Merge branch 'dev' into 'master'

PyPI publish package

See merge request !2

.gitignore

+.vscode
+*.code-workspace
+*.pyc
+dist
+*.egg-info
+__pycache__

.gitlab-ci.yml

+image: python:3.7
+
+stages:
+  - lint
+  - test
+  - deploy
+
+before_script:
+  - pip install poetry
+  - poetry install -v
+
+lint:
+  before_script:
+    - pip install flake8
+  script:
+    - flake8 --max-line-length=88 crisprbact
+
+test:
+  stage: test
+  script:
+    - poetry run pytest
+
+deploy:
+  stage: deploy
+  script:
+    - poetry config http-basic.pypi $PYPI_USERNAME $PYPI_PWD
+    - poetry build -v
+    - poetry publish
+
+  rules:
+    - if: '$CI_COMMIT_TAG =~ /^\d+\.\d+\.\d+$/'

.pre-commit-config.yaml

+# See https://pre-commit.com for more information
+# See https://pre-commit.com/hooks.html for more hooks
+repos:
+  - repo: https://github.com/pre-commit/pre-commit-hooks
+    rev: v2.4.0
+    hooks:
+      - id: trailing-whitespace
+      - id: end-of-file-fixer
+      - id: check-yaml
+      - id: check-added-large-files
+  - repo: https://github.com/ambv/black
+    rev: stable
+    hooks:
+      - id: black
+        exclude: .hooks
+        language_version: python3.7
+  - repo: https://github.com/pre-commit/pre-commit-hooks
+    rev: v2.4.0
+    hooks:
+      - id: flake8
+        args: [--max-line-length=89]

README.md

 # CRISPRbact
 
-Tools to design and analyse CRISPRi experiments
\ No newline at end of file
+**Tools to design and analyse CRISPRi experiments in bacteria.**
+
+CRISPRbact currently contains an on-target activity prediction tool for the Streptococcus pyogenes dCas9 protein.
+This tool takes as an input the sequence of a gene of interest and returns a list of possible target sequences with the predicted on-target activity. Predictions are made using a linear model fitted on data from a genome-wide CRISPRi screen performed in E. coli (Cui et al. Nature Communications, 2018). The model predicts the ability of dCas9 to block the RNA polymerase when targeting the non-template strand (i.e. the coding strand) of a target gene.
+
+## Getting Started
+
+### Installation
+
+For the moment, you can install this package only via PyPI
+
+#### PyPI
+
+```console
+$ pip install crisprbact
+$ crisprbact --help
+```
+
+```
+Usage: crisprbact [OPTIONS] COMMAND [ARGS]...
+
+Options:
+  -v, --verbose
+  --help         Show this message and exit.
+
+Commands:
+  predict
+```
+
+### API
+
+Using this library in your python code.
+
+```python
+from crisprbact import on_target_predict
+
+guide_rnas = on_target_predict("ACCACTGGCGTGCGCGTTACTCATCAGATGCTGTTCAATACCGATCAGGTTATCGAAGTGTTTGTGATTGTTTGCCGCGCGCGTGGCGAAGGCCCGTGATGAAGGAAAAGTTTTGCGCTATGTTGGCAATATTGATGAAG")
+
+for guide_rna in guide_rnas:
+    print(guide_rna)
+
+```
+
+_output :_
+
+```
+{'target': 'TCATCACGGGCCTTCGCCACGCGCG', 'guide': 'TCATCACGGGCCTTCGCCAC', 'start': 82, 'stop': 102, 'pam': 80, 'ori': '-', 'pred': -0.4719254873780802}
+{'target': 'CATCACGGGCCTTCGCCACGCGCGC', 'guide': 'CATCACGGGCCTTCGCCACG', 'start': 81, 'stop': 101, 'pam': 79, 'ori': '-', 'pred': 1.0491308060379676}
+{'target': 'CGCGCGCGGCAAACAATCACAAACA', 'guide': 'CGCGCGCGGCAAACAATCAC', 'start': 63, 'stop': 83, 'pam': 61, 'ori': '-', 'pred': -0.9021152826078697}
+{'target': 'CCTGATCGGTATTGAACAGCATCTG', 'guide': 'CCTGATCGGTATTGAACAGC', 'start': 29, 'stop': 49, 'pam': 27, 'ori': '-', 'pred': 0.23853258873311955}
+```
+
+### Command line interface
+
+#### Predict guide RNAs activity
+
+Input the sequence of a target gene and this script will output candidate guide RNAs for the S. pyogenes dCas9 with predicted on-target activity.
+
+```console
+$ crisprbact predict --help
+```
+
+```
+Usage: crisprbact predict [OPTIONS] COMMAND [ARGS]...
+
+Options:
+  --help  Show this message and exit.
+
+Commands:
+  from-seq  Outputs candidate guide RNAs for the S.
+  from-str  Outputs candidate guide RNAs for the S.
+```
+
+##### From a string sequence:
+
+The target input sequence can be a simple string.
+
+```console
+$ crisprbact predict from-str --help
+```
+
+```
+Usage: crisprbact predict from-str [OPTIONS] [OUTPUT_FILE]
+
+  Outputs candidate guide RNAs for the S. pyogenes dCas9 with predicted on-
+  target activity from a target gene.
+
+  [OUTPUT_FILE] file where the candidate guide RNAs are saved. Default =
+  "stdout"
+
+Options:
+  -t, --target TEXT  [required]
+  --help             Show this message and exit.
+```
+
+```console
+$ crisprbact predict from-str -t ACCACTGGCGTGCGCGTTACTCATCAGATGCTGTTCAATACCGATCAGGTTATCGAAGTGTTTGTGATTGTTTGCCGCGCGCGTGGCGAAGGCCCGTGATGAAGGAAAAGTTTTGCGCTATGTTGGCAATATTGATGAAG guide-rnas.tsv
+```
+
+output file `guide-rnas.tsv` :
+
+No `seq_id` is defined since it is from a simple string.
+
+```
+target	PAM position	prediction	seq_id
+TCATCACGGGCCTTCGCCACGCGCG	80	-0.4719254873780802	N/A
+CATCACGGGCCTTCGCCACGCGCGC	79	1.0491308060379676	N/A
+CGCGCGCGGCAAACAATCACAAACA	61	-0.9021152826078697	N/A
+CCTGATCGGTATTGAACAGCATCTG	27	0.23853258873311955	N/A
+```
+
+You can also pipe the results :
+
+```console
+$ crisprbact predict from-str -t ACCACTGGCGTGCGCGTTACTCATCAGATGCTGTTCAATACCGATCAGGTTATCGAAGTGTTTGTGATTGTTTGCCGCGCGCGTGGCGAAGGCCCGTGATGAAGGAAAAGTTTTGCGCTATGTTGGCAATATTGATGAAG | tail -n +2 | wc -l
+```
+
+##### From a sequence file
+
+```console
+$ crisprbact predict from-seq --help
+```
+
+```
+Usage: crisprbact predict from-seq [OPTIONS] [OUTPUT_FILE]
+
+  Outputs candidate guide RNAs for the S. pyogenes dCas9 with predicted on-
+  target activity from a target gene.
+
+  [OUTPUT_FILE] file where the candidate guide RNAs are saved. Default =
+  "stdout"
+
+Options:
+  -t, --target FILENAME           Sequence file  [required]
+  -f, --seq-format [fasta|fa|gb|genbank]
+                                  Sequence file format  [default: fasta]
+  --help                          Show this message and exit.
+```
+
+- Fasta file (could be a multifasta file)
+
+```console
+$ crisprbact predict from-seq -t /tmp/seq.fasta guide-rnas.tsv
+```
+
+- GenBank file
+
+```console
+$ crisprbact predict from-seq -t /tmp/seq.gb -f gb guide-rnas.tsv
+```
+
+##### Output file
+
+```
+target	PAM position	prediction	input_id
+ATTTGTTGGCAACCCAGCCAGCCTT	855	-0.7310112260341689	CP027060.1
+CACGTCCGGCAATATTTCCGCGAAC	830	0.14773859036983505	CP027060.1
+TCCGAGCGGCAACGTCTCTGATAAC	799	-0.4922487382950619	CP027060.1
+GCTTAAAGGGCAAAATGTCACGCCT	769	-1.814666749464254	CP027060.1
+CTTAAAGGGCAAAATGTCACGCCTT	768	-0.4285147731290152	CP027060.1
+CGTTTGAGGAGATCCACAAAATTAT	732	-1.2437430146548256	CP027060.1
+CATGAATGGTATAAACCGGCGTGCC	680	-0.8043242669169294	CP027060.1
+
+```
+
+## Contributing
+
+### Clone repo
+
+```console
+$ git clone https://gitlab.pasteur.fr/dbikard/crisprbact.git
+```
+
+### Create a virtualenv
+
+```console
+$ virtualenv -p python3.7 .venv
+$ . .venv/bin/activate
+$ pip install poetry
+```
+
+### Install crisprbact dependencies
+
+```console
+$ poetry install
+```
+
+### Install hooks
+
+In order to run flake8 and black for each commit.
+
+```console
+$ pre-commit install
+```

crisprbact/__init__.py

+from .predict import on_target_predict
+
+__all__ = ["on_target_predict"]

crisprbact/cli.py

+from crisprbact import on_target_predict
+from Bio import SeqIO
+import click
+
+
+class Config(object):
+    def __init__(self):
+        self.verbose = False
+
+
+pass_config = click.make_pass_decorator(Config, ensure=True)
+
+HEADER = ["target", "PAM position", "prediction", "seq_id"]
+
+
+@click.group()
+@click.option("-v", "--verbose", is_flag=True)
+@pass_config
+def main(config, verbose):
+    config.verbose = verbose
+
+
+@main.group()
+@pass_config
+def predict(config):
+    pass
+
+
+@predict.command()
+@click.option("-t", "--target", type=str, required=True)
+@click.argument("output-file", type=click.File("w"), default="-")
+@pass_config
+def from_str(config, target, output_file):
+    """
+    Outputs candidate guide RNAs for the S. pyogenes dCas9 with predicted on-target
+    activity from a target gene.
+
+    [OUTPUT_FILE] file where the candidate guide RNAs are saved. Default = "stdout"
+
+    """
+    if config.verbose:
+        print_parameters(target)
+
+    guide_rnas = on_target_predict(target)
+    click.echo("\t".join(HEADER), file=output_file)
+    write_guide_rnas(guide_rnas, output_file)
+
+
+@predict.command()
+@click.option(
+    "-t", "--target", type=click.File("rU"), required=True, help="Sequence file"
+)
+@click.option(
+    "-f",
+    "--seq-format",
+    type=click.Choice(["fasta", "fa", "gb", "genbank"]),
+    help="Sequence file format",
+    default="fasta",
+    show_default=True,
+)
+@click.argument("output-file", type=click.File("w"), default="-")
+@pass_config
+def from_seq(config, target, seq_format, output_file):
+    """
+    Outputs candidate guide RNAs for the S. pyogenes dCas9 with predicted on-target
+    activity from a target gene.
+
+    [OUTPUT_FILE] file where the candidate guide RNAs are saved. Default = "stdout"
+
+    """
+    fg = "blue"
+    if config.verbose:
+        print_parameters(target.name, fg)
+    click.echo("\t".join(HEADER), file=output_file)
+    for record in SeqIO.parse(target, seq_format):
+        if config.verbose:
+            click.secho(" - search guide RNAs for %s " % record.id, fg=fg)
+        guide_rnas = on_target_predict(str(record.seq))
+        write_guide_rnas(guide_rnas, output_file, record.id)
+
+
+def print_parameters(target, fg="blue"):
+    click.secho("[Verbose mode]", fg=fg)
+    click.secho("Target sequence : %s" % target, fg=fg)
+
+
+def write_guide_rnas(guide_rnas, output_file, seq_id="N/A"):
+
+    for guide_rna in guide_rnas:
+        # click.echo(guide_rna)
+        click.echo(
+            "\t".join(
+                [
+                    guide_rna["target"],
+                    str(guide_rna["pam"]),
+                    str(guide_rna["pred"]),
+                    seq_id,
+                ]
+            ),
+            file=output_file,
+        )
+
+
+if __name__ == "__main__":
+    main()

model/predict.py → crisprbact/predict.py

 import numpy as np
-import gffpandas.gffpandas as gffpd
-from typing import Tuple
 import re
+from importlib.resources import open_binary
 
-with open("on_target/model/reg_coef.pkl", "br") as handle:
+with open_binary("crisprbact", "reg_coef.pkl") as handle:
     coef = np.load(handle, allow_pickle=True)
 
 bases = ["A", "T", "G", "C"]
 
 
 def encode(seq):
-    '''One-hot encoding of a sequence (only non-ambiguous bases (ATGC) accepted)'''
+    """One-hot encoding of a sequence (only non-ambiguous bases (ATGC) accepted)"""
+
     return np.array([[int(b == p) for b in seq] for p in bases])
 
 
@@ -28,7 +28,7 @@ def find_targets(seq):
     repam = "[ATGC]GG"
     L = len(seq)
     seq_revcomp = rev_comp(seq)
-    alltargets = [
+    return (
         dict(
             [
                 ("target", m.group(1)),
@@ -40,17 +40,19 @@ def find_targets(seq):
             ]
         )
         for m in re.finditer("(?=([ATGC]{6}" + repam + "[ATGC]{16}))", seq_revcomp)
-    ]
-    return alltargets
+    )
 
 
 def on_target_predict(seq):
+
     seq = seq.upper()  # make uppercase
     seq = re.sub(r"\s", "", seq)  # removes white space
-    alltargets = find_targets(seq)
+    alltargets = list(find_targets(seq))
     if alltargets:
         X = np.array(
-            [encode(tar["target"][:7] + tar["target"][9:]) for tar in alltargets] #encore and remove GG of PAM
+            [
+                encode(tar["target"][:7] + tar["target"][9:]) for tar in alltargets
+            ]  # encode and remove GG of PAM
         )
         X = X.reshape(X.shape[0], -1)
         preds = predict(X)

pyproject.toml

+[tool.poetry]
+name = "crisprbact"
+version = "0.1.0"
+license = "GPL-3.0"
+description = "Tools to design and analyse CRISPRi experiments"
+authors = ["David Bikard <david.bikard@pasteur.fr>", "Remi Planel <rplanel@pasteur.fr>"]
+keywords = ["CRISPR", "genomics", "bacteria", "CRISPRi", "screen"]
+homepage = "https://gitlab.pasteur.fr/dbikard/crisprbact"
+classifiers = [
+    "Environment :: Console",
+    "Operating System :: POSIX :: Linux",
+    "Intended Audience :: Science/Research",
+    "Programming Language :: Python :: 3",
+    "Topic :: Scientific/Engineering :: Bio-Informatics",
+    "Natural Language :: English",
+    "License :: OSI Approved :: GNU General Public License v3 (GPLv3)"
+]
+readme = "README.md"
+
+[tool.poetry.dependencies]
+python = "^3.7"
+numpy = "^1.17"
+click = "^7.0"
+biopython = "^1.75"
+
+[tool.poetry.dev-dependencies]
+pytest = "^5.2"
+flake8 = "^3.7"
+pre-commit = "^1.20.0"
+black = "^19.10b0"
+
+[tool.poetry.scripts]
+crisprbact= "crisprbact.cli:main"
+
+[build-system]
+requires = ["poetry>=0.12"]
+build-backend = "poetry.masonry.api"
+
+[tool.black]
+target-version = ['py37']
+include = '\.pyi?$'
+exclude = '''
+
+(
+  /(
+      \.eggs         # exclude a few common directories in the
+    | \.git          # root of the project
+    | \.hg
+    | \.mypy_cache
+    | \.tox
+    | \.venv
+    | \.hooks
+    | _build
+    | buck-out
+    | build
+    | dist
+  )/
+  | foo.py           # also separately exclude a file named foo.py in
+                     # the root of the project
+)
+'''
+
+[flake8]
+max-line-length = 89
+max-complexity = 18

tests/predict_test.py

-import pytest
-from on_target.model.predict import on_target_predict
+import crisprbact
 
 
 def test_on_target_predict_empty():
     # Empty sequence
-    predicted_target = on_target_predict("")
+    predicted_target = crisprbact.on_target_predict("")
     assert len(predicted_target) == 0, "the list is non empty"
 
 
 def test_on_target_predict_size_guide():
     size_guide = 20
-    predicted_targets = on_target_predict(
-        "TGCCTGTTTACGCGCCGATTGTTGCGAGATTTGGACGGACGTTGACGGGGTCTATACCTGCGACCCGCGTCAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTACCAGGAAGCGATGGAGCTTTCCTACTTCGGCG"
+    predicted_targets = crisprbact.on_target_predict(
+        """ TGCCTGTTTACGCGCCGATTGTTGCG
+        AGATTTGGACGGACGTTGACGGGG
+        TCTATACCTGCGACCCGCGTCAGG
+        TGCCCGATGCGAGGTTGTTGAAGT
+        CGATGTCCTACCAGGAAGCGATGG
+        AGCTTTCCTACTTCGGCG"""
     )
     guides = (predicted_target["guide"] for predicted_target in predicted_targets)
     for guide in guides:
@@ -27,4 +31,3 @@ def test_on_target_predict_size_guide():
         assert (
             start_val - pam_val == 2
         ), "the difference between start and pam position is different than 2"
-