Commit 711b04ce authored by Gael  MILLOT's avatar Gael MILLOT
Browse files

release v8.2.0: All the problems should be solved in this version

parent 6f7f7048
......@@ -209,9 +209,14 @@ Gitlab developers
## WHAT'S NEW IN
### v8.2.0
1) All the problems should be solved in this version
### v8.1.0
1) Display improvement. But still problem when using the option -resume of nextflow run.
1) Display improvement. But still problem when using the option -resume of nextflow run
### v8.0.0
......
......@@ -402,10 +402,8 @@ options(scipen = 1000) # to avoid writing of scientific numbers in tables, see h
write.table(res.ini, file = paste0("./", file_name, "_annot.freq"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t") # if duplicated -> non selected data for highest usage # file for plotting all the insertion sites in duplicated and non duplicated reads
options(scipen = 0)
print(unique(obs.ini))
print(res$Position)
print(file_name)
if( ! grepl(x = file_name, pattern = "^.*nodup.*$")){
if( ! grepl(x = file_name, pattern = "^.*nodup.*$")){ # selection of the highest insertion usage sites
obs.ini <- obs.ini[obs.ini[ , 2] %in% res$Position, ] # obs.ini[ , 2] because no column names
}
options(scipen = 1000) # to avoid writing of scientific numbers in tables, see https://stackoverflow.com/questions/3978266/number-format-writing-1e-5-instead-of-0-00001
......@@ -413,7 +411,7 @@ write.table(obs, file = paste0("./", file_name, "_annot.pos"), row.names = FALSE
options(scipen = 0)
options(scipen = 1000)
write.table(obs.ini, file = paste0("./", file_name, ".pos"), row.names = FALSE, col.names = FALSE, append = FALSE, quote = FALSE, sep = "\t") # if duplicated -> selected data for highest usage # non annotated file, for sequence extractions
write.table(obs.ini, file = paste0("./", file_name, "_selected_if_dup.pos"), row.names = FALSE, col.names = FALSE, append = FALSE, quote = FALSE, sep = "\t") # if duplicated -> selected data for highest usage # non annotated file, for sequence extractions
options(scipen = 0)
......
This diff is collapsed.
......@@ -5,6 +5,7 @@ But genome centered on the OriC
tss_ORI_CENTERED.txt same as
Z:\reference_genomes\coli_K12_MG1655_NC_000913.3\tss.txt
But genome centered on the OriC
1) le nom du gène associé au promoteur, 2) l’ID du promoteur, 3) son orientation et 4) sa position.
cds_ORI_CENTERED.txt same as
Z:\reference_genomes\coli_K12_MG1655_NC_000913.3\NC_000913_CDS.csv
......
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1548171 1548211 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1643769 1643809 LEADING_16 LEADING 16
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 1827068 1827108 LAGGING_0 LAGGING 0
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2210730 2210770 LEADING_16 LEADING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2349135 2349175 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2378798 2378838 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2470510 2470550 LAGGING_16 LAGGING 16
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 2919428 2919468 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
ref 3859524 3859564 LEADING_0 LEADING 0
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
CATCCAGTTCGAACTCTGCGTTATCCAGCGCGAGCACTCG
A 0.00000 24.00000 0.00000 0.00000 0.00000 24.00000 0.00000 0.00000 0.00000 0.00000 0.00000 24.00000 24.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 24.00000 0.00000 0.00000 0.00000 24.00000 0.00000 0.00000 0.00000 0.00000 0.00000 24.00000 0.00000 0.00000 24.00000 0.00000 0.00000 0.00000 0.00000
C 24.00000 0.00000 0.00000 24.00000 24.00000 0.00000 0.00000 0.00000 0.00000 24.00000 0.00000 0.00000 0.00000 24.00000 0.00000 24.00000 0.00000 0.00000 24.00000 0.00000 0.00000 0.00000 0.00000 0.00000 24.00000 24.00000 0.00000 0.00000 24.00000 0.00000 24.00000 0.00000 0.00000 0.00000 24.00000 0.00000 24.00000 0.00000 24.00000 0.00000
G 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 24.00000 0.00000 0.00000 0.00000 24.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 24.00000 0.00000 24.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 24.00000 0.00000 24.00000 0.00000 24.00000 0.00000 24.00000 0.00000 0.00000 0.00000 0.00000 0.00000 24.00000
T 0.00000 0.00000 24.00000 0.00000 0.00000 0.00000 0.00000 24.00000 24.00000 0.00000 0.00000 0.00000 0.00000 0.00000 24.00000 0.00000 24.00000 0.00000 0.00000 0.00000 24.00000 24.00000 0.00000 24.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 24.00000 0.00000 0.00000
Other 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
CTGTTCCTTAATGCTGGTAAACGCATTGTTGAATTGACCA
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT
GGCGACGTTTACGCCTGTGATCACTATGTTTATCCGCAAT