCACTATACGCGCCCTGAAGTGTTAGAGGGGATGGAAGTACCGCCAGTATTGCTGTCGGGAAACCATGCTGAGATACGTCGCTGGCGTTTGAAACAGTCGCTGGGCCGAACCTGGCTTAGAAGACCTGAACTTCTGGAAAACCTGGCTCTGACTGAAGAGCAAGCAAGGTTGCTGGCGGAGTTCAAAACAGAACACGCACAACAGCAGCATAAACATGATGGGATGGCATAG
CCGGCTCTGCGAGAGAGGAGCGCTCGC
ATGAATAATCATTTTGGGAAAGGGTTAATGGCCGGGTTGCACGCGCCATATGCATATAGCGCGCATCATGCGGTGAATTTCTGTTCTGAGTATAAACGTGGCTTTGTATTGGGTTTTACACACCGTATGTTCGAAAAGACCGGCGATCGTCAACTTAGCGCGTGGGAGGCTGGAATTCTGACGCGTCGCTATGGTCTGGATAAAGAAATGGTGATGGATTTCTTTAAAGAGAATCATTCCGGGATGGCGGTTCGCTTCTTTATGGCCGGTTATCGACTCGAAGGTTGA
>genome3_plasmid
ATGTCTACGCTTCTCTATTTGCACGGATTCAACAGTTCCCCTCGCTCGGCAAAAGCGTGCCAGCTAAAAAACTGGCTGGCGGAGCGTCATCCGCATGTTGAGATGATCGTCCCTCAACTACCGCCGTATCCTGCCGATGCGGCGGAGTTGCTGGAGTCTCTCGTGCTTGAGCATGGCGGTGCGCCATTAGGGCTGGTAGGATCGTCGCTGGGTGGTTATTACGCCACCTGGCTGTCGCAATGTTTTATGCTGCCGGCTGTGGTGGTGAATCCCGCCGTGCGGCCCTTTGAATTACTGACCGACTATCTCGGTCAGAACGAGAACCCCTACACCGGGCAGCAATATGTGCTAGAGTCTCGCCATATTTATGATCTTAAAGTCATGCAGATTGACCCGCTGGAAGCGCCGGACCTGATCTGGCTACTGCAACAGACGGGCGATGAAGTGCTGGATTACCGCCAGGCGGTGGCATATTACGCCTCCTGCCGTCAGACAGTGACCGAGGGTGGTAATCACGCATTCACGGGCTTCGAAGATTATTTCAACCAGATTGTCGATTTTCTTGGACTGCACAGTTGCTGA
CGCGTAGCGGCCGGAATCTTCTCGGAGAGGCGCTTCTCTCTCGGAG
ATGATTGACCCTATTTTTGCGTCCTGTACGCTAATTGCCGTCTTTGTTGTTTTACTGGCCATGGGCGCGCCTATCGGGATCTGCATCGTTATCGCCTCTTTCAGCACCATGATGCTGGTACTGCCTTTCGATATTTCGATGTTCGCCACCGCGCAAAAAATGTTCTCCAGCCTGGACAGTTTTGCCTTGCTGGCCGTGCCGTTCTTCGTTTTGTCCGGGGTGATCATGAATAGCGGGGGAATTGCCGCCCGGCTGATCAATTTTGCCAAACTGTTTACTGGCAAACTGCCCGGTTCGCTCTCTTATACCAACATCGTCGGCAATATGATGTTCGGTGCAATTTCCGGATCGGCAATTGCCGCCTCAACCTCCATCGGCGGCGTGATGGTGCCGATGAGCGCGCGCGAAGGTTACGATCGCGGCTTTGCGGCCGCGGTGAATATCGCCTCCGCGCCGACGGGAATGTTAATTCCGCCCACCACGGCTTTTATCCTTTATGCGCTGGCAAGCGGGGGAACATCGATTGCCGCTCTGTTCGCCGGCGGTCTGGTCGCGGGAGTGCTGTGGGGCGTTGGCTGTATGCTGGTCACGCTGGTAGTCGCTAAGCGTCGAAATTATCGGGTTTTCTTCACCGTCCAAAAAGGCATGGCGCTAAAAGTTGCCGTTGAGGCCATTCCCAGCCTGTTACTGATCGTGATTATCGTCGGCGGCATTGTGCAGGGGATTTTCACCGCCATTGAAGCCTCCGCGATTGCCGTGGTGTATACGTTATTGCTGACGATGGTGTTTTACCGCACGCTGAAAATTAAGGATTTGCCTTCGATTTTGCTCCAGACAGTGGTAATGACCGGGGTCATCATGTTCCTGCTGGCAACCTCTTCGGCGATGTCCTTCTCAATGTCGATCACCAATATTCCTGCGGCGCTGAGCGATATGATCCTCGGTATTTCCGCCAATAAACTGGTTATCCTGTTAGTCATTACCGTCTTTTTGTTGATTATCGGCGCATTTATGGATATCGGTCCGGCCATTCTGATTTTTACCCCGATTCTGCTGCCGATCATGGCTAAACTGGGCGTCGATCCGGTGCATTTGGGCATTATCATGATCTATAACCTGGCGATTGGCACCATTACGCCGCCAGTTGGCAGTGGTTTATATGTCGGGGCGAGCGTCGGTAAGGTCAAAGTTGAGGAAGTGATTAAACCGTTGCTGCCTTTTTACGGCGCGATTATCGGCGTTCTGTTATTAATTACCTACATTCCGGAAATCATACTGTTCTTACCCCGTCTACTGGGCATCATGTAA
ACCCGATGGCGCGCAGAGGCGCGAGTTCTGGANNNNNNCACAGGGCTTAGAGGCGCTATGGCA
ATGATAATTAATGGGAAATTAATTAAAGCAAAAGACTTAGCTAAGGCTGCAGGTGTATCTCGTTCAACAGTGATTAAATATTACGGCATTAGCCGTGAGAATTACGAAAGGGTAGCAACTGAAAGAAGGAAGCTTGCTTTTGAACTAAGAGCATCAGGTTTAAAATGGAAAGAAGTTGCTGAAAAAATGAACACGACAAAATATAGCGCAATTGCATATTATAGACGATATTTAGCATTAGAGAAAAACAAATAA
CAGGCGCTAAGGCGGCGATCCTAGCGCGCGATCGCGCATGCG
ATGGTCGAACTGCAACATCAACGGCTGATGGTGCTTGCCGAACAGCTCCAGCTGGACAGTCTTATCGGCGCAGCGCCGGCGCTGTCGCAACAGGCGGTGGATCAGGAATGGAGCTACATGGACTTCCTGGAGCACCTGTTACATGAGGAGAAACTGGCCCGGCATCAGCGTAAACAGGCGATGTACACGCGGATGGCAGCCTTCCCGGCGGTAAAGACGTTCGAGGAGTACGACTTCACCTTCGCCACCGGCGCTCCTCAGAAGCAAATCCAGTCGCTGCGATCCCTGAGCTTCATAGAGCGTAACGAAAACATCGTGTTGCTGGGGCCATCGGGCGTGGGAAAAACGCATCTGGCGATAGCCATGGGCTACGAAGCAGTACGGGCGGGCATCAAGGTTCGCTTCACAACAGCAGCGGACCTGCTGCTACAGCTGTCCACTTCACAGCGTCAGGGCCGTTACAAAACGACTCTCAATCGTGGTGTCATGGCCCCGAAGCTGCTTATCATCGATGAAATAGGTTATCTGCCGTTCAGTCAGGAGGAAGCCAAGCTGTTCTTCCAGGTCATCGCCAAACGTTACGAGAAGAGCGCGATGATCCTGACCTCCAACCTGCCGTTCGGGCAGTGGGATCAGACGTTCGCCGGTGATGCAGCGCTGACATCGGCGATGCTGGACCGGATCTTACATCACTCACACGTCGTGCAAATAAAAGGGGAAAGCTATCGACTGAAGCAGAAACGAAAGGCCGGGGTTATAGCTGAAGCTAATCCTGAGTAA
\ No newline at end of file
>g4
ATGAAAGCGCTACTGTGGCTGGTGGGTCTCGCGTTGCTGTTAACAGGCTGCGCGAGCGAAAAAGGAATTATCGATAAAGAGGGATATCAGCTTGATACCCGACATCGGGCGCAGGCGGCCTATCCGCGCATTAAAGTCCTGGTGATTCACTATACGGCGGAAAACTTTGACGTTTCGCTGGCGACGTTAACGGGCCGCAACGTCAGTTCGCATTACCTGATTCCCGCAACCCCGCCATTATATGGCGGTAAACCGCGCATCTGGCAACTGGTGCCGGAACAGGATCAGGCCTGGCATGCGGGCGTCAGTTTCTGGCGAGGCGCCACGCGTCTCAATGATACGTCTATTGGCATTGAGCTGGAAAATCGCGGCTGGCGAATGTCCGGCGGGGTGAAATCTTTCGCGCCGTTTGAATCCGCGCAAATTCAGGCATTGATTCCGTTAGCGAAGGACATTATCGCGCGCTATGACATCAAACCGCAGAATGTGGTGGCCCATGCGGATATCGCGCCGCAGCGTAAAGACGATCCCGGCCCGCGCTTCCCGTGGCGCGAGCTGGCGGCGCAGGGGATTGGCGCCTGGCCTGACGCCCAGCGTGTGGCGTTTTATCTGGCTGGACGCGCGCCGTATACGCCAGTCGATACCGCAACGGTGCTTGCGTTACTCTCGCGCTATGGCTATGAAGTCAAAGCCGATATGACGGCGCGCGAGCAGCAGCGGGTGATTATGGCGTTCCAGATGCACTTCCGTCCGGCGCAATGGAACGGTATCGCAGATGCCGAAACGCAGGCGATTGCCGAAGCATTACTGGAGAAGTACGGCCAGGATTAA
cgcgatcgcgcgcatatcgcgcgcgatag
ATGCCGCACTTTATTGCTGAATGTACTGAAAATATTCGCGAGCAGGCTGATTTACCCGGCCTGTTCAGCAAGGTAAACGAGGCGCTGGCCGCCAGCGGGATTTTCCCCATCGGCGGTATCCGCAGTCGCGCCCACTGGCTGGATACCTGGCAGATGGCTGACGGTAAGCATGATTATGCGTTTGTGCATATGACGCTGAAAATCGGTACCGGGCGCAGCCTGGAGAGCCGTCAGGAAGTCGGCGAAATGCTGTTTGGGCTGATTAAAGCCCACTTCGCCGACCTGATGGAGAACCGCTATCTGGCGCTGTCGTTTGAGATTGCCGAGCTACATCCGACGCTCAATTACAAACAAAACAACGTACACGCGTTATTTAAATAG
ccgcatatgcggcgctcaggagcgctagc
ATGCTCGATAAACAGACCCATACCCTGATCGCCCAGCGACTTAATCAGGCTGAAAAACAGCGTGAACAAATTCGCGCAGTGTCGCTGGATTATCCCAACATCACTATTGAAGATGCCTATGCCGTACAGCGTGAATGGGTCAATATCAAGATCGCCGAAGGGCGCACGCTCAAAGGCCACAAAATCGGCCTGACCTCAAAAGCGATGCAGGCCAGCTCGCAAATCAGCGAACCGGATTACGGCGCGCTGCTTGACGATATGTTCTTCCATGACGGCGGCGATATCCCCACCGACCGTTTTATCGTCCCGCGTATTGAAGTGGAGCTGGCGTTCGTGCTGGCGAAACCGCTGCGCGGCCCTCACTGCACGCTGTTCGACGTCTACAACGCCACGGATTATGTGATTCCGGCGCTGGAACTGATTGACGCCCGCAGCCACAACATCGACCCGGAAACCCAGCGCCCGCGCAAAGTGTTCGACACCATTTCCGACAACGCCGCCAACGCCGGGGTGATCCTCGGTGGTCGCCCCATCAAACCAGACGAGCTGGATCTGCGCTGGATCTCCGCGCTGCTCTATCGCAACGGCGTGATCGAAGAAACCGGCGTCGCCGCAGGCGTGCTGAATCATCCGGCCAACGGCGTGGCGTGGCTGGCGAACAAGCTTGCCCCCTACGATGTCCAGCTTGAAGCCGGGCAGATCATCCTCGGCGGCTCGTTCACCCGCCCGGTGCCGGCGAGCAAGGGCGACACCTTCCATGTCGATTACGGCAACATGGGCGCGATCAGTTGCCGGTTTGTGTAA
ccagatccgcgcgcgcatatatatcgcgcgcatacg
ATGCCCGTGAATAAGTTCTCCCGACGTACCCTCCTGACGGCAGGTTCCGCGCTTGCTGTTCTTCCTTTTCTGCGCGCCTTGCCGGTACAGGCGCGTGAACCTCGCGAGACCGTCGATATTAAGGATTATCCGGCGGATGACGGTATCGCCTCGTTCAAACAGGCCTTCGCCGACGGACAGACCGTGGTCTTACCGCCAGGATGGGTGTGTGAAAATATCAATGCGGCGATAACGATTCCGGCGGGAAAAACGCTGCGGGTACAGGGCGCGGTGCGTGGGAATGGCCGGGGACGGTTTATTTTGCAGGACGGGTGTCAGGTGGTGGGGGAGCAGGGCGGCAGTCTGCACAATGTGACGCTGGATGTTCGCGGGTCGGACTGTGTGATTAAAGGCGTGACGATGAGCGGCTTTGGCCCCGTCGCGCAAATTTTCATCGGCGGTAAGGAACCGCAGGTGATGCGTAATCTCATTATCGATGACATCACCGTTACCCACGCCAACTACGCCATTCTCCGCCAGGGATTTCATAACCAAATGGACGGCGCGCGGATTACGCATAGCCGCTTTAGCGATTTGCAGGGGGACGCCATTGAGTGGAATGTCGCGATTCACGACCGCGACATCCTGATTTCCGATCATGTCATCGAACGCATTGATTGTACCAATGGCAAAATCAACTGGGGGATCGGCATCGGGCTGGCGGGTAGCACCTATGACAACAGTTATCCTGAAGATCAGGCAGTAAAAAACTTTGTGGTGGCCAATATTACCGGATCTGATTGCCGACAGCTGGTGCACGTAGAAAATGGCAAACATTTCGTCATTCGCAATGTCAAAGCCAAAAACATCACGCCCGATTTCAGTAAAAATGCGGGTATTGATAACGCAACGATCGCCATTTATGGCTGTGATAATTTCGTCATTGATAATATTGATATGACGAATAGTGCTGGGATGCTCATCGGCTATGGCGTCGTTAAAGGAAAATACCTGTCAATTCCGCAAAACTTTAAATTAAACGCTATTCGGTTGGATAATCGCCAGGTTGCTTATAAATTACGCGGCATTCAAATTTCCTCCGGCAACATCCCCTCTTTTGTCGCCATCACCAATGTACGGATGACGCGTGCTACGCTGGAACTGCATAATCAACCGCAGCACCTCTTTCTGCGTAATATCAACGTGATGCAAACTTCAGCGATTGGCCCGGCGTTAAAAATGCATTTCGATTTGCGTAAAGATGTCCGTGGTCAATTTATGGCCCGCCAGGACACGCTGCTTTCCCTCGCTAATGTTCATGCCATCAATGAAAACGGGCAGAGTTCCGTGGATATCGACAGGATTAATCACCAAACCGTGAATGTCGAAGCAGTGAATTTTTCGCTGCCGAAGCGGGGAGGGTAA
cagagctcgcgcgatcgcga
ATGTCAGAAAATAAATTACACGTTATCGATTTGCACAAACGCTACGGCGGTCATGAAGTGCTGAAAGGGGTATCGTTGCAGGCCCGCGCCGGAGATGTGATTAGCATCATCGGCTCGTCCGGCTCCGGTAAAAGCACTTTTTTGCGCTGTATTAACTTCCTCGAAAAACCGAGCGAAGGCGCGATTATCGTGAACGGTCAGAACATTAATCTGGTGCGCGACAAAGACGGGCAGCTCAAAGTGGCGGATAAAAATCAGCTACGCTTGTTGCGTACCCGCCTGACGATGGTGTTTCAGCACTTTAACCTCTGGAGCCACATGACGGTGCTGGAAAATGTGATGGAAGCGCCGATTCAGGTACTGGGATTAAGCAAGCACGACGCGCGCGAGCGGGCGTTGAAATATCTGGCGAAGGTGGGGATTGATGAGCGCGCTCAGGGCAAATATCCCGTCCATCTCTCCGGCGGCCAACAGCAGCGCGTTTCTATTGCGCGCGCGCTGGCGATGGAACCTGACGTTTTACTGTTCGATGAACCCACATCGGCGCTCGATCCTGAACTGGTCGGCGAAGTGTTGCGCATCATGCAACAACTGGCGGAAGAAGGCAAAACGATGGTGGTGGTCACGCATGAAATGGGCTTCGCCCGCCATGTCTCTTCGCACGTTATTTTTCTGCATCAGGGGAAAATTGAAGAAGAGGGCGATCCGGAGCAGGTGTTCGGCAATCCGCAAAGCCCGCGTTTACAGCAATTCCTGAAAGGCTCGCTGAAATAA
cagatacgcgcatggcga
GTGTTTATTGGCATCGTTAGCCTGTTTCCTGAAATGTTCCGCGCAATTACCGATTACGGGGTAACTGGCCGGGCAGTAAAAAAAGGCCTGCTGAACATCCAAAGCTGGAGTCCTCGCGACTTCGCGCATGACCGGCACCGTACCGTGGACGACCGTCCTTACGGCGGCGGACCGGGGATGTTAATGATGGTGCAACCCTTGCGGGACGCCATTCACGCAGCAAAAGCCGCGGCAGGTGAAGGCGCTAAAGTGATTTATCTGTCGCCTCAGGGACGCAAGCTTGATCAAGCGGGCGTTAGCGAGCTGGCCACGAATCAGAAGCTTATTCTGGTGTGTGGTCGCTACGAAGGCGTAGATGAGCGCGTAATTCAGACCGAAATTGACGAAGAATGGTCAATTGGCGATTACGTTCTCAGCGGTGGCGAACTACCGGCAATGACGCTGATTGACTCCGTCGCCCGGTTTATACCGGGGGTTCTGGGGCATGAGGCATCAGCAATCGAAGATTCGTTTGCTGATGGGTTGCTGGATTGTCCGCACTATACGCGCCCTGAAGTGTTAGAGGGGATGGAAGTACCGCCAGTATTGCTGTCGGGAAACCATGCCGAGATACGTCGCTGGCGCTTGAAACAGTCGCTGGGCCGAACCTGGCTTAGAAGACCTGAACTTCTGGAAAACCTGGCTCTGACTGAAGAGCAAGCAAGGTTGCTGGCGGAGTTCAAAACAGAACACGCACAACAGCAGCATAAACATGATGGGATGGCATAG
cgatagcgctagagcg
ATGAATAATCATTTTGGGAAAGGGTTAATGGCTGGGTTGCACGCGCCATATGCATATAGCGCGCATCATGCGGTGAATTTCTGTTCTGAGTATAAACGTGGCTTTGTATTGGGTTTTACACACCGTATGTTCGAAAAGACCGGCGATCGTCAACTTAGCGCGTGGGAGGCCGGAATTCTGACGCGTCGCTATGGTCTGGATAAAGAAATGGTGATGGATTTCTTTAAAGAGAATCATTCCGGGATGGCGGTTCGCTTCTTTATGGTCGGTTATCGACTCGAAGGTTGA
cagatgcgcgatcg
ATGTCTACGCTTCTCTATTTGCACGGATTCAACAGTTCCCCTCGCTCGGCAAAAGCGTGCCAGCTAAAAAACTGGCTGGCGGAGCGTCATCCGCATGTCGAGATGATCGTCCCTCAACTACCGCCGTATCCTGCCGATGCGGCGGAGTTGCTGGAATCTCTCGTGCTTGAGCATGGCGGTGCGCCATTAGGGCTGGTAGGATCGTCGCTGGGTGGTTATTACGCCACCTGGCTGTCGCAATGTTTTATGCTGCCGGCTGTGGTGGTGAATCCCGCCGTGCGGCCCTTTGAATTACTGACCGACTATCTCGGTCAGAACGAGAACCCCTACACCGGGCAGCAATATGTGCTAGAGTCTCGCCATATTTATGATCTTAAAGTCATGCAGATTGACCCGCTGGAAGCGCCGGACCTGATCTGGCTACTGCAACAGACGGGCGATGAAGTGCTGGATTACCGCCAGGCGGTGGCATATTACGCCTCCTGCCGTCAGACAGTGACCGAGGGTGGTAATCACGCATTCACGGGCTTCGAAGATTATTTCAACCAGATTGTCGATTTTCTTGGACTGCACAGTTGCTGA
cacggatgcgccatcggc
TTGCTGGCCGTGCCGTTCTTCGTTTTGTCCGGGGTGATCATGAATAGCGGGGGAATTGCCGCCCGGCTGGTCAATTTTGCCAAACTGTTTACTGGCAAACTGCCCGGCTCGCTCTCTTATACCAACATCGTCGGCAATATGATGTTCGGTGCAATTTCCGGATCGGCAATTGCCGCCTCAACCTCCATCGGCGGCGTGATGGTGCCGATGAGCGCGCGCGAAGGTTACGATCGCGGCTTTGCGGCCGCGGTGAATATCGCCTCCGCGCCGACGGGAATGTTAATTCCGCCCACCACGGCTTTTATCCTTTATGCGCTGGCAAGCGGGGGAACATCGATTGCCGCTCTGTTCGCCGGCGGTCTGGTCGCGGGAGTGCTGTGGGGCGTTGGCTGTATGCTGGTCACGCTGGTGGTCGCTAAGCGTCGAAATTATCGGGTTTTCTTCACCGTCCAAAAAGGCATGGCGCTAAAAGTTGCCGTTGAGGCCATTCCCAGCCTGCTGCTGATCGTGATTATCGTCGGCGGCATTGTGCAGGGGATTTTCACCGCCATTGAAGCCTCCGCGATTGCCGTGGTGTATACATTATTGTTGACGATGGTGTTTTACCGCACGCTGAAAATTAAGGATTTGCCTTCGATTTTGCTCCAGACAGTGGTAATGACCGGGGTCATCATGTTCCTGCTGGCAACCTCTTCGGCGATGTCCTTCTCGATGTCGATCACCAATATTCCTGCGGCGCTGAGCGATATGATCCTCGGTATTTCCGCCAATAAACTGGTTATCCTGTTAGTCATTACCGTCTTTTTGTTGATTATCGGCGCATTTATGGATATCGGTCCGGCCATTCTGATTTTTACCCCGATTCTGCTGCCGATCATGGCTAAACTGGGCGTCGATCCGGTGCATTTTGGCATTATCATGATCTATAACCTGGCGATTGGCACCATTACGCCGCCAGTTGGCAGTGGTTTATATGTCGGGGCGAGCGTCGGTAAGGTCAAAGTTGAGGAAGTGATTAAACCGTTGCTGCCTTTTTACGGCGCGATTATCGGCGTTCTGTTATTAATTACCTACATTCCGGAAATCACACTGTTCTTACCCCGTCTACTGGGCATCATGTAA
3 GEN4.1111.00001.0001i_00005 GENO.0321.00001.0002i_00005 GENO.1216.00002.0001i_00006
4 GEN4.1111.00001.0001i_00008 GENO.0321.00001.0002i_00010 GENO.1216.00002.0002b_00009
5 GEN4.1111.00001.0001b_00009 GENO.0321.00001.0002b_00011 GENO.1216.00002.0002b_00010
7 GEN4.1111.00001.0001i_00002 GENO.0321.00001.0002b_00003 GENO.1216.00002.0001i_00003
9 GEN4.1111.00001.0001i_00007 GENO.0321.00001.0002i_00009 GENO.1216.00002.0001b_00008
11 GEN4.1111.00001.0001i_00004 GENO.0321.00001.0002i_00004 GENO.1216.00002.0001i_00005
orig_name to_annotate gsize nb_conts L90
genome1.fst Examples/input_files/annot-input/tmp_files/genome1.fst_prokka-split5N.fna 9808 2 2
genome2.fst Examples/input_files/annot-input/tmp_files/genome2.fst_prokka-split5N.fna 10717 5 4
genome3-chromo.fst-all.fna Examples/input_files/annot-input/tmp_files/genome3-chromo.fst-all.fna_prokka-split5N.fna 8817 3 3
genome4.fst Examples/input_files/tmp_files/annot-input/genome4.fst_prokka-split5N.fna 7134 1 1
>1_genome1
ATGTGTAAAAGCCGGAGGGGTTATCTTTTCCCGGCTTTTTATTATCAATTACTCATTAACTCCTGTTCCGTTCTTTTGCGTTTAATCACCGGAATATCTCCGGTATTGTTCAGCGCCCCGGAAATGTTTTTAACCACTGTTCTGCACTCCGTTTATTAAACGCGCTCAGCGCGCGCTCATATATCGCGCGCGCGCGCGCGCATATATATATAATGAGTGAGGCTGAAGCCCGCCCGACTAACTTTATTCGTCAGATTATTGATGAAGATCTGGCGAGTGGTAAACATACCACTGTCCATACCCGTTTTCCGCCGGAGCCGAATGGCTATCTGCATATCGGCCACGCGAAATCTATCTGCCTGAACTTTGGCATCGCGCAAGATTATCAGGGCCAGTGCAACCTGCGTTTCGATGACACCAACCCGGTAAAAGAAGATATCGAGTACGTTGATTCGATCAAAAACGACGTCGAGTGGTTAGGCTTTCACTGGTCTGGCGATATTCGCTACTCCTCCGATTACTTTGACCAACTGCACGCCTATGCGGTCGAGCTAATCAATAAAGGCCTGGCCTATGTTGATGAGCTGACGCCGGAGCAGATCCGTGAATACCGCGGTACGCTGACCGCGCCGGGTAAAAACAGCCCGTTCCGCGATCGCAGCGTCGAAGAGAACCTCGCGCTATTTGAAAAAATGCGTACCGGCGGTTTTGAAGAGGGTAAAGCCTGTCTGCGCGCTAAAATCGACATGGCGTCGCCGTTTATCGTGATGCGCGATCCGGTGCTGTATCGCATTAAATTCGCCGAGCATCATCAGACTGGCAACAAGTGGTGCATCTATCCGATGTACGACTTTACTCACTGCATCAGCGATGCGCTGGAAGGCATTACTCATTCTCTGTGTACGCTGGAGTTCCAGGATAACCGTCGTCTGTACGACTGGGTGCTGGACAACATCACCATTCCGGTTCACCCGCGCCAGTACGAATTCTCGCGCCTGAATCTGGAATACACCGTGATGTCCAAGCGTAAGCTGAACCTGCTGGTGACCGACAAACACGTCGAAGGTTGGGACGATCCGCGTATGCCGACTATTTCCGGTCTGCGCCGTCGCGGCTATACCGCGGCTTCTATTCGTGAGTTCTGCAAACGCATCGGCGTCACCAAGCAGGACAACACTATTGAGATGGCGTCGCTGGAATCCTGCATTCGCGAAGATCTGAACGAAAACGCGCCGCGCGCGATGGCGGTAATCGATCCGGTAAAACTGGTTATCGAAAATTACCCGCAGGGTGAGAGCGAAATGGTTACCATGCCTAACCATCCGAATAAACCGGAGATGGGCAGCCGTGAAGTGCCGTTTAGCGGTGAGATCTGGATCGATCGCGCAGATTTCCGCGAAGAAGCGAACAAACAGTACAAACGTCTGGTGATGGGCAAAGAAGTGCGTCTGCGTAATGCCTACGTCATTAAAGCGGAGCGCGTAGAGAAGGATGCCGAAGGGAATATCACCACCATCTTCTGTACCTATGATGCTGATACGCTGAGTAAAGATCCGGCTGACGGGCGTAAAGTGAAAGGCGTAATCCACTGGGTTAGCGCAGCACATGCGCTGCCGATTGAAATTCGTCTCTACGACCGTCTGTTCAGCGTGCCGAATCCGGGCGCCGCGGAGGACTTCCTGTCTGTTATCAACCCCGAATCATTAGTGATTAAGCAGGGGTATGGCGAGCCGTCGCTGAAAGCGGCGGTAGCAGGAAAAGCTTTCCAGTTTGAACGTGAAGGCTACTTCTGCCTCGACAGCCGCTATGCAACGGCCGATAAGCTGGTCTTTAACCGCACCGTGGGCCTGCGTGATACCTGGGCGAAAGCGGGCGAGTAACGCGCATAGGCGGCCTTCAAGGAGGCGCTAGGCGAATGAAAGCGCTACTGTGGCTGGTGGGTCTCGCGTTGCTGTTAACAGGCTGCGCGAGCGAAAAAGGAATTATCGATAAAGAGGGATATCAGCTTGATACCCGACATCGGGCGCAGGCGGCCTATCCGCGCATTAAAGTCCTGGTGATTCACTATACGGCGGAAAACTTTGACGTTTCGCTGGCGACGTTAACGGGTCGCAACGTCAGTTCGCATTACCTGATTCCCGCAACCCCGCCATTATATGGCGGTAAACCGCGCATCTGGCAACTGGTGCCGGAACAGGATCAGGCCTGGCATGCGGGCGTCAGTTTCTGGCGAGGCGCCACGCGTCTCAATGATACGTCTATTGGCATTGAGCTGGAAAATCGTGGTTGGCGAATGTCCGGCGGGGTGAAATCTTTCGCGCCGTTTGAATCCGCGCAAATTCAGGCATTGATTCCGTTAGCGAAGGATATTATCGCGCGCTATAACATCAAACCGCAGAATGTGGTGGCCCATGCGGATATCGCGCCGCAGCGTAAAGACGATCCCGGCCCGCGCTTCCCGTGGCGCGAGCTGGCGGCGCAGGGGATTAGCGCCTGGCCTGACGCCCAGCGTGTGGCGTTTTATCTGGCTGGACGCGCGCCGTATACGCCAGTCGATACCGCAACGGTGCTTGCGTTACTCTCGCGCTATGGCTATGAAGTCAAAGCCGATATGACGGCACGCGAGCAGCAGCGGGTGATTATGGCGTTCCAGATGCACTTCCGTCCGGCGCAATGGAACGGTATCGCAGATGCCGAAACGCAGGCGATTGCCGAAGCATTACTGGAGAAGTACGGCCAGGATTAACGCGATAGGCGCGCGAGATTACGCGCGCAGTATCGCGC
>2_genome1
CGCGCATAGCGCGCAATGCCGCACTTTATTGCTGAATGTACTGAAAATATTCGCGAGCAGGCTGATTTACCCGGCCTGTTCAGCAAGGTAAACGAGGCGCTGGCCGCCAGCGGGATTTTCCCCATCGGCGGTATCCGCAGTCGCGCCCACTGGCTGGATACCTGGCAGATGGCTGACGGTAAGCATGATTACGCGTTTGTGCATATGACGCTGAAAATCGGCGCCGGGCGCAGCCTGGAGAGCCGTCAGGAAGTTGGCGAAATGCTGTTTGGGCTGATTAAAGCCCACTTCGCCGACCTGATGGAGAACCGCTATCTGGCGCTGTCGTTTGAGATTGCCGAGCTACATCCGACGCTCAATTACAAACAAAACAACGTACACGCGTTATTTAAATAGCCGATATGAGGCGCGGCGCTATAAGGCGCTCATGAGCATGCCCGCGACTAAATTCTCCCGACGTACCCTCCTGACGGCAGGTTCTGCGCTTGCTGTTCTTCCTTTTCTGCGCGCCTTGCCGGTACAGGCGCGTGAACCTCGCGAGACCGTCGATATTAAGGATTATCCGGCGGATGACGGTATCGCCTCGTTCAAACAGGCCTTCGCCGACGGACAGACCGTGGTCGTACCGCCAGGATGGGTGTGTGAAAATATCAATGCGGCGATAACGATTCCGGCGGGAAAAACGCTGCGGGTACAGGGCGCGGTGCGTGGGAATGGCCGGGGACGGTTTATTTTGCAGGACGGGTGTCAGGTGGTGGGGGAGCAGGGCGGCAGTCTGCACAATGTGACGCTGGATGTTCGCGGGTCGGACTGTGTGATTAAAGGCGTGGCGATGAGCGGCTTTGGCCCCGTCGCGCAAATTTTCATCGGTGGTAAGGAACCGCAGGTGATGCGTAATCTCATTATCGATGACATCACCGTTACCCACGCCAACTACGCCATTCTCCGCCAGGGATTTCATAACCAAATGGATGGCGCGCGGATTACGCATAGCCGCTTTAGCGATTTACAGGGGGACGCCATTGAGTGGAATGTCGCGATTCACGACCGCGACATCCTGATTTCCGATCATGTCATCGAACGCATTAATTGTACCAATGGCAAAATCAACTGGGGGATCGGCATCGGGCTGGCGGGTAGCACCTATGACAACAGTTATCCTGAAGACCAGGCAGTAAAAAACTTTGTGGTGGCCAATATTACCGGATCTGATTGCCGACAGCTTGTGCACGTAGAAAATGGCAAACATTTCGTCATTCGCAATGTCAAAGCCAAAAACATCACGCCCGGTTTCAGTAAAAATGCGGGTATTGATAACGCAACGATCGCAATTTATGGCTGTGATAATTTCGTCATTGATAATATTGATATGACGAATAGTGCCGGGATGCTCATCGGCTATGGCGTCGTTAAAGGAAAATACCTGTCAATTCCGCAAAACTTTAAATTAAACGCTATTCGGTTGGATAATCGCCAGGTTGCTTATAAATTACGCGGCATTCAAATTTCCTCCGGCAACACCCCCTCTTTTGTCGCCATCACCAATGTACGGATGACGCGTGCTACGCTGGAACTGCATAATCAACCGCAGCACCTCTTTCTGCGCAATATCAACGTGATGCAAACTTCAGCGATTGGCCCGGCGTTAAAAATGCATTTCGATTTGCGTAAAGATGTACGTGGTCAATTTATGGCCCGCCAGGACACGCTGCTTTCCCTCGCTAATGTTCATGCCATCAATGAAAACGGGCAGAGTTCCGTGGATATCGACAGGATTAATCACCAAACCGTGAATGTCGAAGCAGTGAATTTTTCGCTGCCGAAGCGGGGAGGGTAACGAATTCCGCGGCATATAGCGGCGCGATAGCATGTCAGAAAATAAATTACACGTTATCGATTTGCACAAACGCTACGGCGGTCATGAAGTGCTGAAAGGGGTATCGCTGCAGGCCCGCGCCGGAGATGTGATTAGCATCATCGGCTCGTCCGGCTCCGGTAAAAGCACTTTTTTGCGCTGTATTAACTTCCTCGAAAAACCGAGCGAAGGCGCGATTATCGTGAACGGTCAGAACATTAATCTGGTGCGCGACAAAGATGGGCAGCTCAAAGTGGCGGATAAAAATCAGCTACGCTTGTTGCGTACCCGCCTGACGATGGTGTTTCAGCACTTCAACCTCTGGAGCCACATGACGGTGCTGGAAAATGTGATGGAAGCGCCGATTCAGGTACTGGGATTAAGCAAGCACGACGCGCGCGAGCGGGCGTTGAAATATCTGGCGAAGGTGGGGATTGATGAGCGCGCTCAGGGCAAATATCCCGTCCATCTCTCCGGCGGCCAACAGCAGCGCGTTTCTATTGCGCGCGCGCTGGCGATGGAACCTGACGTTTTACTGTTCGATGAACCCACATCGGCGCTCGATCCTGAACTGGTCGGCGAAGTGTTGCGCATCATGCAACAACTGGCGGAAGAAGGCAAAACGATGGTGGTGGTCACGCATGAAATGGGCTTCGCTCGCCATGTCTCTTCGCACGTTATTTTTCTGCATCAGGGGAAAATTGAAGAAGAGGGTGATCCGGAGCAGGTGTTCGGCAATCCGCAAAGCCCGCGTTTACAGCAATTCCTGAAAGGCTCGCTGAAATAACGCTCAGAGGCGCGCGCGCGCTATATACGCGCAGTGTTTATTGGCATAGTTAGCCTGTTTCCTGAAATGTTCCGCGCAATTACCGATTACGGGGTAACTGGCCGGGCAGTAAAAAAAGGCCTGCTGAACATCCAAAGCTGGAGTCCTCGCGACTTCGCGCATGACCGGCACCGTACCGTGGACGACCGTCCTTACGGCGGCGGACCGGGGATGTTAATGATGGTGCAACCCTTGCGGGACGCCATTCACGCAGCAAAAGCCGCGGCAGGTGAAGGCGCTAAAGTGATTTATCTGTCGCCTCAGGGACGCAAGCTTGATCAAGCGGGCGTTAGCGAGCTGGCCACGAATCAGAAGCTTATTCTGGTGTGTGGTCGCTACGAAGGCGTAGATGAGCGCGTAATTCAGACCGAAATTGACGAAGAATGGTCAATTGGCGATTACGTTCTCAGCGGTGGCGAACTACCGGCAATGACGCTGATTGACTCCGTCGCCCGGTTTATACCGGGGGTTCTGGGGCATGAGGCATCAGCAATCGAAGATTCGTTTGCTGATGGGTTGCTGGATTGTCCGCACTATACGCGCCCTGAAGTGTTAGAGGGGATGGAAGTACCGCCAGTATTGCTGTCGGGAAACCATGCTGAGATACGTCGCTGGCGTTTGAAACAGTCGCTGGGCCGAACCTGGCTTAGAAGACCTGAACTTCTGGAAAACCTGGCTCTGACTGAAGAGCAAGCAAGGTTGCTGGCGGAGTTCAAAACAGAACACGCACAACAGCAGCATAAACATGATGGGATGGCATAGCCGTCATATGGGCTCTCAGAGGAGACGCGCTAATGCGCAGTACGTGTTTATTGGCATAGTTAGCCTGTTTCCTGAAATGTTCCGCGCAATTACCGATTACGGGGTAACTGGCCGGGCAGTAAAAAAAGGCCTGCTGAACATCCAAAGCTGGAGTCCTCGCGACTTCGCGCATGACCGGCACCGTACCGTGGACGACCGTCCTTACGGCGGCGGACCGGGGATGTTAATGATGGTGCAACCCTTGCGGGACGCCATTCACGCAGCAAAAGCCGCGGCAGGTGAAGGCGCTAAAGTGATTTATCTGTCGCCTCAGGGACGCAAGCTTGATCAAGCGGGCGTTAGCGAGCTGGCCACGAATCAGAAGCTTATTCTGGTGTGTGGTCGCTACGAAGGCGTAGATGAGCGCGTAATTCAGACCGAAATTGACGAAGAATGGTCAATTGGCGATTACGTTCTCAGCGGTGGCGAACTACCGGCAATGACGCTGATTGACTCCGTCGCCCGGTTTATACCGGGGGTTCTGGGGCATGAGGCATCAGCAATCGAAGATTCGTTTGCTGATGGGTTGCTGGATTGTCCGCACTATACGCGCCCTGAAGTGTTAGAGGGGATGGAAGTACCGCCAGTATTGCTGTCGGGAAACCATGCTGAGATACGTCGCTGGCGTTTGAAACAGTCGCTGGGCCGAACCTGGCTTAGAAGACCTGAACTTCTGGAAAACCTGGCTCTGACTGAAGAGCAAGCAAGGTTGCTGGCGGAGTTCAAAACAGAACACGCACAACAGCAGCATAAACATGATGGGATGGCATAGCGCATACGCGCGCGATATATATTCGCGCAGAGGCGCGCATAGCGATGAAGTTTGTTGCGCCCGAACAGGCACCGGAACAGGCGGAGGTCATCAAAAATACGCCGTTCTGGCCTGATGTGGACCTGTCGGAATTTCGCAGTGTGATGCGCACTGACGGCACGGTGACGCAGCCGCGTTTAAAGCAGGTCGTGCTGACGGCGATCTCTGAGGTTAACGCTGAGCTGTACGACTTCCGCAACCGTCAGCAGATGCTGGGCTGGCGGACACTTGCTGAGGTTCCCGCAGAAATGCTGGACGGTAAAAGCGAGCGTATCCGGCACTACCACAACGCTGTTTTTTGCTGGGCGCGCGCTGTGCTTAATGAGCGTTATCAGGACTATGACGCCACGGCGTCAGGCGTGAAGCGAGGGGAGGAGCTGGCGGAGGCCAGCGGCGATCTGTGGCGTGATGCCCGCTGGGCCATCAGCCGGGTGCAGGATGTACCGCACTGTACGGTGGAGCTTATCTGAACGGCTAGCGCGTAGCGGCAGTCTCGGATGAATAATCATTTTGGGAAAGGGTTAATGGCCGGGTTGCACGCGCCATATGCATATAGCGCGCATCATGCGGTGAATTTCTGTTCTGAGTATAAACGTGGCTTTGTATTGGGTTTTACACACCGTATGTTCGAAAAGACCGGCGATCGTCAACTTAGCGCGTGGGAGGCTGGAATTCTGACGCGTCGCTATGGTCTGGATAAAGAAATGGTGATGGATTTCTTTAAAGAGAATCATTCCGGGATGGCGGTTCGCTTCTTTATGGCCGGTTATCGACTCGAAGGTTGACGATCGCGCGCAGGAGGAGAGCTCTCTTCTTCTAGAGCATGTCTACGCTTCTCTATTTGCACGGATTCAACAGTTCCCCTCGCTCGGCAAAAGCGTGCCAGCTAAAAAACTGGCTGGCGGAGCGTCATCCGCATGTTGAGATGATCGTCCCTCAGCTGCCGCCGTATCCTGCCGATGCGGCGGAGTTGCTGGAATCTCTCGTGCTTGAGCATGGCGGTGCGCCATTAGGGCTGGTAGGATCGTCGCTGGGTGGTTATTACGCCACCTGGCTGTCGCAATGTTTTATGCTGCCGGCTGTGGTGGTGAATCCCGCCGTGCGGCCCTTTGAATTACTGACCGACTATCTCGGTCAGAACGAGAACCCCTACACCGGGCAGCAATATGTGCTAGAGTCTCGCCATATTTATGATCTTAAAGTCATGCAGATTGACCCGCTGGAAGCGCCGGACCTGATCTGGCTACTGCAACAGACGGGCGATGAAGTGCTGTATTACCGCCAGGCGGTGGCATATTACGCCTCCTGCCGTCAGACAGTGACCGAGGGTGGTAATCACGCATTCACGGGCTTCGAAGATTATTTCAACCAGATTGTCGATTTTCTTGGACTGCACAGTTGCTGACGGCTATGCGCGCGCTCGATGATTGACCCTATTTTTGCGTCCTGTACGCTAATTGCCGTCTTTGTTGTTTTACTGGCCATGGGCGCGCCTATCGGGATCTGCATCGTTATCGCCTCTTTCAGCACCATGATGCTGGTACTGCCTTTCGATATTTCGATGTTCGCCACCGCGCAAAAAATGTTCTCCAGCCTGGACAGTTTTGCCTTGCTGGCCGTGCCGTTCTTCGTTTTGTCCGGGGTGATCATGAATAGCGGGGGAATTGCCGCCCGGCTGGTCAATTTTGCCAAACTGTTTACTGGCAAACTGCCCGGCTCGCTCTCTTATACCAACATCGTCGGCAATATGATGTTCGGTGCAATTTCCGGATCGGCGATTGCCGCCTCAACCTCCATCGGCGGCGTGATGGTGCCGATGAGCGCGCGCGAAGGTTACGATCGCGGCTTTGCGGCCGCGGTGAATATCGCCTCCGCGCCGACGGGAATGTTAATTCCGCCCACCACGGCTTTTATCCTTTACGCGCTGGCAAGCGGGGGAACATCGATTGCCGCTCTGTTCGCCGGCGGTCTGGTCGCGGGAGTGCTGTGGGGCGTTGGCTGTATGCTGGTCACGCTGGTGGTCGCTAAGCGTCGAAATTATCGGGTTTTCTTCACCGTCCAAAAAGGTATGGCGCTAAAAGTTGCCGTTGAGGCCATTCCCAGCCTGCTGCTGATCGTGATTATTGTCGGCGGCATTGTGCAGGGGATTTTCACCGCCATTGAAGCCTCCGCGATTGCCGTGGTGTATACGTTATTGCTGACGATGGTGTTTTACCGCACGCTGAAAATTAAGGATTTGCCTTCGATTTTGCTCCAGACAGTGGTAATGACCGGGGTCATCATGTTCCTGCTGGCAACCTCTTCGGCGATGTCCTTCTCGATGTCGATCACCAATATTCCTGCGGCGCTGAGCGATATGATCCTCGGTATTTCCGCCAATAAACTGGTTATCCTGTTAGTCATTACCGTCTTTTTGTTGATTATCGGCGCATTTATGGATATTGGTCCGGCCATTCTGATTTTTACCCCGATTCTGCTGCCAATCATGGCTAAACTGGGCGTCGATCCGGTGCATTTCGGCATTATCATGATCTATAACCTGGCGATTGGCACCATTACGCCGCCAGTTGGCAGTGGTTTATATGTCGGGGCGAGCGTCGGTAAGGTCAAAGTTGAGGAAGTGATTAAACCGTTGCTGCCTTTTTACGGCGCGATTATCGGCGTTCTGTTATTAATTACCTACATTCCGGAAATCACACTGTTCTTACCCCGTCTACTGGGCATCATGTAA
>1_this_is_genome2_contig_number1
ATGTCAGAAAATAAATTACACGTTATCGATTTGCACAAACGCTACGGCGGTCATGAAGTGCTGAAAGGGGTATCGCTGCAGGCCCGCGCCGGAGATGTGATTAGCATTATCGGCTCGTCCGGTTCCGGTAAAAGCACTTTTTTGCGCTGCATTAACTTCCTCGAAAAATCGAGCGAAGGCGCGATTATCGTGAACGGTCAGAACATTAATCTGGTGCGCGACAAAGACGGGCAGCTCAAAGTGGCGGATAAAAATCAGCTACGCTTGTTGCGTACCCGCCTGACGATGGTGTTTCAGCACTTTAACCTCTGGAACCACATGACGGTGCTGGAAAATGTGATGGAAGCGCCGATTCAGGTACTGGGATTAAGCAAGCACGACGCGCGCGAGCGGGCGTTGAAATATCTGGCGAAGGTGGGGATTGATGAGCGCGCTCAGGGCAAATATCCCGTCCATCTCTCCGGCGGCCAACAGCAGCGCGTTTCTATTGCGCGCGCGCTGGCGATGGAACCTGACGTTTTACTGTTCGATGAACCCACATCGGCGCTCGATCCTGAACTGGTCGGCGAAGTGTTGCGCATCATGCAACAACTGGCGGAAGAAGGCAAAACGATGGTGGTGGTCACGCATGAAATGGGCTTCGCCCGCCATGTCTCTTCGCACGTGATTTTTCTGCATCAGGGGAAAATTGAAGAAGAGGGCAATCCGGAGCAGGTGTTCGGCAATCCGCAAAGCCCGCGTTTACAGCAATTCCTGAAAGGCTCGCTGAAATAAACGCTAGAGGACGCGCCTCTCAGAGAGCGCGCTCTCTCAGAGAGGCGCGCGCCTCTTTCGCAGAGACCNNCGCTCATGAGCGATGCCCGCGACTAAATTCTCCCGACGTACCCTCCTGACGGCAGGTTCCGCGCTTGCTGTTCTTCCTTTTCTGCGCGCCTTGCCGGTACAGGCGCGTGAACCTCGCCAGACCGTCGATATTAAGGATTATCCGGCGGATGACGGTATCGCCTCGTTCAAACAGGCCTTCGCCGACGGGCAGACTGTGGTCGTGCCGTCAGGATGGGTGTGTGAAAATATCAATGCGGCGATAACGATTCCGGCGGGAAAAACGCTGCGGATACAGGGCGCGGTGCGTGGGAATGGCCGGGGACGGTTTATTTTGCTGGACGGGTGTCAGGTGGTGGGGGAGCAGGGCGGCAGTCTGCACAATGTGACGCTGGATGTTCGCGGGTCGGACTGTGTGATTAAAGGCGTGACGATGAGCGGCTTTGGCCCCGTCGCGCAAATTTTCATCGGCGGTAAGGAACCGCAGGTGATGCGTAATCTCATTATCGATGACATCACCGTTACCCACGCCAACTACGCCATTCTCCGCCAGGGATTTCATAACCAAATGGACGGCGCGCGGATTACGCATAGTCGCTTTAGCGATTTGCAGGGGGACGCCATTGAGTGGAATGTCGCGATTCATGACCGCGACATCCTGATTTCCGATCATGTCATCGAACGCATTGATTGTACCAATGGCAAAATCAACTGGGGGATCGGCATCGGGCTGGCGGGTAGCGCCTATGACAATAGTTATCCTGAAGACCAGGCAGTAAAAAACTTTGTGGTGGCCAATATTACCGGATCTGATTGCCGACAACTGGTACACGTAGAAAATGGCAAACATTTCGTCATTCGCAATGTCAAAGCCAAAAACATCACGCCCGATTTCAGTAAAAATGCGGGTATTGATAACGCAACGATCGCCATTTATGGCTGTGATAATTTCGTCATTGATAATATTGATATGACGAATAGTGCCGGGATGCTCATCGGCTATGGCGTCGTTAAAGGAAAATACCTGTCAATTCCGCAAAACTTTAAATTAAACGCTATTCGGTTGGATAATCGCCAGGTTGCTTATAAATTACGCGGCATTCAAATTTCCTCCGGTAACGCCCCCTCATTTGTTGCCATCACCAATGTACGGATGACGCGTGCTACGCTGGAACTGCATAATCAACCGCAGCACCTCTTTTTGCGTAATATCAACGTGATGCAAACTTCAGCGATTGGCCCGGCGTTAAAAATGCATTTTGATTTGCGTAAAGATGTCCGTGGTCAATTTATGGCCCGCCAGGACACGCTGCTTTCCCTCGCTAATGTTCATGCCATCAATGAAAACGGGCAGAGTTCCGTGGATATCGACAGGATTAATCACCAAACCGTGAATGTCGAAGCAGTGAATTTTTCGCTGCCGAAGCGGGGAGGGTAACACTCGCGCATAGAGAGCTCTCAGAGGAGCGCGCGCGCTATAGCGCGC
>2_this_is_genome2_contig_number1
CGCGATAATATAGCGCGCGCTCATAGCATGAGCGCGCTATTTCTGGCCATCCCGTTAACCATTTTTGTGTTGTTTGTGTTACCGATTTGGCTGTGGCTGCATTACAGCAACCGCGCCGGTCGGGGAGAACTGTCGCAAAGCGAGCAGCAACGCTTACTGCAACTCACAGACGACGCGCAACGTATGCGCGAGCGCATTCAGGCGCTGGAAGATATTCTTGATGCAGAGCATCCGAACTGGAGAGAGCGCTAACGCCATATTATAGCGCGCCTCATAAGAGCGGCCTATAGCGCGCTANNNATGCCGCACTTTATTGCTGAATGTACTGAAAATATTCGCGAGCAGGCTGATTTACCAAGCCTGTTCAGCAAGGTAAACGAGGCGCTGGCCGCCACCGGGATTTTCCCCATCGGCGGTATCCGCAGTCGCGCCCACTGGCTGGATACCTGGCAGATGGCTGACGGTAAGCATGATTACGCGTTTGTGCATATGACGCTGAAAATCGGCGCCGGGCGCAGCCTGGAGAGCCGTCAGGAAGTCGGCGAAATGCTGTTTGGGCTGATTAAAGCCCACTTCGCCGACCTGATGGAGAACCGCTATCTGGCGCTGTCGTTTGAGATTGCCGAGTTACATCCAACGCTCAATTACAAACAAAACAACGTACACGCGTTATTTAAATAGCCAGAGATTCGCGCGTTCAGAGAGGAGCTCTCTCATAGACGCGCGCATATGCGCTCTAGAGAGGCGCGCCTAATGGCGCGCTATGATGAAAGCGCTACTGTGGCTGGTTGGTCTCGCGTTGCTGTTAACAGGCTGCGCGAGCGAAAAAGGAATTATCGATAAAGAGGGATATCAGCTTGATACCCGACATCGGGCGCAGGCGGCCTATCCGCGCATTAAAGTCCTGGTGATTCACTATACGGCGGAAAACTTTGACGTTTCGCTGGCGACGTTAACGGGTCGCAACGTCAGTTCGCATTACCTGATTCCCGCAACCCCGCCATTATATGGCGGTAAACCGCGCATCTGGCAACTGGTGCCGGAACAGGATCAGGCTTGGCATGCGGGCGTCAGTTTCTGGCGAGGCGCCACGCGTCTCAATGATACGTCTATTGGCATTGAGCTGGAAAATCGCGGCTGGCGAATGTCCGGCGGGGTGAAATCTTTCGCGCCGTTTGAATCCGCGCAAATTCAGGCATTGATCCCGTTAGCGAAGGACATTATCGCGCGCTATGACATCAAACCGCAGAATGTGGTGGCCCATGCGGATATCGCGCCGCAGCGTAAAGACGATCCCGGCCCGCGCTTCCCGTGGCGCGAGCTGGCGGCACAGGGGATTGGCGCCTGGCCTGACGCCCAGCGTGTGGCGTTTTATCTGGCTGGACGCGCGCCGTATACGCCAGTCGATACCGCAACGGTGCTTGCGTTACTCTCGCGCTATGGCTATGAAGTCAAAGCCGATATGACGGCGCGCGAGCAACAGCGGGTGATTATGGCGTTCCAGATGCACTTCCGTCCGGCGCAATGGAACGGTATCGCAGATGCCGAAACGCAGGCGATTGCCGAAGCATTACTGGAGAAGTACGGCCAGGATTAACAAAGCGCTCTCAGAGAGAGCGCTCTGCAGATGAGTGAGGCTGAAGCCCGCCCGACTAACTTTATTCGTCAGATTATTGATGAAGATCTGGCGAGTGGTAAACATACCACTGTCCATACCCGTTTTCCGCCGGAGCCGAATGGCTATCTGCACATCGGCCACGCGAAATCTATCTGCCTGAACTTTGGCATCGCGCAAGATTATCAGGGCCAGTGCAACCTGCGTTTCGATGACACCAACCCGGTAAAAGAAGATATCGAGTACGTTGATTCGATCAAAAACGACGTCGAGTGGTTAGGCTTTCACTGGTCTGGCGATATTCGCTACTCCTCCGATTACTTTGACCAACTGCACGCCTATGCGGTCGAGCTCATCAATAAAGGCCTGGCCTACGTTGATGAGCTGACGCCGGAGCAGATCCGCGAATACCGTGGTACGCTGACCGCGCCGGGTAAAAACAGCCCGTTCCGCGATCGCAGCGTGGAAGAAAACCTCGCGCTATTTGAAAAAATGCGTACCGGCGGTTTTGAAGAGGGTAAAGCCTGTCTGCGCGCTAAAATCGACATGGCGTCGCCGTTTATCGTGATGCGCGATCCGGTGCTGTATCGCATTAAATTCGCCGAGCATCATCAGACCGGCACGAAGTGGTGCATCTATCCGATGTACGACTTTACTCACTGCATCAGCGATGCGCTGGAAGGCATTACTCATTCTCTGTGTACGCTGGAGTTCCAGGACAACCGTCGTCTGTACGACTGGGTGCTGGACAACATCACCATTCCGGTTCACCCGCGCCAGTACGAATTCTCGCGCCTGAATCTGGAATACACCGTGATGTCCAAGCGTAAGCTGAACCTGCTGGTGACCGACAAACACGTCGAAGGTTGGGATGATCCGCGTATGCCGACTATTTCCGGTCTGCGCCGTCGCGGCTATACCGCGGCTTCTATTCGTGAGTTCTGCAAACGCATCGGCGTCACCAAGCAGGACAACACTATTGAGATGGCGTCGCTGGAATCCTGCATTCGCGAAGATCTGAACGAAAACGCGCCGCGCGCGATGGCGGTAATCGATCCGGTAAAACTGGTTATCGAAAACTACCCGCAGGGCGAGAGCGAAATGGTTACCATGCCTAACCATCCGAATAAACCGGAGATGGGCAGCCGTGAAGTGCCGTTTAGCGGTGAGATCTGGATCGATCGCGCGGATTTCCGCGAAGAAGCGAACAAACAGTACAAACGTCTGGTGATGGGCAAAGAAGTGCGTCTGCGTAATGCCTACGTCATTAAAGCGGAGCGCGTAGAGAAGGATGCCGAAGGGAATATCACCACCATCTTCTGTACCTATGATGCTGATACGCTGAGTAAAGATCCGGCTGACGGGCGTAAAGTGAAAGGCGTAATCCACTGGGTTAGCGTAGCACATGCGCTGCCGATTGAAATTCGTCTCTACGACCGTCTGTTCAGCGTGCCGAACCCGGGCGCCGCGGAGGACTTCCTGTCTGTTATCAACCCCGAATCATTAGTGATTAAGCAGGGGTATGGCGAGCCGTCGCTGAAAGCGGCGGTAGCAGGGAAAGCTTTCCAGTTTGAACGTGAAGGTTACTTCTGCCTTGACAGCCGCTATGCAACGGCCGATAAGCTGGTCTTTAACCGCACCGTGGGCCTGCGTGATACCTGGGCGAAAGCGGGCGAATAA
>3_this_is_genome2_contig_number2
ACGCGCTATAGGGCTCTCAGAGAGTCTCAGTGTTTATTGGCATCGTTAGCCTGTTTCCTGAAATGTTCCGCGCAATTACCGATTACGGGGTAACTGGCCGGGCAGTAAAAAAAGGCCTGCTGAACATCCAAAGCTGGAGTCCTCGCGACTTCGCGCATGACCGGCACCGTACCGTGGACGACCGTCCTTACGGCGGCGGACCGGGGATGTTAATGATGGTGCAACCCTTGCGGGACGCCATTCATGCAGCAAAAGCCGCGGCAGGTGAAGGCGCTAAAGTGATTTATCTGTCGCCTCAGGGACGCAAGCTTGATCAAGCGGGCGTTAGCGAGCTGGCCACGAATCAGAAACTCATTCTGGTGTGTGGTCGCTACGAAGGCGTAGATGAGCGCGTAATTCAGGCCGAAATTGACGAAGAATGGTCAATTGGCGATTACGTTCTCAGCGGTGGCGAACTACCGGCAATGACGCTGATTGACTCCGTCGCCCGGTTTATACCGGGGGTTCTGGGGCATGAGGCATCAGCAATCGAAGATTCGTTTGCTGATGGGTTGCTGGATTGTCCGCACTATACGCGCCCTGAAGTGTTAGAGGGGATGGAAGTACCGCCAGTATTGCTGTCGGGAAACCATGCTGAGATACGTCGCTGGCGTTTGAAACAGTCACTGGGCCGAACCTGGCTTAGAAGACCTGAACTTCTGGAAAACCTGGCTCTGACTGAAGAGCAAGCAAGGTTGCTGGCGGAGTTCAAAACAGAACACGCACAACAGCAGCATAAACATGATGGGATGGCATAGCGAGATCGCGCATAGCGCGCGGCGAGATCCGCGAGACATGAATAATCATTTTGGGAAAGGGTTAATGGCCGGGTTGCACGCGCCATATGCATATAGCGCGCATCATGCGGTGAATTTCTGTTCTGAGTATAAACGTGGCTTTGTATTGGGTTTTACACACCGTATGTTCGAAAAGACCGGCGATCGTCAACTTAGCGCGTGGGAGGCCGGAATTCTGACGCGTCGCTATGGTCTGGATAAAGAAATGGTGATGGATTTCTTTAAAGAGAATCATTCCGGGATGGCGGTTCGCTTCTTTATGGCTGGTTATCGACTCGAAGGTTGAACGCCTCTAGAGCGCTAGAGGCGCGCGCGATATACGCGGCGCGAGACATGTCTACGCTTCTCTATTTGCACGGATTCAACAGTTCCCCTCGCTCGGCAAAAGCGTGCCAGCTAAAAAACTGGCTGGCGGAGCGTCATCCGCATGTTGAGATGATCGTCCCTCAACTGCCGCCGTATCCTGCCGATGCGGCGGAGTTGCTGGAATCTCTCGTACTTGAGCATGGCGGTGCGCCATTAGGGCTGGTAGGATCGTCGCTGGGTGGTTATTACGCCACCTGGCTGTCGCAATGTTTTATGCTGCCGGCTGTGGTGGTGAATCCCGCCGTGCGGCCCTTTGAATTACTGACCGACTATCTCGGTCAGAACGAGAACCCCTACACCGGGCAGCAATATGTGCTAGAGTCTCGCCATATTTATGATCTTAAAGTCATGCAGATTGACCCGCTGGAAGCGCCGGACCTGATCTGGCTACTGCAACAGACGGGCGATGAAGTGCTGGATTACCGCCAGGCGGTGGCATATTACGCCTCCTGCCGTCAGACAGTGACCGAGGGGGGTAATCACGCATTCACGGGCTTCGAAGATTATTTCAACCAGATTGTCGATTTTCTTGGACTGCACAGTTGCTGACCGGATATACGCGCGCGCGCTATATAGCGCGCGCGGCGATATAGCGCATGAAGTTTGTTGCGCCAGAACAGGCACCGGAACAGGCGGAAATCATCAGAAATACGCCGTTCTGGCCTGATGTGGACCTGTCGGAGTTTCGCAGCATGATGCGCACTGATGGCACGGTGACGCAGCCGCGTTTAAAGCAGGTTGCGCTGTCGGCAATTTCGGAGGTCAACGCAGAGCTGTATGAGTTTCGCAGACGCCAGCAGATGCTGGGGTATGCCTCGCTGGCAGAAGTCCCGGCGGAACAACTGGACGGCAAAAGCGAGCGCATTCAGCACTATTTCAACGCGGTTTACTGCTGGGCACGCGCCATGCTCAACGAACGTTACCAGGACTATGACGCCACGGCATCCGGTGTGAAGCGGGGCGAAGAACTGGCAGAAGCCAGCGGTGATTTGTGGCGTGACGCCCGCTGGGCCATCAGCCGGGTGCAGGATGCGCCGCACTGCACAGTGGAGCTTATCTGA
>4_this_is_genome2_contig_number3
ATGATTGACCCTATTTTTGCGTCCTGTACGCTAATTGCCGTCTTTGTTGTTTTACTGGCCATGGGCGCGCCTATCGGGATCTGCATCGTTATCGCCTCTTTCAGCACCATGATGCTGGTACTGCCTTTCGATATTTCGATGTTCGCCACCGCGCAAAAAATGTTCTCCAGCCTGGACAGTTTTGCCTTGCTGGCCGTGCCGTTCTTCGTTTTGTCCGGGGTGATCATGAATAGCGGGGGAATTGCCGCCCGACTGGTCAATTTTGCCAAACTGTTTACTGGCAAACTGCCCGGCTCGCTCTCTTACACCAACATCGTCGGCAATATGATGTTCGGTGCAATTTCCGGATCGGCGATTGCCGCCTCAACCTCTATCGGCGGCGTGATGGTGCCGATGAGCGCGCGCGAAGGTTACGATCGCGGTTTTGCGGCCGCGGTGAATATCGCCTCCGCGCCGACGGGAATGTTAATTCCGCCCACCACGGCTTTTATCCTTTATGCGCTGGCAAGCGGGGGAACATCGATTGCCGCTCTGTTCGCCGGCGGTCTGGTCGCGGGAGTGCTGTGGGGCGTTGGCTGTATGCTGGTCACGCTGGTGGTCGCTAAGCGTCGAAATTATCGGGTTTTCTTCACCGTCCAAAAAGGCATGGCGCTAAAAGTTGCCGTTGAGGCCATTCCCAGCCTGTTACTGATCGTGATTATTGTCGGCGGCATTGTGCAGGGGATTTTCACCGCCATTGAAGCCTCCGCGATTGCCGTGGTGTATACGTTATTGCTGACGATAGTGTTTTACCGCACGCTGAAAATTAAGGATTTGCCTTCGATTTTGCTCCAGACAGTGGTAATGACCGGGGTCATCATGTTCCTGCTGGCAACCTCTTCGGCGATGTCCTTCTCGATGTCGATCACCAATATTCCTGCGGCGCTGAGCGATATGATCCTCGGTATTTCCGCCAATAAACTGGTTATCCTGTTAGTCATTACCGTCTTTTTGTTGATTATCGGCGCATTTATGGATATCGGTCCGGCCATTCTGATTTTTACCCCGATTCTGCTGCCGATTATGACTAAACTGGGCGTCGATCCGGTGCATTTCGGCATTATCATGATCTATAACCTGGCGATAGGCACCATTACGCCGCCAGTTGGCAGTGGTTTATATGTCGGGGCGAGCGTCGGTAAGGTCAAAGTTGAGGACGTTATCAAACCGTTGATGCCTTTTTACGGCGCGATTATCGGCGTTCTGTTATTAATTACCTACATTCCGGAAATCACACTGTTTTTACCCCGTCTACTGGGCATCATGTAAACGCTCATAGGCGGCGCGCGCGCTCTCAGGAATGAAGTTTGTTGCGCCAGAACAGGCACCGGAACAGGCGGAGGTCATCAAAAATACGCCGTTCTGGCCTGATGTGAACCTGTCGGAATTTCGCAGTGTGATGCGCACTGACGGCACGGTGACGCAGCCGCGTTTAAAGCAGGTCGTGCTGACGGCGATCTCTGAGGTTAACGCTGAGCTGTACGACTTCCGCAACCGTCAGCAGATGCTGGGCTGGCGGACACTTGCTGAGGTTCCCGCAGAAATGCTGGACGGTAAAAGCGAGCGTATCCGGCACTACCACAACGCTGTTTTTTGCTGGGCGCGCGCTGTGCTTAATGAGCGTTATCAGGACTATGACGCCACGGCGTCAGGCGTGAAGCGAGGGGAGGAGCTGGCGGAGGCCAGCGGCGATCTGTGGCGTGATGCCCGCTGGGCCATCAGCCGGGTGCAGGATGCACCGCACTGTACGGTGGAGCTTATCTGACGCTCATAGGCGCGCGCTCATAGCGCGATGGAAACAAATATTACCTGGCAACAATTGATAGATGAATATTTCTTCGCAAAACCTCTGCGCTCAGCATCTGAATGGAGTTACACCAAAGTCTTCAAATCATTTGTACATTATATGGGGCCGTTAAGCTGCCCTAATGATGTGACATATCACAAAGTGCTTGCCTGGCGCCGTTTTCTTTTAAAAGAGAAAAAGCTGTCCGGACGTACCTGGAATAACAAGGTGGCGCATATGCGGGCCATCTTTAACTACGGAATACAGCGAGGGTTACTGCACTATGACGAAAATCCGTTTAACAATTCGGTAGTTAAACCGGACAAGAAGAGAAAGAAAACGCTCACTCAGGCACAGATTGAGTATGCCTATCAGATCATGGAGCAGTATGAAAATCAGGAGAATACAGGGCTGGGACTGAAATATTCCCGCTGCGCCTTATTTCCTGCATGGTTCTGGCTCACTGTCCTGGATACGCTCTATTACACAGGGATACGTCAGAACCAGTTATTACATATTCGGCTGAATGATGTTGATTTGAGAGAAGGGCAGATTCGGCTGATTACGGAGGGGTGTAAAAATCACAAAGAACACTATGTGCCGGTGATCAGTTTTCTGCGTCCACGGCTGACCTGTTTAATGGAGAAAGCGCAGAGCGAAGGATTGAAAGGTAATGACCGCCTGTTCAATATTGCACTTTTTACCGGCAAAGATCCCGCCATTGGCGATGACATGGATTCTCCTCAGGTAAGAGCATTCTTCCGTCGTCTGTCCAAGGAGTGTCAGTTTGCGATCAGTCCTCATCGTTTCAGACACACGCTGGCCACGGAGATGATGAAAATGCCGGAACAGAATCTGCATATGGCGCAAAGTGTGCTGGGTCATTCAAACATGAAATCCACGCTGGAGTATGTGGAGAATGATATTGCAGTGATGGGGAGGGCTCTGGAAGCGCAGTTTATGCAGATTAAGGCAGCACATGCCCGAAGCATTTACAGTGGGTTGACAAAGAATAGATAA
>5_genome2_small
GATACA
>1_header_genome3_chromo
ATGAGAGCGCTACTGTGGCTGGTGGGTCTTGCGTTGCTGTTAACAGGCTGCGCGAGCGAAAAAGGAATTATCGATGAAGAGGGATATCAGCTTGATACCCGACATCGGGCGCAGGCGGCCTATCCGCGCATTAAAGTCCTGGTGATTCACTATACGGCGGAAAACTTTGACGTTTCGCTGGCGACGTTAACGGGCCGCAACGTCAGTTCGCATTACCTGATTCCCGCAACCCCGCCATTATATGGCGGTAAACCGCGCATCTGGCAACTGGTGCCGGAACAGGATCAGGCCTGGCATGCGGGCGTCAGTTTCTGGCGAGGCGCCACGCGTCTCAATGATACGTCTATTGGCATTGAGCTGGAAAATCGCGGCTGGCGAATGTCCGGCGGGGTGAAATCTTTCGCGCCGTTTGAATCCGCGCAAATTCAGGCATTGATTCCGTTAGCGAAGGACATTATCGCGCGCTATGACATCAAACCGCAGAATGTGGTGGCCCATGCGGATATCGCGCCGCAGCGTAAAGACGATCCCGGCCCGCGCTTCCCGTGGCGCGAGCTGGCGGCACAGGGGATTGGCGCCTGGCCTGACGCCCAGCGTGTGGCGTTTTATCTGGCTGGACGCGCGCCGTATACGCCAGTCGATACCGCAACGGTGCTTGCGTTACTCTCGCGCTATGGCTATGAAGTCAAAGCCGATATGACGGCGCGCGAGCAACAGCGGGTGATTATGGCGTTCCAGATGCACTTCCGTCCGGCGCAATGGAACGGTATCGCAGATGCCGAAACGCAGGCGATTGCCGAAGCATTACTGGAGAAGTACGGCCAGGATTAACGAGTCCGGGAGCGGCGAGATTCCGGGCAGAGGAGGCGGCTATAGCGGATGAGAGCGCTACTGTGGCTGGTGGGTCTTGCGTTGCTGTTAACAGGCTGCGCGAGCGAAAAAGGAATTATCGATGAAGAGGGATATCAGCTTGATACCCGACATCGGGCGCAGGCGGCCTATCCGCGCATTAAAGTCCTGGTGATTCACTATACGGCGGAAAACTTTGACGTTTCGCTGGCGACGTTAACGGGCCGCAACGTCAGTTCGCATTACCTGATTCCCGCAACCCCGCCATTATATGGCGGTAAACCGCGCATCTGGCAACTGGTGCCGGAACAGGATCAGGCCTGGCATGCGGGCGTCAGTTTCTGGCGAGGCGCCACGCGTCTCAATGATACGTCTATTGGCATTGAGCTGGAAAATCGCGGCTGGCGAATGTCCGGCGGGGTGAAATCTTTCGCGCCGTTTGAATCCGCGCAAATTCAGGCATTGATTCCGTTAGCGAAGGACATTATCGCGCGCTATGACATCAAACCGCAGAATGTGGTGGCCCATGCGGATATCGCGCCGCAGCGTAAAGACGATCCCGGCCCGCGCTTCCCGTGGCGCGAGCTGGCGGCACAGGGGATTGGCGCCTGGCCTGACGCCCAGCGTGTGGCGTTTTATCTGGCTGGACGCGCGCCGTATACGCCAGTCGATACCGCAACGGTGCTTGCGTTACTCTCGCGCTATGGCTATGAAGTCAAAGCCGATATGACGGCGCGCGAGCAACAGCGGGTGATTATGGCGTTCCAGATGCACTTCCGTCCGGCGCAATGGAACGGTATCGCAGATGCCGAAACGCAGGCGATTGCCGAAGCATTACTGGAGAAGTACGGCCAGGATTAACAGGGCGCGGTATCGCGAGGACTCTCTCTTCGAGGACATGCCGCACTTTATTGCTGAATGTACTGAAAATATTCGCGAGCAGGCTGATTTACCCGGCCTGTTCAGCAAGGTAAACGAGGCGCTGGCCGCCAGCGGGATTTTCCCCATCGGCGGTATCCGCAGTCGCGCCCACTGGCTGGATACCTGGCAGATGGCTGACGGTAAGCATGATTACGCGTTTGTGCATATGACGCTGAAAATCGGCGCCGGGCGCAGCCTGGAGAGCCGTCAGGAAGTCGGCGAAATGCTGTTCGGGCTGATTAAAGCCCACTTCGCCGACCTGATGGAGAACCGCTATCTGGCGCTGTCGTTTGAGATTGCCGAGTTACATCCAACGCTCAATTACAAACAAAACAACGTACACGCGTTATTTAAATAGCCCGAGTATTAGCGCGCGGCGGCGCTATAGGCGCGCTATAGGCATGAGCGCGCTATTTCTGGCCATCCCGTTAACCATTTTTGTGTTGTTTGTGTTACCGATTTGGCTGTGGCTGCATTACAGCAACCGCGCCGGTCGGGGAGAACTGTCGCAAAGCGAGCAGCAACGCTTACTGCAACTCACAGACGACGCGCAACGTATGCGCGAGCGCATTCAGGCGCTGGAAGACATTCTTGATGCAGAGCATCCGAACTGGAGAGAGCGCTAACGAGAGTCTCGGAGGAGCGGCGCTCTGGATGCCCGCGACTAAATTCTCCCGACGTACCCTCCTGACGGCAGGTTCTGCGCTTGCTGTTCTTCCTTTCCTGCGCGCCTTGCCGGTACAGGCGCGTGAACCTCGCGAGACCGTCGATATTAAGGATTATCCGGCGGATGACGGTATCGCCTCGTTCAAACAGGCCTTCGCCGACGGACAGACCGTGGTCGTACCGCCAGGATGGGTGTGTGAAAATATCAATGCGGCGATAACGATTCCGGCGGGAAAAACGCTGCGGGTACAGGGCGCGGTGCGTGGGAATGGCCGGGGACGGTTTATTTTGCAGGACGGGTGTCAGGTGGTGGGGGAGCAGGGCGGCAGTCTGCACAATGTGACGCTGGATGTTCGCGGGTCGGACTGTGTGATTAAAGGCGTGGCGATGAGCGGCTTTGGCCCCGTCGCGCAAATTTTCATCGGTGGTAAGGAACCGCAGGTGATGCGTAATCTCATTATCGATGACATCACCGTTACCCACGCCAACTACGCCATTCTCCGCCAGGGATTTCATAACCAAATGGACGGCGCGAGGATTACGCATAGCCGCTTTAGCGATTTACAGGGGGACGCCATTGAGTGGAATGTCGCGATTCACGACCGCGATATCCTGATTTCCGATCATGTCATCGAACGCATTGATTGTACCAATGGCAAAATCAACTGGGGGATCGGCATCGGGCTGGCGGGTAGCACCTATGACAACAGTTATCCTGAAGACCAGGCAGTAAAAAACTTTGTGGTGGCCAATATTACCGGATCTGATTGCCGACAGCTTGTGCACGTAGAAAATGGCAAACATTTCGTCATTCGCAATGTCAAAGCCAAAAACATCACGCCCGATTTCAGTAAAAATGCGGGTATTGATAACGCAACGATCGCAATTTATGGCTGTGATAATTTCGTCATTGATAATATTGATATGACGAATAGTGCCGGGATGCTCATCGGCTATGGCGTCGTTAAAGGAAAATACCTGTCAATTCCGCAAAACTTTAAATTAAACGCTATTCGGTTGGATAATCGCCAGGTTGCTTATAAATTACGCGGCATTCAAATTTCCTCCGGCAACACCCCCTCTTTTGTCGCCATCACCAATGTACGGATGACGCGTGCTACGCTGGAACTGCATAATCAACCGCAGCACCTCTTCCTGCGTAATATCAACGTGATGCAAACTTCAGCGATTGGCCCGGCGTTAAAAATGCATTTCGATTTGCGTAAAGATGTCCGTGGTCAATTTATGGCCCGCCAGGACACGCTGCTTTCCCTCGCTAATGTTCATGCCATCAATGAAAACGGGCAGAGTTCCGTGGATATCGACAGGATTAATCACCAAACCGTGAATGTCGAAGCAGTGAATTTTTCGCTGCCGAAGCGGGGAGGGTAACGCGTCTGCGCGCGCGGAGAGAGGCTCTCAGGACATGTCAGAAAATAAATTACACGTTATCGATTTGCACAAACGCTACGGCGGTCATGAAGTGCTGAAAGGGGTATCGCTGCAGGCCCGCGCCGGAGATGTGATTAGCATCATCGGCTCGTCCGGCTCCGGTAAAAGCACTTTTTTGCGCTGTATTAACTTCCTCGAAAAACCGAGCGAAGACGCGATTATCGTGAACGGTCAGAACATTAATCTGGTGCGCGACAAAGACGGGCAGCTCAAAGTGGCGGATAAAAATCAGCTACGCTTGTTGCGTACCCGCCTGACGATGGTGTTTCAGCACTTTAACCTCTGGAGCCACATGACGGTGCTGGAAAATGTGATGGAAGCGCCGATTCAGGTACTGGGATTAAGCAAGCACGACGCGCGCGAGCGGGCGTTGAAATATCTGGCGAAGGTGGGGATTGATGAGCGCGCTCAGGGCAAATATCCCGTTCATCTCTCCGGTGGCCAACAGCAGCGCGTTTCTATTGCGCGCGCGCTGGCGATGGAACCTGACGTTTTACTGTTCGATGAACCCACTTCGGCGCTCGATCCTGAACTGGTCGGCGAAGTGTTGCGCATCATGCAACAACTGGCGGAAGAAGGCAAAACGATGGTGGTGGTCACGCATGAAATGGGCTTCGTTCGCCATGTCTCTTCGCACGTTATTTTTCTGCATCAGGGGAAAATTGAAGAAGAGGGCGATCCGGAGCAGGTGTTCGGCAATCCGCAAAGCCCGCGTTTACAGCAATTCCTGAAAGGCTCGCTGAAATAACCGGATGCGCGCGATATATCGGCGATGCGTGTTTATTGGCATCGTTAGCCTGTTTCCTGAAATGTTCCGCGCAATTACCGATTACGGGGTAACTGGCCGGGCAGTAAAAAATGGCCTGCTGAACATCCAAAGCTGGAGTCCTCGCGACTTCACGCATGACCGGCACCGTACCGTGGACGATCGTCCTTACGGCGGCGGACCAGGGATGTTAATGATGGTGCAACCCTTGCGGGACGCCATTCACGCAGCAAAAGCCGCGGCAGGTGAAGGCGCTAAAGTGATTTATCTGTCGCCTCAGGGACGCAAGCTTGATCAAGCGGGCGTTAGCGAGCTGGCCACGAATCAGAAGCTTATTCTGGTGTGTGGTCGCTACGAAGGCGTAGATGAGCGCGTAATTCAGACCGAAATTGACGAAGAATGGTCAATTGGCGATTACGTTCTCAGCGGTGGCGAACTACCGGCAATGACGCTGATTGACTCCGTCGCCCGGTTTATACCGGGAGTTCTGGGGCATGAAGCATCAGCAATCGAAGATTCGTTTGCTGATGGGTTGCTGGATTGTCCGCACTATACGCGCCCTGAAGTGTTAGAGGGGATGGAAGTACCGCCAGTATTGCTGTCGGGAAACCATGCTGAGATACGTCGCTGGCGTTTGAAACAGTCGCTGGGCCGAACCTGGCTTAGAAGACCTGAACTTCTGGAAAACCTGGCTCTGACTGAAGAGCAAGCAAGGTTGCTGGCGGAGTTCAAAACAGAACACGCACAACAGCAGCATAAACATGATGGGATGGCATAGCCGGCTCTGCGAGAGAGGAGCGCTCGCATGAATAATCATTTTGGGAAAGGGTTAATGGCCGGGTTGCACGCGCCATATGCATATAGCGCGCATCATGCGGTGAATTTCTGTTCTGAGTATAAACGTGGCTTTGTATTGGGTTTTACACACCGTATGTTCGAAAAGACCGGCGATCGTCAACTTAGCGCGTGGGAGGCTGGAATTCTGACGCGTCGCTATGGTCTGGATAAAGAAATGGTGATGGATTTCTTTAAAGAGAATCATTCCGGGATGGCGGTTCGCTTCTTTATGGCCGGTTATCGACTCGAAGGTTGA
>2_genome3_plasmid
ATGTCTACGCTTCTCTATTTGCACGGATTCAACAGTTCCCCTCGCTCGGCAAAAGCGTGCCAGCTAAAAAACTGGCTGGCGGAGCGTCATCCGCATGTTGAGATGATCGTCCCTCAACTACCGCCGTATCCTGCCGATGCGGCGGAGTTGCTGGAGTCTCTCGTGCTTGAGCATGGCGGTGCGCCATTAGGGCTGGTAGGATCGTCGCTGGGTGGTTATTACGCCACCTGGCTGTCGCAATGTTTTATGCTGCCGGCTGTGGTGGTGAATCCCGCCGTGCGGCCCTTTGAATTACTGACCGACTATCTCGGTCAGAACGAGAACCCCTACACCGGGCAGCAATATGTGCTAGAGTCTCGCCATATTTATGATCTTAAAGTCATGCAGATTGACCCGCTGGAAGCGCCGGACCTGATCTGGCTACTGCAACAGACGGGCGATGAAGTGCTGGATTACCGCCAGGCGGTGGCATATTACGCCTCCTGCCGTCAGACAGTGACCGAGGGTGGTAATCACGCATTCACGGGCTTCGAAGATTATTTCAACCAGATTGTCGATTTTCTTGGACTGCACAGTTGCTGACGCGTAGCGGCCGGAATCTTCTCGGAGAGGCGCTTCTCTCTCGGAGATGATTGACCCTATTTTTGCGTCCTGTACGCTAATTGCCGTCTTTGTTGTTTTACTGGCCATGGGCGCGCCTATCGGGATCTGCATCGTTATCGCCTCTTTCAGCACCATGATGCTGGTACTGCCTTTCGATATTTCGATGTTCGCCACCGCGCAAAAAATGTTCTCCAGCCTGGACAGTTTTGCCTTGCTGGCCGTGCCGTTCTTCGTTTTGTCCGGGGTGATCATGAATAGCGGGGGAATTGCCGCCCGGCTGATCAATTTTGCCAAACTGTTTACTGGCAAACTGCCCGGTTCGCTCTCTTATACCAACATCGTCGGCAATATGATGTTCGGTGCAATTTCCGGATCGGCAATTGCCGCCTCAACCTCCATCGGCGGCGTGATGGTGCCGATGAGCGCGCGCGAAGGTTACGATCGCGGCTTTGCGGCCGCGGTGAATATCGCCTCCGCGCCGACGGGAATGTTAATTCCGCCCACCACGGCTTTTATCCTTTATGCGCTGGCAAGCGGGGGAACATCGATTGCCGCTCTGTTCGCCGGCGGTCTGGTCGCGGGAGTGCTGTGGGGCGTTGGCTGTATGCTGGTCACGCTGGTAGTCGCTAAGCGTCGAAATTATCGGGTTTTCTTCACCGTCCAAAAAGGCATGGCGCTAAAAGTTGCCGTTGAGGCCATTCCCAGCCTGTTACTGATCGTGATTATCGTCGGCGGCATTGTGCAGGGGATTTTCACCGCCATTGAAGCCTCCGCGATTGCCGTGGTGTATACGTTATTGCTGACGATGGTGTTTTACCGCACGCTGAAAATTAAGGATTTGCCTTCGATTTTGCTCCAGACAGTGGTAATGACCGGGGTCATCATGTTCCTGCTGGCAACCTCTTCGGCGATGTCCTTCTCAATGTCGATCACCAATATTCCTGCGGCGCTGAGCGATATGATCCTCGGTATTTCCGCCAATAAACTGGTTATCCTGTTAGTCATTACCGTCTTTTTGTTGATTATCGGCGCATTTATGGATATCGGTCCGGCCATTCTGATTTTTACCCCGATTCTGCTGCCGATCATGGCTAAACTGGGCGTCGATCCGGTGCATTTGGGCATTATCATGATCTATAACCTGGCGATTGGCACCATTACGCCGCCAGTTGGCAGTGGTTTATATGTCGGGGCGAGCGTCGGTAAGGTCAAAGTTGAGGAAGTGATTAAACCGTTGCTGCCTTTTTACGGCGCGATTATCGGCGTTCTGTTATTAATTACCTACATTCCGGAAATCATACTGTTCTTACCCCGTCTACTGGGCATCATGTAAACCCGATGGCGCGCAGAGGCGCGAGTTCTGGA
>3_genome3_plasmid
CACAGGGCTTAGAGGCGCTATGGCAATGATAATTAATGGGAAATTAATTAAAGCAAAAGACTTAGCTAAGGCTGCAGGTGTATCTCGTTCAACAGTGATTAAATATTACGGCATTAGCCGTGAGAATTACGAAAGGGTAGCAACTGAAAGAAGGAAGCTTGCTTTTGAACTAAGAGCATCAGGTTTAAAATGGAAAGAAGTTGCTGAAAAAATGAACACGACAAAATATAGCGCAATTGCATATTATAGACGATATTTAGCATTAGAGAAAAACAAATAACAGGCGCTAAGGCGGCGATCCTAGCGCGCGATCGCGCATGCGATGGTCGAACTGCAACATCAACGGCTGATGGTGCTTGCCGAACAGCTCCAGCTGGACAGTCTTATCGGCGCAGCGCCGGCGCTGTCGCAACAGGCGGTGGATCAGGAATGGAGCTACATGGACTTCCTGGAGCACCTGTTACATGAGGAGAAACTGGCCCGGCATCAGCGTAAACAGGCGATGTACACGCGGATGGCAGCCTTCCCGGCGGTAAAGACGTTCGAGGAGTACGACTTCACCTTCGCCACCGGCGCTCCTCAGAAGCAAATCCAGTCGCTGCGATCCCTGAGCTTCATAGAGCGTAACGAAAACATCGTGTTGCTGGGGCCATCGGGCGTGGGAAAAACGCATCTGGCGATAGCCATGGGCTACGAAGCAGTACGGGCGGGCATCAAGGTTCGCTTCACAACAGCAGCGGACCTGCTGCTACAGCTGTCCACTTCACAGCGTCAGGGCCGTTACAAAACGACTCTCAATCGTGGTGTCATGGCCCCGAAGCTGCTTATCATCGATGAAATAGGTTATCTGCCGTTCAGTCAGGAGGAAGCCAAGCTGTTCTTCCAGGTCATCGCCAAACGTTACGAGAAGAGCGCGATGATCCTGACCTCCAACCTGCCGTTCGGGCAGTGGGATCAGACGTTCGCCGGTGATGCAGCGCTGACATCGGCGATGCTGGACCGGATCTTACATCACTCACACGTCGTGCAAATAAAAGGGGAAAGCTATCGACTGAAGCAGAAACGAAAGGCCGGGGTTATAGCTGAAGCTAATCCTGAGTAA
>1_g4
ATGAAAGCGCTACTGTGGCTGGTGGGTCTCGCGTTGCTGTTAACAGGCTGCGCGAGCGAAAAAGGAATTATCGATAAAGAGGGATATCAGCTTGATACCCGACATCGGGCGCAGGCGGCCTATCCGCGCATTAAAGTCCTGGTGATTCACTATACGGCGGAAAACTTTGACGTTTCGCTGGCGACGTTAACGGGCCGCAACGTCAGTTCGCATTACCTGATTCCCGCAACCCCGCCATTATATGGCGGTAAACCGCGCATCTGGCAACTGGTGCCGGAACAGGATCAGGCCTGGCATGCGGGCGTCAGTTTCTGGCGAGGCGCCACGCGTCTCAATGATACGTCTATTGGCATTGAGCTGGAAAATCGCGGCTGGCGAATGTCCGGCGGGGTGAAATCTTTCGCGCCGTTTGAATCCGCGCAAATTCAGGCATTGATTCCGTTAGCGAAGGACATTATCGCGCGCTATGACATCAAACCGCAGAATGTGGTGGCCCATGCGGATATCGCGCCGCAGCGTAAAGACGATCCCGGCCCGCGCTTCCCGTGGCGCGAGCTGGCGGCGCAGGGGATTGGCGCCTGGCCTGACGCCCAGCGTGTGGCGTTTTATCTGGCTGGACGCGCGCCGTATACGCCAGTCGATACCGCAACGGTGCTTGCGTTACTCTCGCGCTATGGCTATGAAGTCAAAGCCGATATGACGGCGCGCGAGCAGCAGCGGGTGATTATGGCGTTCCAGATGCACTTCCGTCCGGCGCAATGGAACGGTATCGCAGATGCCGAAACGCAGGCGATTGCCGAAGCATTACTGGAGAAGTACGGCCAGGATTAACGCGATCGCGCGCATATCGCGCGCGATAGATGCCGCACTTTATTGCTGAATGTACTGAAAATATTCGCGAGCAGGCTGATTTACCCGGCCTGTTCAGCAAGGTAAACGAGGCGCTGGCCGCCAGCGGGATTTTCCCCATCGGCGGTATCCGCAGTCGCGCCCACTGGCTGGATACCTGGCAGATGGCTGACGGTAAGCATGATTATGCGTTTGTGCATATGACGCTGAAAATCGGTACCGGGCGCAGCCTGGAGAGCCGTCAGGAAGTCGGCGAAATGCTGTTTGGGCTGATTAAAGCCCACTTCGCCGACCTGATGGAGAACCGCTATCTGGCGCTGTCGTTTGAGATTGCCGAGCTACATCCGACGCTCAATTACAAACAAAACAACGTACACGCGTTATTTAAATAGCCGCATATGCGGCGCTCAGGAGCGCTAGCATGCTCGATAAACAGACCCATACCCTGATCGCCCAGCGACTTAATCAGGCTGAAAAACAGCGTGAACAAATTCGCGCAGTGTCGCTGGATTATCCCAACATCACTATTGAAGATGCCTATGCCGTACAGCGTGAATGGGTCAATATCAAGATCGCCGAAGGGCGCACGCTCAAAGGCCACAAAATCGGCCTGACCTCAAAAGCGATGCAGGCCAGCTCGCAAATCAGCGAACCGGATTACGGCGCGCTGCTTGACGATATGTTCTTCCATGACGGCGGCGATATCCCCACCGACCGTTTTATCGTCCCGCGTATTGAAGTGGAGCTGGCGTTCGTGCTGGCGAAACCGCTGCGCGGCCCTCACTGCACGCTGTTCGACGTCTACAACGCCACGGATTATGTGATTCCGGCGCTGGAACTGATTGACGCCCGCAGCCACAACATCGACCCGGAAACCCAGCGCCCGCGCAAAGTGTTCGACACCATTTCCGACAACGCCGCCAACGCCGGGGTGATCCTCGGTGGTCGCCCCATCAAACCAGACGAGCTGGATCTGCGCTGGATCTCCGCGCTGCTCTATCGCAACGGCGTGATCGAAGAAACCGGCGTCGCCGCAGGCGTGCTGAATCATCCGGCCAACGGCGTGGCGTGGCTGGCGAACAAGCTTGCCCCCTACGATGTCCAGCTTGAAGCCGGGCAGATCATCCTCGGCGGCTCGTTCACCCGCCCGGTGCCGGCGAGCAAGGGCGACACCTTCCATGTCGATTACGGCAACATGGGCGCGATCAGTTGCCGGTTTGTGTAACCAGATCCGCGCGCGCATATATATCGCGCGCATACGATGCCCGTGAATAAGTTCTCCCGACGTACCCTCCTGACGGCAGGTTCCGCGCTTGCTGTTCTTCCTTTTCTGCGCGCCTTGCCGGTACAGGCGCGTGAACCTCGCGAGACCGTCGATATTAAGGATTATCCGGCGGATGACGGTATCGCCTCGTTCAAACAGGCCTTCGCCGACGGACAGACCGTGGTCTTACCGCCAGGATGGGTGTGTGAAAATATCAATGCGGCGATAACGATTCCGGCGGGAAAAACGCTGCGGGTACAGGGCGCGGTGCGTGGGAATGGCCGGGGACGGTTTATTTTGCAGGACGGGTGTCAGGTGGTGGGGGAGCAGGGCGGCAGTCTGCACAATGTGACGCTGGATGTTCGCGGGTCGGACTGTGTGATTAAAGGCGTGACGATGAGCGGCTTTGGCCCCGTCGCGCAAATTTTCATCGGCGGTAAGGAACCGCAGGTGATGCGTAATCTCATTATCGATGACATCACCGTTACCCACGCCAACTACGCCATTCTCCGCCAGGGATTTCATAACCAAATGGACGGCGCGCGGATTACGCATAGCCGCTTTAGCGATTTGCAGGGGGACGCCATTGAGTGGAATGTCGCGATTCACGACCGCGACATCCTGATTTCCGATCATGTCATCGAACGCATTGATTGTACCAATGGCAAAATCAACTGGGGGATCGGCATCGGGCTGGCGGGTAGCACCTATGACAACAGTTATCCTGAAGATCAGGCAGTAAAAAACTTTGTGGTGGCCAATATTACCGGATCTGATTGCCGACAGCTGGTGCACGTAGAAAATGGCAAACATTTCGTCATTCGCAATGTCAAAGCCAAAAACATCACGCCCGATTTCAGTAAAAATGCGGGTATTGATAACGCAACGATCGCCATTTATGGCTGTGATAATTTCGTCATTGATAATATTGATATGACGAATAGTGCTGGGATGCTCATCGGCTATGGCGTCGTTAAAGGAAAATACCTGTCAATTCCGCAAAACTTTAAATTAAACGCTATTCGGTTGGATAATCGCCAGGTTGCTTATAAATTACGCGGCATTCAAATTTCCTCCGGCAACATCCCCTCTTTTGTCGCCATCACCAATGTACGGATGACGCGTGCTACGCTGGAACTGCATAATCAACCGCAGCACCTCTTTCTGCGTAATATCAACGTGATGCAAACTTCAGCGATTGGCCCGGCGTTAAAAATGCATTTCGATTTGCGTAAAGATGTCCGTGGTCAATTTATGGCCCGCCAGGACACGCTGCTTTCCCTCGCTAATGTTCATGCCATCAATGAAAACGGGCAGAGTTCCGTGGATATCGACAGGATTAATCACCAAACCGTGAATGTCGAAGCAGTGAATTTTTCGCTGCCGAAGCGGGGAGGGTAACAGAGCTCGCGCGATCGCGAATGTCAGAAAATAAATTACACGTTATCGATTTGCACAAACGCTACGGCGGTCATGAAGTGCTGAAAGGGGTATCGTTGCAGGCCCGCGCCGGAGATGTGATTAGCATCATCGGCTCGTCCGGCTCCGGTAAAAGCACTTTTTTGCGCTGTATTAACTTCCTCGAAAAACCGAGCGAAGGCGCGATTATCGTGAACGGTCAGAACATTAATCTGGTGCGCGACAAAGACGGGCAGCTCAAAGTGGCGGATAAAAATCAGCTACGCTTGTTGCGTACCCGCCTGACGATGGTGTTTCAGCACTTTAACCTCTGGAGCCACATGACGGTGCTGGAAAATGTGATGGAAGCGCCGATTCAGGTACTGGGATTAAGCAAGCACGACGCGCGCGAGCGGGCGTTGAAATATCTGGCGAAGGTGGGGATTGATGAGCGCGCTCAGGGCAAATATCCCGTCCATCTCTCCGGCGGCCAACAGCAGCGCGTTTCTATTGCGCGCGCGCTGGCGATGGAACCTGACGTTTTACTGTTCGATGAACCCACATCGGCGCTCGATCCTGAACTGGTCGGCGAAGTGTTGCGCATCATGCAACAACTGGCGGAAGAAGGCAAAACGATGGTGGTGGTCACGCATGAAATGGGCTTCGCCCGCCATGTCTCTTCGCACGTTATTTTTCTGCATCAGGGGAAAATTGAAGAAGAGGGCGATCCGGAGCAGGTGTTCGGCAATCCGCAAAGCCCGCGTTTACAGCAATTCCTGAAAGGCTCGCTGAAATAACAGATACGCGCATGGCGAGTGTTTATTGGCATCGTTAGCCTGTTTCCTGAAATGTTCCGCGCAATTACCGATTACGGGGTAACTGGCCGGGCAGTAAAAAAAGGCCTGCTGAACATCCAAAGCTGGAGTCCTCGCGACTTCGCGCATGACCGGCACCGTACCGTGGACGACCGTCCTTACGGCGGCGGACCGGGGATGTTAATGATGGTGCAACCCTTGCGGGACGCCATTCACGCAGCAAAAGCCGCGGCAGGTGAAGGCGCTAAAGTGATTTATCTGTCGCCTCAGGGACGCAAGCTTGATCAAGCGGGCGTTAGCGAGCTGGCCACGAATCAGAAGCTTATTCTGGTGTGTGGTCGCTACGAAGGCGTAGATGAGCGCGTAATTCAGACCGAAATTGACGAAGAATGGTCAATTGGCGATTACGTTCTCAGCGGTGGCGAACTACCGGCAATGACGCTGATTGACTCCGTCGCCCGGTTTATACCGGGGGTTCTGGGGCATGAGGCATCAGCAATCGAAGATTCGTTTGCTGATGGGTTGCTGGATTGTCCGCACTATACGCGCCCTGAAGTGTTAGAGGGGATGGAAGTACCGCCAGTATTGCTGTCGGGAAACCATGCCGAGATACGTCGCTGGCGCTTGAAACAGTCGCTGGGCCGAACCTGGCTTAGAAGACCTGAACTTCTGGAAAACCTGGCTCTGACTGAAGAGCAAGCAAGGTTGCTGGCGGAGTTCAAAACAGAACACGCACAACAGCAGCATAAACATGATGGGATGGCATAGCGATAGCGCTAGAGCGATGAATAATCATTTTGGGAAAGGGTTAATGGCTGGGTTGCACGCGCCATATGCATATAGCGCGCATCATGCGGTGAATTTCTGTTCTGAGTATAAACGTGGCTTTGTATTGGGTTTTACACACCGTATGTTCGAAAAGACCGGCGATCGTCAACTTAGCGCGTGGGAGGCCGGAATTCTGACGCGTCGCTATGGTCTGGATAAAGAAATGGTGATGGATTTCTTTAAAGAGAATCATTCCGGGATGGCGGTTCGCTTCTTTATGGTCGGTTATCGACTCGAAGGTTGACAGATGCGCGATCGATGTCTACGCTTCTCTATTTGCACGGATTCAACAGTTCCCCTCGCTCGGCAAAAGCGTGCCAGCTAAAAAACTGGCTGGCGGAGCGTCATCCGCATGTCGAGATGATCGTCCCTCAACTACCGCCGTATCCTGCCGATGCGGCGGAGTTGCTGGAATCTCTCGTGCTTGAGCATGGCGGTGCGCCATTAGGGCTGGTAGGATCGTCGCTGGGTGGTTATTACGCCACCTGGCTGTCGCAATGTTTTATGCTGCCGGCTGTGGTGGTGAATCCCGCCGTGCGGCCCTTTGAATTACTGACCGACTATCTCGGTCAGAACGAGAACCCCTACACCGGGCAGCAATATGTGCTAGAGTCTCGCCATATTTATGATCTTAAAGTCATGCAGATTGACCCGCTGGAAGCGCCGGACCTGATCTGGCTACTGCAACAGACGGGCGATGAAGTGCTGGATTACCGCCAGGCGGTGGCATATTACGCCTCCTGCCGTCAGACAGTGACCGAGGGTGGTAATCACGCATTCACGGGCTTCGAAGATTATTTCAACCAGATTGTCGATTTTCTTGGACTGCACAGTTGCTGACACGGATGCGCCATCGGCTTGCTGGCCGTGCCGTTCTTCGTTTTGTCCGGGGTGATCATGAATAGCGGGGGAATTGCCGCCCGGCTGGTCAATTTTGCCAAACTGTTTACTGGCAAACTGCCCGGCTCGCTCTCTTATACCAACATCGTCGGCAATATGATGTTCGGTGCAATTTCCGGATCGGCAATTGCCGCCTCAACCTCCATCGGCGGCGTGATGGTGCCGATGAGCGCGCGCGAAGGTTACGATCGCGGCTTTGCGGCCGCGGTGAATATCGCCTCCGCGCCGACGGGAATGTTAATTCCGCCCACCACGGCTTTTATCCTTTATGCGCTGGCAAGCGGGGGAACATCGATTGCCGCTCTGTTCGCCGGCGGTCTGGTCGCGGGAGTGCTGTGGGGCGTTGGCTGTATGCTGGTCACGCTGGTGGTCGCTAAGCGTCGAAATTATCGGGTTTTCTTCACCGTCCAAAAAGGCATGGCGCTAAAAGTTGCCGTTGAGGCCATTCCCAGCCTGCTGCTGATCGTGATTATCGTCGGCGGCATTGTGCAGGGGATTTTCACCGCCATTGAAGCCTCCGCGATTGCCGTGGTGTATACATTATTGTTGACGATGGTGTTTTACCGCACGCTGAAAATTAAGGATTTGCCTTCGATTTTGCTCCAGACAGTGGTAATGACCGGGGTCATCATGTTCCTGCTGGCAACCTCTTCGGCGATGTCCTTCTCGATGTCGATCACCAATATTCCTGCGGCGCTGAGCGATATGATCCTCGGTATTTCCGCCAATAAACTGGTTATCCTGTTAGTCATTACCGTCTTTTTGTTGATTATCGGCGCATTTATGGATATCGGTCCGGCCATTCTGATTTTTACCCCGATTCTGCTGCCGATCATGGCTAAACTGGGCGTCGATCCGGTGCATTTTGGCATTATCATGATCTATAACCTGGCGATTGGCACCATTACGCCGCCAGTTGGCAGTGGTTTATATGTCGGGGCGAGCGTCGGTAAGGTCAAAGTTGAGGAAGTGATTAAACCGTTGCTGCCTTTTTACGGCGCGATTATCGGCGTTCTGTTATTAATTACCTACATTCCGGAAATCACACTGTTCTTACCCCGTCTACTGGGCATCATGTAA
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment