Commit ea85c66d authored by Amandine  PERRIN's avatar Amandine PERRIN
Browse files

change tab to space between rep name and info in Replicons directory

parent 647a117b
Pipeline #66654 passed with stages
in 5 minutes and 38 seconds
...@@ -1148,7 +1148,7 @@ def get_genome_contigs_and_rename(gembase_name, gpath, outfile, logger): ...@@ -1148,7 +1148,7 @@ def get_genome_contigs_and_rename(gembase_name, gpath, outfile, logger):
# - add its name with its original name to # - add its name with its original name to
# - write header ("<contig name> <size>") to replicon file # - write header ("<contig name> <size>") to replicon file
if prev_cont: if prev_cont:
cont = "\t".join([prev_cont, str(cont_size)]) + "\n" cont = " ".join([prev_cont, str(cont_size)]) + "\n"
prevcont_nohead = prev_cont.split(">")[1] prevcont_nohead = prev_cont.split(">")[1]
prev_orig_name_nohead = prev_orig_name.split(">")[1] prev_orig_name_nohead = prev_orig_name.split(">")[1]
if prev_orig_name_nohead: if prev_orig_name_nohead:
...@@ -1172,7 +1172,7 @@ def get_genome_contigs_and_rename(gembase_name, gpath, outfile, logger): ...@@ -1172,7 +1172,7 @@ def get_genome_contigs_and_rename(gembase_name, gpath, outfile, logger):
cont_size += len(line.strip()) cont_size += len(line.strip())
# Write last contig, if there is one (if gpath not empty) # Write last contig, if there is one (if gpath not empty)
if prev_cont: if prev_cont:
cont = "\t".join([prev_cont, str(cont_size)]) + "\n" cont = " ".join([prev_cont, str(cont_size)]) + "\n"
prevcont_nohead = "".join(prev_cont.split(">")[1:]) prevcont_nohead = "".join(prev_cont.split(">")[1:])
prev_orig_name_nohead = prev_orig_name.split(">")[1] prev_orig_name_nohead = prev_orig_name.split(">")[1]
if prev_orig_name_nohead: if prev_orig_name_nohead:
......
##gff-version 3 ##gff-version 3
# Sequence Data: seqnum=1;seqlen=3480;seqhdr="H561_S27 L001_R1_001_(paired)_contig_1" # Sequence Data: seqnum=1;seqlen=3480;seqhdr="H561_S27 L001_R1_001_(paired)_contig_1"
# Model Data: version=Prodigal.v2.6.3;run_type=Metagenomic;model="20|Escherichia_coli_UMN026|B|50.7|11|1";gc_cont=50.70;transl_table=11;uses_sd=1 # Model Data: version=Prodigal.v2.6.3;run_type=Metagenomic;model="20|Escherichia_coli_UMN026|B|50.7|11|1";gc_cont=50.70;transl_table=11;uses_sd=1
H561_S27 Prodigal_v2.6.3 CDS 3 140 31.2 - 0 ID=1_1;partial=10;start_type=ATG;rbs_motif=GGAG/GAGG;rbs_spacer=5-10bp;gc_cont=0.580;conf=99.92;score=31.21;cscore=19.39;sscore=11.82;rscore=11.19;uscore=-3.31;tscore=3.95; H561_S27 Prodigal_v2.6.3 CDS 3 140 31.2 - 0 ID=1_1;partial=10;start_type=ATG;rbs_motif=GGAG/GAGG;rbs_spacer=5-10bp;gc_cont=0.580;conf=99.92;score=31.21;cscore=19.39;sscore=11.82;rscore=11.19;uscore=-3.31;tscore=3.95;
......
