Commit 736027d1 authored by Blaise Li's avatar Blaise Li
Browse files

Made snakemake wrappers a submodule.

parent 36306d05
...@@ -19,3 +19,6 @@ ...@@ -19,3 +19,6 @@
[submodule "plotting_scripts"] [submodule "plotting_scripts"]
path = plotting_scripts path = plotting_scripts
url = git@gitlab.pasteur.fr:bli/plotting_scripts.git url = git@gitlab.pasteur.fr:bli/plotting_scripts.git
[submodule "snakemake_wrappers"]
path = snakemake_wrappers
url = git@gitlab.pasteur.fr:bli/snakemake_wrappers.git
Subproject commit 2295326f9037d590ba5953cba6c436af729b8efa
import pandas as pd
counts_data = pd.read_table(snakemake.input.counts_data, index_col="gene")
feature_lengths = pd.read_table(snakemake.params.feature_lengths_file, index_col="gene")
common = counts_data.index.intersection(feature_lengths.index)
rpk = 1000 * counts_data.loc[common].div(feature_lengths.loc[common]["union_exon_len"], axis="index")
rpk.to_csv(snakemake.output.rpk_file, sep="\t")
import pandas as pd
rpk = pd.read_table(snakemake.input.rpk_file, index_col="gene")
tpm = 1000000 * rpk / rpk.sum()
tpm.to_csv(snakemake.output.tpm_file, sep="\t")
######## Snakemake header ########
import sys; sys.path.insert(0, "/home/bli/.local/lib/python3.6/site-packages"); import pickle; snakemake = pickle.loads(b'\x80\x03csnakemake.script\nSnakemake\nq\x00)\x81q\x01}q\x02(X\x05\x00\x00\x00inputq\x03csnakemake.io\nInputFiles\nq\x04)\x81q\x05XR\x00\x00\x00results/bowtie2/mapped_C_elegans/reads/WT_HS30_2_piRNA_on_C_elegans/piRNA.fastq.gzq\x06a}q\x07X\x06\x00\x00\x00_namesq\x08}q\tsbX\x06\x00\x00\x00outputq\ncsnakemake.io\nOutputFiles\nq\x0b)\x81q\x0c(XA\x00\x00\x00results/bowtie2/mapped_C_elegans/WT_HS30_2/piRNA_on_C_elegans.samq\rXS\x00\x00\x00results/bowtie2/not_mapped_C_elegans/WT_HS30_2_piRNA_unmapped_on_C_elegans.fastq.gzq\x0ee}q\x0f(h\x08}q\x10(X\x03\x00\x00\x00samq\x11K\x00N\x86q\x12X\x05\x00\x00\x00nomapq\x13K\x01N\x86q\x14uh\x11h\rh\x13h\x0eubX\x06\x00\x00\x00paramsq\x15csnakemake.io\nParams\nq\x16)\x81q\x17Xk\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/genomeq\x18a}q\x19(h\x08}q\x1aX\x05\x00\x00\x00indexq\x1bK\x00N\x86q\x1csh\x1bh\x18ubX\t\x00\x00\x00wildcardsq\x1dcsnakemake.io\nWildcards\nq\x1e)\x81q\x1f(X\x02\x00\x00\x00WTq X\x04\x00\x00\x00HS30q!X\x01\x00\x00\x002q"X\x05\x00\x00\x00piRNAq#e}q$(h\x08}q%(X\x03\x00\x00\x00libq&K\x00N\x86q\'X\x05\x00\x00\x00treatq(K\x01N\x86q)X\x03\x00\x00\x00repq*K\x02N\x86q+X\t\x00\x00\x00read_typeq,K\x03N\x86q-uX\x03\x00\x00\x00libq.h X\x05\x00\x00\x00treatq/h!X\x03\x00\x00\x00repq0h"X\t\x00\x00\x00read_typeq1h#ubX\x07\x00\x00\x00threadsq2K\x01X\t\x00\x00\x00resourcesq3csnakemake.io\nResources\nq4)\x81q5(K\x01K\x01e}q6(h\x08}q7(X\x06\x00\x00\x00_coresq8K\x00N\x86q9X\x06\x00\x00\x00_nodesq:K\x01N\x86q;uh8K\x01h:K\x01ubX\x03\x00\x00\x00logq<csnakemake.io\nLog\nq=)\x81q>(X&\x00\x00\x00logs/map_on_genome_WT_HS30_2_piRNA.logq?X&\x00\x00\x00logs/map_on_genome_WT_HS30_2_piRNA.errq@e}qA(h\x08}qB(X\x07\x00\x00\x00map_logqCK\x00N\x86qDX\x07\x00\x00\x00map_errqEK\x01N\x86qFuhCh?hEh@ubX\x06\x00\x00\x00configqG}qH(X\x07\x00\x00\x00lib2rawqIccollections\nOrderedDict\nqJ)RqK(X\x02\x00\x00\x00WTqLXQ\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/wt{treat}_{rep}.fastq.gzqMX\x04\x00\x00\x00prg1qNXS\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/prg1{treat}_{rep}.fastq.gzqOuX\t\x00\x00\x00lib2adaptqPhJ)RqQ(hLX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqRhNX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqSuX\x07\x00\x00\x00missingqT]qUhJ)RqVahLX\x02\x00\x00\x00WTqWX\x06\x00\x00\x00mutantqXX\x04\x00\x00\x00prg1qYX\x05\x00\x00\x00trim5qZX\x01\x00\x00\x004q[X\x05\x00\x00\x00trim3q\\h[X\n\x00\x00\x00treatmentsq]]q^(X\x02\x00\x00\x00RTq_X\x04\x00\x00\x00HS30q`X\t\x00\x00\x00HS30RT120qaeX\n\x00\x00\x00replicatesqb]qc(X\x01\x00\x00\x001qdh"eX\x07\x00\x00\x00min_lenqeX\x02\x00\x00\x0018qfX\x07\x00\x00\x00max_lenqgX\x02\x00\x00\x0026qhX\x0e\x00\x00\x00count_biotypesqi]qj(X\t\x00\x00\x00antisenseqkX\x04\x00\x00\x00tRNAqlX\x05\x00\x00\x00snRNAqmX\x06\x00\x00\x00snoRNAqnX\x04\x00\x00\x00rRNAqoX\x05\x00\x00\x00piRNAqpX\x05\x00\x00\x00ncRNAqqX\x05\x00\x00\x00miRNAqrX\x07\x00\x00\x00lincRNAqsX\x0e\x00\x00\x00protein_codingqtX\n\x00\x00\x00pseudogenequX\t\x00\x00\x00antisenseqvX\x14\x00\x00\x00DNA_transposons_rmskqwX\x14\x00\x00\x00RNA_transposons_rmskqxX\x0f\x00\x00\x00satellites_rmskqyX\x13\x00\x00\x00simple_repeats_rmskqzeX\x0e\x00\x00\x00annot_biotypesq{]q|(X\t\x00\x00\x00antisenseq}X\x04\x00\x00\x00tRNAq~X\x05\x00\x00\x00snRNAq\x7fX\x06\x00\x00\x00snoRNAq\x80X\x04\x00\x00\x00rRNAq\x81X\x05\x00\x00\x00piRNAq\x82X\x05\x00\x00\x00ncRNAq\x83X\x05\x00\x00\x00miRNAq\x84X\x07\x00\x00\x00lincRNAq\x85X\x12\x00\x00\x00protein_coding_CDSq\x86X\x12\x00\x00\x00protein_coding_UTRq\x87X\x1a\x00\x00\x00protein_coding_pure_intronq\x88X\n\x00\x00\x00pseudogeneq\x89X\t\x00\x00\x00antisenseq\x8aX\x14\x00\x00\x00DNA_transposons_rmskq\x8bX\x14\x00\x00\x00RNA_transposons_rmskq\x8cX\x0f\x00\x00\x00satellites_rmskq\x8dX\x13\x00\x00\x00simple_repeats_rmskq\x8eeX\x08\x00\x00\x00data_dirq\x8fX\x04\x00\x00\x00dataq\x90X\t\x00\x00\x00annot_dirq\x91X_\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genesq\x92X\x0f\x00\x00\x00local_annot_dirq\x93X\x0b\x00\x00\x00annotationsq\x94X\x07\x00\x00\x00alignerq\x95X\x07\x00\x00\x00bowtie2q\x96X\x05\x00\x00\x00indexq\x97h\x18X\x0b\x00\x00\x00convert_dirq\x98X=\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Wormbase/WS253/geneIDsq\x99X\n\x00\x00\x00output_dirq\x9aX\x07\x00\x00\x00resultsq\x9bX\x07\x00\x00\x00log_dirq\x9cX\x04\x00\x00\x00logsq\x9duX\x04\x00\x00\x00ruleq\x9eX\r\x00\x00\x00map_on_genomeq\x9fub.')
######## Original script #########
from snakemake.shell import shell
cmd = """
genome_dir="${{HOME}}/Genomes"
genome="C_elegans"
cmd="bowtie2 --seed 123 -t -L 6 -i S,1,0.8 -N 0 --mm -x {snakemake.params.index} -U {snakemake.input[0]} --no-unal --un-gz {snakemake.output.nomap} -S {snakemake.output.sam}"
echo ${{cmd}}
eval ${{cmd}} 1> {snakemake.log.map_log} 2> {snakemake.log.map_err}
"""
shell(cmd)
######## Snakemake header ########
import sys; sys.path.insert(0, "/home/bli/.local/lib/python3.6/site-packages"); import pickle; snakemake = pickle.loads(b'\x80\x03csnakemake.script\nSnakemake\nq\x00)\x81q\x01}q\x02(X\x05\x00\x00\x00inputq\x03csnakemake.io\nInputFiles\nq\x04)\x81q\x05XR\x00\x00\x00results/bowtie2/mapped_C_elegans/reads/prg1_RT_2_siRNA_on_C_elegans/siRNA.fastq.gzq\x06a}q\x07X\x06\x00\x00\x00_namesq\x08}q\tsbX\x06\x00\x00\x00outputq\ncsnakemake.io\nOutputFiles\nq\x0b)\x81q\x0c(XA\x00\x00\x00results/bowtie2/mapped_C_elegans/prg1_RT_2/siRNA_on_C_elegans.samq\rXS\x00\x00\x00results/bowtie2/not_mapped_C_elegans/prg1_RT_2_siRNA_unmapped_on_C_elegans.fastq.gzq\x0ee}q\x0f(h\x08}q\x10(X\x03\x00\x00\x00samq\x11K\x00N\x86q\x12X\x05\x00\x00\x00nomapq\x13K\x01N\x86q\x14uh\x11h\rh\x13h\x0eubX\x06\x00\x00\x00paramsq\x15csnakemake.io\nParams\nq\x16)\x81q\x17Xk\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/genomeq\x18a}q\x19(h\x08}q\x1aX\x05\x00\x00\x00indexq\x1bK\x00N\x86q\x1csh\x1bh\x18ubX\t\x00\x00\x00wildcardsq\x1dcsnakemake.io\nWildcards\nq\x1e)\x81q\x1f(X\x04\x00\x00\x00prg1q X\x02\x00\x00\x00RTq!X\x01\x00\x00\x002q"X\x05\x00\x00\x00siRNAq#e}q$(h\x08}q%(X\x03\x00\x00\x00libq&K\x00N\x86q\'X\x05\x00\x00\x00treatq(K\x01N\x86q)X\x03\x00\x00\x00repq*K\x02N\x86q+X\t\x00\x00\x00read_typeq,K\x03N\x86q-uX\x03\x00\x00\x00libq.h X\x05\x00\x00\x00treatq/h!X\x03\x00\x00\x00repq0h"X\t\x00\x00\x00read_typeq1h#ubX\x07\x00\x00\x00threadsq2K\x01X\t\x00\x00\x00resourcesq3csnakemake.io\nResources\nq4)\x81q5(K\x01K\x01e}q6(h\x08}q7(X\x06\x00\x00\x00_coresq8K\x00N\x86q9X\x06\x00\x00\x00_nodesq:K\x01N\x86q;uh8K\x01h:K\x01ubX\x03\x00\x00\x00logq<csnakemake.io\nLog\nq=)\x81q>(X&\x00\x00\x00logs/map_on_genome_prg1_RT_2_siRNA.logq?X&\x00\x00\x00logs/map_on_genome_prg1_RT_2_siRNA.errq@e}qA(h\x08}qB(X\x07\x00\x00\x00map_logqCK\x00N\x86qDX\x07\x00\x00\x00map_errqEK\x01N\x86qFuhCh?hEh@ubX\x06\x00\x00\x00configqG}qH(X\x07\x00\x00\x00lib2rawqIccollections\nOrderedDict\nqJ)RqK(X\x02\x00\x00\x00WTqLXQ\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/wt{treat}_{rep}.fastq.gzqMX\x04\x00\x00\x00prg1qNXS\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/prg1{treat}_{rep}.fastq.gzqOuX\t\x00\x00\x00lib2adaptqPhJ)RqQ(hLX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqRhNX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqSuX\x07\x00\x00\x00missingqT]qUhJ)RqVahLX\x02\x00\x00\x00WTqWX\x06\x00\x00\x00mutantqXX\x04\x00\x00\x00prg1qYX\x05\x00\x00\x00trim5qZX\x01\x00\x00\x004q[X\x05\x00\x00\x00trim3q\\h[X\n\x00\x00\x00treatmentsq]]q^(X\x02\x00\x00\x00RTq_X\x04\x00\x00\x00HS30q`X\t\x00\x00\x00HS30RT120qaeX\n\x00\x00\x00replicatesqb]qc(X\x01\x00\x00\x001qdh"eX\x07\x00\x00\x00min_lenqeX\x02\x00\x00\x0018qfX\x07\x00\x00\x00max_lenqgX\x02\x00\x00\x0026qhX\x0e\x00\x00\x00count_biotypesqi]qj(X\t\x00\x00\x00antisenseqkX\x04\x00\x00\x00tRNAqlX\x05\x00\x00\x00snRNAqmX\x06\x00\x00\x00snoRNAqnX\x04\x00\x00\x00rRNAqoX\x05\x00\x00\x00piRNAqpX\x05\x00\x00\x00ncRNAqqX\x05\x00\x00\x00miRNAqrX\x07\x00\x00\x00lincRNAqsX\x0e\x00\x00\x00protein_codingqtX\n\x00\x00\x00pseudogenequX\t\x00\x00\x00antisenseqvX\x14\x00\x00\x00DNA_transposons_rmskqwX\x14\x00\x00\x00RNA_transposons_rmskqxX\x0f\x00\x00\x00satellites_rmskqyX\x13\x00\x00\x00simple_repeats_rmskqzeX\x0e\x00\x00\x00annot_biotypesq{]q|(X\t\x00\x00\x00antisenseq}X\x04\x00\x00\x00tRNAq~X\x05\x00\x00\x00snRNAq\x7fX\x06\x00\x00\x00snoRNAq\x80X\x04\x00\x00\x00rRNAq\x81X\x05\x00\x00\x00piRNAq\x82X\x05\x00\x00\x00ncRNAq\x83X\x05\x00\x00\x00miRNAq\x84X\x07\x00\x00\x00lincRNAq\x85X\x12\x00\x00\x00protein_coding_CDSq\x86X\x12\x00\x00\x00protein_coding_UTRq\x87X\x1a\x00\x00\x00protein_coding_pure_intronq\x88X\n\x00\x00\x00pseudogeneq\x89X\t\x00\x00\x00antisenseq\x8aX\x14\x00\x00\x00DNA_transposons_rmskq\x8bX\x14\x00\x00\x00RNA_transposons_rmskq\x8cX\x0f\x00\x00\x00satellites_rmskq\x8dX\x13\x00\x00\x00simple_repeats_rmskq\x8eeX\x08\x00\x00\x00data_dirq\x8fX\x04\x00\x00\x00dataq\x90X\t\x00\x00\x00annot_dirq\x91X_\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genesq\x92X\x0f\x00\x00\x00local_annot_dirq\x93X\x0b\x00\x00\x00annotationsq\x94X\x07\x00\x00\x00alignerq\x95X\x07\x00\x00\x00bowtie2q\x96X\x05\x00\x00\x00indexq\x97h\x18X\x0b\x00\x00\x00convert_dirq\x98X=\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Wormbase/WS253/geneIDsq\x99X\n\x00\x00\x00output_dirq\x9aX\x07\x00\x00\x00resultsq\x9bX\x07\x00\x00\x00log_dirq\x9cX\x04\x00\x00\x00logsq\x9duX\x04\x00\x00\x00ruleq\x9eX\r\x00\x00\x00map_on_genomeq\x9fub.')
######## Original script #########
from snakemake.shell import shell
cmd = """
genome_dir="${{HOME}}/Genomes"
genome="C_elegans"
cmd="bowtie2 --seed 123 -t -L 6 -i S,1,0.8 -N 0 --mm -x {snakemake.params.index} -U {snakemake.input[0]} --no-unal --un-gz {snakemake.output.nomap} -S {snakemake.output.sam}"
echo ${{cmd}}
eval ${{cmd}} 1> {snakemake.log.map_log} 2> {snakemake.log.map_err}
"""
shell(cmd)
######## Snakemake header ########
import sys; sys.path.insert(0, "/home/bli/.local/lib/python3.6/site-packages"); import pickle; snakemake = pickle.loads(b'\x80\x03csnakemake.script\nSnakemake\nq\x00)\x81q\x01}q\x02(X\x05\x00\x00\x00inputq\x03csnakemake.io\nInputFiles\nq\x04)\x81q\x05XY\x00\x00\x00results/bowtie2/mapped_C_elegans/reads/prg1_HS30RT120_2_siRNA_on_C_elegans/siRNA.fastq.gzq\x06a}q\x07X\x06\x00\x00\x00_namesq\x08}q\tsbX\x06\x00\x00\x00outputq\ncsnakemake.io\nOutputFiles\nq\x0b)\x81q\x0c(XH\x00\x00\x00results/bowtie2/mapped_C_elegans/prg1_HS30RT120_2/siRNA_on_C_elegans.samq\rXZ\x00\x00\x00results/bowtie2/not_mapped_C_elegans/prg1_HS30RT120_2_siRNA_unmapped_on_C_elegans.fastq.gzq\x0ee}q\x0f(h\x08}q\x10(X\x03\x00\x00\x00samq\x11K\x00N\x86q\x12X\x05\x00\x00\x00nomapq\x13K\x01N\x86q\x14uh\x11h\rh\x13h\x0eubX\x06\x00\x00\x00paramsq\x15csnakemake.io\nParams\nq\x16)\x81q\x17Xk\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/genomeq\x18a}q\x19(h\x08}q\x1aX\x05\x00\x00\x00indexq\x1bK\x00N\x86q\x1csh\x1bh\x18ubX\t\x00\x00\x00wildcardsq\x1dcsnakemake.io\nWildcards\nq\x1e)\x81q\x1f(X\x04\x00\x00\x00prg1q X\t\x00\x00\x00HS30RT120q!X\x01\x00\x00\x002q"X\x05\x00\x00\x00siRNAq#e}q$(h\x08}q%(X\x03\x00\x00\x00libq&K\x00N\x86q\'X\x05\x00\x00\x00treatq(K\x01N\x86q)X\x03\x00\x00\x00repq*K\x02N\x86q+X\t\x00\x00\x00read_typeq,K\x03N\x86q-uX\x03\x00\x00\x00libq.h X\x05\x00\x00\x00treatq/h!X\x03\x00\x00\x00repq0h"X\t\x00\x00\x00read_typeq1h#ubX\x07\x00\x00\x00threadsq2K\x01X\t\x00\x00\x00resourcesq3csnakemake.io\nResources\nq4)\x81q5(K\x01K\x01e}q6(h\x08}q7(X\x06\x00\x00\x00_coresq8K\x00N\x86q9X\x06\x00\x00\x00_nodesq:K\x01N\x86q;uh8K\x01h:K\x01ubX\x03\x00\x00\x00logq<csnakemake.io\nLog\nq=)\x81q>(X-\x00\x00\x00logs/map_on_genome_prg1_HS30RT120_2_siRNA.logq?X-\x00\x00\x00logs/map_on_genome_prg1_HS30RT120_2_siRNA.errq@e}qA(h\x08}qB(X\x07\x00\x00\x00map_logqCK\x00N\x86qDX\x07\x00\x00\x00map_errqEK\x01N\x86qFuhCh?hEh@ubX\x06\x00\x00\x00configqG}qH(X\x07\x00\x00\x00lib2rawqIccollections\nOrderedDict\nqJ)RqK(X\x02\x00\x00\x00WTqLXQ\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/wt{treat}_{rep}.fastq.gzqMX\x04\x00\x00\x00prg1qNXS\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/prg1{treat}_{rep}.fastq.gzqOuX\t\x00\x00\x00lib2adaptqPhJ)RqQ(hLX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqRhNX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqSuX\x07\x00\x00\x00missingqT]qUhJ)RqVahLX\x02\x00\x00\x00WTqWX\x06\x00\x00\x00mutantqXX\x04\x00\x00\x00prg1qYX\x05\x00\x00\x00trim5qZX\x01\x00\x00\x004q[X\x05\x00\x00\x00trim3q\\h[X\n\x00\x00\x00treatmentsq]]q^(X\x02\x00\x00\x00RTq_X\x04\x00\x00\x00HS30q`X\t\x00\x00\x00HS30RT120qaeX\n\x00\x00\x00replicatesqb]qc(X\x01\x00\x00\x001qdh"eX\x07\x00\x00\x00min_lenqeX\x02\x00\x00\x0018qfX\x07\x00\x00\x00max_lenqgX\x02\x00\x00\x0026qhX\x0e\x00\x00\x00count_biotypesqi]qj(X\t\x00\x00\x00antisenseqkX\x04\x00\x00\x00tRNAqlX\x05\x00\x00\x00snRNAqmX\x06\x00\x00\x00snoRNAqnX\x04\x00\x00\x00rRNAqoX\x05\x00\x00\x00piRNAqpX\x05\x00\x00\x00ncRNAqqX\x05\x00\x00\x00miRNAqrX\x07\x00\x00\x00lincRNAqsX\x0e\x00\x00\x00protein_codingqtX\n\x00\x00\x00pseudogenequX\t\x00\x00\x00antisenseqvX\x14\x00\x00\x00DNA_transposons_rmskqwX\x14\x00\x00\x00RNA_transposons_rmskqxX\x0f\x00\x00\x00satellites_rmskqyX\x13\x00\x00\x00simple_repeats_rmskqzeX\x0e\x00\x00\x00annot_biotypesq{]q|(X\t\x00\x00\x00antisenseq}X\x04\x00\x00\x00tRNAq~X\x05\x00\x00\x00snRNAq\x7fX\x06\x00\x00\x00snoRNAq\x80X\x04\x00\x00\x00rRNAq\x81X\x05\x00\x00\x00piRNAq\x82X\x05\x00\x00\x00ncRNAq\x83X\x05\x00\x00\x00miRNAq\x84X\x07\x00\x00\x00lincRNAq\x85X\x12\x00\x00\x00protein_coding_CDSq\x86X\x12\x00\x00\x00protein_coding_UTRq\x87X\x1a\x00\x00\x00protein_coding_pure_intronq\x88X\n\x00\x00\x00pseudogeneq\x89X\t\x00\x00\x00antisenseq\x8aX\x14\x00\x00\x00DNA_transposons_rmskq\x8bX\x14\x00\x00\x00RNA_transposons_rmskq\x8cX\x0f\x00\x00\x00satellites_rmskq\x8dX\x13\x00\x00\x00simple_repeats_rmskq\x8eeX\x08\x00\x00\x00data_dirq\x8fX\x04\x00\x00\x00dataq\x90X\t\x00\x00\x00annot_dirq\x91X_\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genesq\x92X\x0f\x00\x00\x00local_annot_dirq\x93X\x0b\x00\x00\x00annotationsq\x94X\x07\x00\x00\x00alignerq\x95X\x07\x00\x00\x00bowtie2q\x96X\x05\x00\x00\x00indexq\x97h\x18X\x0b\x00\x00\x00convert_dirq\x98X=\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Wormbase/WS253/geneIDsq\x99X\n\x00\x00\x00output_dirq\x9aX\x07\x00\x00\x00resultsq\x9bX\x07\x00\x00\x00log_dirq\x9cX\x04\x00\x00\x00logsq\x9duX\x04\x00\x00\x00ruleq\x9eX\r\x00\x00\x00map_on_genomeq\x9fub.')
######## Original script #########
from snakemake.shell import shell
cmd = """
genome_dir="${{HOME}}/Genomes"
genome="C_elegans"
cmd="bowtie2 --seed 123 -t -L 6 -i S,1,0.8 -N 0 --mm -x {snakemake.params.index} -U {snakemake.input[0]} --no-unal --un-gz {snakemake.output.nomap} -S {snakemake.output.sam}"
echo ${{cmd}}
eval ${{cmd}} 1> {snakemake.log.map_log} 2> {snakemake.log.map_err}
"""
shell(cmd)
######## Snakemake header ########
import sys; sys.path.insert(0, "/home/bli/.local/lib/python3.6/site-packages"); import pickle; snakemake = pickle.loads(b'\x80\x03csnakemake.script\nSnakemake\nq\x00)\x81q\x01}q\x02(X\x05\x00\x00\x00inputq\x03csnakemake.io\nInputFiles\nq\x04)\x81q\x05XT\x00\x00\x00results/bowtie2/mapped_C_elegans/reads/prg1_HS30_2_siRNA_on_C_elegans/siRNA.fastq.gzq\x06a}q\x07X\x06\x00\x00\x00_namesq\x08}q\tsbX\x06\x00\x00\x00outputq\ncsnakemake.io\nOutputFiles\nq\x0b)\x81q\x0c(XC\x00\x00\x00results/bowtie2/mapped_C_elegans/prg1_HS30_2/siRNA_on_C_elegans.samq\rXU\x00\x00\x00results/bowtie2/not_mapped_C_elegans/prg1_HS30_2_siRNA_unmapped_on_C_elegans.fastq.gzq\x0ee}q\x0f(h\x08}q\x10(X\x03\x00\x00\x00samq\x11K\x00N\x86q\x12X\x05\x00\x00\x00nomapq\x13K\x01N\x86q\x14uh\x11h\rh\x13h\x0eubX\x06\x00\x00\x00paramsq\x15csnakemake.io\nParams\nq\x16)\x81q\x17Xk\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/genomeq\x18a}q\x19(h\x08}q\x1aX\x05\x00\x00\x00indexq\x1bK\x00N\x86q\x1csh\x1bh\x18ubX\t\x00\x00\x00wildcardsq\x1dcsnakemake.io\nWildcards\nq\x1e)\x81q\x1f(X\x04\x00\x00\x00prg1q X\x04\x00\x00\x00HS30q!X\x01\x00\x00\x002q"X\x05\x00\x00\x00siRNAq#e}q$(h\x08}q%(X\x03\x00\x00\x00libq&K\x00N\x86q\'X\x05\x00\x00\x00treatq(K\x01N\x86q)X\x03\x00\x00\x00repq*K\x02N\x86q+X\t\x00\x00\x00read_typeq,K\x03N\x86q-uX\x03\x00\x00\x00libq.h X\x05\x00\x00\x00treatq/h!X\x03\x00\x00\x00repq0h"X\t\x00\x00\x00read_typeq1h#ubX\x07\x00\x00\x00threadsq2K\x01X\t\x00\x00\x00resourcesq3csnakemake.io\nResources\nq4)\x81q5(K\x01K\x01e}q6(h\x08}q7(X\x06\x00\x00\x00_coresq8K\x00N\x86q9X\x06\x00\x00\x00_nodesq:K\x01N\x86q;uh8K\x01h:K\x01ubX\x03\x00\x00\x00logq<csnakemake.io\nLog\nq=)\x81q>(X(\x00\x00\x00logs/map_on_genome_prg1_HS30_2_siRNA.logq?X(\x00\x00\x00logs/map_on_genome_prg1_HS30_2_siRNA.errq@e}qA(h\x08}qB(X\x07\x00\x00\x00map_logqCK\x00N\x86qDX\x07\x00\x00\x00map_errqEK\x01N\x86qFuhCh?hEh@ubX\x06\x00\x00\x00configqG}qH(X\x07\x00\x00\x00lib2rawqIccollections\nOrderedDict\nqJ)RqK(X\x02\x00\x00\x00WTqLXQ\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/wt{treat}_{rep}.fastq.gzqMX\x04\x00\x00\x00prg1qNXS\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/prg1{treat}_{rep}.fastq.gzqOuX\t\x00\x00\x00lib2adaptqPhJ)RqQ(hLX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqRhNX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqSuX\x07\x00\x00\x00missingqT]qUhJ)RqVahLX\x02\x00\x00\x00WTqWX\x06\x00\x00\x00mutantqXX\x04\x00\x00\x00prg1qYX\x05\x00\x00\x00trim5qZX\x01\x00\x00\x004q[X\x05\x00\x00\x00trim3q\\h[X\n\x00\x00\x00treatmentsq]]q^(X\x02\x00\x00\x00RTq_X\x04\x00\x00\x00HS30q`X\t\x00\x00\x00HS30RT120qaeX\n\x00\x00\x00replicatesqb]qc(X\x01\x00\x00\x001qdh"eX\x07\x00\x00\x00min_lenqeX\x02\x00\x00\x0018qfX\x07\x00\x00\x00max_lenqgX\x02\x00\x00\x0026qhX\x0e\x00\x00\x00count_biotypesqi]qj(X\t\x00\x00\x00antisenseqkX\x04\x00\x00\x00tRNAqlX\x05\x00\x00\x00snRNAqmX\x06\x00\x00\x00snoRNAqnX\x04\x00\x00\x00rRNAqoX\x05\x00\x00\x00piRNAqpX\x05\x00\x00\x00ncRNAqqX\x05\x00\x00\x00miRNAqrX\x07\x00\x00\x00lincRNAqsX\x0e\x00\x00\x00protein_codingqtX\n\x00\x00\x00pseudogenequX\t\x00\x00\x00antisenseqvX\x14\x00\x00\x00DNA_transposons_rmskqwX\x14\x00\x00\x00RNA_transposons_rmskqxX\x0f\x00\x00\x00satellites_rmskqyX\x13\x00\x00\x00simple_repeats_rmskqzeX\x0e\x00\x00\x00annot_biotypesq{]q|(X\t\x00\x00\x00antisenseq}X\x04\x00\x00\x00tRNAq~X\x05\x00\x00\x00snRNAq\x7fX\x06\x00\x00\x00snoRNAq\x80X\x04\x00\x00\x00rRNAq\x81X\x05\x00\x00\x00piRNAq\x82X\x05\x00\x00\x00ncRNAq\x83X\x05\x00\x00\x00miRNAq\x84X\x07\x00\x00\x00lincRNAq\x85X\x12\x00\x00\x00protein_coding_CDSq\x86X\x12\x00\x00\x00protein_coding_UTRq\x87X\x1a\x00\x00\x00protein_coding_pure_intronq\x88X\n\x00\x00\x00pseudogeneq\x89X\t\x00\x00\x00antisenseq\x8aX\x14\x00\x00\x00DNA_transposons_rmskq\x8bX\x14\x00\x00\x00RNA_transposons_rmskq\x8cX\x0f\x00\x00\x00satellites_rmskq\x8dX\x13\x00\x00\x00simple_repeats_rmskq\x8eeX\x08\x00\x00\x00data_dirq\x8fX\x04\x00\x00\x00dataq\x90X\t\x00\x00\x00annot_dirq\x91X_\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genesq\x92X\x0f\x00\x00\x00local_annot_dirq\x93X\x0b\x00\x00\x00annotationsq\x94X\x07\x00\x00\x00alignerq\x95X\x07\x00\x00\x00bowtie2q\x96X\x05\x00\x00\x00indexq\x97h\x18X\x0b\x00\x00\x00convert_dirq\x98X=\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Wormbase/WS253/geneIDsq\x99X\n\x00\x00\x00output_dirq\x9aX\x07\x00\x00\x00resultsq\x9bX\x07\x00\x00\x00log_dirq\x9cX\x04\x00\x00\x00logsq\x9duX\x04\x00\x00\x00ruleq\x9eX\r\x00\x00\x00map_on_genomeq\x9fub.')
######## Original script #########
from snakemake.shell import shell
cmd = """
genome_dir="${{HOME}}/Genomes"
genome="C_elegans"
cmd="bowtie2 --seed 123 -t -L 6 -i S,1,0.8 -N 0 --mm -x {snakemake.params.index} -U {snakemake.input[0]} --no-unal --un-gz {snakemake.output.nomap} -S {snakemake.output.sam}"
echo ${{cmd}}
eval ${{cmd}} 1> {snakemake.log.map_log} 2> {snakemake.log.map_err}
"""
shell(cmd)
######## Snakemake header ########
import sys; sys.path.insert(0, "/home/bli/.local/lib/python3.6/site-packages"); import pickle; snakemake = pickle.loads(b'\x80\x03csnakemake.script\nSnakemake\nq\x00)\x81q\x01}q\x02(X\x05\x00\x00\x00inputq\x03csnakemake.io\nInputFiles\nq\x04)\x81q\x05X[\x00\x00\x00results/bowtie2/mapped_C_elegans/reads/WT_HS30RT120_1_18-26_on_C_elegans/all_siRNA.fastq.gzq\x06a}q\x07X\x06\x00\x00\x00_namesq\x08}q\tsbX\x06\x00\x00\x00outputq\ncsnakemake.io\nOutputFiles\nq\x0b)\x81q\x0c(XJ\x00\x00\x00results/bowtie2/mapped_C_elegans/WT_HS30RT120_1/all_siRNA_on_C_elegans.samq\rX\\\x00\x00\x00results/bowtie2/not_mapped_C_elegans/WT_HS30RT120_1_all_siRNA_unmapped_on_C_elegans.fastq.gzq\x0ee}q\x0f(h\x08}q\x10(X\x03\x00\x00\x00samq\x11K\x00N\x86q\x12X\x05\x00\x00\x00nomapq\x13K\x01N\x86q\x14uh\x11h\rh\x13h\x0eubX\x06\x00\x00\x00paramsq\x15csnakemake.io\nParams\nq\x16)\x81q\x17Xk\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/genomeq\x18a}q\x19(h\x08}q\x1aX\x05\x00\x00\x00indexq\x1bK\x00N\x86q\x1csh\x1bh\x18ubX\t\x00\x00\x00wildcardsq\x1dcsnakemake.io\nWildcards\nq\x1e)\x81q\x1f(X\x02\x00\x00\x00WTq X\t\x00\x00\x00HS30RT120q!X\x01\x00\x00\x001q"X\t\x00\x00\x00all_siRNAq#e}q$(h\x08}q%(X\x03\x00\x00\x00libq&K\x00N\x86q\'X\x05\x00\x00\x00treatq(K\x01N\x86q)X\x03\x00\x00\x00repq*K\x02N\x86q+X\t\x00\x00\x00read_typeq,K\x03N\x86q-uX\x03\x00\x00\x00libq.h X\x05\x00\x00\x00treatq/h!X\x03\x00\x00\x00repq0h"X\t\x00\x00\x00read_typeq1h#ubX\x07\x00\x00\x00threadsq2K\x01X\t\x00\x00\x00resourcesq3csnakemake.io\nResources\nq4)\x81q5(K\x01K\x01e}q6(h\x08}q7(X\x06\x00\x00\x00_coresq8K\x00N\x86q9X\x06\x00\x00\x00_nodesq:K\x01N\x86q;uh8K\x01h:K\x01ubX\x03\x00\x00\x00logq<csnakemake.io\nLog\nq=)\x81q>(X/\x00\x00\x00logs/map_on_genome_WT_HS30RT120_1_all_siRNA.logq?X/\x00\x00\x00logs/map_on_genome_WT_HS30RT120_1_all_siRNA.errq@e}qA(h\x08}qB(X\x07\x00\x00\x00map_logqCK\x00N\x86qDX\x07\x00\x00\x00map_errqEK\x01N\x86qFuhCh?hEh@ubX\x06\x00\x00\x00configqG}qH(X\x07\x00\x00\x00lib2rawqIccollections\nOrderedDict\nqJ)RqK(X\x02\x00\x00\x00WTqLXQ\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/wt{treat}_{rep}.fastq.gzqMX\x04\x00\x00\x00prg1qNXS\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/prg1{treat}_{rep}.fastq.gzqOuX\t\x00\x00\x00lib2adaptqPhJ)RqQ(hLX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqRhNX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqSuX\x07\x00\x00\x00missingqT]qUhJ)RqVahLX\x02\x00\x00\x00WTqWX\x06\x00\x00\x00mutantqXX\x04\x00\x00\x00prg1qYX\x05\x00\x00\x00trim5qZX\x01\x00\x00\x004q[X\x05\x00\x00\x00trim3q\\h[X\n\x00\x00\x00treatmentsq]]q^(X\x02\x00\x00\x00RTq_X\x04\x00\x00\x00HS30q`X\t\x00\x00\x00HS30RT120qaeX\n\x00\x00\x00replicatesqb]qc(h"X\x01\x00\x00\x002qdeX\x07\x00\x00\x00min_lenqeX\x02\x00\x00\x0018qfX\x07\x00\x00\x00max_lenqgX\x02\x00\x00\x0026qhX\t\x00\x00\x00positionsqi]qj(X\x05\x00\x00\x00firstqkX\x04\x00\x00\x00lastqleX\x0c\x00\x00\x00orientationsqm]qn(X\x03\x00\x00\x00fwdqoX\x03\x00\x00\x00revqpX\x03\x00\x00\x00allqqeX\x0b\x00\x00\x00small_typesqr]qs(X\x07\x00\x00\x00prot_siqtX\x05\x00\x00\x00te_siquX\x07\x00\x00\x00pseu_siqvX\x08\x00\x00\x00satel_siqwX\t\x00\x00\x00simrep_siqxX\x02\x00\x00\x00piqyX\x02\x00\x00\x00miqzX\x08\x00\x00\x00prot_siuq{X\x06\x00\x00\x00te_siuq|X\x08\x00\x00\x00pseu_siuq}X\t\x00\x00\x00satel_siuq~X\n\x00\x00\x00simrep_siuq\x7feX\x0e\x00\x00\x00count_biotypesq\x80]q\x81(X\t\x00\x00\x00antisenseq\x82X\x04\x00\x00\x00tRNAq\x83X\x05\x00\x00\x00snRNAq\x84X\x06\x00\x00\x00snoRNAq\x85X\x04\x00\x00\x00rRNAq\x86X\x05\x00\x00\x00piRNAq\x87X\x05\x00\x00\x00ncRNAq\x88X\x05\x00\x00\x00miRNAq\x89X\x07\x00\x00\x00lincRNAq\x8aX\x0e\x00\x00\x00protein_codingq\x8bX\n\x00\x00\x00pseudogeneq\x8cX\t\x00\x00\x00antisenseq\x8dX\x14\x00\x00\x00DNA_transposons_rmskq\x8eX\x14\x00\x00\x00RNA_transposons_rmskq\x8fX\x0f\x00\x00\x00satellites_rmskq\x90X\x13\x00\x00\x00simple_repeats_rmskq\x91eX\x0e\x00\x00\x00annot_biotypesq\x92]q\x93(X\t\x00\x00\x00antisenseq\x94X\x04\x00\x00\x00tRNAq\x95X\x05\x00\x00\x00snRNAq\x96X\x06\x00\x00\x00snoRNAq\x97X\x04\x00\x00\x00rRNAq\x98X\x05\x00\x00\x00piRNAq\x99X\x05\x00\x00\x00ncRNAq\x9aX\x05\x00\x00\x00miRNAq\x9bX\x07\x00\x00\x00lincRNAq\x9cX\x12\x00\x00\x00protein_coding_CDSq\x9dX\x12\x00\x00\x00protein_coding_UTRq\x9eX\x1a\x00\x00\x00protein_coding_pure_intronq\x9fX\n\x00\x00\x00pseudogeneq\xa0X\t\x00\x00\x00antisenseq\xa1X\x14\x00\x00\x00DNA_transposons_rmskq\xa2X\x14\x00\x00\x00RNA_transposons_rmskq\xa3X\x0f\x00\x00\x00satellites_rmskq\xa4X\x13\x00\x00\x00simple_repeats_rmskq\xa5eX\n\x00\x00\x00gene_listsq\xa6]q\xa7X%\x00\x00\x00replication_dependent_octamer_histoneq\xa8aX\x08\x00\x00\x00data_dirq\xa9X\x04\x00\x00\x00dataq\xaaX\t\x00\x00\x00annot_dirq\xabX_\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genesq\xacX\x0f\x00\x00\x00local_annot_dirq\xadX\x0b\x00\x00\x00annotationsq\xaeX\x07\x00\x00\x00alignerq\xafX\x07\x00\x00\x00bowtie2q\xb0X\x05\x00\x00\x00indexq\xb1h\x18X\x0b\x00\x00\x00convert_dirq\xb2X=\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Wormbase/WS253/geneIDsq\xb3X\n\x00\x00\x00output_dirq\xb4X\x07\x00\x00\x00resultsq\xb5X\x07\x00\x00\x00log_dirq\xb6X\x04\x00\x00\x00logsq\xb7uX\x04\x00\x00\x00ruleq\xb8X\r\x00\x00\x00map_on_genomeq\xb9ub.')
######## Original script #########
from snakemake.shell import shell
cmd = """
genome_dir="${{HOME}}/Genomes"
genome="C_elegans"
cmd="bowtie2 --seed 123 -t -L 6 -i S,1,0.8 -N 0 --mm -x {snakemake.params.index} -U {snakemake.input[0]} --no-unal --un-gz {snakemake.output.nomap} -S {snakemake.output.sam}"
echo ${{cmd}}
eval ${{cmd}} 1> {snakemake.log.map_log} 2> {snakemake.log.map_err}
"""
shell(cmd)
######## Snakemake header ########
import sys; sys.path.insert(0, "/home/bli/.local/lib/python3.6/site-packages"); import pickle; snakemake = pickle.loads(b'\x80\x03csnakemake.script\nSnakemake\nq\x00)\x81q\x01}q\x02(X\x05\x00\x00\x00inputq\x03csnakemake.io\nInputFiles\nq\x04)\x81q\x05XT\x00\x00\x00results/bowtie2/mapped_C_elegans/reads/prg1_HS30_1_siRNA_on_C_elegans/siRNA.fastq.gzq\x06a}q\x07X\x06\x00\x00\x00_namesq\x08}q\tsbX\x06\x00\x00\x00outputq\ncsnakemake.io\nOutputFiles\nq\x0b)\x81q\x0c(XC\x00\x00\x00results/bowtie2/mapped_C_elegans/prg1_HS30_1/siRNA_on_C_elegans.samq\rXU\x00\x00\x00results/bowtie2/not_mapped_C_elegans/prg1_HS30_1_siRNA_unmapped_on_C_elegans.fastq.gzq\x0ee}q\x0f(h\x08}q\x10(X\x03\x00\x00\x00samq\x11K\x00N\x86q\x12X\x05\x00\x00\x00nomapq\x13K\x01N\x86q\x14uh\x11h\rh\x13h\x0eubX\x06\x00\x00\x00paramsq\x15csnakemake.io\nParams\nq\x16)\x81q\x17Xk\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/genomeq\x18a}q\x19(h\x08}q\x1aX\x05\x00\x00\x00indexq\x1bK\x00N\x86q\x1csh\x1bh\x18ubX\t\x00\x00\x00wildcardsq\x1dcsnakemake.io\nWildcards\nq\x1e)\x81q\x1f(X\x04\x00\x00\x00prg1q X\x04\x00\x00\x00HS30q!X\x01\x00\x00\x001q"X\x05\x00\x00\x00siRNAq#e}q$(h\x08}q%(X\x03\x00\x00\x00libq&K\x00N\x86q\'X\x05\x00\x00\x00treatq(K\x01N\x86q)X\x03\x00\x00\x00repq*K\x02N\x86q+X\t\x00\x00\x00read_typeq,K\x03N\x86q-uX\x03\x00\x00\x00libq.h X\x05\x00\x00\x00treatq/h!X\x03\x00\x00\x00repq0h"X\t\x00\x00\x00read_typeq1h#ubX\x07\x00\x00\x00threadsq2K\x01X\t\x00\x00\x00resourcesq3csnakemake.io\nResources\nq4)\x81q5(K\x01K\x01e}q6(h\x08}q7(X\x06\x00\x00\x00_coresq8K\x00N\x86q9X\x06\x00\x00\x00_nodesq:K\x01N\x86q;uh8K\x01h:K\x01ubX\x03\x00\x00\x00logq<csnakemake.io\nLog\nq=)\x81q>(X(\x00\x00\x00logs/map_on_genome_prg1_HS30_1_siRNA.logq?X(\x00\x00\x00logs/map_on_genome_prg1_HS30_1_siRNA.errq@e}qA(h\x08}qB(X\x07\x00\x00\x00map_logqCK\x00N\x86qDX\x07\x00\x00\x00map_errqEK\x01N\x86qFuhCh?hEh@ubX\x06\x00\x00\x00configqG}qH(X\x07\x00\x00\x00lib2rawqIccollections\nOrderedDict\nqJ)RqK(X\x02\x00\x00\x00WTqLXQ\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/wt{treat}_{rep}.fastq.gzqMX\x04\x00\x00\x00prg1qNXS\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/prg1{treat}_{rep}.fastq.gzqOuX\t\x00\x00\x00lib2adaptqPhJ)RqQ(hLX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqRhNX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqSuX\x07\x00\x00\x00missingqT]qUhJ)RqVahLX\x02\x00\x00\x00WTqWX\x06\x00\x00\x00mutantqXX\x04\x00\x00\x00prg1qYX\x05\x00\x00\x00trim5qZX\x01\x00\x00\x004q[X\x05\x00\x00\x00trim3q\\h[X\n\x00\x00\x00treatmentsq]]q^(X\x02\x00\x00\x00RTq_X\x04\x00\x00\x00HS30q`X\t\x00\x00\x00HS30RT120qaeX\n\x00\x00\x00replicatesqb]qc(h"X\x01\x00\x00\x002qdeX\x07\x00\x00\x00min_lenqeX\x02\x00\x00\x0018qfX\x07\x00\x00\x00max_lenqgX\x02\x00\x00\x0026qhX\x0e\x00\x00\x00count_biotypesqi]qj(X\t\x00\x00\x00antisenseqkX\x04\x00\x00\x00tRNAqlX\x05\x00\x00\x00snRNAqmX\x06\x00\x00\x00snoRNAqnX\x04\x00\x00\x00rRNAqoX\x05\x00\x00\x00piRNAqpX\x05\x00\x00\x00ncRNAqqX\x05\x00\x00\x00miRNAqrX\x07\x00\x00\x00lincRNAqsX\x0e\x00\x00\x00protein_codingqtX\n\x00\x00\x00pseudogenequX\t\x00\x00\x00antisenseqvX\x14\x00\x00\x00DNA_transposons_rmskqwX\x14\x00\x00\x00RNA_transposons_rmskqxX\x0f\x00\x00\x00satellites_rmskqyX\x13\x00\x00\x00simple_repeats_rmskqzeX\x0e\x00\x00\x00annot_biotypesq{]q|(X\t\x00\x00\x00antisenseq}X\x04\x00\x00\x00tRNAq~X\x05\x00\x00\x00snRNAq\x7fX\x06\x00\x00\x00snoRNAq\x80X\x04\x00\x00\x00rRNAq\x81X\x05\x00\x00\x00piRNAq\x82X\x05\x00\x00\x00ncRNAq\x83X\x05\x00\x00\x00miRNAq\x84X\x07\x00\x00\x00lincRNAq\x85X\x12\x00\x00\x00protein_coding_CDSq\x86X\x12\x00\x00\x00protein_coding_UTRq\x87X\x1a\x00\x00\x00protein_coding_pure_intronq\x88X\n\x00\x00\x00pseudogeneq\x89X\t\x00\x00\x00antisenseq\x8aX\x14\x00\x00\x00DNA_transposons_rmskq\x8bX\x14\x00\x00\x00RNA_transposons_rmskq\x8cX\x0f\x00\x00\x00satellites_rmskq\x8dX\x13\x00\x00\x00simple_repeats_rmskq\x8eeX\x08\x00\x00\x00data_dirq\x8fX\x04\x00\x00\x00dataq\x90X\t\x00\x00\x00annot_dirq\x91X_\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genesq\x92X\x0f\x00\x00\x00local_annot_dirq\x93X\x0b\x00\x00\x00annotationsq\x94X\x07\x00\x00\x00alignerq\x95X\x07\x00\x00\x00bowtie2q\x96X\x05\x00\x00\x00indexq\x97h\x18X\x0b\x00\x00\x00convert_dirq\x98X=\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Wormbase/WS253/geneIDsq\x99X\n\x00\x00\x00output_dirq\x9aX\x07\x00\x00\x00resultsq\x9bX\x07\x00\x00\x00log_dirq\x9cX\x04\x00\x00\x00logsq\x9duX\x04\x00\x00\x00ruleq\x9eX\r\x00\x00\x00map_on_genomeq\x9fub.')
######## Original script #########
from snakemake.shell import shell
cmd = """
genome_dir="${{HOME}}/Genomes"
genome="C_elegans"
cmd="bowtie2 --seed 123 -t -L 6 -i S,1,0.8 -N 0 --mm -x {snakemake.params.index} -U {snakemake.input[0]} --no-unal --un-gz {snakemake.output.nomap} -S {snakemake.output.sam}"
echo ${{cmd}}
eval ${{cmd}} 1> {snakemake.log.map_log} 2> {snakemake.log.map_err}
"""
shell(cmd)
######## Snakemake header ########
import sys; sys.path.insert(0, "/home/bli/.local/lib/python3.6/site-packages"); import pickle; snakemake = pickle.loads(b'\x80\x03csnakemake.script\nSnakemake\nq\x00)\x81q\x01}q\x02(X\x05\x00\x00\x00inputq\x03csnakemake.io\nInputFiles\nq\x04)\x81q\x05XT\x00\x00\x00results/bowtie2/mapped_C_elegans/reads/WT_RT_2_18-26_on_C_elegans/all_siRNA.fastq.gzq\x06a}q\x07X\x06\x00\x00\x00_namesq\x08}q\tsbX\x06\x00\x00\x00outputq\ncsnakemake.io\nOutputFiles\nq\x0b)\x81q\x0c(XC\x00\x00\x00results/bowtie2/mapped_C_elegans/WT_RT_2/all_siRNA_on_C_elegans.samq\rXU\x00\x00\x00results/bowtie2/not_mapped_C_elegans/WT_RT_2_all_siRNA_unmapped_on_C_elegans.fastq.gzq\x0ee}q\x0f(h\x08}q\x10(X\x03\x00\x00\x00samq\x11K\x00N\x86q\x12X\x05\x00\x00\x00nomapq\x13K\x01N\x86q\x14uh\x11h\rh\x13h\x0eubX\x06\x00\x00\x00paramsq\x15csnakemake.io\nParams\nq\x16)\x81q\x17Xk\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/genomeq\x18a}q\x19(h\x08}q\x1aX\x05\x00\x00\x00indexq\x1bK\x00N\x86q\x1csh\x1bh\x18ubX\t\x00\x00\x00wildcardsq\x1dcsnakemake.io\nWildcards\nq\x1e)\x81q\x1f(X\x02\x00\x00\x00WTq X\x02\x00\x00\x00RTq!X\x01\x00\x00\x002q"X\t\x00\x00\x00all_siRNAq#e}q$(h\x08}q%(X\x03\x00\x00\x00libq&K\x00N\x86q\'X\x05\x00\x00\x00treatq(K\x01N\x86q)X\x03\x00\x00\x00repq*K\x02N\x86q+X\t\x00\x00\x00read_typeq,K\x03N\x86q-uX\x03\x00\x00\x00libq.h X\x05\x00\x00\x00treatq/h!X\x03\x00\x00\x00repq0h"X\t\x00\x00\x00read_typeq1h#ubX\x07\x00\x00\x00threadsq2K\x01X\t\x00\x00\x00resourcesq3csnakemake.io\nResources\nq4)\x81q5(K\x01K\x01e}q6(h\x08}q7(X\x06\x00\x00\x00_coresq8K\x00N\x86q9X\x06\x00\x00\x00_nodesq:K\x01N\x86q;uh8K\x01h:K\x01ubX\x03\x00\x00\x00logq<csnakemake.io\nLog\nq=)\x81q>(X(\x00\x00\x00logs/map_on_genome_WT_RT_2_all_siRNA.logq?X(\x00\x00\x00logs/map_on_genome_WT_RT_2_all_siRNA.errq@e}qA(h\x08}qB(X\x07\x00\x00\x00map_logqCK\x00N\x86qDX\x07\x00\x00\x00map_errqEK\x01N\x86qFuhCh?hEh@ubX\x06\x00\x00\x00configqG}qH(X\x07\x00\x00\x00lib2rawqIccollections\nOrderedDict\nqJ)RqK(X\x02\x00\x00\x00WTqLXQ\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/wt{treat}_{rep}.fastq.gzqMX\x04\x00\x00\x00prg1qNXS\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/prg1{treat}_{rep}.fastq.gzqOuX\t\x00\x00\x00lib2adaptqPhJ)RqQ(hLX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqRhNX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqSuX\x07\x00\x00\x00missingqT]qUhJ)RqVahLX\x02\x00\x00\x00WTqWX\x06\x00\x00\x00mutantqXX\x04\x00\x00\x00prg1qYX\x05\x00\x00\x00trim5qZX\x01\x00\x00\x004q[X\x05\x00\x00\x00trim3q\\h[X\n\x00\x00\x00treatmentsq]]q^(X\x02\x00\x00\x00RTq_X\x04\x00\x00\x00HS30q`X\t\x00\x00\x00HS30RT120qaeX\n\x00\x00\x00replicatesqb]qc(X\x01\x00\x00\x001qdh"eX\x07\x00\x00\x00min_lenqeX\x02\x00\x00\x0018qfX\x07\x00\x00\x00max_lenqgX\x02\x00\x00\x0026qhX\t\x00\x00\x00positionsqi]qj(X\x05\x00\x00\x00firstqkX\x04\x00\x00\x00lastqleX\x0c\x00\x00\x00orientationsqm]qn(X\x03\x00\x00\x00fwdqoX\x03\x00\x00\x00revqpX\x03\x00\x00\x00allqqeX\x0b\x00\x00\x00small_typesqr]qs(X\x07\x00\x00\x00prot_siqtX\x05\x00\x00\x00te_siquX\x07\x00\x00\x00pseu_siqvX\x08\x00\x00\x00satel_siqwX\t\x00\x00\x00simrep_siqxX\x02\x00\x00\x00piqyX\x02\x00\x00\x00miqzX\x08\x00\x00\x00prot_siuq{X\x06\x00\x00\x00te_siuq|X\x08\x00\x00\x00pseu_siuq}X\t\x00\x00\x00satel_siuq~X\n\x00\x00\x00simrep_siuq\x7feX\x0e\x00\x00\x00count_biotypesq\x80]q\x81(X\t\x00\x00\x00antisenseq\x82X\x04\x00\x00\x00tRNAq\x83X\x05\x00\x00\x00snRNAq\x84X\x06\x00\x00\x00snoRNAq\x85X\x04\x00\x00\x00rRNAq\x86X\x05\x00\x00\x00piRNAq\x87X\x05\x00\x00\x00ncRNAq\x88X\x05\x00\x00\x00miRNAq\x89X\x07\x00\x00\x00lincRNAq\x8aX\x0e\x00\x00\x00protein_codingq\x8bX\n\x00\x00\x00pseudogeneq\x8cX\t\x00\x00\x00antisenseq\x8dX\x14\x00\x00\x00DNA_transposons_rmskq\x8eX\x14\x00\x00\x00RNA_transposons_rmskq\x8fX\x0f\x00\x00\x00satellites_rmskq\x90X\x13\x00\x00\x00simple_repeats_rmskq\x91eX\x0e\x00\x00\x00annot_biotypesq\x92]q\x93(X\t\x00\x00\x00antisenseq\x94X\x04\x00\x00\x00tRNAq\x95X\x05\x00\x00\x00snRNAq\x96X\x06\x00\x00\x00snoRNAq\x97X\x04\x00\x00\x00rRNAq\x98X\x05\x00\x00\x00piRNAq\x99X\x05\x00\x00\x00ncRNAq\x9aX\x05\x00\x00\x00miRNAq\x9bX\x07\x00\x00\x00lincRNAq\x9cX\x12\x00\x00\x00protein_coding_CDSq\x9dX\x12\x00\x00\x00protein_coding_UTRq\x9eX\x1a\x00\x00\x00protein_coding_pure_intronq\x9fX\n\x00\x00\x00pseudogeneq\xa0X\t\x00\x00\x00antisenseq\xa1X\x14\x00\x00\x00DNA_transposons_rmskq\xa2X\x14\x00\x00\x00RNA_transposons_rmskq\xa3X\x0f\x00\x00\x00satellites_rmskq\xa4X\x13\x00\x00\x00simple_repeats_rmskq\xa5eX\n\x00\x00\x00gene_listsq\xa6]q\xa7X%\x00\x00\x00replication_dependent_octamer_histoneq\xa8aX\x08\x00\x00\x00data_dirq\xa9X\x04\x00\x00\x00dataq\xaaX\t\x00\x00\x00annot_dirq\xabX_\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genesq\xacX\x0f\x00\x00\x00local_annot_dirq\xadX\x0b\x00\x00\x00annotationsq\xaeX\x07\x00\x00\x00alignerq\xafX\x07\x00\x00\x00bowtie2q\xb0X\x05\x00\x00\x00indexq\xb1h\x18X\x0b\x00\x00\x00convert_dirq\xb2X=\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Wormbase/WS253/geneIDsq\xb3X\n\x00\x00\x00output_dirq\xb4X\x07\x00\x00\x00resultsq\xb5X\x07\x00\x00\x00log_dirq\xb6X\x04\x00\x00\x00logsq\xb7uX\x04\x00\x00\x00ruleq\xb8X\r\x00\x00\x00map_on_genomeq\xb9ub.')
######## Original script #########
from snakemake.shell import shell
cmd = """
genome_dir="${{HOME}}/Genomes"
genome="C_elegans"
cmd="bowtie2 --seed 123 -t -L 6 -i S,1,0.8 -N 0 --mm -x {snakemake.params.index} -U {snakemake.input[0]} --no-unal --un-gz {snakemake.output.nomap} -S {snakemake.output.sam}"
echo ${{cmd}}
eval ${{cmd}} 1> {snakemake.log.map_log} 2> {snakemake.log.map_err}
"""
shell(cmd)
######## Snakemake header ########
import sys; sys.path.insert(0, "/home/bli/.local/lib/python3.6/site-packages"); import pickle; snakemake = pickle.loads(b'\x80\x03csnakemake.script\nSnakemake\nq\x00)\x81q\x01}q\x02(X\x05\x00\x00\x00inputq\x03csnakemake.io\nInputFiles\nq\x04)\x81q\x05XP\x00\x00\x00results/bowtie2/mapped_C_elegans/reads/WT_RT_2_piRNA_on_C_elegans/piRNA.fastq.gzq\x06a}q\x07X\x06\x00\x00\x00_namesq\x08}q\tsbX\x06\x00\x00\x00outputq\ncsnakemake.io\nOutputFiles\nq\x0b)\x81q\x0c(X?\x00\x00\x00results/bowtie2/mapped_C_elegans/WT_RT_2/piRNA_on_C_elegans.samq\rXQ\x00\x00\x00results/bowtie2/not_mapped_C_elegans/WT_RT_2_piRNA_unmapped_on_C_elegans.fastq.gzq\x0ee}q\x0f(h\x08}q\x10(X\x03\x00\x00\x00samq\x11K\x00N\x86q\x12X\x05\x00\x00\x00nomapq\x13K\x01N\x86q\x14uh\x11h\rh\x13h\x0eubX\x06\x00\x00\x00paramsq\x15csnakemake.io\nParams\nq\x16)\x81q\x17Xk\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/genomeq\x18a}q\x19(h\x08}q\x1aX\x05\x00\x00\x00indexq\x1bK\x00N\x86q\x1csh\x1bh\x18ubX\t\x00\x00\x00wildcardsq\x1dcsnakemake.io\nWildcards\nq\x1e)\x81q\x1f(X\x02\x00\x00\x00WTq X\x02\x00\x00\x00RTq!X\x01\x00\x00\x002q"X\x05\x00\x00\x00piRNAq#e}q$(h\x08}q%(X\x03\x00\x00\x00libq&K\x00N\x86q\'X\x05\x00\x00\x00treatq(K\x01N\x86q)X\x03\x00\x00\x00repq*K\x02N\x86q+X\t\x00\x00\x00read_typeq,K\x03N\x86q-uX\x03\x00\x00\x00libq.h X\x05\x00\x00\x00treatq/h!X\x03\x00\x00\x00repq0h"X\t\x00\x00\x00read_typeq1h#ubX\x07\x00\x00\x00threadsq2K\x01X\t\x00\x00\x00resourcesq3csnakemake.io\nResources\nq4)\x81q5(K\x01K\x01e}q6(h\x08}q7(X\x06\x00\x00\x00_coresq8K\x00N\x86q9X\x06\x00\x00\x00_nodesq:K\x01N\x86q;uh8K\x01h:K\x01ubX\x03\x00\x00\x00logq<csnakemake.io\nLog\nq=)\x81q>(X$\x00\x00\x00logs/map_on_genome_WT_RT_2_piRNA.logq?X$\x00\x00\x00logs/map_on_genome_WT_RT_2_piRNA.errq@e}qA(h\x08}qB(X\x07\x00\x00\x00map_logqCK\x00N\x86qDX\x07\x00\x00\x00map_errqEK\x01N\x86qFuhCh?hEh@ubX\x06\x00\x00\x00configqG}qH(X\x07\x00\x00\x00lib2rawqIccollections\nOrderedDict\nqJ)RqK(X\x02\x00\x00\x00WTqLXQ\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/wt{treat}_{rep}.fastq.gzqMX\x04\x00\x00\x00prg1qNXS\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/prg1{treat}_{rep}.fastq.gzqOuX\t\x00\x00\x00lib2adaptqPhJ)RqQ(hLX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqRhNX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqSuX\x07\x00\x00\x00missingqT]qUhJ)RqVahLX\x02\x00\x00\x00WTqWX\x06\x00\x00\x00mutantqXX\x04\x00\x00\x00prg1qYX\x05\x00\x00\x00trim5qZX\x01\x00\x00\x004q[X\x05\x00\x00\x00trim3q\\h[X\n\x00\x00\x00treatmentsq]]q^(X\x02\x00\x00\x00RTq_X\x04\x00\x00\x00HS30q`X\t\x00\x00\x00HS30RT120qaeX\n\x00\x00\x00replicatesqb]qc(X\x01\x00\x00\x001qdh"eX\x07\x00\x00\x00min_lenqeX\x02\x00\x00\x0018qfX\x07\x00\x00\x00max_lenqgX\x02\x00\x00\x0026qhX\x0e\x00\x00\x00count_biotypesqi]qj(X\t\x00\x00\x00antisenseqkX\x04\x00\x00\x00tRNAqlX\x05\x00\x00\x00snRNAqmX\x06\x00\x00\x00snoRNAqnX\x04\x00\x00\x00rRNAqoX\x05\x00\x00\x00piRNAqpX\x05\x00\x00\x00ncRNAqqX\x05\x00\x00\x00miRNAqrX\x07\x00\x00\x00lincRNAqsX\x0e\x00\x00\x00protein_codingqtX\n\x00\x00\x00pseudogenequX\t\x00\x00\x00antisenseqvX\x14\x00\x00\x00DNA_transposons_rmskqwX\x14\x00\x00\x00RNA_transposons_rmskqxX\x0f\x00\x00\x00satellites_rmskqyX\x13\x00\x00\x00simple_repeats_rmskqzeX\x0e\x00\x00\x00annot_biotypesq{]q|(X\t\x00\x00\x00antisenseq}X\x04\x00\x00\x00tRNAq~X\x05\x00\x00\x00snRNAq\x7fX\x06\x00\x00\x00snoRNAq\x80X\x04\x00\x00\x00rRNAq\x81X\x05\x00\x00\x00piRNAq\x82X\x05\x00\x00\x00ncRNAq\x83X\x05\x00\x00\x00miRNAq\x84X\x07\x00\x00\x00lincRNAq\x85X\x12\x00\x00\x00protein_coding_CDSq\x86X\x12\x00\x00\x00protein_coding_UTRq\x87X\x1a\x00\x00\x00protein_coding_pure_intronq\x88X\n\x00\x00\x00pseudogeneq\x89X\t\x00\x00\x00antisenseq\x8aX\x14\x00\x00\x00DNA_transposons_rmskq\x8bX\x14\x00\x00\x00RNA_transposons_rmskq\x8cX\x0f\x00\x00\x00satellites_rmskq\x8dX\x13\x00\x00\x00simple_repeats_rmskq\x8eeX\x08\x00\x00\x00data_dirq\x8fX\x04\x00\x00\x00dataq\x90X\t\x00\x00\x00annot_dirq\x91X_\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genesq\x92X\x0f\x00\x00\x00local_annot_dirq\x93X\x0b\x00\x00\x00annotationsq\x94X\x07\x00\x00\x00alignerq\x95X\x07\x00\x00\x00bowtie2q\x96X\x05\x00\x00\x00indexq\x97h\x18X\x0b\x00\x00\x00convert_dirq\x98X=\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Wormbase/WS253/geneIDsq\x99X\n\x00\x00\x00output_dirq\x9aX\x07\x00\x00\x00resultsq\x9bX\x07\x00\x00\x00log_dirq\x9cX\x04\x00\x00\x00logsq\x9duX\x04\x00\x00\x00ruleq\x9eX\r\x00\x00\x00map_on_genomeq\x9fub.')
######## Original script #########
from snakemake.shell import shell
cmd = """
genome_dir="${{HOME}}/Genomes"
genome="C_elegans"
cmd="bowtie2 --seed 123 -t -L 6 -i S,1,0.8 -N 0 --mm -x {snakemake.params.index} -U {snakemake.input[0]} --no-unal --un-gz {snakemake.output.nomap} -S {snakemake.output.sam}"
echo ${{cmd}}
eval ${{cmd}} 1> {snakemake.log.map_log} 2> {snakemake.log.map_err}
"""
shell(cmd)
######## Snakemake header ########
import sys; sys.path.insert(0, "/home/bli/.local/lib/python3.6/site-packages"); import pickle; snakemake = pickle.loads(b'\x80\x03csnakemake.script\nSnakemake\nq\x00)\x81q\x01}q\x02(X\x05\x00\x00\x00inputq\x03csnakemake.io\nInputFiles\nq\x04)\x81q\x05XT\x00\x00\x00results/bowtie2/mapped_C_elegans/reads/WT_RT_1_18-26_on_C_elegans/all_siRNA.fastq.gzq\x06a}q\x07X\x06\x00\x00\x00_namesq\x08}q\tsbX\x06\x00\x00\x00outputq\ncsnakemake.io\nOutputFiles\nq\x0b)\x81q\x0c(XC\x00\x00\x00results/bowtie2/mapped_C_elegans/WT_RT_1/all_siRNA_on_C_elegans.samq\rXU\x00\x00\x00results/bowtie2/not_mapped_C_elegans/WT_RT_1_all_siRNA_unmapped_on_C_elegans.fastq.gzq\x0ee}q\x0f(h\x08}q\x10(X\x03\x00\x00\x00samq\x11K\x00N\x86q\x12X\x05\x00\x00\x00nomapq\x13K\x01N\x86q\x14uh\x11h\rh\x13h\x0eubX\x06\x00\x00\x00paramsq\x15csnakemake.io\nParams\nq\x16)\x81q\x17Xk\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/genomeq\x18a}q\x19(h\x08}q\x1aX\x05\x00\x00\x00indexq\x1bK\x00N\x86q\x1csh\x1bh\x18ubX\t\x00\x00\x00wildcardsq\x1dcsnakemake.io\nWildcards\nq\x1e)\x81q\x1f(X\x02\x00\x00\x00WTq X\x02\x00\x00\x00RTq!X\x01\x00\x00\x001q"X\t\x00\x00\x00all_siRNAq#e}q$(h\x08}q%(X\x03\x00\x00\x00libq&K\x00N\x86q\'X\x05\x00\x00\x00treatq(K\x01N\x86q)X\x03\x00\x00\x00repq*K\x02N\x86q+X\t\x00\x00\x00read_typeq,K\x03N\x86q-uX\x03\x00\x00\x00libq.h X\x05\x00\x00\x00treatq/h!X\x03\x00\x00\x00repq0h"X\t\x00\x00\x00read_typeq1h#ubX\x07\x00\x00\x00threadsq2K\x01X\t\x00\x00\x00resourcesq3csnakemake.io\nResources\nq4)\x81q5(K\x01K\x01e}q6(h\x08}q7(X\x06\x00\x00\x00_coresq8K\x00N\x86q9X\x06\x00\x00\x00_nodesq:K\x01N\x86q;uh8K\x01h:K\x01ubX\x03\x00\x00\x00logq<csnakemake.io\nLog\nq=)\x81q>(X(\x00\x00\x00logs/map_on_genome_WT_RT_1_all_siRNA.logq?X(\x00\x00\x00logs/map_on_genome_WT_RT_1_all_siRNA.errq@e}qA(h\x08}qB(X\x07\x00\x00\x00map_logqCK\x00N\x86qDX\x07\x00\x00\x00map_errqEK\x01N\x86qFuhCh?hEh@ubX\x06\x00\x00\x00configqG}qH(X\x07\x00\x00\x00lib2rawqIccollections\nOrderedDict\nqJ)RqK(X\x02\x00\x00\x00WTqLXQ\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/wt{treat}_{rep}.fastq.gzqMX\x04\x00\x00\x00prg1qNXS\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/prg1{treat}_{rep}.fastq.gzqOuX\t\x00\x00\x00lib2adaptqPhJ)RqQ(hLX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqRhNX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqSuX\x07\x00\x00\x00missingqT]qUhJ)RqVahLX\x02\x00\x00\x00WTqWX\x06\x00\x00\x00mutantqXX\x04\x00\x00\x00prg1qYX\x05\x00\x00\x00trim5qZX\x01\x00\x00\x004q[X\x05\x00\x00\x00trim3q\\h[X\n\x00\x00\x00treatmentsq]]q^(X\x02\x00\x00\x00RTq_X\x04\x00\x00\x00HS30q`X\t\x00\x00\x00HS30RT120qaeX\n\x00\x00\x00replicatesqb]qc(h"X\x01\x00\x00\x002qdeX\x07\x00\x00\x00min_lenqeX\x02\x00\x00\x0018qfX\x07\x00\x00\x00max_lenqgX\x02\x00\x00\x0026qhX\t\x00\x00\x00positionsqi]qj(X\x05\x00\x00\x00firstqkX\x04\x00\x00\x00lastqleX\x0c\x00\x00\x00orientationsqm]qn(X\x03\x00\x00\x00fwdqoX\x03\x00\x00\x00revqpX\x03\x00\x00\x00allqqeX\x0b\x00\x00\x00small_typesqr]qs(X\x07\x00\x00\x00prot_siqtX\x05\x00\x00\x00te_siquX\x07\x00\x00\x00pseu_siqvX\x08\x00\x00\x00satel_siqwX\t\x00\x00\x00simrep_siqxX\x02\x00\x00\x00piqyX\x02\x00\x00\x00miqzX\x08\x00\x00\x00prot_siuq{X\x06\x00\x00\x00te_siuq|X\x08\x00\x00\x00pseu_siuq}X\t\x00\x00\x00satel_siuq~X\n\x00\x00\x00simrep_siuq\x7feX\x0e\x00\x00\x00count_biotypesq\x80]q\x81(X\t\x00\x00\x00antisenseq\x82X\x04\x00\x00\x00tRNAq\x83X\x05\x00\x00\x00snRNAq\x84X\x06\x00\x00\x00snoRNAq\x85X\x04\x00\x00\x00rRNAq\x86X\x05\x00\x00\x00piRNAq\x87X\x05\x00\x00\x00ncRNAq\x88X\x05\x00\x00\x00miRNAq\x89X\x07\x00\x00\x00lincRNAq\x8aX\x0e\x00\x00\x00protein_codingq\x8bX\n\x00\x00\x00pseudogeneq\x8cX\t\x00\x00\x00antisenseq\x8dX\x14\x00\x00\x00DNA_transposons_rmskq\x8eX\x14\x00\x00\x00RNA_transposons_rmskq\x8fX\x0f\x00\x00\x00satellites_rmskq\x90X\x13\x00\x00\x00simple_repeats_rmskq\x91eX\x0e\x00\x00\x00annot_biotypesq\x92]q\x93(X\t\x00\x00\x00antisenseq\x94X\x04\x00\x00\x00tRNAq\x95X\x05\x00\x00\x00snRNAq\x96X\x06\x00\x00\x00snoRNAq\x97X\x04\x00\x00\x00rRNAq\x98X\x05\x00\x00\x00piRNAq\x99X\x05\x00\x00\x00ncRNAq\x9aX\x05\x00\x00\x00miRNAq\x9bX\x07\x00\x00\x00lincRNAq\x9cX\x12\x00\x00\x00protein_coding_CDSq\x9dX\x12\x00\x00\x00protein_coding_UTRq\x9eX\x1a\x00\x00\x00protein_coding_pure_intronq\x9fX\n\x00\x00\x00pseudogeneq\xa0X\t\x00\x00\x00antisenseq\xa1X\x14\x00\x00\x00DNA_transposons_rmskq\xa2X\x14\x00\x00\x00RNA_transposons_rmskq\xa3X\x0f\x00\x00\x00satellites_rmskq\xa4X\x13\x00\x00\x00simple_repeats_rmskq\xa5eX\n\x00\x00\x00gene_listsq\xa6]q\xa7X%\x00\x00\x00replication_dependent_octamer_histoneq\xa8aX\x08\x00\x00\x00data_dirq\xa9X\x04\x00\x00\x00dataq\xaaX\t\x00\x00\x00annot_dirq\xabX_\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genesq\xacX\x0f\x00\x00\x00local_annot_dirq\xadX\x0b\x00\x00\x00annotationsq\xaeX\x07\x00\x00\x00alignerq\xafX\x07\x00\x00\x00bowtie2q\xb0X\x05\x00\x00\x00indexq\xb1h\x18X\x0b\x00\x00\x00convert_dirq\xb2X=\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Wormbase/WS253/geneIDsq\xb3X\n\x00\x00\x00output_dirq\xb4X\x07\x00\x00\x00resultsq\xb5X\x07\x00\x00\x00log_dirq\xb6X\x04\x00\x00\x00logsq\xb7uX\x04\x00\x00\x00ruleq\xb8X\r\x00\x00\x00map_on_genomeq\xb9ub.')
######## Original script #########
from snakemake.shell import shell
cmd = """
genome_dir="${{HOME}}/Genomes"
genome="C_elegans"
cmd="bowtie2 --seed 123 -t -L 6 -i S,1,0.8 -N 0 --mm -x {snakemake.params.index} -U {snakemake.input[0]} --no-unal --un-gz {snakemake.output.nomap} -S {snakemake.output.sam}"
echo ${{cmd}}
eval ${{cmd}} 1> {snakemake.log.map_log} 2> {snakemake.log.map_err}
"""
shell(cmd)
######## Snakemake header ########
import sys; sys.path.insert(0, "/home/bli/.local/lib/python3.6/site-packages"); import pickle; snakemake = pickle.loads(b'\x80\x03csnakemake.script\nSnakemake\nq\x00)\x81q\x01}q\x02(X\x05\x00\x00\x00inputq\x03csnakemake.io\nInputFiles\nq\x04)\x81q\x05XW\x00\x00\x00results/bowtie2/mapped_C_elegans/reads/WT_HS30RT120_2_piRNA_on_C_elegans/piRNA.fastq.gzq\x06a}q\x07X\x06\x00\x00\x00_namesq\x08}q\tsbX\x06\x00\x00\x00outputq\ncsnakemake.io\nOutputFiles\nq\x0b)\x81q\x0c(XF\x00\x00\x00results/bowtie2/mapped_C_elegans/WT_HS30RT120_2/piRNA_on_C_elegans.samq\rXX\x00\x00\x00results/bowtie2/not_mapped_C_elegans/WT_HS30RT120_2_piRNA_unmapped_on_C_elegans.fastq.gzq\x0ee}q\x0f(h\x08}q\x10(X\x03\x00\x00\x00samq\x11K\x00N\x86q\x12X\x05\x00\x00\x00nomapq\x13K\x01N\x86q\x14uh\x11h\rh\x13h\x0eubX\x06\x00\x00\x00paramsq\x15csnakemake.io\nParams\nq\x16)\x81q\x17Xk\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/genomeq\x18a}q\x19(h\x08}q\x1aX\x05\x00\x00\x00indexq\x1bK\x00N\x86q\x1csh\x1bh\x18ubX\t\x00\x00\x00wildcardsq\x1dcsnakemake.io\nWildcards\nq\x1e)\x81q\x1f(X\x02\x00\x00\x00WTq X\t\x00\x00\x00HS30RT120q!X\x01\x00\x00\x002q"X\x05\x00\x00\x00piRNAq#e}q$(h\x08}q%(X\x03\x00\x00\x00libq&K\x00N\x86q\'X\x05\x00\x00\x00treatq(K\x01N\x86q)X\x03\x00\x00\x00repq*K\x02N\x86q+X\t\x00\x00\x00read_typeq,K\x03N\x86q-uX\x03\x00\x00\x00libq.h X\x05\x00\x00\x00treatq/h!X\x03\x00\x00\x00repq0h"X\t\x00\x00\x00read_typeq1h#ubX\x07\x00\x00\x00threadsq2K\x01X\t\x00\x00\x00resourcesq3csnakemake.io\nResources\nq4)\x81q5(K\x01K\x01e}q6(h\x08}q7(X\x06\x00\x00\x00_coresq8K\x00N\x86q9X\x06\x00\x00\x00_nodesq:K\x01N\x86q;uh8K\x01h:K\x01ubX\x03\x00\x00\x00logq<csnakemake.io\nLog\nq=)\x81q>(X+\x00\x00\x00logs/map_on_genome_WT_HS30RT120_2_piRNA.logq?X+\x00\x00\x00logs/map_on_genome_WT_HS30RT120_2_piRNA.errq@e}qA(h\x08}qB(X\x07\x00\x00\x00map_logqCK\x00N\x86qDX\x07\x00\x00\x00map_errqEK\x01N\x86qFuhCh?hEh@ubX\x06\x00\x00\x00configqG}qH(X\x07\x00\x00\x00lib2rawqIccollections\nOrderedDict\nqJ)RqK(X\x02\x00\x00\x00WTqLXQ\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/wt{treat}_{rep}.fastq.gzqMX\x04\x00\x00\x00prg1qNXS\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/prg1{treat}_{rep}.fastq.gzqOuX\t\x00\x00\x00lib2adaptqPhJ)RqQ(hLX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqRhNX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqSuX\x07\x00\x00\x00missingqT]qUhJ)RqVahLX\x02\x00\x00\x00WTqWX\x06\x00\x00\x00mutantqXX\x04\x00\x00\x00prg1qYX\x05\x00\x00\x00trim5qZX\x01\x00\x00\x004q[X\x05\x00\x00\x00trim3q\\h[X\n\x00\x00\x00treatmentsq]]q^(X\x02\x00\x00\x00RTq_X\x04\x00\x00\x00HS30q`X\t\x00\x00\x00HS30RT120qaeX\n\x00\x00\x00replicatesqb]qc(X\x01\x00\x00\x001qdh"eX\x07\x00\x00\x00min_lenqeX\x02\x00\x00\x0018qfX\x07\x00\x00\x00max_lenqgX\x02\x00\x00\x0026qhX\x0e\x00\x00\x00count_biotypesqi]qj(X\t\x00\x00\x00antisenseqkX\x04\x00\x00\x00tRNAqlX\x05\x00\x00\x00snRNAqmX\x06\x00\x00\x00snoRNAqnX\x04\x00\x00\x00rRNAqoX\x05\x00\x00\x00piRNAqpX\x05\x00\x00\x00ncRNAqqX\x05\x00\x00\x00miRNAqrX\x07\x00\x00\x00lincRNAqsX\x0e\x00\x00\x00protein_codingqtX\n\x00\x00\x00pseudogenequX\t\x00\x00\x00antisenseqvX\x14\x00\x00\x00DNA_transposons_rmskqwX\x14\x00\x00\x00RNA_transposons_rmskqxX\x0f\x00\x00\x00satellites_rmskqyX\x13\x00\x00\x00simple_repeats_rmskqzeX\x0e\x00\x00\x00annot_biotypesq{]q|(X\t\x00\x00\x00antisenseq}X\x04\x00\x00\x00tRNAq~X\x05\x00\x00\x00snRNAq\x7fX\x06\x00\x00\x00snoRNAq\x80X\x04\x00\x00\x00rRNAq\x81X\x05\x00\x00\x00piRNAq\x82X\x05\x00\x00\x00ncRNAq\x83X\x05\x00\x00\x00miRNAq\x84X\x07\x00\x00\x00lincRNAq\x85X\x12\x00\x00\x00protein_coding_CDSq\x86X\x12\x00\x00\x00protein_coding_UTRq\x87X\x1a\x00\x00\x00protein_coding_pure_intronq\x88X\n\x00\x00\x00pseudogeneq\x89X\t\x00\x00\x00antisenseq\x8aX\x14\x00\x00\x00DNA_transposons_rmskq\x8bX\x14\x00\x00\x00RNA_transposons_rmskq\x8cX\x0f\x00\x00\x00satellites_rmskq\x8dX\x13\x00\x00\x00simple_repeats_rmskq\x8eeX\x08\x00\x00\x00data_dirq\x8fX\x04\x00\x00\x00dataq\x90X\t\x00\x00\x00annot_dirq\x91X_\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genesq\x92X\x0f\x00\x00\x00local_annot_dirq\x93X\x0b\x00\x00\x00annotationsq\x94X\x07\x00\x00\x00alignerq\x95X\x07\x00\x00\x00bowtie2q\x96X\x05\x00\x00\x00indexq\x97h\x18X\x0b\x00\x00\x00convert_dirq\x98X=\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Wormbase/WS253/geneIDsq\x99X\n\x00\x00\x00output_dirq\x9aX\x07\x00\x00\x00resultsq\x9bX\x07\x00\x00\x00log_dirq\x9cX\x04\x00\x00\x00logsq\x9duX\x04\x00\x00\x00ruleq\x9eX\r\x00\x00\x00map_on_genomeq\x9fub.')
######## Original script #########
from snakemake.shell import shell
cmd = """
genome_dir="${{HOME}}/Genomes"
genome="C_elegans"
cmd="bowtie2 --seed 123 -t -L 6 -i S,1,0.8 -N 0 --mm -x {snakemake.params.index} -U {snakemake.input[0]} --no-unal --un-gz {snakemake.output.nomap} -S {snakemake.output.sam}"
echo ${{cmd}}
eval ${{cmd}} 1> {snakemake.log.map_log} 2> {snakemake.log.map_err}
"""
shell(cmd)
######## Snakemake header ########
import sys; sys.path.insert(0, "/home/bli/.local/lib/python3.6/site-packages"); import pickle; snakemake = pickle.loads(b'\x80\x03csnakemake.script\nSnakemake\nq\x00)\x81q\x01}q\x02(X\x05\x00\x00\x00inputq\x03csnakemake.io\nInputFiles\nq\x04)\x81q\x05XW\x00\x00\x00results/bowtie2/mapped_C_elegans/reads/WT_HS30RT120_1_piRNA_on_C_elegans/piRNA.fastq.gzq\x06a}q\x07X\x06\x00\x00\x00_namesq\x08}q\tsbX\x06\x00\x00\x00outputq\ncsnakemake.io\nOutputFiles\nq\x0b)\x81q\x0c(XF\x00\x00\x00results/bowtie2/mapped_C_elegans/WT_HS30RT120_1/piRNA_on_C_elegans.samq\rXX\x00\x00\x00results/bowtie2/not_mapped_C_elegans/WT_HS30RT120_1_piRNA_unmapped_on_C_elegans.fastq.gzq\x0ee}q\x0f(h\x08}q\x10(X\x03\x00\x00\x00samq\x11K\x00N\x86q\x12X\x05\x00\x00\x00nomapq\x13K\x01N\x86q\x14uh\x11h\rh\x13h\x0eubX\x06\x00\x00\x00paramsq\x15csnakemake.io\nParams\nq\x16)\x81q\x17Xk\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/genomeq\x18a}q\x19(h\x08}q\x1aX\x05\x00\x00\x00indexq\x1bK\x00N\x86q\x1csh\x1bh\x18ubX\t\x00\x00\x00wildcardsq\x1dcsnakemake.io\nWildcards\nq\x1e)\x81q\x1f(X\x02\x00\x00\x00WTq X\t\x00\x00\x00HS30RT120q!X\x01\x00\x00\x001q"X\x05\x00\x00\x00piRNAq#e}q$(h\x08}q%(X\x03\x00\x00\x00libq&K\x00N\x86q\'X\x05\x00\x00\x00treatq(K\x01N\x86q)X\x03\x00\x00\x00repq*K\x02N\x86q+X\t\x00\x00\x00read_typeq,K\x03N\x86q-uX\x03\x00\x00\x00libq.h X\x05\x00\x00\x00treatq/h!X\x03\x00\x00\x00repq0h"X\t\x00\x00\x00read_typeq1h#ubX\x07\x00\x00\x00threadsq2K\x01X\t\x00\x00\x00resourcesq3csnakemake.io\nResources\nq4)\x81q5(K\x01K\x01e}q6(h\x08}q7(X\x06\x00\x00\x00_coresq8K\x00N\x86q9X\x06\x00\x00\x00_nodesq:K\x01N\x86q;uh8K\x01h:K\x01ubX\x03\x00\x00\x00logq<csnakemake.io\nLog\nq=)\x81q>(X+\x00\x00\x00logs/map_on_genome_WT_HS30RT120_1_piRNA.logq?X+\x00\x00\x00logs/map_on_genome_WT_HS30RT120_1_piRNA.errq@e}qA(h\x08}qB(X\x07\x00\x00\x00map_logqCK\x00N\x86qDX\x07\x00\x00\x00map_errqEK\x01N\x86qFuhCh?hEh@ubX\x06\x00\x00\x00configqG}qH(X\x07\x00\x00\x00lib2rawqIccollections\nOrderedDict\nqJ)RqK(X\x02\x00\x00\x00WTqLXQ\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/wt{treat}_{rep}.fastq.gzqMX\x04\x00\x00\x00prg1qNXS\x00\x00\x00/pasteur/entites/Mhe/bli/raw_data/small_RNA-seq/20162212/prg1{treat}_{rep}.fastq.gzqOuX\t\x00\x00\x00lib2adaptqPhJ)RqQ(hLX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqRhNX\x15\x00\x00\x00TGGAATTCTCGGGTGCCAAGGqSuX\x07\x00\x00\x00missingqT]qUhJ)RqVahLX\x02\x00\x00\x00WTqWX\x06\x00\x00\x00mutantqXX\x04\x00\x00\x00prg1qYX\x05\x00\x00\x00trim5qZX\x01\x00\x00\x004q[X\x05\x00\x00\x00trim3q\\h[X\n\x00\x00\x00treatmentsq]]q^(X\x02\x00\x00\x00RTq_X\x04\x00\x00\x00HS30q`X\t\x00\x00\x00HS30RT120qaeX\n\x00\x00\x00replicatesqb]qc(h"X\x01\x00\x00\x002qdeX\x07\x00\x00\x00min_lenqeX\x02\x00\x00\x0018qfX\x07\x00\x00\x00max_lenqgX\x02\x00\x00\x0026qhX\x0e\x00\x00\x00count_biotypesqi]qj(X\t\x00\x00\x00antisenseqkX\x04\x00\x00\x00tRNAqlX\x05\x00\x00\x00snRNAqmX\x06\x00\x00\x00snoRNAqnX\x04\x00\x00\x00rRNAqoX\x05\x00\x00\x00piRNAqpX\x05\x00\x00\x00ncRNAqqX\x05\x00\x00\x00miRNAqrX\x07\x00\x00\x00lincRNAqsX\x0e\x00\x00\x00protein_codingqtX\n\x00\x00\x00pseudogenequX\t\x00\x00\x00antisenseqvX\x14\x00\x00\x00DNA_transposons_rmskqwX\x14\x00\x00\x00RNA_transposons_rmskqxX\x0f\x00\x00\x00satellites_rmskqyX\x13\x00\x00\x00simple_repeats_rmskqzeX\x0e\x00\x00\x00annot_biotypesq{]q|(X\t\x00\x00\x00antisenseq}X\x04\x00\x00\x00tRNAq~X\x05\x00\x00\x00snRNAq\x7fX\x06\x00\x00\x00snoRNAq\x80X\x04\x00\x00\x00rRNAq\x81X\x05\x00\x00\x00piRNAq\x82X\x05\x00\x00\x00ncRNAq\x83X\x05\x00\x00\x00miRNAq\x84X\x07\x00\x00\x00lincRNAq\x85X\x12\x00\x00\x00protein_coding_CDSq\x86X\x12\x00\x00\x00protein_coding_UTRq\x87X\x1a\x00\x00\x00protein_coding_pure_intronq\x88X\n\x00\x00\x00pseudogeneq\x89X\t\x00\x00\x00antisenseq\x8aX\x14\x00\x00\x00DNA_transposons_rmskq\x8bX\x14\x00\x00\x00RNA_transposons_rmskq\x8cX\x0f\x00\x00\x00satellites_rmskq\x8dX\x13\x00\x00\x00simple_repeats_rmskq\x8eeX\x08\x00\x00\x00data_dirq\x8fX\x04\x00\x00\x00dataq\x90X\t\x00\x00\x00annot_dirq\x91X_\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genesq\x92X\x0f\x00\x00\x00local_annot_dirq\x93X\x0b\x00\x00\x00annotationsq\x94X\x07\x00\x00\x00alignerq\x95X\x07\x00\x00\x00bowtie2q\x96X\x05\x00\x00\x00indexq\x97h\x18X\x0b\x00\x00\x00convert_dirq\x98X=\x00\x00\x00/pasteur/entites/Mhe/Genomes/C_elegans/Wormbase/WS253/geneIDsq\x99X\n\x00\x00\x00output_dirq\x9aX\x07\x00\x00\x00resultsq\x9bX\x07\x00\x00\x00log_dirq\x9cX\x04\x00\x00\x00logsq\x9duX\x04\x00\x00\x00ruleq\x9eX\r\x00\x00\x00map_on_genomeq\x9fub.')
######## Original script #########
from snakemake.shell import shell
cmd = """
genome_dir="${{HOME}}/Genomes"
genome="C_elegans"
cmd="bowtie2 --seed 123 -t -L 6 -i S,1,0.8 -N 0 --mm -x {snakemake.params.index} -U {snakemake.input[0]} --no-unal --un-gz {snakemake.output.nomap} -S {snakemake.output.sam}"
echo ${{cmd}}
eval ${{cmd}} 1> {snakemake.log.map_log} 2> {snakemake.log.map_err}
"""
shell(cmd)
from snakemake.shell import shell
cmd = """
converter="/pasteur/entites/Mhe/Genomes/C_elegans/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genes/genes_id2name.pickle"
cmd="htseq-count -f bam -s {snakemake.params.stranded} -a 0 -t transcript -i gene_id -m {snakemake.params.mode} {snakemake.input.sorted_bam} {snakemake.params.annot} | tee {snakemake.output.counts} | id2name.py ${{converter}} > {snakemake.output.counts_converted}"
echo ${{cmd}} > {snakemake.log.log}
eval ${{cmd}} 1>> {snakemake.log.log} 2> {snakemake.log.err} || error_exit "htseq-count failed"
"""
shell(cmd)
#!/bin/sh
python3.6 setup.py build_ext
# .egg-link does not work with PYTHONPATH ?
python3.6 -m pip install -e .
python3.6 -m pip install --no-deps --ignore-installed .
from setuptools import setup, find_packages
import os
# OPJ = os.path.join
# OPA = os.path.abspath
# OPB = os.path.basename
from glob import glob
#from Cython.Build import cythonize
#import libworkflows
# Adapted from Biopython
__version__ = "Undefined"
for line in open('smincludes/__init__.py'):
if (line.startswith('__version__')):
exec(line.strip())
# _rule_files = [OPA(rule_file) for rule_file in glob(OPJ("smincludes", "*.rules"))]
# print(_rule_files)
setup(
name="smincludes",
#version=libworkflows.__version__,
version=__version__,
description="Rules that can be included in snakemake workflows.",
author="Blaise Li",
author_email="blaise.li@normalesup.org",
license="MIT",
packages=find_packages(),
package_data={"smincludes": ["*.rules"]},
)
#ext_modules = cythonize("libsmallrna/libsmallrna.pyx"),
#install_requires=["cytoolz"],
#zip_safe=False
from glob import glob
import os
OPJ = os.path.join
OPA = os.path.abspath
OPB = os.path.basename
__all__ = ["rules"]
# The working directory is that of the importing context.
# __path__ gives access to the package path
_local_dir, = __path__
_rule_files = glob(OPJ(_local_dir, "*.rules"))
rules = {}
for rule_file in _rule_files:
rules[OPB(rule_file)[:-6]] = OPA(rule_file)
import os
# Not necessary, because variables defined at include time seem to be
# availble here (same for data_dir).
#lib2raw = config["lib2raw"]
def lib2data(wildcards):
return lib2raw[wildcards.lib][wildcards.rep]
rule link_raw_data:
"""This rule installs the raw data in a local directory using symlinks.
The location of the original files is taken from the configuration."""
input:
raw = lib2data,
output:
link = os.path.join(data_dir, "{lib}_{rep}.fastq.gz"),
message:
"Making link {output.link} to raw data {input.raw}."
run:
os.symlink(os.path.abspath(input.raw), output.link)
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment