add solutions for OOP

source/Object_Oriented_Programming.rst

@@ -8,19 +8,145 @@
 Object Oriented Programming
 ***************************
 
+
 Exercises
 =========
 
+Exercise
+--------
+
+Modelize a sequence with few attributes and methods
+
+.. literalinclude:: _static/code/sequence.py
+   :linenos:
+   :language: python
+
+:download:`sequence.py <_static/code/sequence.py>` .
+
 
 Exercise
 --------
 
+Instanciate 2 sequences using your Sequence class, and draw schema representing the namespaces
+
+.. image:: _static/figs/sequence_namespace.png
+       :alt: sequence namespace
+       :align: left
+       :height: 400px
+
+
+.. container:: clearer
+
+    .. image :: _static/figs/spacer.png
+
 Exercise
 --------
 
+Can you explain this result (draw namespaces  to explain) ?
+how to modify the class variable *class_attr*
+
+.. literalinclude:: _static/code/class_attribute.py
+   :linenos:
+   :language: python
+
+:download:`class_attribute.py <_static/code/class_attribute.py>` .
+
 Exercise
 --------
 
+Write the definition of a Point class. Objects from this class should have a
+
+    * a method **show** to display the coordinates of the point
+    * a method **move** to change these coordinates.
+    * a method **dist** that computes the distance between 2 points.
+
+.. note::
+    the distance between 2 points A(x0, y0) and B(x1, y1) can be compute
+
+
+    .. math::
+         d(AB) = \sqrt{(x1-x0))^2 + (y1-y0)^2}
+
+    (http://www.mathwarehouse.com/algebra/distance_formula/index.php)
+
+
+The following python code provides an example of the expected behaviour of objects belonging to this class: ::
+
+    >>> p1 = Point(2, 3)
+    >>> p2 = Point(3, 3)
+    >>> p1.show()
+    (2, 3)
+    >>> p2.show()
+    (3, 3)
+    >>> p1.move(10, -10)
+    >>> p1.show()
+    (12, -7)
+    >>> p2.show()
+    (3, 3)
+    >>> p1.dist(p2)
+    1.0
+
+
+.. literalinclude:: _static/code/point.py
+   :linenos:
+   :language: python
+
+:download:`point.py <_static/code/point.py>` .
 
 Exercise
---------
\ No newline at end of file
+--------
+
+Use OOP to modelize restriction enzyme, and sequences.
+
+the sequence must implement the following methods
+
+    * enzyme_filter which take as a list of enzymes as argument and return a **new** list containing the enzymes which have
+      binding site in sequence
+
+the restriction enzyme must implements the following methods
+
+    * binds which take a sequence as argument and return True if the sequence contains a binding site, False otherwise.
+
+solve the exercise :ref:`enzyme_exercise` using this new implementation.
+
+
+.. literalinclude:: _static/code/enzyme.py
+   :linenos:
+   :language: python
+
+:download:`enzyme.py <_static/code/enzyme.py>` .
+
+Exercise
+--------
+
+refactor your code of :ref:`matrix_exercise` in OOP style programming. implements only
+
+ * **size**: return the number of rows, and number of columns
+ * **get_cell**: that take the number of rows, the number of columns as parameters,
+   and returns the content of cell corresponding to row number col number
+ * **set_cell**: that take the number of rows, the number of columns as parameters, and a value
+   and set the value val in cell specified by row number x column number
+ * **to_str**: return a string representation of the matrix
+ * **mult**: that take a scalar and return a new matrix which is the scalar product of matrix x val
+
+you can change the name of the methods to be more pythonic
+
+.. literalinclude:: _static/code/matrix_obj.py
+   :linenos:
+   :language: python
+
+:download:`matrix_obj.py <_static/code/matrix_obj.py>` .
+
+Exercise
+--------
+
+Use the code to read multiple sequences fasta file in procedural style and refactor it in OOP style.
+use the file :download:`abcd.fasta <_static/data/abcd.fasta>` to test your code.
+
+What is the benefit to use oop style instead of procedural style?
+
+.. literalinclude:: _static/code/fasta_object.py
+   :linenos:
+   :language: python
+
+:download:`fasta_object.py <_static/code/fasta_object.py>` .
\ No newline at end of file

source/_static/code/class_attribute.py

+class MyClass(object):
+
+    class_attr = 'foo'
+
+    def __init__(self, val):
+        self.inst_attr = val
+
+
+
+
+a = MyClass(1)
+b = MyClass(2)
+
+print a.inst_attr
+1
+print b.inst_attr
+2
+
+print a.class_attr == b.class_attr
+True
+print a.class_attr is b.class_attr
+True
+
+b.class_attr = 4
+
+print a.class_attr
+4
+del a.class_attr
+
+MyClass.class_attr = 4
\ No newline at end of file

source/_static/code/enzyme.py

@@ -31,12 +31,15 @@ class Sequence(object):
 class RestrictionEnzyme(object):
 
     def __init__(self, name, binding, cut, end, comment=''):
-        self.name = name
-        self.binding = binding
-        self.cut = cut
-        self.end = end
-        self.comment = comment
-
+        self._name = name
+        self._binding = binding
+        self._cut = cut
+        self._end = end
+        self._comment = comment
+
+    @property
+    def name(self):
+        return self._name
 
     def binds(self, seq):
         """

source/_static/code/sequence.py

+class Sequence(object):
+
+    def __init__(self, identifier, comment, seq):
+        self.id = identifier
+        self.comment = comment
+        self.seq = self._clean(seq)
+
+
+    def _clean(self, seq):
+        """
+        remove newline from the string representing the sequence
+        :param seq: the string to clean
+        :return: the string without '\n'
+        :rtype: string
+        """
+        return seq.replace('\n')
+
+
+    def gc_percent(self):
+        """
+        :return: the gc ratio
+        :rtype: float
+        """
+        seq = self.seq.upper()
+        return float(seq.count('G') + seq.count('C')) / len(seq)
+
+
+
+
+dna1 = Sequence('gi214', 'the first sequence', 'tcgcgcaacgtcgcctacatctcaagattca')
+dna2 = Sequence('gi3421', 'the second sequence', 'gagcatgagcggaattctgcatagcgcaagaatgcggc')
\ No newline at end of file

source/index.rst

@@ -17,7 +17,7 @@ Contents:
    Dive_into_Functions
    Modules_and_Packages
    Input_Output
-   
+   Object_Oriented_Programming
    
 Indices and tables
 ==================