Commit e16be17e authored by Bertrand  NÉRON's avatar Bertrand NÉRON
Browse files

add exercises with their solutions

parent 845a38df
......@@ -11,6 +11,61 @@ Collection Data Types
Exercices
=========
Exercice
--------
Draw the representation in memory of the following expressions.
what is the data type of each object.
::
x = [1, 2, 3, 4]
y = x[1]
y = 3.14
x[1] = 'foo'
Exercice
--------
wihout using python shell, what is the results of the following statements:
.. note::
sum is a function which return the sum of each elements of a list.
::
x = [1, 2, 3, 4]
x[3] = -4 # what is the value of x now ?
y = sum(x)/len(x) #what is the value of y ? why ?
y = 0
because sum(x) is an integer, len(x) is also an integer so in python2.x the result is an integer,
all the digits after the periods are discarded.
In python3 we will obtain the expected result (see :ref:``)
Exercice
--------
How to compute safely the average of a list? ::
float(sum(l))/float(len(l)
exercise
--------
generate a list containing all codons. ::
codons = []
for a in 'acgt':
for b in 'acgt':
for c in 'acgt':
codon = a + b + c
codons.append(codon)
exercice
--------
......@@ -25,6 +80,101 @@ solution ::
>>> list(set(l))
exercice
--------
let the following enzymes collection: ::
import collections
RestrictEnzyme = collections.namedtuple("RestrictEnzyme", "name comment sequence cut end")
ecor1 = RestrictEnzyme("EcoRI", "Ecoli restriction enzime I", "gaattc", 1, "sticky")
ecor5 = RestrictEnzyme("EcoRV", "Ecoli restriction enzime V", "gatatc", 3, "blunt")
bamh1 = RestrictEnzyme("BamHI", "type II restriction endonuclease from Bacillus amyloliquefaciens ", "ggatcc", 1, "sticky")
hind3 = RestrictEnzyme("HindIII", "type II site-specific nuclease from Haemophilus influenzae", "aagctt", 1 , "sticky")
taq1 = RestrictEnzyme("TaqI", "Thermus aquaticus", "tcga", 1 , "sticky")
not1 = RestrictEnzyme("NotI", "Nocardia otitidis", "gcggccgc", 2 , "sticky")
sau3a1 = RestrictEnzyme("Sau3aI", "Staphylococcus aureus", "gatc", 0 , "sticky")
hae3 = RestrictEnzyme("HaeIII", "Haemophilus aegyptius", "ggcc", 2 , "blunt")
sma1 = RestrictEnzyme("SmaI", "Serratia marcescens", "cccggg", 3 , "blunt")
and the 2 dna fragments: ::
dna_1 = """tcgcgcaacgtcgcctacatctcaagattcagcgccgagatccccgggggttgagcgatccccgtcagttggcgtgaattcag
cagcagcgcaccccgggcgtagaattccagttgcagataatagctgatttagttaacttggatcacagaagcttccaga
ccaccgtatggatcccaacgcactgttacggatccaattcgtacgtttggggtgatttgattcccgctgcctgccagg"""
dna_2 = """gagcatgagcggaattctgcatagcgcaagaatgcggccgcttagagcgatgctgccctaaactctatgcagcgggcgtgagg
attcagtggcttcagaattcctcccgggagaagctgaatagtgaaacgattgaggtgttgtggtgaaccgagtaag
agcagcttaaatcggagagaattccatttactggccagggtaagagttttggtaaatatatagtgatatctggcttg"""
| which enzymes cut the dna_1 ?
| the dna_2 ?
| the dna_1 but not the dna_2?
::
dna_1 = dna_1.replace('\n', '')
dans_2 = dna_2.replace('\n', '')
enzymes = [ecor1, ecor5, bamh1, hind3, taq1, not1, sau3a1, hae3, sma1]
digest_1 = []
for enz in enzymes:
pos = dna_1.find(enz.sequence)
if pos != -1:
digest_1.append(enz)
with this first algorithm we find if an enzyme cut the dna but we cannot find all cuts in the dna for an enzyme.
If we find a cutting site, we must search again starting at the first nucleotid after the begining of the match
until the end of the the dna, for this we use the start parameter of the find function, and so on.
As we don't know how many loop we need to scan the dna until the end we use a ``while`` loop testing for the presence of a cutting site.::
digest_1 = []
for enz in enzymes:
pos = dna_1.find(enz.sequence)
while pos != -1:
digest_1.append(enz)
pos = dna_1.find(enz.sequence, pos + 1)
digest_2 = []
for enz in enzymes:
pos = dna_2.find(enz.sequence)
while pos != -1:
digest_2.append(enz)
pos = dna_2.find(enz.sequence, pos + 1)
cut_dna_1 = set(digest_1)
cut_dna_2 = set(digest_2)
cut_dna_1_not_dna_2 = cut_dna_1 - cut_dna_2
If we want also the position, for instance to compute the fragments of dna. ::
digest_1 = []
for enz in enzymes:
pos = dna_1.find(enz.sequence)
while pos != -1:
digest_1.append((enz, pos))
pos = dna_1.find(enz.sequence, pos + 1)
from operator import itemgetter
digest_1.sort(key=itemgetter(1))
[(e.name, d) for e, d in digest_1]
digest_2 = []
for enz in enzymes:
pos = dna_2.find(enz.sequence)
while pos != -1:
digest_2.append((enz, pos))
pos = dna_2.find(enz.sequence, pos + 1)
cut_dna_1 = set([e.name for e in digest_1])
cut_dna_2 = set([e.name for e in digest_2])
cut_dna_1_not_dna_2 = cut_dna_1 - cut_dna_2
exercice
--------
......
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment