Skip to content
Snippets Groups Projects
Commit 8bababd2 authored by Remi PLANEL's avatar Remi PLANEL
Browse files

Update the readme

parent e6d23812
No related branches found
No related tags found
1 merge request!4Multi seed size
Pipeline #24827 passed with stage
in 47 seconds
Hide whitespace changes
Inline Side-by-side
Showing
with 38 additions and 19 deletions
README.md
+ 38
− 19
View file @ 8bababd2
......@@ -46,10 +46,10 @@ for guide_rna in guide_rnas:
_output :_
```
{'target': 'TCATCACGGGCCTTCGCCACGCGCG', 'guide': 'TCATCACGGGCCTTCGCCAC', 'start': 82, 'stop': 102, 'pam': 80, 'ori': '-', 'pred': -0.4719254873780802}
{'target': 'CATCACGGGCCTTCGCCACGCGCGC', 'guide': 'CATCACGGGCCTTCGCCACG', 'start': 81, 'stop': 101, 'pam': 79, 'ori': '-', 'pred': 1.0491308060379676}
{'target': 'CGCGCGCGGCAAACAATCACAAACA', 'guide': 'CGCGCGCGGCAAACAATCAC', 'start': 63, 'stop': 83, 'pam': 61, 'ori': '-', 'pred': -0.9021152826078697}
{'target': 'CCTGATCGGTATTGAACAGCATCTG', 'guide': 'CCTGATCGGTATTGAACAGC', 'start': 29, 'stop': 49, 'pam': 27, 'ori': '-', 'pred': 0.23853258873311955}
{'target': 'TCATCACGGGCCTTCGCCACGCGCG', 'guide': 'TCATCACGGGCCTTCGCCAC', 'start': 82, 'stop': 102, 'pam': 80, 'ori': '-', 'target_id': 1, 'pred': -0.4719254873780802, 'off_targets_per_seed': []}
{'target': 'CATCACGGGCCTTCGCCACGCGCGC', 'guide': 'CATCACGGGCCTTCGCCACG', 'start': 81, 'stop': 101, 'pam': 79, 'ori': '-', 'target_id': 2, 'pred': 1.0491308060379676, 'off_targets_per_seed': []}
{'target': 'CGCGCGCGGCAAACAATCACAAACA', 'guide': 'CGCGCGCGGCAAACAATCAC', 'start': 63, 'stop': 83, 'pam': 61, 'ori': '-', 'target_id': 3, 'pred': -0.9021152826078697, 'off_targets_per_seed': []}
{'target': 'CCTGATCGGTATTGAACAGCATCTG', 'guide': 'CCTGATCGGTATTGAACAGC', 'start': 29, 'stop': 49, 'pam': 27, 'ori': '-', 'target_id': 4, 'pred': 0.23853258873311955, 'off_targets_per_seed': []}
```
### Command line interface
......@@ -82,7 +82,7 @@ $ crisprbact predict from-str --help
```
```
Usage: crisprbact predict from-str [OPTIONS] [OUTPUT_FILE]
Usage: cli.py predict from-str [OPTIONS] [OUTPUT_FILE]
Outputs candidate guide RNAs for the S. pyogenes dCas9 with predicted on-
target activity from a target gene.
......@@ -91,8 +91,15 @@ Usage: crisprbact predict from-str [OPTIONS] [OUTPUT_FILE]
"stdout"
Options:
-t, --target TEXT [required]
--help Show this message and exit.
-t, --target TEXT Sequence file to target [required]
-s, --off-target-sequence FILENAME
Sequence in which you want to find off-
targets
-w, --off-target-sequence-format [fasta|gb|genbank]
Sequence in which you want to find off-
targets format [default: genbank]
--help Show this message and exit.
```
```console
......@@ -124,7 +131,7 @@ $ crisprbact predict from-seq --help
```
```
Usage: crisprbact predict from-seq [OPTIONS] [OUTPUT_FILE]
Usage: cli.py predict from-seq [OPTIONS] [OUTPUT_FILE]
Outputs candidate guide RNAs for the S. pyogenes dCas9 with predicted on-
target activity from a target gene.
......@@ -133,9 +140,16 @@ Usage: crisprbact predict from-seq [OPTIONS] [OUTPUT_FILE]
"stdout"
Options:
-t, --target FILENAME Sequence file [required]
-f, --seq-format [fasta|fa|gb|genbank]
Sequence file format [default: fasta]
-t, --target FILENAME Sequence file to target [required]
-f, --seq-format [fasta|gb|genbank]
Sequence file to target format [default:
fasta]
-s, --off-target-sequence FILENAME
Sequence in which you want to find off-
targets
-w, --off-target-sequence-format [fasta|gb|genbank]
Sequence in which you want to find off-
targets format [default: genbank]
--help Show this message and exit.
```
......@@ -151,17 +165,22 @@ $ crisprbact predict from-seq -t /tmp/seq.fasta guide-rnas.tsv
$ crisprbact predict from-seq -t /tmp/seq.gb -f gb guide-rnas.tsv
```
- Off-targets
```console
predict from-seq -t data-test/sequence.fasta -s data-test/sequence.gb guide-rnas.tsv
```
##### Output file
```
target PAM position prediction input_id
ATTTGTTGGCAACCCAGCCAGCCTT 855 -0.7310112260341689 CP027060.1
CACGTCCGGCAATATTTCCGCGAAC 830 0.14773859036983505 CP027060.1
TCCGAGCGGCAACGTCTCTGATAAC 799 -0.4922487382950619 CP027060.1
GCTTAAAGGGCAAAATGTCACGCCT 769 -1.814666749464254 CP027060.1
CTTAAAGGGCAAAATGTCACGCCTT 768 -0.4285147731290152 CP027060.1
CGTTTGAGGAGATCCACAAAATTAT 732 -1.2437430146548256 CP027060.1
CATGAATGGTATAAACCGGCGTGCC 680 -0.8043242669169294 CP027060.1
target_id target PAM position prediction target_seq_id seed_size off_target_recid off_target_start off_target_end off_target_pampos off_target_strand off_target_feat_type off_target_feat_start off_target_feat_end off_target_feat_strand off_target_locus_tag off_target_gene off_target_note off_target_product off_target_protein_id
1 TGATCCAGGCATTTTTTAGCTTCAT 835 0.47949500169043713 NC_017634.1:2547433-2548329 8 NC_017634.1 1388198 1388209 1388209 +
1 TGATCCAGGCATTTTTTAGCTTCAT 835 0.47949500169043713 NC_017634.1:2547433-2548329 8 NC_017634.1 2244514 2244525 2244525 + CDS 2243562 2244720 -1 NRG857_10810 COG1174 ABC-type proline/glycine betaine transport systems, permease component putative transport system permease YP_006120510.1
1 TGATCCAGGCATTTTTTAGCTTCAT 835 0.47949500169043713 NC_017634.1:2547433-2548329 8 NC_017634.1 4160984 4160995 4160995 + CDS 4160074 4161406 -1 NRG857_19625 hslU COG1220 ATP-dependent protease HslVU (ClpYQ), ATPase subunit ATP-dependent protease ATP-binding subunit HslU YP_006122267.1
1 TGATCCAGGCATTTTTTAGCTTCAT 835 0.47949500169043713 NC_017634.1:2547433-2548329 8 NC_017634.1 4534189 4534200 4534200 +
1 TGATCCAGGCATTTTTTAGCTTCAT 835 0.47949500169043713 NC_017634.1:2547433-2548329 8 NC_017634.1 548804 548815 548804 -
1 TGATCCAGGCATTTTTTAGCTTCAT 835 0.47949500169043713 NC_017634.1:2547433-2548329 8 NC_017634.1 786462 786473 786462 - CDS 785384 786470 1 NRG857_03580 COG2055 Malate/L-lactate dehydrogenases hypothetical protein YP_006119079.1
```
......
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment