tempo: last version ok for Coli except in global_logo

README.md

@@ -146,7 +146,7 @@ Then run:
 
 ```bash
 # distant main.nf file
-HOME="$ZEUSHOME/14985_loot/" ; nextflow run --modules ${MODULES} -hub pasteur gmillot/14985_loot -r v7.9.0 -c $HOME/nextflow.config ; HOME="/pasteur/appa/homes/gmillot/"
+HOME="$ZEUSHOME/14985_loot/" ; nextflow run --modules ${MODULES} -hub pasteur gmillot/14985_loot -r v7.10.0 -c $HOME/nextflow.config ; HOME="/pasteur/appa/homes/gmillot/"
 
 # local main.nf file ($HOME changed to allow the creation of .nextflow into /$ZEUSHOME/14985_loot/. See NFX_HOME in the nextflow soft script)
 HOME="$ZEUSHOME/14985_loot/" ; nextflow run --modules ${MODULES} main.nf ; HOME="/pasteur/appa/homes/gmillot/"

bin/final_insertion_files.R

@@ -36,8 +36,8 @@
 
 
 # R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
-    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
 }
 # other initializations
 erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -74,6 +74,7 @@ if(interactive() == FALSE){ # if(grepl(x = commandArgs(trailingOnly = FALSE), pa
         "pos", 
         "ori_coord", 
         "ter_coord", 
+        "nb_max_insertion_sites", 
         "file_name", 
         "cute", 
         "log"
@@ -100,11 +101,16 @@ rm(tempo.cat)
 ################################ Test
 
 # cat("\n\n!!!!!!!!!!!!!!!!!!! WARNING: test values are activated\n\n")
-# stat <- "C:/Users/Gael/Documents/Git_projects/14985_loot/dataset/test.fastq_Nremove_trim_5pAttc_1-51.stat" 
-# attc_seq <- "CAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCG" 
-# cute <- "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v10.9.0/cute_little_R_functions.R" 
+# pos <- "C:/Users/Gael/Documents/Git_projects/14985_loot/dataset/test.fastq2_q20.pos" 
+# ori_coord <- "2320711 2320942"
+# ter_coord <- "4627368 4627400"
+# nb_max_insertion_sites <- "6"
+# file_name <- "caca"
+# cute <- "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v11.2.0/cute_little_R_functions.R" 
 # log <- "report.txt"
 
+
+
 ################################ end Test
 
 ################################ Recording of the initial parameters
@@ -119,6 +125,7 @@ param.list <- c(
     "pos", 
     "ori_coord", 
     "ter_coord", 
+    "nb_max_insertion_sites", 
     "file_name", 
     "cute", 
     "log"
@@ -229,6 +236,7 @@ ee <- expression(arg.check <- c(arg.check, tempo$problem) , text.check <- c(text
 tempo <- fun_check(data = pos, class = "vector", typeof = "character", length = 1) ; eval(ee)
 tempo <- fun_check(data = ori_coord, class = "vector", typeof = "character", length = 1) ; eval(ee)
 tempo <- fun_check(data = ter_coord, class = "vector", typeof = "character", length = 1) ; eval(ee)
+tempo <- fun_check(data = nb_max_insertion_sites, class = "vector", typeof = "character", length = 1) ; eval(ee)
 tempo <- fun_check(data = file_name, class = "vector", typeof = "character", length = 1) ; eval(ee)
 tempo <- fun_check(data = cute, class = "vector", typeof = "character", length = 1) ; eval(ee)
 tempo <- fun_check(data = log, class = "vector", typeof = "character", length = 1) ; eval(ee)
@@ -244,6 +252,7 @@ tempo.arg <-c(
     "pos", 
     "ori_coord", 
     "ter_coord", 
+    "nb_max_insertion_sites", 
     "file_name", 
     "cute", 
     "log"
@@ -270,6 +279,10 @@ if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){# normally n
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     ori_coord <- as.integer(ori_coord)
+    if(any(is.na(ori_coord))){
+        tempo.cat <- paste0("ERROR IN final_insertion_files.R:\nTHE CONVERSION OF THE ori_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ori_coord, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
 ter_coord <- strsplit(ter_coord, split = " ")[[1]]
 if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally no NA with is.null()
@@ -277,9 +290,21 @@ if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally n