>test_runprokka_H299.0001 3480 >test_runprokka_H299.0001 3480
AGCAGCACGCTTTTTAATCCGTCCACCGGACCTTCAACCGGCCCTTCGCTGATGGCATCG AGCAGCACGCTTTTTAATCCGTCCACCGGACCTTCAACCGGCCCTTCGCTGATGGCATCG
ATCACACTCAGCAGCTGCGTGGACTTCAGGTTGTCCTTCGCTTCGCGCGGGGTATGCCCC ATCACACTCAGCAGCTGCGTGGACTTCAGGTTGTCCTTCGCTTCGCGCGGGGTATGCCCC
TTACTGCTGCCTTTACCCATTCGTCATGCTCCATAAACGATAAAACCGCCCGGAGGCGGT TTACTGCTGCCTTTACCCATTCGTCATGCTCCATAAACGATAAAACCGCCCGGAGGCGGT
......
##gff-version 3 ##gff-version 3
##sequence-region test.0417.00002.0001 1 9603 ##sequence-region test.0417.00002.0001 1 9603
##sequence-region test.0417.00002.0002 1 22446 ##sequence-region test.0417.00002.0002 1 22446
##sequence-region test.0417.00002.0003 1 51012 ##sequence-region test.0417.00002.0003 1 51012
......
##gff-version 3 ##gff-version 3
##sequence-region test_runprokka_H299.0001 1 3480 ##sequence-region test_runprokka_H299.0001 1 3480
##sequence-region test_runprokka_H299.0002 1 7080 ##sequence-region test_runprokka_H299.0002 1 7080
##sequence-region test_runprokka_H299.0003 1 2583 ##sequence-region test_runprokka_H299.0003 1 2583
......
>test.0417.00002.0001 9603 >test.0417.00002.0001 9603
TCTCATACTACCCAATTTCTTAAAAGTGCAAATTTGTGAAGCTTATCCTGTTATTATTTT TCTCATACTACCCAATTTCTTAAAAGTGCAAATTTGTGAAGCTTATCCTGTTATTATTTT
AAGTTTCATGCCAAATTCTCTCACCAGATAATGCCGCCCTCTTCCGAAAAATAATCAAGA AAGTTTCATGCCAAATTCTCTCACCAGATAATGCCGCCCTCTTCCGAAAAATAATCAAGA
GGCCAAACAATATCTAAAATGATACAACTGTATCTATTCCCCTGAAAAATACATTATTCA GGCCAAACAATATCTAAAATGATACAACTGTATCTATTCCCCTGAAAAATACATTATTCA
......
>test_runprokka_H299.0001 3480 >test_runprokka_H299.0001 3480
AGCAGCACGCTTTTTAATCCGTCCACCGGACCTTCAACCGGCCCTTCGCTGATGGCATCG AGCAGCACGCTTTTTAATCCGTCCACCGGACCTTCAACCGGCCCTTCGCTGATGGCATCG
ATCACACTCAGCAGCTGCGTGGACTTCAGGTTGTCCTTCGCTTCGCGCGGGGTATGCCCC ATCACACTCAGCAGCTGCGTGGACTTCAGGTTGTCCTTCGCTTCGCGCGGGGTATGCCCC
TTACTGCTGCCTTTACCCATTCGTCATGCTCCATAAACGATAAAACCGCCCGGAGGCGGT TTACTGCTGCCTTTACCCATTCGTCATGCTCCATAAACGATAAAACCGCCCGGAGGCGGT
......
##gff-version 3 ##gff-version 3
##sequence-region test.0417.00002.0001 1 9603 ##sequence-region test.0417.00002.0001 1 9603
##sequence-region test.0417.00002.0002 1 22446 ##sequence-region test.0417.00002.0002 1 22446
##sequence-region test.0417.00002.0003 1 51012 ##sequence-region test.0417.00002.0003 1 51012
......
##gff-version 3 ##gff-version 3
##sequence-region test_runprokka_H299.0001 1 3480 ##sequence-region test_runprokka_H299.0001 1 3480
##sequence-region test_runprokka_H299.0002 1 7080 ##sequence-region test_runprokka_H299.0002 1 7080
##sequence-region test_runprokka_H299.0003 1 2583 ##sequence-region test_runprokka_H299.0003 1 2583
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment