Commit 213318ab authored by Gael  MILLOT's avatar Gael MILLOT
Browse files

Version v8.0.0 with the correct file example

parent e6d98f20
This source diff could not be displayed because it is too large. You can view the blob instead.
>LAGGING_0::ref:1827068-1827108
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
>LEADING_0::ref:2919428-2919468
GTACCGACTTAACTGTGTTGATCATCGTACGCAAGTGACC
>LEADING_0::ref:3859524-3859564
CGCCGCCTTTAACCAGATAGTTATACAGCAAGCGCGCACC
>LEADING_16::ref:1548171-1548211
CATGCTGAATAAACTGAAGTTATCCAGATAGTTCGCCAGC
>LEADING_16::ref:1643769-1643809
TGTTTCGGATAACAGGAAGTTATCCGAAGCGATGAGAGTT
>LEADING_16::ref:2210730-2210770
TTGTCTGTAGAAAAGTAAGATGAGGAGCGAAGGCATGAAA
>LAGGING_16::ref:2349135-2349175
TGGTCAATTCAACAATGCGTTTACCAGCATTAAGGAACAG
>LAGGING_16::ref:2378798-2378838
ATTGCGGATAAACATAGTGATCACAGGCGTAAACGTCGCC
>LAGGING_16::ref:2470510-2470550
CACATTACCTAAATCAAAGATATAGAGCATTTTTGCCTCC
>LAGGING_0::ref:1827068-1827108
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
>LEADING_0::ref:2919428-2919468
GTACCGACTTAACTGTGTTGATCATCGTACGCAAGTGACC
>LEADING_0::ref:3859524-3859564
CGCCGCCTTTAACCAGATAGTTATACAGCAAGCGCGCACC
>LEADING_16::ref:1548171-1548211
GCTGGCGAACTATCTGGATAACTTCAGTTTATTCAGCATG
>LEADING_16::ref:1643769-1643809
AACTCTCATCGCTTCGGATAACTTCCTGTTATCCGAAACA
>LEADING_16::ref:2210730-2210770
TTTCATGCCTTCGCTCCTCATCTTACTTTTCTACAGACAA
>LAGGING_16::ref:2349135-2349175
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
>LAGGING_16::ref:2378798-2378838
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
>LAGGING_16::ref:2470510-2470550
GGAGGCAAAAATGCTCTATATCTTTGATTTAGGTAATGTG
>LEADING_16::ref:1548171-1548211
GCTGGCGAACTATCTGGATAACTTCAGTTTATTCAGCATG
>LEADING_16::ref:1643769-1643809
AACTCTCATCGCTTCGGATAACTTCCTGTTATCCGAAACA
>LAGGING_0::ref:1827068-1827108
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
>LEADING_16::ref:2210730-2210770
TTTCATGCCTTCGCTCCTCATCTTACTTTTCTACAGACAA
>LAGGING_16::ref:2349135-2349175
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
>LAGGING_16::ref:2378798-2378838
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
>LAGGING_16::ref:2470510-2470550
GGAGGCAAAAATGCTCTATATCTTTGATTTAGGTAATGTG
>LEADING_0::ref:2919428-2919468
GTACCGACTTAACTGTGTTGATCATCGTACGCAAGTGACC
>LEADING_0::ref:3859524-3859564
CGCCGCCTTTAACCAGATAGTTATACAGCAAGCGCGCACC
>LEADING_16::ref:1548171-1548211
CATGCTGAATAAACTGAAGTTATCCAGATAGTTCGCCAGC
>LEADING_16::ref:1643769-1643809
TGTTTCGGATAACAGGAAGTTATCCGAAGCGATGAGAGTT
>LEADING_16::ref:2210730-2210770
TTGTCTGTAGAAAAGTAAGATGAGGAGCGAAGGCATGAAA
>LAGGING_16::ref:2349135-2349175
TGGTCAATTCAACAATGCGTTTACCAGCATTAAGGAACAG
>LAGGING_16::ref:2378798-2378838
ATTGCGGATAAACATAGTGATCACAGGCGTAAACGTCGCC
>LAGGING_16::ref:2470510-2470550
CACATTACCTAAATCAAAGATATAGAGCATTTTTGCCTCC
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1548192
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
16 1643790
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
0 1827089
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2210751
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2349156
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2378819
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
16 2470531
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 2919449
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
0 3859545
Sequence Position names fork orient freq
obs 2919449 Leading_0 Leading Forward 24
obs 3859545 Leading_0 Leading Forward 152
obs 1827089 Lagging_0 Lagging Forward 24
obs 1548192 Leading_16 Leading Reverse 25
obs 1643790 Leading_16 Leading Reverse 24
obs 2210751 Leading_16 Leading Reverse 33
obs 2349156 Lagging_16 Lagging Reverse 50
obs 2378819 Lagging_16 Lagging Reverse 53
obs 2470531 Lagging_16 Lagging Reverse 24
Sequence Position names fork orient
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1548192 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1643790 Leading_16 Leading Reverse
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 1827089 Lagging_0 Lagging Forward
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2210751 Leading_16 Leading Reverse
obs 2349156 Lagging_16 Lagging Reverse
obs 2349156 Lagging_16 Lagging Reverse
obs 2349156 Lagging_16 Lagging Reverse
obs 2349156 Lagging_16 Lagging Reverse
obs 2349156 Lagging_16 Lagging Reverse