Skip to content
Snippets Groups Projects
Commit 4b29b15e authored by Bertrand  NÉRON's avatar Bertrand NÉRON
Browse files

fix typo to make sphinx happy

parent 1a5b5e73
No related branches found
No related tags found
No related merge requests found
...@@ -110,6 +110,7 @@ Then create the following two DNA fragments:: ...@@ -110,6 +110,7 @@ Then create the following two DNA fragments::
aattccatttactggccagggtaagagttttggtaaatatatagtgatatctggcttg""" aattccatttactggccagggtaagagttttggtaaatatatagtgatatctggcttg"""
* In a file <my_file.py> * In a file <my_file.py>
#. Create a function *one_line_dna* that transforms a multi-line sequence into a single-line DNA sequence. #. Create a function *one_line_dna* that transforms a multi-line sequence into a single-line DNA sequence.
#. Create a collection containing all enzymes #. Create a collection containing all enzymes
#. Create a function that takes two parameters: #. Create a function that takes two parameters:
......
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Please register or to comment