Commit 561097d6 authored by Blaise Li's avatar Blaise Li
Browse files

Minor language and format updates.

parent 9f15a02a
Pipeline #58073 passed with stages
in 13 seconds
......@@ -277,25 +277,26 @@ We will see how to determine all occurrences of restriction sites when we learn
We want to perform a PCR on sv40, can you give the length and the sequence of the amplicon?
We want to perform a PCR on sv40. Can you give the length and the sequence of the amplicon?
Write a function which have 3 parameters ``sequence``, ``primer_1`` and ``primer_2``
Write a function which has 3 parameters ``sequence``, ``primer_1`` and ``primer_2`` and returns the amplicon length.
* *We consider only the cases where primer_1 and primer_2 are present in sequence*
* *to simplify the exercise, the 2 primers can be read directly on the sv40 sequence.*
* *We consider only the cases where primer_1 and primer_2 are present in the sequence.*
* *To simplify the exercise, the 2 primers can be read directly in the sv40 sequence (i.e. no need to reverse-complement).*
test you algorithm with the following primers
Test you algorithm with the following primers:
Write the pseudocode before to implement it.
Write the function in pseudocode before implementing it.
| *function amplicon_len(sequence primer_1, primer_2)*
| *pos_1 <- find position of primer_1 in sequence*
| *pos_2 <- find position of primer_2 in sequence*
| *amplicon length <- pos_2 + length(primer_2) - pos_1*
| *return amplicon length*
| *return amplicon length*
.. literalinclude:: _static/code/
......@@ -304,44 +305,50 @@ Write the pseudocode before to implement it.
>>> import sv40
>>> import sv40
>>> import fasta_to_one_line
>>> sequence = fasta_to_one_line(sv40)
>>> print amplicon_len(sequence, first_primer, second_primer )
:download:` <_static/code/>` .
:download:` <_static/code/>`.
reverse the following sequence "TACCTTCTGAGGCGGAAAGA" (don't compute the complement): ::
#. Reverse the following sequence ``"TACCTTCTGAGGCGGAAAGA"`` (don't compute the complement).
# or
>>> l = list(s)
>>> l = list(s)
# take care reverse() reverse a list in place (the method do a side effect and return None )
# so if you don't have a object reference on the list you cannot get the reversed list!
>>> l.reverse()
>>> print l
>>> ''.join(l)
# or
>>> rev_s = reversed(s)
The most efficient way to reverse a string or a list is the way using the slice.
The most efficient way to reverse a string or a list is the way using the slice.
.. #. Using the shorter string ``s = 'gaattc'`` draw what happens in memory when you reverse ``s``.
| The il2_human contains 4 cysteins (C) in positions 9, 78, 125, 145.
| We want to generate the sequence of a mutatnt were the cysteins 78 and 125 are replaced by serins (S)
| Write the pseudocode, before to propose an implementation:
| The ``il2_human`` sequence contains 4 cysteins (C) in positions 9, 78, 125, 145.
| We want to generate the sequence of a mutant where the cysteins 78 and 125 are replaced by serins (S)
| Write the pseudocode, before proposing an implementation:
We have to take care of the string numbered vs sequence numbered:
We have to take care of the difference between Python string numbering and usual position numbering:
| C in seq -> in string
| 9 -> 8
......@@ -350,36 +357,34 @@ We have to take care of the string numbered vs sequence numbered:
| 145 -> 144
| *generate 3 slices from the il2_human*
| *head <- from the begining and cut between the first cytein and the second*
| *head <- from the begining and cut between the first cystein and the second*
| *body <- include the 2nd and 3rd cystein*
| *tail <- cut after the 3rd cystein until the end*
| *replace body cystein by serin*
| *tail <- cut after the 3rd cystein until the end*
| *replace body cystein by serin*
| *make new sequence with head body_mutate tail*
il2_human =
head = il2_human[:77]
body = il2_human[77:125]
tail = il2_human[126:]
body_mutate = body.replace('C', 'S')
il2_mutate = head + body_mutate + tail
head = il2_human[:77]
body = il2_human[77:125]
tail = il2_human[126:]
body_mutate = body.replace('C', 'S')
il2_mutate = head + body_mutate + tail
Write a function
Write a function which:
* which take a sequence as parameter
* compute the GC%
* and return it
* display the results readable for human as a micro report like this:
'the sv40 is 5243 bp length and have 40.80% gc'
use sv40 sequence to test your function.
* takes a sequence as parameter;
* computes the GC%;
* and returns it;
* displays the results as a "human-readable" micro report like this:
``'The sv40 is 5243 bp length and has 40.80% gc'``.
Use the sv40 sequence to test your function.
.. literalinclude:: _static/code/
......@@ -387,14 +392,14 @@ use sv40 sequence to test your function.
>>> import sv40
>>> import sv40
>>> import fasta_to_one_line
>>> import gc_percent
>>> sequence = fasta_to_one_line(sv40)
>>> gc_pc = gc_percent(sequence)
>>> report = "the sv40 is {0} bp length and have {1:.2%} gc".format(len(sequence), gc_pc)
>>> report = "The sv40 is {0} bp length and has {1:.2%} gc".format(len(sequence), gc_pc)
>>> print report
'the sv40 is 5243 bp length and have 40.80% gc'
'The sv40 is 5243 bp length and has 40.80% gc'
:download:` <_static/code/>` .
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment