Skip to content
Snippets Groups Projects
Unverified Commit 1f2f3aea authored by Bertrand  NÉRON's avatar Bertrand NÉRON
Browse files

Merge branch 'master' of...

parents ea36cda5 46c497e2
Branches
No related tags found
No related merge requests found
Pipeline #57945 passed
...@@ -13,29 +13,35 @@ Exercises ...@@ -13,29 +13,35 @@ Exercises
Exercise Exercise
-------- --------
Write a function which take the path of file as parameter Write a function that takes the path of file as parameter
and display it's content on the screen. and displays it's content on the screen.
We wait same behavior as the shell *cat* command. :: We expect the same behavior as the shell ``cat`` command.
::
import sys import sys
import os import os
def cat(path): def cat(path):
if not os.path.exists(path): if not os.path.exists(path):
sys.exit("no such file: {0}".format(path) # Exit Python with a non-zero value
# to signify a failure
sys.exit("no such file: {0}".format(path))
with open(path, 'r') as infile: with open(path, 'r') as infile:
for line in infile: for line in infile:
print line # By default, print adds a "\n" to what it prints
# lines from a file already end with "\n".
print(line, end="")
Exercise Exercise
-------- --------
Write a function which take the path of a file in rebase format Write a function that takes the path of a file in rebase format
and return in a dictionary the collection of the enzyme contains in the file. and returns in a dictionary the collection of the enzyme contained in the file.
The sequence of the binding site must be cleaned up. The sequence of the binding site must be cleaned up.
use the file :download:`rebase_light.txt <_static/data/rebase_light.txt>` to test your code. Use the file :download:`rebase_light.txt <_static/data/rebase_light.txt>` to test your code.
.. literalinclude:: _static/code/rebase.py .. literalinclude:: _static/code/rebase.py
:linenos: :linenos:
...@@ -46,11 +52,11 @@ use the file :download:`rebase_light.txt <_static/data/rebase_light.txt>` to tes ...@@ -46,11 +52,11 @@ use the file :download:`rebase_light.txt <_static/data/rebase_light.txt>` to tes
Exercise Exercise
-------- --------
write a function which take the path of a fasta file (containing only one sequence) Write a function that takes the path of a fasta file
and return a data structure of your choice that allow to stock and returns a data structure of your choice that allows to store
the id of the sequence and the sequence itself. the id of the sequence and the sequence itself.
use the file :download:`seq.fasta <_static/data/seq.fasta>` to test your code. Use the file :download:`seq.fasta <_static/data/seq.fasta>` to test your code.
.. literalinclude:: _static/code/fasta_reader.py .. literalinclude:: _static/code/fasta_reader.py
:linenos: :linenos:
...@@ -81,7 +87,7 @@ Write sequences with 80 aa/line ...@@ -81,7 +87,7 @@ Write sequences with 80 aa/line
Exercise Exercise
-------- --------
we ran a blast with the folowing command *blastall -p blastp -d uniprot_sprot -i query_seq.fasta -e 1e-05 -m 8 -o blast2.txt* We ran a blast with the following command *blastall -p blastp -d uniprot_sprot -i query_seq.fasta -e 1e-05 -m 8 -o blast2.txt*
-m 8 is the tabular output. So each fields is separate to the following by a '\t' -m 8 is the tabular output. So each fields is separate to the following by a '\t'
...@@ -114,7 +120,7 @@ Hint: ...@@ -114,7 +120,7 @@ Hint:
^^^^^ ^^^^^
Use the module csv in python https://docs.python.org/3/library/csv.html#module-csv Use the module csv in python https://docs.python.org/3/library/csv.html#module-csv
use a reader like below :: Use a reader, as follows::
>>> reader = csv.reader(input, quotechar='"') >>> reader = csv.reader(input, quotechar='"')
...@@ -134,6 +140,7 @@ use the file :download:`abcd.fasta <_static/data/abcd.fasta>` to test your code. ...@@ -134,6 +140,7 @@ use the file :download:`abcd.fasta <_static/data/abcd.fasta>` to test your code.
solution 1 solution 1
^^^^^^^^^^ ^^^^^^^^^^
.. literalinclude:: _static/code/multiple_fasta_reader.py .. literalinclude:: _static/code/multiple_fasta_reader.py
:linenos: :linenos:
:language: python :language: python
...@@ -142,6 +149,7 @@ solution 1 ...@@ -142,6 +149,7 @@ solution 1
solution 2 solution 2
^^^^^^^^^^ ^^^^^^^^^^
.. literalinclude:: _static/code/multiple_fasta_reader2.py .. literalinclude:: _static/code/multiple_fasta_reader2.py
:linenos: :linenos:
:language: python :language: python
...@@ -150,6 +158,7 @@ solution 2 ...@@ -150,6 +158,7 @@ solution 2
solution 3 solution 3
^^^^^^^^^^ ^^^^^^^^^^
.. literalinclude:: _static/code/fasta_iterator.py .. literalinclude:: _static/code/fasta_iterator.py
:linenos: :linenos:
:language: python :language: python
...@@ -162,19 +171,19 @@ if the file is huge (>G0) it can be a problem. ...@@ -162,19 +171,19 @@ if the file is huge (>G0) it can be a problem.
The third version allow to red sequences one by one. The third version allow to red sequences one by one.
To do that we have to open the file outside the reader function To do that we have to open the file outside the reader function
The fasta format is very convenient for human but not for parser. The fasta format is very convenient for human but not for parser.
The end of a sequence is indicated by the end of file or the begining of a new one. The end of a sequence is indicated by the end of file or the beginning of a new one.
So with this version we have play with the cursor to place the cursor backward So with this version we have play with the cursor to place the cursor backward
when we encouter a new sequence. then the cursor is placed at the right place when we encounter a new sequence. Then the cursor is placed at the right place
for the next sequence. for the next sequence.
The third version is an iterator and use generator. The third version is an iterator and use generator.
generators are functions which keep a state between to calls. Generators are functions which keep a state between to calls.
generators does not use return to return a value but the keyword yield. Generators do not use return to return a value but the keyword yield.
Thus this implementation retrun sequence by sequence without to play with the cursor. Thus this implementation return sequence by sequence without to play with the cursor.
You can call this function and put in in a loop or call next. You can call this function and put in in a loop or call next.
Work with the sequence and pass to the next sequence on so on. Work with the sequence and pass to the next sequence on so on.
for instance which is a very convenient way to use it: :: For instance which is a very convenient way to use it::
for seq in fasta_iter('my_fast_file.fasta'): for seq in fasta_iter('my_fast_file.fasta'):
print seq print seq
......
...@@ -116,6 +116,9 @@ A tutorial is available https://biopython.org/wiki/SeqIO :: ...@@ -116,6 +116,9 @@ A tutorial is available https://biopython.org/wiki/SeqIO ::
print("sequence =", sv40_rcd.seq) print("sequence =", sv40_rcd.seq)
Other example of usage of ``SeqIO``: :download:`seq_io.py <_static/code/seq_io.py>`
Exercise Exercise
-------- --------
...@@ -228,4 +231,4 @@ What is the benefit to use oop style instead of procedural style? ...@@ -228,4 +231,4 @@ What is the benefit to use oop style instead of procedural style?
:linenos: :linenos:
:language: python :language: python
:download:`fasta_object.py <_static/code/fasta_object.py>` . :download:`fasta_object.py <_static/code/fasta_object.py>` .
\ No newline at end of file
#!/usr/bin/env python3
def rebase_parser(rebase_file): def rebase_parser(rebase_file):
""" """
:param rebase_file: the rebase file to parse :param rebase_file: the rebase file to parse
:type rebase_file: file object :type rebase_file: file object
:return: at each call return a tuple (str enz name, str binding site) :return: at each call yields a tuple (str enz name, str binding site)
:rtype: iterator :rtype: iterator
""" """
def clean_seq(seq): def clean_seq(seq):
...@@ -15,25 +16,38 @@ def rebase_parser(rebase_file): ...@@ -15,25 +16,38 @@ def rebase_parser(rebase_file):
if char in 'ACGT': if char in 'ACGT':
clean_seq += char clean_seq += char
return clean_seq return clean_seq
for line in rebase_file: for line in rebase_file:
fields = line.split() fields = line.split()
#fields = fields.split()
name = fields[0] name = fields[0]
seq = clean_seq(fields[2]) seq = clean_seq(fields[2])
yield (name, seq) yield (name, seq)
def rebase2dict(rebase_path):
"""
:param rebase_path: the path to rebase file to parse
:type rebase_path: str
:return: a dict with items (str enz name, str binding site)
"""
with open(rebase_path, 'r') as rebase_input:
# enz_dict = {}
# for (name, seq) in rebase_parser(rebase_input):
# enz_dict[name] = seq
enz_dict = dict(rebase_parser(rebase_input))
return enz_dict
if __name__ == '__main__': if __name__ == '__main__':
import sys import sys
import os.path import os.path
if len(sys.argv) != 2: if len(sys.argv) != 2:
sys.exit("usage multiple_fasta fasta_path") sys.exit("Usage: rebase.py rebase_file")
rebase_path = sys.argv[1] rebase_path = sys.argv[1]
if not os.path.exists(rebase_path): if not os.path.exists(rebase_path):
sys.exit("No such file: {}".format(rebase_path)) sys.exit("No such file: {}".format(rebase_path))
with open(rebase_path, 'r') as rebase_input: enz_dict = rebase2dict(rebase_path)
for enz in rebase_parser(rebase_input): print(enz_dict)
print enz
\ No newline at end of file
#!/usr/bin/env python3
"""Example of use of SeqIO from biopython
Here, we parse a fasta file, put the records in a list, search for a motif in
the sequence of the first record, and create a subsequence around this motif.
"""
from Bio import SeqIO
records = list(SeqIO.parse(fasta_filename, "fasta"))
records
# [SeqRecord(seq=Seq('GCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGCCATGGGGCGGAGAATGG...GCG', SingleLetterAlphabet()), id='gi|965480|gb|J02400.1|SV4CG', name='gi|965480|gb|J02400.1|SV4CG', description='gi|965480|gb|J02400.1|SV4CG Simian virus 40 complete genome', dbxrefs=[])]
sequence = records[0].seq
sequence
# Seq('GCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGCCATGGGGCGGAGAATGG...GCG', SingleLetterAlphabet())
motif = "TAAAT"
sequence.find(motif)
# 15
motif_pos = sequence.find(motif)
subseq_start = motif_pos - 10
subseq_end = motif_pos + len(motif) + 11
subseq = sequence[subseq_start:subseq_end]
subseq
# Seq('GGCCTCTGCATAAATAAAAAAAATTA', SingleLetterAlphabet())
genetic_code = { 'ttt': 'F', 'tct': 'S', 'tat': 'Y', 'tgt': 'C', genetic_code = { 'ttt': 'F', 'tct': 'S', 'tat': 'Y', 'tgt': 'C',
'ttc': 'F', 'tcc': 'S', 'tac': 'Y', 'tgc': 'C', 'ttc': 'F', 'tcc': 'S', 'tac': 'Y', 'tgc': 'C',
'tta': 'L', 'tca': 'S', 'taa': '*', 'tga': '*', 'tta': 'L', 'tca': 'S', 'taa': '*', 'tga': '*',
'ttg': 'L', 'tcg': 'S', 'tag': '*', 'tgg': 'W', 'ttg': 'L', 'tcg': 'S', 'tag': '*', 'tgg': 'W',
...@@ -23,7 +23,11 @@ def translate(nuc_seq, code): ...@@ -23,7 +23,11 @@ def translate(nuc_seq, code):
# to avoid to compute len(seq)/3 at each loop # to avoid to compute len(seq)/3 at each loop
# I compute it once and use a reference # I compute it once and use a reference
# it could be expensive if the sequence is very long. # it could be expensive if the sequence is very long.
cycle = len(nuc_seq)/3
# another way to determine the end of looping
# stop_iteration = len(nuc_seq)
# while (start + 2) < stop_iteration:
cycle = len(nuc_seq)//3
while n < cycle: while n < cycle:
start = n * 3 start = n * 3
end = start + 3 end = start + 3
...@@ -34,23 +38,18 @@ def translate(nuc_seq, code): ...@@ -34,23 +38,18 @@ def translate(nuc_seq, code):
else: else:
raise RuntimeError("unknow codon: " + codon) raise RuntimeError("unknow codon: " + codon)
n += 1 n += 1
# if use the other looping solution
# n += 3
return prot_seq return prot_seq
def translate2(nuc_seq, code, phase = 1): def translate2(nuc_seq, code, phase = 1):
prot_seq = '' prot_seq = ''
if 0 < phase < 4 : if 0 < phase < 4 :
start = phase - 1 start = phase - 1
nuc_seq = nuc_seq[start:]
elif -4 < phase < 0: elif -4 < phase < 0:
start = -phase - 1 start = -phase - 1
nuc_seq = nuc_seq[::-1] nuc_seq = nuc_seq[::-1]
# an other way to determine the end of looping nuc_seq = nuc_seq[start:]
stop_iteration = len(nuc_seq) prot_seq = translate(nuc_seq, code)
while (start + 2) < stop_iteration:
end = start + 3
codon = nuc_seq[start:end].lower()
if codon in code:
prot_seq += code[codon]
else:
raise RuntimeError("unknow codon")
start += 3
return prot_seq return prot_seq
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Please register or to comment