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     ter_coord <- as.integer(ter_coord)
+    if(any(is.na(ter_coord))){
+        tempo.cat <- paste0("ERROR IN final_insertion_files.R:\nTHE CONVERSION OF THE ter_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ter_coord, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
+}
+if(length(nb_max_insertion_sites) != 1 & any(grepl(nb_max_insertion_sites, pattern = "\\D"))){# normally no NA with is.null()
+    tempo.cat <- paste0("ERROR IN final_insertion_files.R:\nTHE nb_max_insertion_sites PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(nb_max_insertion_sites, collapse = " "))
+    stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
+}else{
+    nb_max_insertion_sites <- as.integer(nb_max_insertion_sites)
+    if(any(is.na(nb_max_insertion_sites))){
+        tempo.cat <- paste0("ERROR IN final_insertion_files.R:\nTHE CONVERSION OF THE nb_max_insertion_sites PARAMETER INTO INTEGER RETURNS NA: \n", paste0(nb_max_insertion_sites, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
-
-
 
 # end other checkings
 # reserved word checking
@@ -298,7 +323,7 @@ if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally n
 ################ Ignition
 
 
-fun_report(data = paste0("\n\n################################################################ final_insertion_files PROCESS\n\n"), output = log, path = "./", overwrite = FALSE)
+fun_report(data = paste0("\n\n################################################################ final_insertion_files PROCESS WITH FILE ", pos, "\n\n"), output = log, path = "./", overwrite = FALSE)
 ini.date <- Sys.time()
 ini.time <- as.numeric(ini.date) # time of process begin, converted into seconds
 fun_report(data = paste0("\n\n################################ RUNNING DATE AND STARTING TIME\n\n"), output = log, path = "./", overwrite = FALSE)
@@ -318,7 +343,7 @@ fun_report(data = paste0("\n\n################################ RUNNING\n\n"), ou
 ################ Data import
 
 
-obs <- read.table(pos, stringsAsFactors = FALSE) # does not take the header
+obs.ini <- read.table(pos, stringsAsFactors = FALSE) # does not take the header
 
 
 ################ end Data import
@@ -326,7 +351,10 @@ obs <- read.table(pos, stringsAsFactors = FALSE) # does not take the header
 
 ############ modifications of imported tables
 
+fun_report(data = paste0("\nHEAD OF THE INITAL FILE ", pos), output = log, path = "./", overwrite = FALSE)
+fun_report(data = head(obs.ini), output = log, path = "./", overwrite = FALSE)
 
+obs <- obs.ini # obs.ini will be only filtered for highest most frequent position and then returned for the seq_around_insertion process
 names(obs) <- c("orient", "pos")
 obs <- obs[2:1]
 
@@ -344,23 +372,44 @@ obs$fork<- factor(obs$fork, levels = c(0, 16), labels = c("Leading", "Lagging"))
 obs <- data.frame(Sequence = "obs", Position = obs$pos, names = paste(obs$fork, obs$orient, sep = "_"), fork = obs$fork, orient = obs$orient)
 obs$orient[obs$orient == 0] <- "Forward"
 obs$orient[obs$orient == 16] <- "Reverse"
+fun_report(data = paste0("\nHEAD OF THE MODIFIED FILE ", pos), output = log, path = "./", overwrite = FALSE)
 fun_report(data = head(obs), output = log, path = "./", overwrite = FALSE)
 fun_report(data = paste0("\nNUMBER OF OBS POSITIONS:\n", format(nrow(obs), big.mark=",")), output = log, path = "./", overwrite = FALSE)
 
 
 # saving position file
-options(scipen = 1000) # to avoid writing of scientific numbers in tables, see https://stackoverflow.com/questions/3978266/number-format-writing-1e-5-instead-of-0-00001
-write.table(obs, file = paste0("./", file_name, "_annot.pos"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
-options(scipen = 0)
-
 
 # freq file
+
 res <- aggregate(x = obs$Position, by = list(Sequence = obs$Sequence, Position = obs$Position, names = obs$names, fork = obs$fork, orient = obs$orient), FUN = length)
 names(res)[names(res) == "x"] <- "freq"
+if( ! grepl(x = file_name, pattern = "^.*nodup.*$")){
+    if(nb_max_insertion_sites > nrow(res)){
+            res <- res[order(res$freq, decreasing = TRUE)[1:nrow(res)], ]
+            tempo.cat <- paste0("\nWARNING: nb_max_insertion_sites PARAMETER IS GREATER THAN THE NUMBER OF DIFFERENT SITES: \n", format(nrow(res), big.mark=","))
+            fun_report(data = tempo.cat, output = log, path = "./", overwrite = FALSE)
+            cat(tempo.cat)
+        }else{
+            res <- res[order(res$freq, decreasing = TRUE)[1:nb_max_insertion_sites], ]
+        }
+}
+options(scipen = 1000) # to avoid writing of scientific numbers in tables, see https://stackoverflow.com/questions/3978266/number-format-writing-1e-5-instead-of-0-00001
+write.table(res, file = paste0("./", file_name, "_annot.freq"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
+options(scipen = 0)
+
+if( ! grepl(x = file_name, pattern = "^.*nodup.*$")){
+    obs <- obs[obs$pos %in% res$Position, ]
+    obs.ini <- obs.ini[obs.ini[ , 2] %in% res$Position, ] # obs.ini[ , 2] because no column names
+}
 options(scipen = 1000) # to avoid writing of scientific numbers in tables, see https://stackoverflow.com/questions/3978266/number-format-writing-1e-5-instead-of-0-00001
-write.table(res, file = paste0("./", file_name, "_annot_insertion.freq"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
+write.table(obs, file = paste0("./", file_name, "_annot.pos"), row.names = FALSE, col.names = TRUE, append = FALSE, quote = FALSE, sep = "\t")
 options(scipen = 0)
 
+options(scipen = 1000)
+write.table(obs.ini, file = paste0("./", file_name, ".pos"), row.names = FALSE, col.names = FALSE, append = FALSE, quote = FALSE, sep = "\t")
+options(scipen = 0)
+
+
 
 ############ end modifications of imported tables
 

bin/global_logo.R

@@ -36,8 +36,8 @@
 
 
 # R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
-    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
 }
 # other initializations
 erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -265,6 +265,7 @@ if(length(tempo) != 4){
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     freq <- tempo
+    freq_name_test <- tempo[1]
 }
 if(length(insertion_dist) != 1 & any(grepl(insertion_dist, pattern = "\\D"))){# normally no NA with is.null()
     tempo.cat <- paste0("ERROR IN global_logo.R:\nTHE insertion_dist PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(insertion_dist, collapse = " "))
@@ -368,13 +369,16 @@ for(i0 in 1:length(freq)){
 
 
 
-png(filename = paste0("global_logo_", file_name, ".png"), width = 5000, height = 1800, units = "px", res = 300)
-
+if( ! grepl(x = freq_name_test, pattern = "^.*nodup.*$")){
+    png(filename = paste0("global_logo_dup_", file_name, ".png"), width = 5000, height = 1800, units = "px", res = 300)
+}else{
+    png(filename = paste0("global_logo_nodup_", file_name, ".png"), width = 5000, height = 1800, units = "px", res = 300)
+}
 
 width <- 7
 height <- 2.5
-text.size <- 5
-title.text.size <- 4
+text.size <- 6
+title.text.size <- 5
 angle <- 90
 tempo.just <- fun_gg_just(angle = angle, pos = "bottom")
 
@@ -389,7 +393,8 @@ if(ncol(tempo) > 0){
     gg4 <- ggplot2::scale_x_discrete(labels = c((-insertion_dist):(-1), 1:insertion_dist)) #remove the x initial numbers
     gg5 <- ggplot2::annotate("text", x = 1:(insertion_dist * 2 - abs(decal)), y = -0.01, hjust = 1, vjust = 0.5, label = c((-insertion_dist + abs(decal)):(-1), 1:(insertion_dist - abs(decal) + 1)), size = text.size, angle = angle)
     gg6 <- ggplot2::coord_cartesian(clip = "off")
-    suppressMessages(print(ggplot2::ggplot() + gg1 + gg2 + gg3 + gg4 + gg5 + gg6))
+    gg7 <- ggplot2::theme(text = ggplot2::element_text(size = text.size * 4))
+    suppressMessages(print(ggplot2::ggplot() + gg1 + gg2 + gg3 + gg4 + gg5 + gg6 + gg7))
 }
 
 

bin/logo.R

@@ -36,8 +36,8 @@
 
 
 # R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
-    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
 }
 # other initializations
 erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -260,6 +260,10 @@ if(length(insertion_dist) != 1 & any(grepl(insertion_dist, pattern = "\\D"))){#
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     insertion_dist <- as.integer(insertion_dist)
+    if(any(is.na(insertion_dist))){
+        tempo.cat <- paste0("ERROR IN logo.R:\nTHE CONVERSION OF THE insertion_dist PARAMETER INTO INTEGER RETURNS NA: \n", paste0(insertion_dist, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
 # end other checkings
 # reserved word checking
@@ -338,8 +342,8 @@ png(filename = paste0("logo_", sub(x = freq, pattern = "\\.stat$", replacement =
 
 width <- 7
 height <- 2.5
-text.size <- 5
-title.text.size <- 4
+text.size <- 6
+title.text.size <- 5
 angle <- 90
 decal <- -1 # indicate the position occupied by the +1 position of the read (that correspond to first base of coli part of read) after rev complementation. Before rev-comp, it is 201 (as mentioned above). After, it is 400-201+1 = 200, thus -1. Allow to overlay consensus that are not centered on the +1 position
 tempo.just <- fun_gg_just(angle = angle, pos = "bottom")
@@ -355,7 +359,8 @@ if(ncol(tempo) > 0){
     gg4 <- ggplot2::scale_x_discrete(labels = c((-insertion_dist):(-1), 1:insertion_dist)) #remove the x initial numbers
     gg5 <- ggplot2::annotate("text", x = 1:(insertion_dist * 2), y = -0.01, hjust = 1, vjust = 0.5, label = c((-insertion_dist):(-1), 1:insertion_dist), size = text.size, angle = angle)
     gg6 <- ggplot2::coord_cartesian(clip = "off")
-    suppressMessages(print(ggplot2::ggplot() + gg1 + gg2 + gg3 + gg4 + gg5 + gg6)) # 
+    gg7 <- ggplot2::theme(text = ggplot2::element_text(size = text.size * 4))
+    suppressMessages(print(ggplot2::ggplot() + gg1 + gg2 + gg3 + gg4 + gg5 + gg6 + gg7))
 }
 
 

bin/motif.R

@@ -36,8 +36,8 @@
 
 
 # R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
-    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
 }
 # other initializations
 erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -293,6 +293,10 @@ if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){# normally n
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     ori_coord <- as.integer(ori_coord)
+    if(any(is.na(ori_coord))){
+        tempo.cat <- paste0("ERROR IN motif.R:\nTHE CONVERSION OF THE ori_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ori_coord, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
 ter_coord <- strsplit(ter_coord, split = " ")[[1]]
 if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally no NA with is.null()
@@ -300,12 +304,20 @@ if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally n
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     ter_coord <- as.integer(ter_coord)
+    if(any(is.na(ter_coord))){
+        tempo.cat <- paste0("ERROR IN motif.R:\nTHE CONVERSION OF THE ter_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ter_coord, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
 if(length(genome_size) != 1 & any(grepl(genome_size, pattern = "\\D"))){# normally no NA with is.null()
-    tempo.cat <- paste0("ERROR IN random_insertion.R:\nTHE genome_size PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(genome_size, collapse = " "))
+    tempo.cat <- paste0("ERROR IN motif.R:\nTHE genome_size PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(genome_size, collapse = " "))
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     genome_size <- as.integer(genome_size)
+    if(any(is.na(genome_size))){
+        tempo.cat <- paste0("ERROR IN motif.R:\nTHE CONVERSION OF THE genome_size PARAMETER INTO INTEGER RETURNS NA: \n", paste0(genome_size, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
 
 

bin/plot_coverage.R

@@ -36,8 +36,8 @@
 
 
 # R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
-    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
 }
 # other initializations
 erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -282,6 +282,10 @@ if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){# normally n
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     ori_coord <- as.integer(ori_coord)
+    if(any(is.na(ori_coord))){
+        tempo.cat <- paste0("ERROR IN plot_coverage.R:\nTHE CONVERSION OF THE ori_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ori_coord, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
 ter_coord <- strsplit(ter_coord, split = " ")[[1]]
 if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally no NA with is.null()
@@ -289,6 +293,10 @@ if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally n
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     ter_coord <- as.integer(ter_coord)
+    if(any(is.na(ter_coord))){
+        tempo.cat <- paste0("ERROR IN plot_coverage.R:\nTHE CONVERSION OF THE ter_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ter_coord, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
 if(length(color_coverage) != 1 & any(grepl(color_coverage, pattern = "\\D"))){# normally no NA with is.null()
     tempo.cat <- paste0("ERROR IN plot_coverage.R:\nTHE color_coverage PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(color_coverage, collapse = " "))

bin/plot_fivep_filtering_stat.R

@@ -36,8 +36,8 @@
 
 
 # R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
-    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
 }
 # other initializations
 erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE

bin/plot_read_length.R

@@ -36,8 +36,8 @@
 
 
 # R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
-    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
 }
 # other initializations
 erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE

bin/print_report.R

@@ -37,8 +37,8 @@
 
 
 # R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
-    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
 }
 # other initializations
 erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE

bin/random_insertion.R

@@ -36,8 +36,8 @@
 
 
 # R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
-    stop(paste0("\n\n================\n\nERROR IN random_insertion.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+    stop(paste0("\n\n================\n\nERROR IN random_insertion.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
 }
 # other initializations
 erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -297,6 +297,10 @@ if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){# normally n
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     ori_coord <- as.integer(ori_coord)
+    if(any(is.na(ori_coord))){
+        tempo.cat <- paste0("ERROR IN random_insertion.R:\nTHE CONVERSION OF THE ori_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ori_coord, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
 ter_coord <- strsplit(ter_coord, split = " ")[[1]]
 if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally no NA with is.null()
@@ -304,12 +308,20 @@ if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally n
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     ter_coord <- as.integer(ter_coord)
+    if(any(is.na(ter_coord))){
+        tempo.cat <- paste0("ERROR IN random_insertion.R:\nTHE CONVERSION OF THE ter_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ter_coord, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
 if(length(genome_size) != 1 & any(grepl(genome_size, pattern = "\\D"))){# normally no NA with is.null()
     tempo.cat <- paste0("ERROR IN random_insertion.R:\nTHE genome_size PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(genome_size, collapse = " "))
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     genome_size <- as.integer(genome_size)
+    if(any(is.na(genome_size))){
+        tempo.cat <- paste0("ERROR IN random_insertion.R:\nTHE CONVERSION OF THE genome_size PARAMETER INTO INTEGER RETURNS NA: \n", paste0(genome_size, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
 
 

bin/seq_around_insertion.R

@@ -36,8 +36,8 @@
 
 
 # R version checking
-if(version$version.string != "R version 4.0.5 (2021-03-31)"){
-    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.0.5 RECOMMANDED\n\n================\n\n"))
+if(version$version.string != "R version 4.1.2 (2021-11-01)"){
+    stop(paste0("\n\n================\n\nERROR IN plot_read_length.R\n", version$version.string, " IS NOT THE 4.1.2 RECOMMANDED\n\n================\n\n"))
 }
 # other initializations
 erase.objects = TRUE # write TRUE to erase all the existing objects in R before starting the algorithm and FALSE otherwise. Beginners should use TRUE
@@ -274,6 +274,10 @@ if(length(ori_coord) != 2 & any(grepl(ori_coord, pattern = "\\D"))){# normally n
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     ori_coord <- as.integer(ori_coord)
+    if(any(is.na(ori_coord))){
+        tempo.cat <- paste0("ERROR IN seq_around_insertion.R:\nTHE CONVERSION OF THE ori_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ori_coord, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
 ter_coord <- strsplit(ter_coord, split = " ")[[1]]
 if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally no NA with is.null()
@@ -281,12 +285,20 @@ if(length(ter_coord) != 2 & any(grepl(ter_coord, pattern = "\\D"))){# normally n
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     ter_coord <- as.integer(ter_coord)
+    if(any(is.na(ter_coord))){
+        tempo.cat <- paste0("ERROR IN seq_around_insertion.R:\nTHE CONVERSION OF THE ter_coord PARAMETER INTO INTEGER RETURNS NA: \n", paste0(ter_coord, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
 if(length(insertion_dist) != 1 & any(grepl(insertion_dist, pattern = "\\D"))){# normally no NA with is.null()
     tempo.cat <- paste0("ERROR IN seq_around_insertion.R:\nTHE insertion_dist PARAMETER MUST BE A SINGLE INTEGER\nHERE IT IS: \n", paste0(insertion_dist, collapse = " "))
     stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE) # == in stop() to be able to add several messages between ==
 }else{
     insertion_dist <- as.integer(insertion_dist)
+    if(any(is.na(insertion_dist))){
+        tempo.cat <- paste0("ERROR IN seq_around_insertion.R:\nTHE CONVERSION OF THE insertion_dist PARAMETER INTO INTEGER RETURNS NA: \n", paste0(insertion_dist, collapse = " "))
+        stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+    }
 }
 
 
@@ -328,6 +340,7 @@ fun_report(data = paste0("\n\n################################ RUNNING\n\n"), ou
 
 
 obs <- read.table(pos, stringsAsFactors = TRUE) # does not take the header
+print(head(obs))
 
 
 ################ end Data import
@@ -338,7 +351,10 @@ obs <- read.table(pos, stringsAsFactors = TRUE) # does not take the header
 
 names(obs) <- c("orient", "pos")
 # ori and dif 
-if( ! any(obs$orient %in% c(0, 16))){cat("\n\nERROR: OTHER THAN 0 OR 16 FOR FLAG\n\n")}
+if( ! any(obs$orient %in% c(0, 16))){
+    tempo.cat <- "ERROR IN seq_around_insertion.R: OTHER THAN 0 OR 16 FOR FLAG"
+    stop(paste0("\n\n================\n\n", tempo.cat, "\n\n================\n\n"), call. = FALSE)
+}
 ori.center <- mean(ori_coord, na.rm = TRUE)
 ter_center <- mean(ter_coord, na.rm = TRUE)
 

nextflow.config

@@ -33,7 +33,6 @@ env {
     primer_fasta="$baseDir/dataset/20200520_adapters_TruSeq_B2699_14985_CL.fasta" // list of primers used for the library and used by Alien trimmer to trim the raw reads
     //primer_fasta="/mnt/share/14985_loot/results/20200520_res_CL14985_newtrim_align/20200520_adapters_TruSeq_B2699_14985_CL.fasta"
     //// end path and files
-
     //// alientrimmer
     alientrimmer_l_param=30 // L parameter of alienTrimmer
     //// end alientrimmer
@@ -52,17 +51,24 @@ env {
     ref_path="$baseDir/dataset/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/" // path of the reference genome
     //ref_path="/pasteur/zeus/projets/p01/BioIT/gmillot/reference_genomes/coli_K12_MG1655_NC_000913.3_ORI_CENTERED/" // path of the reference genome
     ref_file="Ecoli-K12-MG1655_ORI_CENTERED.fasta" // name of the the reference genome fasta file
+    tss_file="TSS_compatible_essential.txt" // Ecoli list of Transcription starting sites. Same as Z:\reference_genomes\coli_K12_MG1655_NC_000913.3\tss.txt but genome centered on the OriC. Write "NULL" if ref_file is not Ecoli
+    ess_file="Essential_genes_MG1655.tsv" // Ecoli list of essential genes same as Z:\reference_genomes\coli_K12_MG1655_NC_000913.3. Just used here to know which are essential genes. Coordinates not used. Thus, no need to center according to Ori. Wrtie "NULL" if ref_file is not Ecoli
+    cds_file="cds_ORI_CENTERED.txt" // Ecoli list of cds same as Z:\reference_genomes\coli_K12_MG1655_NC_000913.3_ORI_CENTERED. Write "NULL" if ref_file is not Ecoli
     ori_coord="2320711 2320942" // [2320711, 2320942] // Ecoli centered coordinates
     ter_coord="4627368 4627400" //[4627368, 4627400] // Ecoli centered coordinates
     color_coverage="5" // three integers for the color of the three coverage plots[1, 2, 5]
     xlab="Ecoli Genome (bp)" // name of the reference genome for graphics
     genome_size="4641652" // in bp
+    prop_coding_genome = "0.88" // proportion of genome covered by CDS. See 20200922 section 30.5.1
+    prop_ess_coding_genome = "0.08" // proportion of the genome covered by essential CDS. See 20200922 section 30.5.1
     insertion_dist="20" // nb of bases upstream and downstream of insertions sites on the ref genome to define a consensus sequence
     motif_fw='G[AT]T' // regex indicating the sequence motif to use for random insertions. "NULL" means completely random. Must be 5' -> 3'
     motif_rev='A[AT]C' // the antiparallel of motif_fw
-    window_size = "50000" // written as R vector, width of the sliding window on the reference genome in bp
-    step=100 // steps of the sliding window on the reference genome in bp
-    cute_path="https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v11.0.0/cute_little_R_functions.R" // single character string indicating the file (and absolute pathway) of the required cute_little_R_functions toolbox. With ethernet connection available, this can also be used: "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/raw/v5.1.0/cute_little_R_functions.R" or local "C:\\Users\\Gael\\Documents\\Git_projects\\cute_little_R_functions\\cute_little_R_functions.R"
+    window_size = "50000" // width of the sliding window on the reference genome in bp. A single space between the number between double quotes. Example: "50000 200000"
+    step = 100 // steps of the sliding window on the reference genome in bp
+    nb_max_insertion_sites = "6" // nb of higest sites used for insertion in data without duplicates removal
+
+    cute_path="https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/-/raw/v11.2.0/cute_little_R_functions.R" // single character string indicating the file (and absolute pathway) of the required cute_little_R_functions toolbox. With ethernet connection available, this can also be used: "https://gitlab.pasteur.fr/gmillot/cute_little_R_functions/raw/v5.1.0/cute_little_R_functions.R" or local "C:\\Users\\Gael\\Documents\\Git_projects\\cute_little_R_functions\\cute_little_R_functions.R"
 }
 
 //////// end variables that will be used only in the main.nf
@@ -221,7 +227,7 @@ process {
     }
 
     withLabel: r_ext {
-        container='gmillot/r_v4.0.5_extended_v2.0:gitlab_v6.4'
+        container='gmillot/r_v4.1.2_extended_v2.0:gitlab_v8.2'
         cpus=1 // only used when name = "local" in the executor part above
         memory='64G' // only used when name = "local" in the executor part above
     }